Complex chromosomal rearrangements mediated by break-induced replication involve structure-selective endonucleases

Complex Chromosomal Rearrangements Mediated by Break-Induced Replication Involve Structure-Selective Endonucleases Benjamin Pardo, Andre ´s Aguilera* Centro Andaluz de Biologı ´a Molecular y Medicina Regenerativa CABIMER, Universidad de Sevilla, Sevilla, Spain Abstract DNA double-strand break (DSB) repair occurring in repeated DNA sequences often leads to the generation of chromosomal rearrangements. Homologous recombination normally ensures a faithful repair of DSBs through a mechanism that transfers the genetic information of an intact donor template to the broken molecule. When only one DSB end shares homology to the donor template, conventional gene conversion fails to occur and repair can be channeled to a recombinationdependent replication pathway termed break-induced replication (BIR), which is prone to produce chromosome nonreciprocal translocations (NRTs), a classical feature of numerous human cancers. Using a newly designed substrate for the analysis of DSB–induced chromosomal translocations, we show that Mus81 and Yen1 structure-selective endonucleases (SSEs) promote BIR, thus causing NRTs. We propose that Mus81 and Yen1 are recruited at the strand invasion intermediate to allow the establishment of a replication fork, which is required to complete BIR. Replication template switching during BIR, a feature of this pathway, engenders complex chromosomal rearrangements when using repeated DNA sequences dispersed over the genome. We demonstrate here that Mus81 and Yen1, together with Slx4, also promote template switching during BIR. Altogether, our study provides evidence for a role of SSEs at multiple steps during BIR, thus participating in the destabilization of the genome by generating complex chromosomal rearrangements. Citation: Pardo B, Aguilera A (2012) Complex Chromosomal Rearrangements Mediated by Break-Induced Replication Involve Structure-Selective Endonucleases. PLoS Genet 8(9): e1002979. doi:10.1371/journal.pgen.1002979 Editor: Michael Lichten, National Cancer Institute, United States of America Received October 26, 2011; Accepted August 8, 2012; Published September 27, 2012 Copyright: ß2012 Pardo, Aguilera. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was funded by grants from the Spanish Ministry of Science and Innovation (BFU2006-05260, BFU2010-16370, and Consolider Ingenio 2010 CSD2007-015), Junta de Andalucı ´a (BIO-102 and CVI-4567), and the European Union (FEDER). BP was supported by fellowships from Fondation Recherche Me ´dicale (SPE20061209019) and EMBO (1003-2006) and a contract of the Juan d e la Cierva Program o f the Spanish Ministry of Science and Innovation (JCI 2009-04101). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] Introduction The maintenance of genome integrity is crucial to prevent cell death in all organisms. Chromosomal rearrangements such as reciprocal translocations, deletions, inversions and duplications threaten genomic stability and must be avoided to prevent cancer development and genomic disorders [1]. The occurrence of unfaithful repair of DNA double-strand breaks (DSBs) is widely admitted to be the main source of chromosomal rearrangements [2–5]. Nonhomologous End Joining (NHEJ) and Homologous recombination (HR) constitute the main pathways of DSB repair. While NHEJ seal the broken DNA ends by simple religation, HR uses sequence homology between the DSB ends and an intact template for repair and is typically considered as error free. Nevertheless, in a number of cases, such as when HR occurs between non-allelic DNA sequences or DNA repeated sequences or HR is used for the repair of DSB ends containing different levels of similarity, irreversible genomic changes can take place. Thus, when only one end of a DSB shares homology with other sequences in the genome, repair by HR can occur through a replication mechanism termed break-induced replication (BIR) that often gives rise to non-reciprocal translocations (NRTs) [6–9]. BIR requires HR canonical factors such as Rad52 and Rad51 to allow efficient strand invasion of the repair template and to form a Displacement-loop (D-loop) that can be extended by DNA synthesis from the invading 39DSB end [10,11]. In the absence of another DSB end to capture the newly synthesized strand or to independently invade the homologous template, the strand invasion intermediate is thought to be converted into a DNA replication fork capable of replicating an entire chromosome arm until encountering a telomere, a centromere, or a converging replication fork [12–15]. A key factor in this process is Pol32, the non-essential subunit of DNA polymerase d, which is dispensable for normal replication but essential for BIR [13]. Another feature of BIR is the unstable nature of its replication intermediates. It has been shown that DSB repair by BIR can occur through several rounds of strand invasion, synthesis, and dissociation from the invaded template [16]. Within dispersed repeated sequences, template switching during BIR can generate complex chromosomal rearrangements [16–21]. BIR reactions can also be aborted to end in half-crossovers [22,23]. Half-crossovers cause NRTs, leaving the template that has been used for repair broken. They are similar to the NRTs observed in humans, which are involved in the cascade of genomic instability characteristic of human cancer cells [24]. Little is known about how BIR intermediates are processed to allow the establishment of a replication fork after strand invasion, and to cause template switching and half-crossovers. Eukaryotic PLOS Genetics | www.plosgenetics.org 1 September 2012 | Volume 8 | Issue 9 | e1002979 cells have evolved a set of DNA structure-selective endonucleases (SSEs) that possess different substrate specificity for various DNA branched molecules during HR, such as D-loops, replication forks, flaps and Holliday junctions (HJs). Conversion of a D-loop into a replication fork during BIR may require the endonucleolytic resolution of a single Holliday junction [16,25]. In budding yeast, Mus81-Mms4 and Yen1 are the only nuclear enzymes capable of cleaving intact HJs with high efficiency in vitro [26,27]. In vivo, their functions seem to overlap during DSB repair [28–31]. Notably, Mus81-Mms4 is required for recombination-mediated DNA repair at replication forks [32–34] and has been shown to play a role in BIR intermediate processing [23]. Additionally, the Slx1– Slx4 nuclease complex may cleave perturbed replications forks [35–37]. Loss of Slx1–Slx4, as loss of Mus81-Mms4, increases the number of gross chromosomal rearrangements in yeast [38]. Slx4 also acts independently of the Slx1 catalytic subunit to interact with several other factors. For instance, Slx4 binds to the 39flap endonuclease complex Rad1–Rad10 to facilitate the removal of non-homologous tails during HR [39,40]. Rad1–Rad10 complex, which functions in nucleotide excision repair (NER) as well as in DSB repair, has also been involved in the formation of translocations in yeast through a single-strand annealing (SSA) mechanism [41,42]. Together, these SSEs form a complex network to ensure genome stability but their specific roles and their interactions at recombination structures remain unclear. In this study, we used a new assay that generates chromosomal rearrangements after DSB repair using dispersed repeated sequences. Chromosomal rearrangements involved multiple rounds of template switching and some events ended in halfcrossovers, generating NRTs. We investigated the role of SSEs in the processing of BIR intermediates combining mutations of Mus81, Rad1, Yen1, Slx1 and Slx4. Our results show that these SSEs act at multiple steps during BIR. First, we uncovered that Mus81 and Yen1 function to allow efficient BIR, thus causing translocations. In the absence of Mus81, Yen1 and Slx4, we observed that template switching during BIR decreased significantly. Altogether, our results led to new insights into the BIR mechanism and the functional role of SSEs in chromosomal rearrangements. Results A new assay for DSB–induced chromosomal rearrangements We designed an experimental system using DNA repeated sequences dispersed over two yeast chromosomes for the analysis of chromosomal rearrangements induced by a single DSB. We took advantage of the presence of the MAT,HMR and HML loci on chromosome III, involved in mating-type switching. The MAT locus is composed of five regions called W, X, Y, Z1 and Z2 [43]. MATadiffers from MATaby the Yaand the Yasequences, respectively. MATashares Yawith HMR and MATashares Ya with HML. Together, MAT,HMR and HML share two homologous regions flanking the Y sequences, termed X and Z1 (see Figure 1A). All three loci contain a cleavage site for the HO endonuclease at the junction between the Y and Z1 regions, but only the MAT locus is susceptible to being cleaved upon HO expression because of the active repression of HMR and HML loci [44]. The strains used in this study harbor a MATa-inc mutation, a G to A substitution at position Z1–2, which impedes HO cleavage at MAT [45,46]. The HO endonuclease gene under control of the GAL1 inducible promoter was integrated at the ADE3 locus and a 240-bp Ya-Z1 fragment containing a HO-cleavable site, along with the URA3 marker, was inserted in the chromosome VII left arm at the ADH4 locus (Figure 1A). Upon galactose addition to the culture medium, HO would cleave this Ya-Z1 fragment asymmetrically into a centromeric 198-bp fragment and a telomeric 42- bp fragment (Figure 1A). To assay DSB repair in this system, we plated cells on a synthetic medium (SC) with either 2% glucose or 2% galactose to assay survival after HO expression and successive breakage of chromosome VII. The WT strain exhibited a survival frequency of 82% (Figure S1), demonstrating efficient DSB repair. We restreaked survivor colonies from galactose-containing plates on glucose medium to repress HO expression. Then, survivors were concomitantly replica-plated on media lacking uracil and on media containing 5-FOA, a drug that generates a toxic metabolite in Ura + cells, to distinguish between the colonies that maintained or lost the URA3 marker of chromosome VII (Figure 1B). We recollected Ura 2 5-FOA-resistant (20%), Ura + 5-FOA-sensitive (12%), and Ura + 5-FOA-resistant colonies (68%). The latter contained both Ura + and Ura 2 cells and may result from differential repair of two DSBs generated on sister chromatids during the S or G2 phase of the cell cycle. To analyze mixed Ura + 5-FOA-resistant colonies, we first separated Ura + cells from 5- FOA-resistant cells by restreaking colonies on media lacking uracil or containing 5-FOA. Further analyses of 5-FOA-resistant and Ura + cells were performed by pulse-field gel electrophoresis (PFGE) to look for chromosomal translocations. Southern analysis using a probe specific to chromosome VII, proximal to the DSB site, and a probe specific to the region between HMR locus and chromosome III telomere (7L probe and 3R1 probe, respectively, Figure 1A) revealed the presence of non-reciprocal translocations (NRTs) between chromosome VII and chromosome III in all 5- FOA-resistant cells (Figure 1C, 1D, and Figure S2A, S2B). NRTs were rarely observed in Ura + cells (Figure S2B). Given a survival rate of 82%, the frequency of translocants (frequency of 5-FOA- resistant survivors among the whole population that did not undergo DSB induction) was 44% in the WT strain. We mainly observed two types of NRTs, which contained chromosome III sequences starting from the MAT or HMR loci to the telomere fused to chromosome VII at the break site (termed T7/3-MAT and T7/3-HMR translocations for more clarity, Figure 1G). Author Summary Genome rearrangements consisting of non-reciprocal translocations (NRTs) seem to play an important role in carcinogenesis in humans. They are likely caused by intracellular mechanisms that are normally committed to repair breaks occurring in the DNA molecule. Failure of faithful repair of DNA double-strand breaks (DSBs) often leads to chromosomal rearrangements when repair occurs within repeated genomic regions. The break-induced replication (BIR) pathway of DSB repair is a major source of complex chromosomal rearrangements, the latter occurring when BIR involves template switching between dispersed repeated sequences. Given the deleterious consequences of such events for genomic stability, it is of great significance to understand the molecular bases of BIR. Here, we examined the role of different DNA nucleases in chromosomal rearrangements and uncovered the functional involvement of the structure-selective endonucleases (SSEs) subunits Mus81, Yen1, and Slx4 at different steps during BIR. Our work provides new clues to understand the origin of NRTs and the role of SSEs in their generation. Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 2 September 2012 | Volume 8 | Issue 9 | e1002979 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 3 September 2012 | Volume 8 | Issue 9 | e1002979 Interestingly, some survivors lacked linear chromosome III at its expected size in the PFGE analysis (Figure 1D, 1E). When we used a probe specific to the region between MAT and HMR loci (3R2 probe, Figure 1A), chromosome III was detected in the well, consistent with a particular structure that did not allow it to enter the gel (Figure 1E). One possibility was that chromosome III became circular, as had been observed more than three decades ago [47,48]. To test this, we digested chromosomal DNA with AsiSI, which cuts chromosome III at a unique inner location. Indeed, AsiSI digestion released chromosome III into the gel (Figure 1E). Circular chromosomes III have been shown to be the product of recombination between unrepressed HMR and HML loci, which share extensive homology in the X and Z1 regions (Figure 1A) [47]. We observed that the size of the AsiSI linearized chromosome was concordant with a chromosome III that would have lost all subtelomeric sequences located beyond the HM loci. To further demonstrate that circular chromosomes III occurred by recombination between HMR and HML,we assayed whether chromosome III circularization would be seen in hmlDcells. We observed that, in the absence of HML locus, all survivors contained a linear chromosome III at its expected size (Figure 1F). Chromosome III circularization pushed us to investigate the occurrence of a DSB at HMR.HMR is naturally packed into heterochromatin to repress its expression and also to impede cleavage by HO [44]. We asked if HMR invasion would release its repression and cause HO cleavage. We first assayed HMR cleavage by Southern at several times after induction of chromosome VII cleavage by HO and did not observe any cuts in the WT (Figure S3C). We only detected HMR cleavage in a hmlDmatDstrain, in which HMR cleavage represented about a third of chromosome VII cleavage by HO (17% versus 46% after 3 h of induction; Figure S3B, S3C). Indeed HMR cleavage was dependent on cleavage at chromosome VII since no cuts were observed in the hmlDmatDstrain without HO cut site on chromosome VII (Figure S3D). We concluded that the induction of a single DSB by HO in chromosome VII permitted another less efficient DSB in chromosome III at the HMR locus as a secondary event. The efficiency of HMR cleavage is expected to be even less than 17% in the WT strain since the MATa-inc locus is also available as a template for strand invasion in this strain. HMR cleavage likely induced chromosome III circularization, which we observed in 50% of translocants in the WT strain. Apart from T7/ 3-MAT, T7/3-HMR translocations and chromosome III circularization, we also observed rare types of rearrangements of chromosome VII and III whose nature has not been addressed in this study. Together, these results demonstrate that complex chromosomal rearrangements are occurring at a high frequency in our experimental system, allowing us to investigate the molecular and genetic bases of these events. DSB repair involves template switching between MATainc,HMR, and HML We performed kinetic experiments to follow the recombination intermediates that gave rise to chromosomal rearrangements using our system. First, a PCR-based assay was used to monitor new DNA synthesis primed from the 39end of the invading strand of chromosome VII. Genomic DNA was extracted at different times after HO induction and PCR was made with one primer specific to chromosome VII (p7, Figure 2A), proximal to the DSB, and primers specific to each potential template used for recombination, MATa-inc and HMR (p3-M and p3-R, Figure 2A). In WT cells, 35 cycles of PCR amplification permitted to detect products that most likely correspond to newly synthesized DNA fragments at both MAT and HMR loci 1 h after DSB induction (Figure 2B). Using more quantitative conditions, we detected the same products after 25 cycles of PCR amplification at 2 h of DSB induction (Figure S4). The amount of products increased over time. We then monitored the appearance of repair intermediates directly by Southern analysis of genomic DNA digested by EcoRV, using a probe specific to chromosome VII, proximal to the DSB site (7L probe). We detected recombination intermediates between chromosome VII and chromosome III at HMR (7/3-HMR, Figure 2C, left), which most likely correspond to newly synthesized DNA fragments 5 h after DSB induction. At MAT, we observed recombination intermediates 24 h after DSB induction (7/3- MAT, Figure 2C, left). Southern analysis also detected an unexpected band that corresponded in size to chromosome VII fused to chromosome III sequences at the HML locus (7/3-HML, Figure 2C, left). We confirmed this assumption by re-probing the Southern membrane with a probe specific to HML (data not shown). The 7/3-HML band most likely corresponds to newly synthesized DNA fragments primed from chromosome VII DSB end at HML and appeared concomitantly with 7/3-HMR intermediates 5 h after DSB induction (Figure 2C). We monitored what was most likely new DNA synthesis primed from the 39DSB end of chromosome VII invading HML by PCR. We detected intermediates 2 h after DSB induction (p7/p3-L, Figure 2B, Figure S4). The DSB end of chromosome VII assayed by PCR and Southern only shares sequence homology with MATa-inc and HMR. Hence, the signals detected at HML would be the consequence of a template switching from MATa-inc or HMR to HML after duplication of the Z1 region that is common to the three loci. In a similar way, template switching could occur between MATa-inc and HMR.7/ 3-HMR and 7/3-HML intermediates detected by Southern appeared about 3–4 h after detection of priming of the 39 invading DSB end by PCR (Figure 2B, 2C). This difference could be due to the difference of sensitivity between the two techniques. Alternatively, this could reflect a transition between the elongation of the 39invading DSB end, a step that is common to GC and BIR, and the establishment of an active replication fork required Figure 1. Description of the assay used in this study. (A) Schematic representation of chromosomes VII (black) and III (blue) in the haploid strain; X region (x, black box), Yaregion (a, red box), Ya region (a, blue box) and Z1 region (z, green box) are indicated on chromosome III, as well as the Ya-Z1 fragment on chromosome VII. See text for more details. (B) Determination of translocation events. Cells were plated on solid synthetic medium containing galactose and survivor colonies were restreaked on rich YPAD medium containing glucose and subsequently replica-plated on SC+5-FOA and SC-ura. (C) (D) Translocations between chromosomes VII and III were detected by PFGE followed by Southern analysis using the 7L and the 3R1 probe (see panel A). Chromosomal DNA samples were extracted from previously selected Ura 2 5-FOAr survivor colonies. (E) Detection of circular chromosome III after PFGE and Southern analysis. Chromosomes III that were not hybridized with the 3R1 probe were detected in the gel wells using 3R2 probe (see panel A). The DNA samples corresponding to circular chromosome III were digested with AsiSI to linearize chromosome III. C, control strain without translocation. (F) PFGE followed by Southern analysis using the 3R2 probe of Ura 2 5-FOAr survivors in hmlDstrain. Black arrows indicate the positions of the T7/3-MAT and the T7/3-HMR translocations and the circular and linear chromosomes III (Chr. III). PFGE, pulse-field gel electrophoresis. 5-FOAr and 5-FOAs refers to colonies either resistant or sensitive to 5-FOA. (G) Schematic representation of the predominant chromosomal rearrangements observed in this study. doi:10.1371/journal.pgen.1002979.g001 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 4 September 2012 | Volume 8 | Issue 9 | e1002979 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 5 September 2012 | Volume 8 | Issue 9 | e1002979 for BIR [11,14]. Using translocants containing T7/3-MAT and T7/3-HMR translocations, we confirmed the size of the repair intermediates detected by Southern (Figure 2C, right). We did not recover any translocant containing translocations corresponding to repair intermediates detected at HML. Together, these data show that one unique feature of our experimental system is that it allows the detection of events of template switching between MATa-inc and HML and possibly between MATa-inc and HMR during chromosomal rearrangement. These events of template switching likely participated to give rise to the formation of T7/3-MAT and T7/3-HMR translocations and dicentric chromosomes resulting from BIR completed from HML (Figure 2D). Because dicentric chromosomes are known to be unstable [49], this may be why we could not detect such type of chromosomal rearrangement. We noted that BIR initiation at HMR by the broken chromosome VII would restore an HO cleavable site that might not be properly silenced in the resulting translocations. In the latter case, HO cleavage would destabilize these translocations and their stabilization would require repair by gene conversion (GC) using the non-cleavable sequences at MATa-inc. Mus81 and Yen1 promote chromosomal rearrangements Observed chromosomal rearrangements likely occurred by BIR through the invasion of the MATa-inc and HMR loci. Homology of the centromeric 198-bp Ya-Z1 fragment present at one DSB end would be used to invade MATa-inc or HMR loci at the Yaregion and to duplicate chromosome III sequences until reaching its right telomere, generating T7/3-MAT and T7/3-HMR NRTs (type a, Figure 3). Alternatively, since we observed the cleavage of chromosome III as a consequence of HMR invasion, it is also possible that T7/3-HMR translocations occurred by BIR followed by single-strand annealing (SSA), co-segregating with an intact chromosome III (type b, Figure 3). Finally, cleaved chromosome III could circularize and co-segregate with the translocation (type c, Figure 3). To confirm genetically the involvement of BIR in the generation of translocations using our experimental system, we assayed mutants of Rad52, Rad51 and Pol32 as representative key functions in BIR. Next, we asked whether DNA nucleases acting on branched structures such as D-loops, replication forks or HJs would have a role in the cascade of recombination events that led to translocations. We chose to study the genetic role of Mus81, Rad1, Yen1, Slx1 and Slx4 because of their known functions in recombination processes [25]. Because none of the genes coding for these SSEs are essential for viability, we assayed deletion mutants and combined mutants between them to assay redundancy of functions. Although Slx1 and Slx4 form a heterodimer complex, such as Mus81-Mms4 and Rad1–Rad10, we decided to study slx1Dand slx4Dmutations separately because Slx4 seems to have additional roles in DSB repair apart from regulating the Slx1 nuclease activity [50,51]. We also included the DNA helicase Sgs1 because of its known role in HJ dissolution (Figure 4A). For each mutant assayed, we recovered survivors after HO endonuclease induction and selected colonies that contained translocations between chromosome VII and chromosome III, as described above (5-FOA-resistant colonies). We did not recover any translocants in rad52Dand rad51Dmutants, in which strand invasion fails to occur (Figure 4A). POL32 deletion reduced 4-fold the frequency of translocations in comparison with the WT (x 2 , p,0.01), arguing in favor of the involvement of the Pol32- dependent BIR pathway in the generation of the translocations analyzed in this study. We did not observe any increase of translocations in sgs1Dcells, even though SGS1 gene had been identified as a suppressor of translocations involving template switching events [19]. Among the nuclease single mutants, only mus81Dshowed a slight but significant decrease in the frequency of translocants (x 2 ,p,0.01) when compared to the WT. In contrast, we observed significant decreases in the frequency of translocants between the WT, mus81Drad1Dand mus81Drad1Dslx1Dmutants, but these effects were found to be epistatic with mus81D(Figure 4A; x 2 ,p,0.01). On the contrary, we observed further significant decreases (x 2 ,p,0.01) in mus81Dyen1Dmutants, of about 3.5-fold and 2.5-fold compared to the WT and mus81D, respectively (Figure 4A). We conclude that Mus81 and Yen1 are both required for translocations in our assay. Since it existed the possibility that the translocations were also produced by BIR/SSA, we assayed translocation formation in an HMR-inc strain, in which HMR locus would not be susceptible to HO cleavage and translocations would only be produced by BIR. We observed that survival dropped from 82% in the original HMR WT strain to 52% in the HMR-inc WT strain, although the frequency of translocants remained around 40% (Figure 4B and Figure S1). In the control HMR-inc background, POL32 deletion reduced 18.5-fold the frequency of translocations in comparison with the WT (Figure 4B; x 2 ,p,0.01). This result demonstrates a clear dependency of translocations on the Pol32-dependent BIR pathway in this background. We observed a significant decrease of 3.4-fold in HMR-inc mus81Dyen1Dmutants compared to the HMR-inc WT but no decrease in the HMR-inc mus81Dand HMR- inc yen1Dsingle mutants (Figure 3B; x 2 ,p,0.01). These results indicate that Mus81 and Yen1 have overlapping functions in BIR. To confirm this, we performed time-course experiments to monitor the kinetics of appearance of BIR intermediates in these mutants (Figure 4C). Kinetics of DSB formation in the mutants was similar to the WT, allowing us to directly compare the accumulation of BIR intermediates at each time point (Figure 4D). In HMR-inc WT cells, 7/3-HMR and 7/3-HML intermediates appeared 4 h and 5 h after DSB induction, respectively (Figure 4C, 4D). 7/3-MAT intermediates were detected 6 h after DSB induction (Figure 4C, 4D), showing that their delayed appearance in the original HMR WT strain was partly due to HMR cleavage. Figure 2. Template switching occurs between MAT a -inc , HMR , and HML loci. (A) Schematic representation of chromosomes VII and III showing the positions of the PCR primers, EcoRV sites (EV) and the 7L probe used for the analysis. Distances between the primers and EcoRV sites and the HO cut sites are indicated. (B) Appearance of BIR repair product, as monitored by PCR, in the WT strain. DNA samples used for PCR were extracted at intervals after HO induction with galactose. PCR reactions were performed with the p7 primer and either the p3-M, p3-R or p3-L primer (see panel A). A primer pair corresponding to ACT1 locus on chromosome VI was used to control the amount of genomic DNA used for PCR at each time point. 35 cycles of PCR amplifications were performed. (C) Appearance of BIR repair products, as monitored by Southern analysis with the 7L probe, in the WT strain. DNA samples were extracted as for the PCR assay. Positions of the bands corresponding to 7/3-MAT, 7/3-HMR and 7/3-HML intermediates, and to the uncut and cut chromosome VII (chr. VII) are indicated. Two genomic DNA samples coming from survivor colonies containing T7/3-MAT and T7/3-HMR translocations were included in the experiment. GAL, galactose; h, hours. (D) Schematic representation of BIR events involving template switching likely occurring in our assay. Black arrows indicate the first invasion events while red arrows indicate the secondary template switching events. The different possible final outcomes are depicted. The red cross indicates the presence of inc non-cleavable sequences. M; MAT;R,HMR;L, HML. See text for more details. doi:10.1371/journal.pgen.1002979.g002 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 6 September 2012 | Volume 8 | Issue 9 | e1002979 No BIR intermediate could be detected in HMR-inc pol32Dcells (Figure 4C, 4D). In HMR-inc mus81Dyen1Dcells, a decrease of BIR intermediates was reproducibly observed at all time points (Figure 4C, 4D). We concluded that Mus81 and Yen1 are both required for promoting efficient Pol32-dependent BIR. Template switching is affected in structure-selective endonuclease mutants We confirmed by PFGE that all 5-FOA-resistant survivors analyzed in mutant backgrounds contained chromosome translocations between chromosome VII and chromosome III (Figure 5A and Figures S5, S6). Notably, a very low amount of T7/3-MAT translocations (8%) were recovered in WT cells (Figure 5B). In pol32Dcells, no T7/3-MAT translocation was recovered (n = 59, x 2 ,p,0.05), showing that this type of translocation has a complete dependency on Pol32 (Figure 5A, 5B). Among the nuclease mutants, rad1Dshowed a significant increase of T7/3-MAT translocations, up to 20% of total translocations (2.5-fold, n = 59, x 2 ,p,0.01), which was not observed in double mutants with mus81Dand slx1D(Figure 5A, 5B). The concomitant absence of Mus81, Slx4 and Yen1 engendered an even higher increase (3.1- fold) of T7/3-MAT translocations that reached up to 25% of total translocations (n = 58, x 2 ,p,0.01) (Figure 5A, 5B). In kinetic experiments, both 7/3-HMR and 7/3-HML intermediates accumulated in the rad1Dand mus81Dslx4Dyen1Dmutants with kinetics clearly delayed (2–3 h) respect to the WT, demonstrating a defect of repair in these mutants (Figure 6A, 6B). At 24 h, signals for 7/3-HMR, 7/3-HML and 7/3-MAT that likely correspond to final repair products were detected in all strains. Notably, we observed a clear increase in the 7/3-MAT/7/3-MAT ratio, up to 24% and 29% in rad1Dand mus81Dslx4Dyen1D, respectively, compared to the 15% seen in the WT (Figure 6C). This Figure 3. Various pathways give rise to chromosomal rearrangements. Schematic representation of the different types of repair giving rise to the chromosomal rearrangements scored in this study. Repair of DSBs in G2 can occur either by BIR, BIR/SSA following HMR cleavage with/without circularization of chromosome III, gene conversion (GC) or erroneous NHEJ. The repair types of only one DSB are depicted for simplification. The other DSBs are repaired via either one of the different types. VII, VII9and III, III9indicate chromosome VII and chromosome III sister-chromatids, respectively. U, URA3;M;MAT;R,HMR;L,HML; M/R, MAT or HMR. See text for more details. doi:10.1371/journal.pgen.1002979.g003 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 7 September 2012 | Volume 8 | Issue 9 | e1002979 Figure 4. Genetic analysis of BIR intermediates processing in SSE mutants. (A) (B) Frequency of translocants of the different strains tested. See Material and Methods for details. ** and *, differences with the WT statistically significant (p,0.01 and p,0.05, respectively, x 2 with Yates’ correction) u, statistically different from mus81D(p,0.01, x 2 with Yates’ correction). Error bars represent standard deviations. (C) Appearance of BIR products as monitored by Southern analysis in HMR-inc WT, HMR-inc pol32Dand HMR-inc mus81Dyen1Dstrains. Experiments were performed as described in Figure 2C. A representative Southern analysis is shown for each genotype analyzed. Positions of the bands corresponding to 7/3-MAT, Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 8 September 2012 | Volume 8 | Issue 9 | e1002979 observation correlated with the increase of T7/3-MAT translocations previously observed in these mutants (Figure 5B). The defects observed in rad1Dand mus81Dslx4Dyen1Dmutants could be explained by the known functions of Rad1 and Slx4 in SSA [50], which would be required for T7/3-HMR translocation formation by BIR/SSA. Indeed, in the control HMR-inc WT strain, the T7/3-MAT translocations represented about 55% of the translocations observed in 5-FOA-resistant survivors (Figure S7B). 7/3-HMR and 7/3-HML intermediates, and to the uncut and cut chromosome VII (Chr. VII) are indicated. GAL, galactose; h, hours. (D) Quantification of BIR product accumulation. Quantification results of chromosome VII cleavage (DSB), 7/3-HMR, 7/3-HML and 7/3-MAT BIR intermediates are shown as percentage. Mean values and standard deviations for 2–3 independent experiments are shown. doi:10.1371/journal.pgen.1002979.g004 Figure 5. PFGE analysis of T7/3 translocations in SSE mutants. (A) PFGE followed by Southern analysis using the 3R1 probe (See Figure 1G) of Ura 2 5-FOAr survivors in WT, pol32D,rad1Dand mus81Dslx4Dyen1Dstrains. Black arrows indicate the positions of the T7/3-MAT and T7/3-HMR translocations and of the linear chromosome III (Chr. III). PFGE, pulse-field gel electrophoresis. (B) Graphical plotting of percent of translocants containing T7/3-MAT translocations of each strain tested. ** and *, differences with the WT statistically significant (p,0.01 and p,0.05, respectively, x 2 with Yates’ correction). See Table S1 for complete statistical analysis. doi:10.1371/journal.pgen.1002979.g005 Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 9 September 2012 | Volume 8 | Issue 9 | e1002979 ADH4-59#1 GCGCGCGGTACCGAATTCAAACCGCTGATTACATCAAA and ADH4-59#2 GCGCGCAGATCTATCGATCTCGAGTCTAGACTAGACCAGTAGCAGCAGTC, and ADH4-39#1 GCGCGCAGATCTGCTAGCACTAGTGGATCCCTTAGTCGCTGCATACAAAG and ADH4-39#2 GCGCGCGAGCTCGAATTCGCACACGCATAATTGACGTT. These two fragments were cloned by the gap repair method in pBluescript II(SK+) previously digested by KpnIandSacI to create pBP99 plasmid. A BglII-BamHI URA3 containing fragment from sp392 plasmid [71] was then cloned in pBP99 digested with BglII to create pBP102. Finally, the HMR fragment was amplified from genomic DNA with the primer pair HO-HMR-Hind3 GCGCGCAAGCTTCAACCACTCTACAAAACCAAAACCA and HO-HMR-Nhe1 GCGCGCGCTAGCAGAAGAAGTTGCAAAGAAATGTGGC and cloned into pBP102 after digestion with HindIII and NheI, to create pBP102-HO. pBP102-HO was linearized with PvuII and transformed into yeast. Integration was selected by uracile prototrophy and verified by PCR and Southern analysis. Determination of survival and translocation frequencies Yeast cells were grown in yeast extract-peptone-adenine- dextrose (YPAD) until reaching the exponential phase of growth, appropriately diluted with H 2 O and plated on synthetic complete (SC) medium containing either 2% glucose or 2% galactose as a carbon source. Survivor colonies on galactose-containing plates were then restreaked on YPAD plates and replica-plated on SC plates containing 5-FOA (USBiological), a drug that generates a toxic metabolite in Ura + cells, or on SC plates lacking uracil. Frequencies were calculated as follows: survival frequency = cfu galactose/cfu glucose; translocants frequency = (cfu galactose Ura25-FOAr+(cfu galactose Ura+5-FOAr)/2)/cfu glucose. 96 to 288 survivor colonies, recovered from 2 to 3 independent induction experiments, were analyzed for each strain tested. Statistical analysis was performed using the x 2 test with Yates’ correction. Kinetic analysis of BIR intermediates by PCR and Southern analysis Yeast cells were grown at 30uC in liquid YPAD until reaching the exponential phase of growth, washed twice with synthetic complete medium SGL (3% glycerol, 2% lactate) and cultured overnight in SGL until reaching an OD 600 nm <0.5 when galactose was added at a final concentration of 2%. Cells were taken at different times after galactose induction and genomic DNA was extracted in agarose plugs according to standard procedures. Agarose plugs were incubated twice in 200 ml16b-Agarase I reaction buffer for 30 min, melted at 65uC for 10 min, equilibrated at 42uC for 15 min and treated with b-Agarase I (New England BioLabs) at 42uC for 1 h before PCR amplification. These were performed with 250 ng of genomic DNA (estimated with Nano- Drop, Thermo Scientific) in a total volume of 30 ml in the following conditions: 16Phusion HF buffer, 200 mM each dNTP, 0.6 U Phusion DNA polymerase (Finnzymes), 0.5 mM each primer. Samples were denatured for 45 s at 98uC, then cycled 25–35 times with 20 s denaturation (98uC), 30 s annealing (57uC) and 45 s extension (72uC) followed by a final extension step of 5 min at 72uC. PCR was performed with primer p7 GCACACGCATAATTGACGTT and primers p3-M GAAGACTTGTGGCGAAGA, p3- R CCAACATTTAGGAAAAAACG or p3-L CGGATGGCACAAGGAACACGCATTT. Control PCR was performed with primers corresponding to ACT1 locus, ACT1up TTCACGCTTACTGCTTTTTTC and ACT1low CAAGGCGACGTAACATAGTTT. PCR products were subjected to gel electrophoresis in 0.8% agarose and stained with ethidium bromide. Instead of b- Agarase I treatment, plugs were digested with 30 U of EcoRV restriction enzyme for 5 h at 37uC and loaded in a 1% agarose gel for Southern analysis. Electrophoresis was run at 80 V for 16 h30 and DNA was transferred into Hybond-XL membranes (GE Healthcare) in alkaline conditions. Membranes were probed with dCT 32 P-labelled PCR fragments obtained with ADH4-39#1and ADH4-39#1 primers (7L probe). Quantification of DNA signals was made relative to the total DNA of each lane and was performed using ImageGauge 4.2 (Fujifilm) program. Pulsed-field gel electrophoresis (PFGE) analysis For each strain, 28 to 84 independent Ura- 5-FOAr survivor colonies were grown in 2,5 ml of YPAD medium overnight at 30uC. Agarose plugs containing chromosomal DNA were made according to the manufacturer’s instructions (Bio-Rad). AsiSI digestion was performed incubating agarose plugs twice in 1 ml 16NEBuffer 4 for 30 min and digested in 200 ml16NEBuffer 4 with 30 U of AsiSI restriction enzyme for 5 h (New England Biolabs). Agarose gels (0.9%) were run in a Bio-Rad CHEF MapperXA apparatus for 16 h at 6 V/cm with a switch time of 70 s and for an additional 12 h at 6 V/cm with a switch time of 120 s. Then, gels were stained with ethidium bromide and DNA was transferred into Hybond-XL membranes (GE Healthcare) in alkaline conditions. Membranes were probed with dCT 32 P-labelled PCR fragments obtained with primers ADH7#1 TGTTGGCTAAAGCTATGG and ADH7#2 TTCTTCGCTGATCGG (3R1 probe), ARS315#1 AAACCAGTCTTTAACCGCCATAATG and ARS315#2CA- GAGCCCAAGAGATAGCCGAACTT (3R2 probe), and with primers HML+HMR-F CAAACATCTTAGTAGTGTCTGAGGA and HML+HMR-R CTGTAATTTACCTAAGTTACCAGAG (X probe). Chromosomal rearrangements different from T7/3-MAT or T7/3-HMR translocations or circular chromosomes III and revealed by the PFGE analysis were not included in the statistical analyses. Supporting Information Figure S1 Survival frequency to DSB induction in the WT and SSE mutants. Graphical plotting of survival frequency of each strain tested. See Material and Methods for more details. {, frequency,10 24 . Error bars represent standard deviations. (TIF) Figure S2 PFGE analysis of translocations in mixed Ura + 5- FOA-resistant colonies. Translocations between chromosomes VII and III were detected by PFGE followed by Southern analysis using the 7L (A) and the 3R1 (B) probe. Chromosomal DNA samples were extracted from previously separated Ura + and 5- FOA-resistant cells. Black arrows indicate the positions of the T7/ 3-HMR translocations and of the linear chromosome III (Chr. III). (TIF) Figure S3 DNA invasion at HMR causes its cleavage. (A) Schematic representation of chromosomes VII and III in our assay. Localization of the 7L and X probes is indicated. (B) Detection of HO cleavage on chromosome VII, as monitored by Southern analysis using the 7L probe in the WT and hmlDmatDYZ strains. DNA samples were extracted at different intervals after HO induction with galactose. Positions of the bands corresponding to the uncut and cut chromosome VII (chr. VII) are indicated. (C) (D) Detection of HMR cleavage product, as monitored by Southern analysis using the X probe in the WT and hmlDmatDYZ strains and the hmlDmatDYZ strain without HO cut site in chromosome VII. DNA samples were extracted at different intervals after HO induction with galactose. Quantification of Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 16 September 2012 | Volume 8 | Issue 9 | e1002979 cleavage at each time point is indicated at the bottom. Positions of the bands corresponding to MAT,HMR,HML, cut MAT, cut HMR, cut HML and matDYZ are indicated. GAL, galactose; h, hours. (TIF) Figure S4 Analysis of repair synthesis products in WT cells, as monitored by PCR. Experiments were performed as in Figure 2B except that in this case only 25 cycles of PCR amplifications were done. (TIF) Figure S5 Genetic analysis of T7/3 translocations in SSE mutants. PFGE followed by Southern analysis using the 3R1 probe of Ura 2 5-FOAr survivors in the WT and different mutants combination strains. Black arrows indicate the positions of the T7/ 3-MAT and T7/3-HMR translocations and of the linear chromosome III (Chr. III). (TIF) Figure S6 Genetic analysis of T7/3 translocations in SSE mutants. Details as in Figure S5. (TIF) Figure S7 PFGE analysis of translocations in the HMR-inc WT strain. (A) Schematic representation of chromosomes III. Localization of the 3L and 3R1 probes is indicated. PFGE followed by Southern analysis using the 3R1 (B) or 3L probes (C) of Ura 2 5- FOAr survivors in the control HMR-inc WT strain. Black arrows indicate the positions of the T7/3-MAT and T7/3-HMR translocations and the circular and linear chromosomes III (Chr. III). (TIF) Figure S8 Genetic analysis of chromosome III circularization in SSE mutants. PFGE followed by Southern analysis using the 3R2 probe of Ura 2 5-FOAr survivors in the WT and different mutants combination strains. Black arrows indicate the positions of T7/3- MAT translocations, and the circular and linear chromosomes III (Chr. III). A red asterisk (*) indicates residual labeling of the 3R1 probe. (TIF) Figure S9 Genetic analysis of chromosome III circularization in SSE mutants. Details as in Figure S8. (TIF) Figure S10 Analysis of chromosome III circularization in Ura + survivors. (A), (B) Southerns from Figure 1D and Figure S2 were re-hybridized with the 3R2 probe to show the presence of circular chromosomes III in the wells. (C), (D) PFGE followed by Southern analysis using the 3R1 and 3R2 probes of pol32DUra + 5-FOAs survivors. (E) Frequency of Ura + survivors carrying a circular chromosome III in WT and pol32Dstrains. **, differences with the WT statistically significant (p,0.01, x 2 with Yates’ correction). (TIF) Table S1 Statistical analysis of PFGE data. The number of translocants analyzed by PFGE and those that contained a T7/3- MAT translocation or a circular chromosome III are indicated for each genotype. Numbers in parentheses correspond to the percentage of the total. The differences between the WT were analyzed using a x 2 test with Yates’ correction. *, statistically significant P values are 0.05 for x 2 .3.84 and 0.01 for x 2 .6.63. n.d., not determined. (DOC) Acknowledgments We thank Marı ´a Moriel-Carretero and Pablo Huertas for critical reading of the manuscript, Sarah Lambert and Marı ´a Moriel-Carretero for helpful discussions, Cristina Tous for technical assistance, and Diane Haun for style supervision. Author Contributions Conceived and designed the experiments: BP AA. Performed the experiments: BP. Analyzed the data: BP AA. Contributed reagents/ materials/analysis tools: BP AA. Wrote the paper: BP AA. References 1. Chen JM, Cooper DN, Ferec C, Kehrer-Sawatzki H, Patrinos GP (2010) Genomic rearrangements in inherited disease and cancer. Semin Cancer Biol 20: 222–233. 2. Agarwal S, Tafel AA, Kanaar R (2006) DNA double-strand break repair and chromosome translocations. DNA Repair (Amst) 5: 1075–1081. 3. Richardson C, Jasin M (2000) Frequent chromosomal translocations induced by DNA double-strand breaks. Nature 405: 697–700. 4. Khanna KK, Jackson SP (2001) DNA double-strand breaks: signaling, repair and the cancer connection. Nat Genet 27: 247–254. 5. Rothkamm K, Lobrich M (2002) Misrepair of radiation-induced DNA doublestrand breaks and its relevance for tumorigenesis and cancer treatment (review). Int J Oncol 21: 433–440. 6. Bosco G, Haber JE (1998) Chromosome break-induced DNA replication leads to nonreciprocal translocations and telomere capture. Genetics 150: 1037–1047. 7. Kang LE, Symington LS (2000) Aberrant double-strand break repair in rad51 mutants of Saccharomyces cerevisiae. Mol Cell Biol 20: 9162–9172. 8. Aguilera A (2001) Double-strand break repair: are Rad51/RecA–DNA joints barriers to DNA replication? Trends Genet 17: 318–321. 9. McEachern MJ, Haber JE (2006) Break-induced replication and recombinational telomere elongation in yeast. Annu Rev Biochem 75: 111–135. 10. Davis AP, Symington LS (2004) RAD51-dependent break-induced replication in yeast. Mol Cell Biol 24: 2344–2351. 11. Malkova A, Naylor ML, Yamaguchi M, Ira G, Haber JE (2005) RAD51- dependent break-induced replication differs in kinetics and checkpoint responses from RAD51-mediated gene conversion. Mol Cell Biol 25: 933–944. 12. Morrow DM, Connelly C, Hieter P (1997) ‘‘Break copy’’ duplication: a model for chromosome fragment formation in Saccharomyces cerevisiae. Genetics 147: 371–382. 13. Lydeard JR, Jain S, Yamaguchi M, Haber JE (2007) Break-induced replication and telomerase-independent telomere maintenance require Pol32. Nature 448: 820–823. 14. Lydeard JR, Lipkin-Moore Z, Sheu YJ, Stillman B, Burgers PM, et al. (2010) Break-induced replication requires all essential DNA replication factors except those specific for pre-RC assembly. Genes Dev 24: 1133–1144. 15. Hashimoto Y, Puddu F, Costanzo V (2012) RAD51- and MRE11-dependent reassembly of uncoupled CMG helicase complex at collapsed replication forks. Nat Struct Mol Biol 19: 17–24. 16. Smith CE, Llorente B, Symington LS (2007) Template switching during breakinduced replication. Nature 447: 102–105. 17. Lee JA, Carvalho CM, Lupski JR (2007) A DNA replication mechanism for generating nonrecurrent rearrangements associated with genomic disorders. Cell 131: 1235–1247. 18. Ruiz JF, Gomez-Gonzalez B, Aguilera A (2009) Chromosomal translocations caused by either Pol32-dependent or Pol32-independent triparental breakinduced replication. Mol Cell Biol 29: 5441–5454. 19. Schmidt KH, Viebranz E, Doerfler L, Lester C, Rubenstein A (2010) Formation of complex and unstable chromosomal translocations in yeast. PLoS ONE 5: e12007. doi:10.1371/journal.pone.0012007 20. Liu P, Erez A, Nagamani SC, Dhar SU, Kolodziejska KE, et al. (2011) Chromosome catastrophes involve replication mechanisms generating complex genomic rearrangements. Cell 146: 889–903. 21. Zhang F, Khajavi M, Connolly AM, Towne CF, Batish SD, et al. (2009) The DNA replication FoSTeS/MMBIR mechanism can generate genomic, genic and exonic complex rearrangements in humans. Nat Genet 41: 849–853. 22. Deem A, Barker K, Vanhulle K, Downing B, Vayl A, et al. (2008) Defective break-induced replication leads to half-crossovers in Saccharomyces cerevisiae. Genetics 179: 1845–1860. 23. Smith CE, Lam AF, Symington LS (2009) Aberrant double-strand break repair resulting in half crossovers in mutants defective for Rad51 or the DNA polymerase delta complex. Mol Cell Biol 29: 1432–1441. 24. Sabatier L, Ricoul M, Pottier G, Murnane JP (2005) The loss of a single telomere can result in instability of multiple chromosomes in a human tumor cell line. Mol Cancer Res 3: 139–150. Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 17 September 2012 | Volume 8 | Issue 9 | e1002979 25. Schwartz EK, Heyer WD (2011) Processing of joint molecule intermediates by structure-selective endonucleases during homologous recombination in eukaryotes. Chromosoma 120: 109–127. 26. Ip SC, Rass U, Blanco MG, Flynn HR, Skehel JM, et al. (2008) Identification of Holliday junction resolvases from humans and yeast. Nature 456: 357–361. 27. Matos J, Blanco MG, Maslen S, Skehel JM, West SC (2011) Regulatory Control of the Resolution of DNA Recombination Intermediates during Meiosis and Mitosis. Cell 147: 158–172. 28. Blanco MG, Matos J, Rass U, Ip SC, West SC (2010) Functional overlap between the structure-specific nucleases Yen1 and Mus81-Mms4 for DNA- damage repair in S. cerevisiae. DNA Repair (Amst) 9: 394–402. 29. Tay YD, Wu L (2010) Overlapping roles for Yen1 and Mus81 in cellular Holliday junction processing. J Biol Chem 285: 11427–11432. 30. Ho CK, Mazon G, Lam AF, Symington LS (2010) Mus81 and Yen1 promote reciprocal exchange during mitotic recombination to maintain genome integrity in budding yeast. Mol Cell 40: 988–1000. 31. Agmon N, Yovel M, Harari Y, Liefshitz B, Kupiec M (2011) The role of Holliday junction resolvases in the repair of spontaneous and induced DNA damage. Nucleic Acids Res 39: 7009–7019. 32. Froget B, Blaisonneau J, Lambert S, Baldacci G (2008) Cleavage of stalled forks by fission yeast Mus81/Eme1 in absence of DNA replication checkpoint. Mol Biol Cell 19: 445–456. 33. Roseaulin L, Yamada Y, Tsutsui Y, Russell P, Iwasaki H, et al. (2008) Mus81 is essential for sister chromatid recombination at broken replication forks. Embo J 27: 1378–1387. 34. Doe CL, Ahn JS, Dixon J, Whitby MC (2002) Mus81-Eme1 and Rqh1 involvement in processing stalled and collapsed replication forks. J Biol Chem 277: 32753–32759. 35. Kaliraman V, Brill SJ (2002) Role of SGS1 and SLX4 in maintaining rDNA structure in Saccharomyces cerevisiae. Curr Genet 41: 389–400. 36. Coulon S, Noguchi E, Noguchi C, Du LL, Nakamura TM, et al. (2006) Rad22Rad52-dependent repair of ribosomal DNA repeats cleaved by Slx1-Slx4 endonuclease. Mol Biol Cell 17: 2081–2090. 37. Coulon S, Gaillard PH, Chahwan C, McDonald WH, Yates JR, 3rd, et al. (2004) Slx1-Slx4 are subunits of a structure-specific endonuclease that maintains ribosomal DNA in fission yeast. Mol Biol Cell 15: 71–80. 38. Zhang C, Roberts TM, Yang J, Desai R, Brown GW (2006) Suppression of genomic instability by SLX5 and SLX8 in Saccharomyces cerevisiae. DNA Repair (Amst) 5: 336–346. 39. Toh GW, Sugawara N, Dong J, Toth R, Lee SE, et al. (2010) Mec1/Tel1- dependent phosphorylation of Slx4 stimulates Rad1-Rad10-dependent cleavage of non-homologous DNA tails. DNA Repair (Amst) 9: 718–726. 40. Lyndaker AM, Goldfarb T, Alani E (2008) Mutants defective in Rad1-Rad10- Slx4 exhibit a unique pattern of viability during mating-type switching in Saccharomyces cerevisiae. Genetics 179: 1807–1821. 41. Hwang JY, Smith S, Myung K (2005) The Rad1-Rad10 complex promotes the production of gross chromosomal rearrangements from spontaneous DNA damage in Saccharomyces cerevisiae. Genetics 169: 1927–1937. 42. Pannunzio NR, Manthey GM, Bailis AM (2010) RAD59 and RAD1 cooperate in translocation formation by single-strand annealing in Saccharomyces cerevisiae. Curr Genet 56: 87–100. 43. Haber JE (1998) Mating-type gene switching in Saccharomyces cerevisiae. Annu Rev Genet 32: 561–599. 44. Lustig AJ (1998) Mechanisms of silencing in Saccharomyces cerevisiae. Curr Opin Genet Dev 8: 233–239. 45. Nickoloff JA, Singer JD, Heffron F (1990) In vivo analysis of the Saccharomyces cerevisiae HO nuclease recognition site by site-directed mutagenesis. Mol Cell Biol 10: 1174–1179. 46. Weiffenbach B, Rogers DT, Haber JE, Zoller M, Russell DW, et al. (1983) Deletions and single base pair changes in the yeast mating type locus that prevent homothallic mating type conversions. Proc Natl Acad Sci U S A 80: 3401–3405. 47. Klar AJ, Strathern JN, Hicks JB, Prudente D (1983) Efficient production of a ring derivative of chromosome III by the mating-type switching mechanism in Saccharomyces cerevisiae. Mol Cell Biol 3: 803–810. 48. Strathern JN, Newlon CS, Herskowitz I, Hicks JB (1979) Isolation of a circular derivative of yeast chromosome III: implications for the mechanism of mating type interconversion. Cell 18: 309–319. 49. Thrower DA, Bloom K (2001) Dicentric chromosome stretching during anaphase reveals roles of Sir2/Ku in chromatin compaction in budding yeast. Mol Biol Cell 12: 2800–2812. 50. Flott S, Alabert C, Toh GW, Toth R, Sugawara N, et al. (2007) Phosphorylation of Slx4 by Mec1 and Tel1 regulates the single-strand annealing mode of DNA repair in budding yeast. Mol Cell Biol 27: 6433–6445. 51. Flott S, Rouse J (2005) Slx4 becomes phosphorylated after DNA damage in a Mec1/Tel1-dependent manner and is required for repair of DNA alkylation damage. Biochem J 391: 325–333. 52. Fekairi S, Scaglione S, Chahwan C, Taylor ER, Tissier A, et al. (2009) Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/ recombination endonucleases. Cell 138: 78–89. 53. Gonzalez-Barrera S, Cortes-Ledesma F, Wellinger RE, Aguilera A (2003) Equal sister chromatid exchange is a major mechanism of double-strand break repair in yeast. Mol Cell 11: 1661–1671. 54. Kadyk LC, Hartwell LH (1992) Sister chromatids are preferred over homologs as substrates for recombinational repair in Saccharomyces cerevisiae. Genetics 132: 387–402. 55. Chabes A, Georgieva B, Domkin V, Zhao X, Rothstein R, et al. (2003) Survival of DNA damage in yeast directly depends on increased dNTP levels allowed by relaxed feedback inhibition of ribonucleotide reductase. Cell 112: 391–401. 56. Deem A, Keszthelyi A, Blackgrove T, Vayl A, Coffey B, et al. (2011) Breakinduced replication is highly inaccurate. PLoS Biol 9: e1000594. doi:10.1371/ journal.pbio.1000594 57. Hanada K, Budzowska M, Davies SL, van Drunen E, Onizawa H, et al. (2007) The structure-specific endonuclease Mus81 contributes to replication restart by generating double-strand DNA breaks. Nat Struct Mol Biol 14: 1096–1104. 58. Zeng S, Xiang T, Pandita TK, Gonzalez-Suarez I, Gonzalo S, et al. (2009) Telomere recombination requires the MUS81 endonuclease. Nat Cell Biol 11: 616–623. 59. Ehmsen KT, Heyer WD (2008) Saccharomyces cerevisiae Mus81-Mms4 is a catalytic, DNA structure-selective endonuclease. Nucleic Acids Res 36: 2182– 2195. 60. Ehmsen KT, Heyer WD (2009) A junction branch point adjacent to a DNA backbone nick directs substrate cleavage by Saccharomyces cerevisiae Mus81-Mms4. Nucleic Acids Res 37: 2026–2036. 61. Fricke WM, Bastin-Shanower SA, Brill SJ (2005) Substrate specificity of the Saccharomyces cerevisiae Mus81-Mms4 endonuclease. DNA Repair (Amst) 4: 243– 251. 62. Ohouo PY, Bastos de Oliveira FM, Almeida BS, Smolka MB (2010) DNA damage signaling recruits the Rtt107-Slx4 scaffolds via Dpb11 to mediate replication stress response. Mol Cell 39: 300–306. 63. Roberts TM, Kobor MS, Bastin-Shanower SA, Ii M, Horte SA, et al. (2006) Slx4 regulates DNA damage checkpoint-dependent phosphorylation of the BRCT domain protein Rtt107/Esc4. Mol Biol Cell 17: 539–548. 64. De Muyt A, Jessop L, Kolar E, Sourirajan A, Chen J, et al. (2012) BLM helicase ortholog Sgs1 is a central regulator of meiotic recombination intermediate metabolism. Mol Cell 46: 43–53. 65. Zakharyevich K, Tang S, Ma Y, Hunter N (2012) Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase. Cell 149: 334–347. 66. Ivanov EL, Haber JE (1995) RAD1 and RAD10, but not other excision repair genes, are required for double-strand break-induced recombination in Saccharomyces cerevisiae. Mol Cell Biol 15: 2245–2251. 67. Munoz-Galvan S, Tous C, Blanco MG, Schwartz EK, Ehmsen KT, et al. (2012) Distinct roles of mus81, yen1, slx1-slx4, and rad1 nucleases in the repair of replication-born double-strand breaks by sister chromatid exchange. Mol Cell Biol 32: 1592–1603. 68. Rouse J (2009) Control of genome stability by SLX protein complexes. Biochem Soc Trans 37: 495–510. 69. Zhang F, Carvalho CM, Lupski JR (2009) Complex human chromosomal and genomic rearrangements. Trends Genet 25: 298–307. 70. Zou H, Rothstein R (1997) Holliday junctions accumulate in replication mutants via a RecA homolog-independent mechanism. Cell 90: 87–96. 71. Frank-Vaillant M, Marcand S (2001) NHEJ regulation by mating type is exercised through a novel protein, Lif2p, essential to the ligase IV pathway. Genes Dev 15: 3005–3012. Nuclease Processing of BIR Intermediates PLOS Genetics | www.plosgenetics.org 18 September 2012 | Volume 8 | Issue 9 | e1002979