Purine homeostasis is necessary for developmental timing, germline maintenance and muscle integrity in caenorhabditis elegans

|INVESTIGATION Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans Roxane Marsac,* Benoît Pinson,* Christelle Saint-Marc,* María Olmedo, †,1 Marta Artal-Sanz, † Bertrand Daignan-Fornier,* and José-Eduardo Gomes* ,2 *Institut de Biochimie et Génétique Cellulaires, Université de Bordeaux and CNRS UMR5095, 33077 Bordeaux cedex, France and †Andalusian Center for Developmental Biology, Consejo Superior de Investigaciones Científicas/Junta de Andalucía/Universidad Pablo de Olavide, Department of Molecular Biology and Biochemical Engineering, 41013 Seville, Spain ORCID IDs: 0000-0003-2800-9288 (R.M.); 0000-0003-2936-9058 (B.P.); 0000-0002-5701-2665 (M.O.); 0000-0003-1126-0492 (M.A.-S.); 0000- 0003-2352-9700 (B.D.-F.); 0000-0001-7264-9448 (J.-E.G.) ABSTRACT Purine homeostasis is ensured through a metabolic network widely conserved from prokaryotes to humans. Purines can either be synthesized de novo, reused, or produced by interconversion of extant metabolites using the so-called recycling pathway. Although thoroughly characterized in microorganisms, such as yeast or bacteria, little is known about regulation of the purine biosynthesis network in metazoans. In humans, several diseases are linked to purine metabolism through as yet poorly understood etiologies. Particularly, the deficiency in adenylosuccinate lyase (ADSL)—an enzyme involved both in the purine de novo and recycling pathways—causes severe muscular and neuronal symptoms. In order to address the mechanisms underlying this deficiency, we established Caenorhabditis elegans as a metazoan model organism to study purine metabolism, while focusing on ADSL. We show that the purine biosynthesis network is functionally conserved in C. elegans. Moreover, adsl-1 (the gene encoding ADSL in C. elegans) is required for developmental timing, germline stem cell maintenance and muscle integrity. Importantly, these traits are not affected when solely the de novo pathway is abolished, and we present evidence that germline maintenance is linked specifically to ADSL activity in the recycling pathway. Hence, our results allow developmental and tissue specific phenotypes to be ascribed to separable steps of the purine metabolic network in an animal model. KEYWORDS ADSL deficiency; AICAR; metabolism; purine salvage pathway; SAICAR; SZMP; ZMP PURINE biosynthesis pathways ensure the production and homeostasis of AMP and GMP in the cell, and are widely conserved throughout evolution. The de novo pathway leads to the synthesis of inosine monophosphate (IMP) using 5-phosphoribosyl-1-pyrophosphate (PRPP) as a precursor. The recycling (salvage) pathway can then transform extant purines, including IMP, synthesized through the de novo pathway, to produce AMP and GMP (Figure 1A; reviewed in Ljungdahl and Daignan-Fornier 2012). Importantly, if available in the extracellular environment, purines can be recovered by specific transporters and subsequently metabolized through the recycling pathway, which requires much less energy expenditure. Indeed, purine synthesis through the de novo pathway requires the hydrolysis of six more molecules of ATP than purine synthesis through the recycling pathway. Imbalance in purine metabolism is involved in several diseases that have been extensively characterized, most of them associated with mutations in genes encoding enzymes involved in purine biosynthesis (reviewed in Nyhan 2005; Kelley and Andersson 2014). The genetics and biochemistry of purine biosynthesis are well established in unicellular organisms like bacteria or yeast, and are highly conserved. Nonetheless, how the disease-causing enzymatic deficiencies lead to the symptoms observed in patients remains elusive. It Copyright © 2019 by the Genetics Society of America doi: https://doi.org/10.1534/genetics.118.301062 Manuscript received April 23, 2018; accepted for publication January 24, 2019; published Early Online January 30, 2019. Supplemental material available at Figshare: https://doi.org/10.25386/genetics. 7642871. 1 Present address: Department of Genetics, University of Seville, 41012 Seville, Spain. 2 Corresponding author: Institut de Biochimie et Génétique Cellulaires, C.N.R.S. UMR5095 and Université de Bordeaux, CS 61390, Bordeaux, 33077 Bordeaux cedex, France. E-mail: [email protected] Genetics, Vol. 211, 1297–1313 April 2019 1297 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 is particularly challenging to untangle the contribution of shortage in the final products—AMP and GMP—from mutation-caused accumulation of intermediate metabolites in the pathway. For instance, ZMP (5-amino-4-imidazole carboxamide ribonucleotide monophosphate; Bochner and Ames 1982) and SZMP (succinyl-ZMP)—two intermediates of the purine de novo pathway (Figure 1)—are known to act as signal metabolites regulating gene expression transcriptionally in yeast (Pinson et al. 2009). Moreover, ZMP is known to activate AMPK (AMP activated kinase) by mimicking AMP (Jin et al. 2007), and SZMP has been shown to directly bind and interfere with pyruvate kinase activity in cancer cells (Keller et al. 2012). In addition, SAMP (succinyl-AMP)—an intermediate metabolite in the recycling pathway—has been shown to stimulate insulin secretion in pancreatic cells (Gooding et al. 2015). Hence SZMP, ZMP, or SAMP buildup could potentially disrupt homeostasis upon deficiencies in the enzymes using them as substrates, i.e., ADSL (SZMP and SAMP) and ATIC (ZMP, Figure 1A). Accordingly, mutations in the human genes encoding for these two enzymes are associated with ADSL deficiency and ATIC deficiency (a.k.a. AICAribosiduria), syndromes whose etiology remains unknown (Race et al. 2000; Marie et al. 2004; Spiegel et al. 2006; Jurecka et al. 2008, 2015; Zikanova et al. 2010). Adding to the complexity of the issue, ADSL catalyzes two different reactions, conversion of SZMP in ZMP in the de novo pathway, and conversion of SAMP in AMP—a step required for AMP synthesis whether coming from the de novo or from the recycling pathway (Figure 1A). This raises the question of which of the two steps is associated with ADSL deficiency phenotypes. In comparison with microorganisms, the study of purine metabolic deficiencies in patients faces yet other challenges. One such challenge is tissue specificity, as different tissues may require different levels of purines depending on their specialized function. For instance, in ADSL-deficiency patients, the most severe symptoms affect the muscles and the nervous system, suggesting these tissues have a larger requirement for purine metabolism, either for their function or during development. Another challenge is purine transport across tissues; the tissue affected by the deficiency not being necessarily the tissue where the enzyme is active. Moreover, purines can be available exogenously from the food source; therefore, the consequences of purine metabolism deficiencies are not necessarily caused by limiting amounts of purines. Finally, purine metabolism might be subject to different regulations throughout development, in which case the impairments observed could be the consequence of a requirement for purine regulation at a specific developmental stage. In order to address these issues, we sought to take advantage of C. elegans as a model organism. Through a genetic approach, we characterized deficiencies in the purine biosynthesis pathways, focusing our analysis on an ADSL-deficient mutant. Our goal was to establish the phenotypes associated with this enzymatic deficiency in order to uncover what functions, tissues, and developmental stages are affected. Given ADSL is required both in the de novo and recycling pathways, we performed a comparative analysis with ATIC and GPPAT deficiencies to dissect the contribution of the de novo vs. recycling pathways to the phenotypes observed. We established that ADSL deficiency strongly disrupts muscle integrity, postembryonic developmental timing and germline stem cell (GSC) maintenance. Importantly, neither abolishing the de novo purine synthesis pathway per se, nor the accumulation of de novo pathway intermediate metabolites ZMP and SZMP, has an impact on these traits. Furthermore, we found no essential requirement for the de novo pathway in C. elegans under standard laboratory conditions. Materials and Methods C. elegans strains and culture Nematodes were maintained under standard culture conditions (Brenner 1974; Stiernagle 2006), on nematode growth medium (NGM), with Escherichia coli (strain OP50) as food source, kept at 20°(except strains carrying the transgene ruIs32 [pie-1p::GFP::H2B + unc-119(+)], which were kept at 25°). The following C. elegans strains were used in the study: N2 (Bristol, wild-type reference strain) obtained from the Caenorhabditis Genetics Center (CGC), AZ212 ruIs32 [pie-1p:: GFP::H2B + unc-119(+)] III, CF1903 glp-1(e2141)III, PE254 feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V, VC2999 R151.2(gk3067)III/hT2 [bli-4(e937)let-?(q782) qIs48](I,III) - parental strain for the hT2 balancer, WBX52 adsl-1(tm3328)I/hT2 [bli-4(e937)let-?(q782)qIs48](I,III), WBX53 adsl-1(tm3328)I; ppat-1(tm6344)III/hT2 [bli- 4(e937)let-?(q782)qIs48]ppat-1(tm6344)(I,III) (from WBX119 and WBX52), WBX119 ppat-1(tm6344)III, WBX117 atic-1(tm6374)IV, WBX116 ppat-1(tm6344)III, atic-1(tm6374) IV (from WBX119 and WBX117); WBX124 atic-1(tm6374) IV; feIs4 [sur-5p::luciferase::GFP + rol- 6(su1006)] V (from PE254 and WBX116), WBX127 ppat- 1(tm6344) I; adsl-1(tm3328) III/hT2 [bli-4(e937)let-? (q782)qIs48]ppat-1(tm6344)(I,III); feIs4 [sur-5p:: luciferase::GFP + rol-6(su1006)] V (from PE254 and WBX53), WBX125 ppat-1(tm6344)III; atic-1(tm6374)IV; feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V(from PE254 and WBX116), WBX130 adsl-1(tm3328)I/hT2 [bli- 4(e937)let-?(q782)qIs48](I,III); feIs4 [sur-5p::luciferase:: GFP + rol-6(su1006)] V (PE254 and WBX53), WBX131 ppat-1(tm6344)III; feIs4 [sur-5p::luciferase::GFP + rol-6(su1006)] V (from PE254 and WBX116), WBX147 ppat-1(tm6344)ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III (from AZ212 and WBX119), WBX149 adsl-1(tm3328) I; ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III/hT2 [bli-4(e937)let-?(q782)qIs48](I,III) (from AZ212 and WBX52) and WBX152 adsl-1(tm3328)I; ppat-1(tm6344) ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III/hT2 [bli- 4(e937)let-?(q782)qIs48](I,III) (from WBX147 and WBX149). The adsl-1(tm3328),ppat-1(tm6344),and 1298 R. Marsac et al. Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 atic-1(tm6374)deletion alleles—referred to as adsl-1(D), ppat-1(D), and atic-1(D)throughout the manuscript—were generated by the laboratory of Shohei Mitani, National Bioresource Project (NBRP), Japan; all strains carrying these alleles used in this study were outcrossed a minimum of four times. Nematode synchronization: Adult worms were collected with M9 buffer in 15 ml conical tubes, centrifuged 1 min at 1000 rpm, and the supernatant was discarded. Worm bleach solution (1 M NaOH, 0.25 M NaOCl) was added until the carcasses dissolved and eggs were released (8 min). Eggs were washed three times with M9 buffer then transferred onto NGM seeded plates. RNAi: adsl-1 PCR fragment was amplified with oligomers 59- CTTCTTCCGGCAGAATCATCCAGTG-39and 59-TGACTGTCG GACGTACTCATTACC-39, and adss-1 PCR fragment was amplified with oligomers 59-GACGTCTTCCAACAAGACTGTGT CC-39and 59-ACGAGACGGCGATACTTCTCCGAG-39. Both fragments were inserted onto L4440 plasmid (EcoRV site) (Timmons and Fire 1998). For RNAi experiments, HT115 (DE3), bacteria transformed with either the adsl-1(RNAi) or adss-1(RNAi) feeding vectors, or L4440 plasmid (Control), were cultured overnight at 37°in LB 150 mg/liter Ampicillin and induced with 2 mM IPTG 1–2 hr prior seeding onto NGM 2 mM IPTG 150 mg/liter Ampicillin, in which synchronous populations of worms were cultured from hatching to adulthood (unless specified). Embryonic lethality in adsl-1(tm3328)/+ progeny: adsl-1 (tm338)/hT2 [bli-4(e937)let-?(q782)qIs48]hermaphrodites— expressing pharyngeal GFP—were crossed to N2 males. Non-GFP hermaphrodites in the progeny were selected as adsl-1(tm338)/+ and allowed to lay eggs, one worm per plate, for 24 hr. Upon removal of the adults plates were kept in culture for another 24 hr, upon which unhatched eggs were scored as dead embryos. Yeast heterologous rescue assay Yeast expression vectors were constructed by inserting fulllength cDNAs of ppat-1 (amplified using oligomers 59-CAC TAAATTACCGGATCAATTCGGGGGATCCATGTGTGGTATA TTTGGGATTG-39and 59-CATAACTAATTACATGATGCGGCC CTCCTGCAGTTATAAATCGATAGCAACTGG-39), adsl-1 (59- CGGGATCCGTATCATGGCCTCCGAAGACAAGT-39and 59- CCAATGCATGAATCAAACATCCAGCTGAACATTTCC-39), and atic-1b (59-GAAGATCTCGACGAATTGTGTGAAATGACCGAC -39and 59-ATAAGAATGCGGCCGCATCTAATGGTGGAAGAGA CGAAGTC-39) onto pCM189 plasmid (Garí et al. 1997). ade4D yeast strain, genotype ade4::KanMX4;his3D1;leu2D0;lys2D0; ura3D0, was used to test heterologous rescue by ppat-1, ade13Dyeast strain, genotype ade13::kanMX4;his3D;leu2D; ura3D, was used to test heterologous rescue by adsl-1 and ade16Dade17Ddouble mutant, genotype ade16::KanMX4; ade17::KanMX4;his3D1;leu2D0;ura3D0;lys2D0was used to test heterologous rescue with atic-1b. adsl-1(D) rescue A genomic fragment containing the adsl-1 reference allele, 1 kb upstream of the start codon and 1 kb downstream of the stop codon, was amplified by PCR using oligonucleotides 59-GCTCCCATGATATTCTACCG-39and 59-GAGGATT CAACGGTGCTTGCA-39, and as template the cosmid R06C7 (obtained from the Sanger Center). The PCR-amplified fragment was cloned onto pBluescript on the EcoRV site, we named this plasmid pRM01. The insert sequence was verified upon cloning. Transgenic lines were obtained by standard microinjection (Mello et al. 1991), adsl-1/+ animals were cotransformed with pRM01 at 1 or 5 ng/ml, pDD04 at 10 ng/ml as transformation marker—pDD04 expresses GFP in the pharynx, under the control of the myo-2 promotor (Giordano-Santini et al. 2010)—and pJM001 as carrier DNA at 30–90 ng/ml [a kind gift from Denis Dupuy, Institut Européen de Chimie et Biologie (IECB), Bordeaux, France]. Imaging For adult morphology, differential interference contrast (DIC) (also known as Nomarski) images were taken with a Leitz Diaplan microscope. Adult worms were mounted in M9 buffer, on a 2% agarose cushion. Images were acquired with a VisiCam 5.0 camera, analyzed, and processed with Fiji software. For imaging of the pie-1p::GFP::H2B germline reporter, synchronized adult worms were mounted in M9 Buffer 5 mM Levamisole onto a 2% agarose cushion. Images were acquired with an Olympus IX81 microscope under a 403oil- immersion objective, with a Hamamatsu Orca R2 camera. Images were analyzed with Fiji software. For size measurements, synchronized populations of young adult worms were used; each worm was measured three times on three different pictures. Images were acquired on a Nikon SMZ18 stereo microscope with VisiCam 5.0 camera, and analyzed and processed with Fiji software. Immunostaining Immunostaining was performed on synchronized populations of worms. N2 and de novo pathway mutants were fixed 72 hr after synchronization; adsl-1(D)and ppat-1(D);adsl-1(D) were fixed 96 hr after synchronization. The fixation protocol was adapted from Benian et al. (1996). Worms were collected in ice-cold PBS buffer in 1.5-ml tubes and centrifuged. The supernatant was discarded, and fixation solution was added (made fresh, 1 ml of MRBW buffer, 320 mM KCl, 80 mM NaCl, 40 mM EGTA, 20 mM spermidine, 60 mM Pipes was added to 2.8 ml of methanol and 200 ml of formaldehyde 20%), followed by five cycles of freezing in liquid N 2 and thawing, followed by 1 hr incubation at 4°with gentle agitation, fixation solution was replaced by a permeabilization solution (PBS, Triton X-100 2%, b-mercaptoethanol 1%) and incubated 1 hr at room temperature, permeabilization solution was renewed and incubated 1 hr at room temperature, followed by three washes in PBSt (PBS, 0.5% Triton X-100), after which worms were incubated with primary ADSL Deficiency in C. elegans 1299 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 antibody (diluted 1:1000 in PBSt 5% fetal calf serum) overnight at 4°with gentle agitation, washed three times in PBSt and incubated with secondary antibody (diluted 1:500 in PBSt 5%FCS). Monoclonal antibody 5–6 (Developmental Studies Hybridoma Bank) directed against muscle myosin was used as primary antibody, anti-mouse Alexa 555 (Molecular Probes) was used as secondary antibody, worms were mounted on Fluoroshield (Sigma). Images were acquired with a Leica DM6000 TCS SP5 confocal microscope using LAS AF (Leica) software. Metabolic profiling by HPLC For an extraction, 7500 young adult worms, 72 hr after synchronization, were collectedwithice-coldwaterinto 15 ml conical tubes, and centrifuged at 1000 rpm for 1minat4°; the supernatant was discarded, eliminating most bacteria. The nematode pellet was washed with 10 ml of cold 10 mM Hepes and centrifuged. The worm pellet was resuspended in 10 mM Hepes, 1 ml of worm suspension was transferred into 4 ml of absolute ethanol at 80°, incubated for 5 min and cooled on ice for 10 min. Samples were desiccated on a rotovapor apparatus; dry residue was resuspended in 350 ml of HyClone Molecular Biology-Grade Water (GE Healthcare) and centrifuged at 21,000 3g, 5 min at 4°. The supernatant was transferred and centrifuged again at 21,000 3g, 1 hr at 4°; this final supernatant was used for HPLC. Metabolites were separated by ionic chromatography on an ICS3000 chromatography station (Dionex, Sunnyvale, CA), and measured by an UV diode array (Ultimate 3000 RS; Dionex). Metabolites were separated on a carbopacPA1 column (250 32 mm; Dionex) using a sodium acetate gradient (Ceballos-Picot et al. 2015). Metabolite levels were normalized relative to dry weight; the same amount of worms used in the extractions were collected in ice-cold water, 72 hr after synchronization, centrifuged, washed five times with water, allowed to evaporate for 4 days at 70°and weighed. Lifespan Upon synchronization (see above), worms were grown on standard conditions until adulthood, whereupon they were transferred onto a new plate every 24 hr, and scored. Immobile worms unresponsive to touch were considered dead. Three replicate experiments were performed on different days, typically with three different plates per genotype, per replicate and 10–40 worms per plate. Locomotion and behavioral assays Locomotion speed measurement was adapted from Zheng et al. (1999), Hart (2006); images were acquired on a Leica Z16 APO Macroscope and processed with Fiji software. Worm displacement was measured by tracking the anterior pharynx position, once per second. For each recording, one single worm was placed on one intermediate plate without food, and then transferred onto the recorded plate 0.5 cm away from the bacterial food source, with the pharynx toward the bacteria lawn. Locomotion was recorded for 1 min, or until the worm reached the bacteria if it did so in ,1 min. Aldicarb (Sigma) and levamisole (Sigma) assays were performed as described in Gendrel et al. (2009). Synchronized adult worms were placed on 1 mM Aldicarb or 0.4 mM Levamisole plates for 2 hr, after which plates were tapped 10 times and worm movement was scored. Mechanosensory response assay was performed as described (Hobert et al. 1999; Hart 2006). Adult worms (72 hr after synchronization) were isolated on plates without food for 3 min, and stimulated with an eyelash on the posterior pharynx, and scored for avoidance behavior; each worm was stimulated and scored 10 times 3 min apart. Postembryonic development Postembryonic development was monitored as described by Olmedo et al. (2015). In brief, upon synchronization, 20 embryos per microliter were incubated in M9 buffer overnight with agitation, allowing L1 larvae to hatch. A single L1 larva was added per well to 96-well plates with S-Basal media, 10 g/liter E. coli OP50 (wet weight) and 100 mMD-Luciferin. The resulting luminescence was measured with a Berthold Centro LB960 XS 3 during 1 sec at 5-min intervals, within a temperature controlled Panasonic MIR-154 incubator. Statistics Statistical analysis was performed using Graphpad, Excel, Numbers, and R softwares. We considered statistical tests to be significant at P,0.01. Data availability Strains and plasmids are available upon request. The authors affirm that all data necessary for confirming the conclusions of the article are present within the article, figures, and tables. Supplemental material available at Figshare: https://doi.org/ 10.25386/genetics.7642871. Results The purine biosynthesis pathway is functionally conserved in C. elegans In order to establish C. elegans as a model to study purine metabolism, we first sought to investigate conservation of the purine biosynthesis network. We identified, through sequence homology, genes encoding the putative nematode enzymes involved in purine biosynthesis (Supplemental Material, Figure S1A). We found that both de novo and recycling pathways are conserved in C. elegans, as judged by sequence similarity. Specifically, for each enzyme, we identified one single ortholog in all but one case (three genes putatively encoding xanthine oxidase). Notably, in Saccharomyces cerevisiae, the histidine pathway contributes to the purine de novo pathway, ZMP being a byproduct of histidine synthesis (reviewed in Ljungdahl and Daignan-Fornier 2012). Consistent with the histidine pathway loss in worms previously 1300 R. Marsac et al. Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 reported (Payne and Loomis 2006), we found no C. elegans orthologs for yeast HIS1, HIS4, HIS6, and HIS7—required for ZMP synthesis through the histidine pathway; thus, ZMP is most likely synthesized exclusively through the purine de novo pathway. Given the sequence conservation, we undertook a functional analysis focusing on the ADSL enzyme, including ATIC andGPPAT forcomparison(seebelow).Importantly,sequence alignment showed that ADSL, ATIC, and GPPAT are highly conserved (Figure S2). The genes encoding ADSL, ATIC, and GPPAT in C. elegans were named adsl-1,atic-1,and ppat-1 (wormbase.org), respectively. We first tested whether those three C. elegans genes were functionally conserved using an heterologous rescue assay. We transformed yeast S. cerevisiae ade13D,ade16Dade17D, and ade4Dmu- tants with plasmids containing the wild-type sequences of the Figure 1 Purine metabolism in C. elegans. (A) Schematics of the purine biosynthesis pathways in C. elegans based on sequence homology. Enzymes subjected to functional analysis are represented in red, other enzymes in green, and metabolites in black. (B) Drop test to assess adenine auxotrophy in yeast S. cerevisiae mutants deficient for enzymes ADSL (ade13D), ATIC (ade16Dade17D), or GPPAT (ade4D) expressing C. elegans genes adsl-1,atic-1b and ppat-1, respectively. Expression of S. cerevisiae genes ADE13,ADE17, and ADE4 was used as positive control, and expression vector without insert as negative control. A culture with adenine is shown as auxotrophy control. In all drop tests presented, four drops are shown per condition, corresponding to serial dilutions (1:10) of cellular suspensions, with deceasing cell concentrations from left to right. (C) Zoom in on HPLC chromatogram peaks of specific metabolites SAICAR (SZMP riboside form), SZMP, sAdo (succinyladenosine, SAMP riboside form), SAMP, ATP, and GTP, upon adsl-1(RNAi) and ppat-1(D);adsl- 1(RNAi). (D) Zoom in on HPLC chromatogram peaks of specific metabolites SAICAR (SZMP riboside form), SZMP, AICAR (ZMP riboside form), ZMP, ATP, and GTP, in atic- 1(D)andppat-1(D);atic-1(D).Ade, adenine; Ado, adenosine; SAdo, succinyl-adenosine; Ino, Inosine; Hypox, hypoxantine; Xant, Xantine; Gua, guanine; Guo, guanosine. In (C) and (D), scales are adjusted differently among metabolites, in order to highlight differences between genotypes. ADSL Deficiency in C. elegans 1301 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 predicted C. elegans homologous genes adsl-1,atic-1, and ppat-1, respectively. Expression of adsl-1 restored adenine prototrophy of ade13Dyeast (Figure 1B); likewise, expression of splicing isoform atic-1b restored adenine prototrophy of the ade16Dade17Ddouble mutant (Figure 1B). These results confirm that adsl-1 encodes the ADSL enzyme and that atic-1 encodes the ATIC enzyme. By contrast, expression of ppat-1 alone was not sufficient to restore adenine prototrophy of yeast ade4D(Figure 1B). Thus, in our heterologous rescue assay, we could neither confirm nor rule out whether ppat-1 encodes the GPPAT enzyme. We next tested functional conservation of ADSL, ATIC, and GPPAT activities in vivo. For our functional analysis, we used deletion mutant alleles, putative genetic nulls, henceforth referred to as adsl-1(D),atic-1(D), and ppat-1(D)(see Materials and Methods). One would predict accumulation of ADSL substrates SZMP and SAMP upon adsl-1 loss-of-function as well as ZMP buildup in atic-1(D), and no detectable de novo pathway intermediate metabolites in ppat-1(D)(Figure S1B). To test these hypotheses, we performed worm metabolic profiling by HPLC (Figure S1C). We observed a consistent accumulation of SZMP and its riboside form SAICAR upon adsl-1(RNAi), as well as a robust accumulation of SAMP, and its riboside form SAdo (Figure 1C), while neither metabolite was detected in the wild-type (N2) reference strain. Hence, both de novo and recycling pathways are functionally conserved in C. elegans, and adsl-1 is required for ADSL activity in vivo. Furthermore, we observe a modest but consistent accumulation of ZMP both in atic-1(D) mutants (Figure 1D), as well as atic-1(RNAi) animals (not shown), demonstrating that atic-1 encodes ATIC enzyme. The accumulation of SZMP and ZMP in adsl-1(RNAi) and atic-1(D)was rather modest. By contrast, we observed a robust accumulation of SAMP in adsl-1(RNAi). These results suggest that C. elegans purine biosynthesis relies mostly on the recycling pathway, at least in standard culture conditions. Notably, ATP levels are slightly lower in adsl-1(RNAi) compared to wild-type (Figure 1C). Otherwise the abundance of ATP and GTP were not severely affected in the deficiencies analyzed. As to the conservation of GPPAT, the HPLC analysis provided crucial functional evidence: SZMP was not detected in ppat-1(D);adsl-1(RNAi) (Figure 1C), nor was ZMP detected in ppat-1(D);atic-1(D)(Figure 1D), or ppat-1(D);atic-1(RNAi) (not shown). This demonstrates that the ppat-1 gene is indeed required for purine synthesis through the de novo pathway. Noteworthy, SAMP accumulation in ppat-1(D);adsl-1(RNAi) is similar to adsl-1(RNAi) alone, providing an internal control for RNAi efficiency and further confirming that SZMP accumulation in adsl-1(RNAi) is dependent on ppat-1.Insummary,our metabolic profiling validates functional conservation of ADSL and ATIC, and demonstrates that ppat-1 is required for the de novo pathway, consistent with the prediction that it encodes the GPPAT enzyme in C. elegans. Functional analysis of adsl-1 Because SZMP and SAMP are known to function as regulatory metabolites in other organisms (Rebora et al. 2001; Pinson et al. 2009; Keller et al. 2014; Gooding et al. 2015), and because they may play an important role in the etiology of the ADSL deficiency, we focused our functional analysis on adsl-1. In order to distinguish the effects of SZMP buildup from those due to the loss of de novo purine synthesis, we further include ppat-1 in our analysis. Moreover, in order to distinguish the effect of ADSL activity strictly in the de novo pathway, converting SZMP to ZMP, from the activity in converting SAMP to AMP, for comparison we used ATIC-deficient worms. ATIC participates only in the de novo pathway accumulating ZMP, which shares some targets with SZMP, at least in yeast (Rebora et al. 2001; Pinson et al. 2009). Finally, in order to test whether phenotypes observed in adsl-1(D)were due to SZMP buildup, we performed a systematic epistasis analysis of the ppat-1(D);adsl-1(D)double mutant. Similarly, to test whether phenotypes in the atic-1(D)mutant were caused by ZMP accumulation, we performed epistasis in the ppat-1(D);atic-1(D)double mutant. Throughout the manuscript, we refer collectively to all three single mutant animals plus the ppat-1(D);adsl-1(D)and ppat-1(D);atic-1(D)double mutants as “purine mutants”, and to ppat-1(D),atic-1(D) single mutants and ppat-1(D);atic-1(D)double mutant animals as “de novo”pathway mutants. adsl-1 is required for the maintenance of GSCs The adsl-1(D)homozygous animals display striking morphological defects. They are noticeably smaller than wild type, sterile, and often present a protruding vulva (Figure 2A). We observe a complete absence of oocytes and sperm cells in adsl-1(D)and ppat-1(D);adsl-1(D)worms. Only a reduced number of nuclei morphologically resembling GSCs are detectable near the vulva, where the germline distal tip cell is found in wild-type animals (Figure S3A). By contrast, de novo pathway mutants are viable and fertile, and the overall morphology is similar to wild-type worms. To better characterize the GSCs phenotype, we used a germline-specific reporter transgene expressing H2B::GFP fusion in the GSCs, under the control of the pie-1 promoter (Praitis et al. 2001). While in ppat-1(D)single mutants, the germline is indistinguishable from wild type, in adsl-1(D)and ppat-1(D);adsl-1(D)animals, sterility is fully penetrant and the germline is barely detectable, if at all (Figure 2B). Indeed we observed that 52.2% of adsl-1(D)(n= 23) and 52% of ppat-1(D);adsl- 1(D)animals (n= 25) had no detectable H2B::GFP, 43.5% of adsl-1(D)and 44% of ppat-1(D);adsl-1(D)had #10 H2B::GFP positive nuclei, and 4.3% of adsl-1(D)and 4% of ppat-1(D);adsl-1(D)had barely .10 H2B::GFP positive nuclei. Hence, adsl-1 is required for proliferation and/or maintenance of GSCs independently of ppat-1. It has been shown that sterility associated with a deficiency in the pyrimidine recycling pathway could be rescued by supplementation of the culture medium with pyrimidine 1302 R. Marsac et al. Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 Figure 2 Developmental defects in purine mutants. (A) DIC whole body images of representative young adults for each of the genotypes studied (Bar, 200 mm). (B) Fluorescence micrographs of worms expressing H2B::GFP in the germline under the control of the pie-1 promoter. Arrows point at rare germ nuclei expressing H2B::GFP; spotty pattern throughout adsl-1(D)and ppat-1(D);adsl-1(D)corresponds to intestinal auto-fluorescence (Bar, 25 mm). (C) Tukey box plot depicting body length of all purine mutants and glp-1(2)for comparison (means statistically different—one-way ANOVA—indicated Pvalues refer to comparison with wild-type—Bonferroni multiple comparison t-test—otherwise comparison to wild type bears no significant difference; n=30forall genotypes). ADSL Deficiency in C. elegans 1303 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 nucleosides (Chi et al. 2016). Thus, we tested whether supplementation with purine nucleosides could rescue adsl-1(D) sterility. When cultured with 20 mM adenosine (Ado in Figure 1A) in the medium from hatching until adulthood, both adsl-1(D)(n= 55) and ppat-1(D);adsl-1(D)(n= 54) were sterile, much like the nonsupplemented controls (n= 80 and n= 88, respectively). As expected, 100 mM inosine (Ino in Figure 1A) supplementation had no effect on adsl-1(D)(n= 28) or ppat-1;adsl-1(D)(n= 64) sterility. Under the same conditions, wild-type (20 mM adenosine n= 86; 100 mM inosine n= 99) and ppat-1(D)(20 mM adenosine n= 76; 100 mM inosine n= 100) worms were fertile, to the same extent as nontreated controls [wild type n= 116; ppat-1(D)n = 114]. We further tested whether adenosine supplementation could rescue adsl-1 partial loss of function. When we performed adsl-1(RNAi) with 20 mM adenosine in the culture medium, we observed 30.8% sterility (n= 182) compared to 17.0% in absence of adenosine supplementation (n= 141), while mock RNAi produced 0% sterility, in both 20 mM adenosine or no adenosine supplementation (n= 101 and n= 103 respectively). In summary, we found no evidence that purine supplementation in the culture medium allows to recover the GSCs defects of adsl-1(D). As mentioned above, the de novo pathway mutants present a germline undistinguishable from wild type, in contrast to the complete sterility of adsl-1(D).InC. elegans, adult hermaphrodites reproduce through self-fertilization, with the number of progeny being modulated by food source and metabolic status (Houthoofd et al. 2002; Watson et al. 2014). In order to investigate whether the de novo pathway could impact the level of fertility, we measured total number of eggs laid by ppat-1(D),atic-1(D), and ppat-1(D);atic-1(D)hermaphrodites throughout their reproductive life. We observed that ppat-1(D)fertility is in the wild-type range, while atic-1(D)fertility is significantly lower (Figure S3B). Importantly, ppat-1(D)is epistatic to atic-1(D)regarding fertility, suggesting that ZMP accumulation, rather than de novo pathway impairment, might reduce fertility. To test this hypothesis, we cultured ppat-1(D); atic-1(D)in the presence of ZMP precursor AICAR (0.1 mM); under these conditions internal ZMP builds up (see below). Consistent with our hypothesis, we observed reduced fertility in ppat-1(D);atic-1(D)treated with AICAR compared to the control (Figure S3B). Furthermore, wild-type worms cultured with 0.5 mM AICAR also displayed reduced fertility. We conclude that ZMP buildup in atic-1(D)causes reduced fertility, while the de novo pathway per se has no impact on this phenotype, as ppat-1(D)is similar to wild type. Taken together, these data show that adsl-1 is essential for germline integrity, while de novo pathway genes ppat-1 and atic-1 are dispensable. The strong germline defects in adsl-1(D)prompted us to investigate whether adsl-1 is required during early embryonic development. We therefore examined the viability of ADSL deficient embryos. adsl-1(D)sterility precludes the analysis of homozygous embryos devoid of maternal contribution. We first analyzed zygotic requirement by examining the progeny of adsl-1(D)/+ heterozygotes (see Materials and Methods); if adsl-1 zygotic expression were strictly essential in the embryo, one would expect no adsl-1(D)homozygous progeny, and a Mendelian 25% proportion of embryonic lethality; instead, we observed only 7.7% of dead embryos. Therefore, either adsl-1 is not essential for embryo development or maternal contribution is, at least in part, sufficient. To further investigate adsl-1 function in the early embryo, we used RNAi, which depletes maternally expressed mRNAs. Because adsl-1 full penetrant loss-of-function leads to sterility, we performed adsl-1(RNAi) knockdown, starting at the L4 stage—resulting in a partial loss-of-function. Under these conditions, we observed 32.2% embryonic lethality in adsl- 1(RNAi) (Figure S3C), suggesting that adsl-1 is required for embryonic development, and that maternal expression contributes to adsl-1 function at this stage. To test whether the de novo pathway is necessary for embryo development, we performed adsl-1(RNAi) in the ppat-1(D), resulting in 31.5% embryonic lethality. The observation that ppat-1(D)does not enhance the adsl-1(RNAi) hypomorphic phenotype suggests that the de novo pathway does not contribute to embryonic development (see below). Consistent with this hypothesis, de novo pathway mutants display an embryonic development indistinguishable from that of wild type; just as in wild-type controls, 100% of the eggs laid hatched in all de novo pathway mutants. Thus, adsl-1 function in the recycling pathway is required for proper embryonic development. adsl-1(D) leads to small body size phenotype The overall morphology observed in adsl-1(D)and ppat-1(D); adsl-1(D)[morphologically indistinguishable from adsl-1(D) single mutants] suggests that cell lineage specification and morphogenesis are not affected. No defects were observed in somatic tissues of adsl-1(D)other than the vulva, including pharynx, intestine, or hypodermis, and animals were viable and mobile. Hence, the smaller size does not seem to result from defects in fate specification. To better characterize this phenotype, we measured body length in adult worms. adsl- 1(D)are significantly smaller than wild type and similar to ppat-1(D);adsl-1(D), while de novo mutants are indistinguishable from wild type (Figure 2C). Given the volume occupied by the germline in adult C. elegans, we wondered whether sterility could account for the small size in adsl- 1(D). We therefore compared adsl-1(D)to glp-1(e2141)mutants, which are known to lack a germline when cultured at 25°(Priess et al. 1987). Given that adult glp-1(e2141)length is in the wild-type range (Figure 2C), sterility cannot account for the small size of adsl-1(D). Notably, newly hatched adsl- 1(D)animals are the same size as wild-type, and morphologically indistinguishable (not shown); hence, size defects are likely to manifest during postembryonic development. We conclude that adsl-1 is required for adult body size independently of the sterility phenotype. By contrast, deficiencies in GPPAT or ATIC in the de novo pathway do not affect this trait. 1304 R. Marsac et al. Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 adsl-1 is required for normal developmental timing and lifespan The small size of adsl-1(D)prompted us to investigate whether postembryonic development was impaired. Given that newly hatched adsl-1(D)are indistinguishable from wild type, we hypothesized the growth defects were linked to abnormal larval development. Upon hatching, and before adulthood, C. elegans goes through four larval stages, each followed by an inactive state known as lethargus during which a molt takes place (Cassada and Russell 1975). Importantly, this sequence follows a highly reproducible timing under standard culture conditions (Byerly et al. 1976). We therefore measured timing of postembryonic development in purine mutants, using the method described by Olmedo et al. (2015). Briefly, newly hatched L1 larvae carrying a transgenic luciferase are cultured in the presence of luciferin, emitting luminescence when active (Lagido et al. 2008). Since larvae cease feeding during lethargus, they stop taking the substrate and a drastic drop in luminescence is observed. Therefore, monitoring the luminescence of individual larvae allows to precisely time the occurrence of each larval (high luminescence) and lethargus (low luminescence) phase (Figure S4A; Olmedo et al. 2015). We observed that both adsl-1(D) and ppat-1(D);adsl-1(D)present strongly delayed postembryonic development (Figure 3A and Figure S4B). Although all larval and lethargus phases are affected in adsl-1(D)mutants, the delay is more pronounced as postembryonic development progresses. By contrast, the overall timing of postembryonic development is not affected in de novo pathway mutants. We therefore conclude that adsl-1 is required for normal postembryonic developmental timing, whereas de novo pathway genes ppat-1 and atic-1 are not. Postembryonic development, metabolism, and the germline are all known to impact lifespan in C. elegans (reviewed in Antebi 2013). Because of adsl-1(D)sterility and developmental delay we measured the lifespan of the purine mutants. adsl-1(D)mutant has a shorter lifespan than wild type (Figure 3B). By contrast, the de novo pathway mutants’lifespan is indistinguishable from wild type (Figure 3B). Importantly, ppat-1(D)suppresses the adsl-1(D)short-lifespan phenotype as ppat-1(D);adsl-1(D)double mutant survival profile is in the wild-type range (Figure 3B). These results strongly suggest that SZMP buildup in adsl-1(D), rather than ADSL activity per se, is responsible for the reduced lifespan. Moreover, we conclude that the developmental delay and sterility of adsl-1(D)are not linked to lifespan. Ascribing adsl-1(D) phenotypes to the de novo vs. recycling pathway Most of defects we observed in adsl-1(D)—germline, vulva, adult size, embryonic and postembryonic development—are not observed in ppat-1(D)or atic-1(D)mutants, suggesting that the ADSL activity of converting SAMP to AMP is the cause of these phenotypes. However, the question of the relative contributions of the de novo and recycling pathways remains open as SAMP to AMP conversion by ADSL has the peculiarity of being required for the synthesis of AMP both through the de novo and recycling pathways (as is the IMP to SAMP conversion by ADSS, Figure 1). Thus, two hypotheses can explain the adsl-1(D)defects regarding SAMP to AMP conversion: either these defects are linked to the recycling but not the de novo pathway, or both the recycling and the de novo pathways contribute redundantly to the phenotypes, such that, in ppat-1(D)mutants, the recycling pathway can compensate for the absence of the de novo pathway. Given that ADSL functions both in the de novo and recycling pathways, the putative null adsl-1(D)does not allow us to discriminate between de novo and recycling pathway Figure 3 Life traits in purine mutants. (A) Graph depicting duration of postembryonic developmental stages, white bars represent larval stages, from L1 to L4 (left to right), orange bars represent lethargus phases consecutive to each larval stage (mean durations of larval development, from t0 until exit from fourth lethargus phase, are statistically different—one-way ANOVA—indicated Pvalues refer to comparison with wild type—Bonferroni multiple comparison t-test—otherwise comparison to wild type bears no significant difference; see detailed representation of the data in Figure S4). (B) Graph depicting fraction of live worms over time for all genotypes studied (Pvalue indicated for the adsl-1(D) vs. wild type comparison, all other genotypes are not significantly different from wild type are significantly different from adsl-1(D)—log rank test with Bonferroni correction; total combined of three independent experiments for each genotype [wild type n= 106, ppat-1(D)n= 91, atic-1(D)n= 126, ppat-1(D);atic-1(D)n= 149, adsl-1(D) n= 227, ppat-1(D);adsl-1(D)n = 113]. ADSL Deficiency in C. elegans 1305 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 elegans molting and developmental timing. G3 (Bethesda) 6: 4077–4086. https://doi.org/10.1534/g3.116.034165 Flavel, M. R., A. Mechler, M. Shahmiri, E. R. Mathews, A. E. Franks et al., 2018 Growth of Caenorhabditis elegans in defined media is dependent on presence of particulate matter. G3 (Bethesda) 8: 567–575. https://doi.org/10.1534/g3.117.300325 Fleming, J. T., M. D. Squire, T. M. Barnes, C. Tornoe, K. Matsuda et al., 1997 Caenorhabditis elegans levamisole resistance genes lev-1,unc-29, and unc-38 encode functional nicotinic acetylcholine receptor subunits. J. Neurosci. 17: 5843–5857. https://doi. org/10.1523/JNEUROSCI.17-15-05843.1997 Garí, E., L. Piedrafita, M. Aldea, and E. Herrero, 1997 A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13: 837–848. https://doi.org/10.1002/(SICI)1097-0061(199707)13:9, 837::AID-YEA145.3.0.CO;2-T Gendrel, M., G. Rapti, J. E. Richmond, and J. L. Bessereau, 2009 A secreted complement-control-related protein ensures acetylcholine receptor clustering. Nature 461: 992–996. https://doi.org/ 10.1038/nature08430 Giordano-Santini, R., S. Milstein, N. Svrzikapa, D. Tu, R. Johnsen et al., 2010 An antibiotic selection marker for nematode transgenesis. Nat. Methods 7: 721–723. https://doi.org/10.1038/ nmeth.1494 Gooding, J. R., M. V. Jensen, X. Dai, B. R. Wenner, D. Lu et al., 2015 Adenylosuccinate is an insulin secretagogue derived from glucose-induced purine metabolism. Cell Rep. 13: 157– 167. https://doi.org/10.1016/j.celrep.2015.08.072 Hansen, D., and T. Schedl, 2013 Stem cell proliferation vs. meiotic fate decision in Caenorhabditis elegans. Adv. Exp. Med. Biol. 757: 71–99. https://doi.org/10.1007/978-1-4614-4015-4_4 Hart, A. C., 2006 Behavior (July 3, 2006), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.87.1, http://www.wormbook.org. Hobert, O., D. G. Moerman, K. A. Clark, M. C. Beckerle, and G. Ruvkun, 1999 A conserved LIM protein that affects muscular adherens junction integrity and mechanosensory function in Caenorhabditis elegans. J. Cell Biol. 144: 45–57. https://doi. org/10.1083/jcb.144.1.45 Houthoofd, K., B. P. Braeckman, I. Lenaerts, K. Brys, A. De Vreese et al., 2002 Axenic growth up-regulates mass-specific metabolic rate, stress resistance, and extends life span in Caenorhabditis elegans. Exp. Gerontol. 37: 1371–1378. https://doi.org/ 10.1016/S0531-5565(02)00173-0 Hubbard, E. J., D. Z. Korta, and D. Dalfó, 2013 Physiological control of germline development. Adv. Exp. Med. Biol. 757: 101–131. https://doi.org/10.1007/978-1-4614-4015-4_5 Jaeken, J., S. K. Wadman, M. Duran, F. J. van Sprang, F. A. Beemer et al., 1988 Adenylosuccinase deficiency: an inborn error of purine nucleotide synthesis. Eur. J. Pediatr. 148: 126–131. https://doi.org/10.1007/BF00445919 Ji, Y., and D. V. Clark, 2006 The purine synthesis gene Prat2 is required for Drosophila metamorphosis, as revealed by invertedrepeat-mediated RNA interference. Genetics 172: 1621–1631. https://doi.org/10.1534/genetics.105.045641 Jin, X., R. Townley, and L. Shapiro, 2007 Structural insight into AMPK regulation: ADP comes into play. Structure 15: 1285– 1295. https://doi.org/10.1016/j.str.2007.07.017 Jurecka, A., M. Zikanova, A. Tylki-Szymanska, J. Krijt, A. Bogdanska et al., 2008 Clinical, biochemical and molecular findings in seven Polish patients with adenylosuccinate lyase deficiency. Mol. Genet. Metab. 94: 435–442. https://doi.org/10.1016/j. ymgme.2008.04.013 Jurecka, A., M. Zikanova, S. Kmoch, and A. Tylki-Szymańska, 2015 Adenylosuccinate lyase deficiency. J. Inherit. Metab. Dis. 38: 231–242. https://doi.org/10.1007/s10545-014- 9755-y Keller, K. E., I. S. Tan, and Y.-S. Lee, 2012 SAICAR stimulates pyruvate kinase isoform M2 and promotes cancer cell survival in glucose-limited conditions. Science 338: 1069–1072. https:// doi.org/10.1126/science.1224409 Keller, K. E., Z. M. Doctor, Z. W. Dwyer, and Y.-S. Lee, 2014 SAICAR induces protein kinase activity of PKM2 that is necessary for sustained proliferative signaling of cancer cells. Mol. Cell 53: 700–709. https://doi.org/10.1016/j.molcel. 2014.02.015 Kelley, R. E., and H. C. Andersson, 2014 Disorders of purines and pyrimidines. Handb. Clin. Neurol. 120: 827–838. https://doi. org/10.1016/B978-0-7020-4087-0.00055-3 Kimble, J., and S. L. Crittenden, 2005 Germline proliferation and its control (August 15, 2005), WormBook, ed. The C. elegans Research Community, WormBook, doi/10.1895/wormbook.1.13.1, http://www.wormbook.org. Lagido, C., J. Pettitt, A. Flett, and L. A. Glover, 2008 Bridging the phenotypic gap: real-time assessment of mitochondrial function and metabolism of the nematode Caenorhabditis elegans. BMC Physiol. 8: 7. https://doi.org/10.1186/1472-6793-8-7 Lewis, J. A., C. H. Wu, H. Berg, and J. H. Levine, 1980 The genetics of levamisole resistance in the nematode Caenorhabditis elegans. Genetics 95: 905–928. Ljungdahl, P. O., and B. Daignan-Fornier, 2012 Regulation of amino acid, nucleotide, and phosphate metabolism in Saccharomyces cerevisiae. Genetics 190: 885–929. https://doi. org/10.1534/genetics.111.133306 MacNeil, L. T., E. Watson, H. E. Arda, L. J. Zhu, and A. J. Walhout, 2013 Diet-induced developmental acceleration independent of TOR and insulin in C. elegans. Cell 153: 240–252. https:// doi.org/10.1016/j.cell.2013.02.049 Malmanche, N., and D. V. Clark, 2004 Drosophila melanogaster Prat, a purine de novo synthesis gene, has a pleiotropic maternal-effect phenotype. Genetics 168: 2011–2023. https://doi. org/10.1534/genetics.104.033134 Marie, S., B. Heron, P. Bitoun, T. Timmerman, G. Van den Berghe et al., 2004 AICA-ribosiduria: a novel, neurologically devastating inborn error of purine biosynthesis caused by mutation of ATIC. Am. J. Hum. Genet. 74: 1276–1281. https://doi.org/ 10.1086/421475 Matecic, M., D. L. Smith, X. Pan, N. Maqani, S. Bekiranov et al., 2010 A microarray-based genetic screen for yeast chronological aging factors. PLoS Genet. 6: e1000921. https://doi.org/ 10.1371/journal.pgen.1000921 Mello, C. C., J. M. Kramer, D. Stinchcomb, and V. Ambros, 1991 Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO J. 10: 3959–3970. https://doi.org/10.1002/j.1460-2075.1991. tb04966.x Monsalve, G. C., and A. R. Frand, 2012 Toward a unified model of developmental timing: a “molting”approach. Worm 1: 221– 230. https://doi.org/10.4161/worm.20874 Monsalve, G. C., C. Van Buskirk, and A. R. Frand, 2011 LIN-42/ PERIOD controls cyclical and developmental progression of C. elegans molts. Curr. Biol. 21: 2033–2045. https://doi.org/ 10.1016/j.cub.2011.10.054 Moreno-Arriola, E., M. El Hafidi, D. Ortega-Cuéllar, and K. Carvajal, 2016 AMP-activated protein kinase regulates oxidative metabolism in Caenorhabditis elegans through the NHR-49 and MDT- 15 transcriptional regulators. PLoS One 11: e0148089. https:// doi.org/10.1371/journal.pone.0148089 Narkar, V. A., M. Downes, R. T. Yu, E. Embler, Y.-X. Wang et al., 2008 AMPK and PPARd agonists are exercise mimetics. Cell 134: 405–415. https://doi.org/10.1016/j.cell.2008.06.051 Nyhan, W. L., 2005 Disorders of purine and pyrimidine metabolism. Mol. Genet. Metab. 86: 25–33. https://doi.org/10.1016/j. ymgme.2005.07.027 1312 R. Marsac et al. Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022 Oburoglu, L., S. Tardito, V. Fritz, S. C. de Barros, P. Merida et al., 2014 Glucose and glutamine metabolism regulate human hematopoietic stem cell lineage specification. Cell Stem Cell 15: 169–184 (erratum: Cell Stem Cell 15: 666–668). https://doi. org/10.1016/j.stem.2014.06.002 Olmedo, M., M. Geibel, M. Artal-Sanz, and M. Merrow, 2015 A high-throughput method for the analysis of larval developmental phenotypes in Caenorhabditis elegans. Genetics 201: 443– 448. https://doi.org/10.1534/genetics.115.179242 Payne, S. H., and W. F. Loomis, 2006 Retention and loss of amino acid biosynthetic pathways based on analysis of whole-genome sequences. Eukaryot. Cell 5: 272–276. https://doi.org/10.1128/ EC.5.2.272-276.2006 Pinson, B., S. Vaur, I. Sagot, F. Coulpier, S. Lemoine et al., 2009 Metabolic intermediates selectively stimulate transcription factor interaction and modulate phosphate and purine pathways. Genes Dev. 23: 1399–1407. https://doi.org/10.1101/ gad.521809 Praitis, V., E. Casey, D. Collar, and J. Austin, 2001 Creation of lowcopy integrated transgenic lines in Caenorhabditis elegans. Genetics 157: 1217–1226. Priess, J. R., H. Schnabel, and R. Schnabel, 1987 The glp-1 locus and cellular interactions in early C. elegans embryos. Cell 51: 601–611. https://doi.org/10.1016/0092-8674(87)90129-2 Race, V., S. Marie, M. F. Vincent, and G. Van den Berghe, 2000 Clinical, biochemical and molecular genetic correlations in adenylosuccinate lyase deficiency. Hum. Mol. Genet. 9: 2159– 2165. https://doi.org/10.1093/hmg/9.14.2159 Rebora, K., C. Desmoucelles, F. Borne, B. Pinson, and B. Daignan- Fornier, 2001 Yeast AMP pathway genes respond to adenine through regulated synthesis of a metabolic intermediate. Mol. Cell. Biol. 21: 7901–7912. https://doi.org/10.1128/MCB.21.23.7901- 7912.2001 Rebora, K., B. Laloo, and B. Daignan-Fornier, 2005 Revisiting purine-histidine cross-pathway regulation in Saccharomyces cerevisiae: a central role for a small molecule. Genetics 170: 61–70. https://doi.org/10.1534/genetics.104.039396 Rodríguez-Palero, M. J., A. López-Díaz, R. Marsac, J. E. Gomes, M. Olmedo et al., 2018 An automated method for the analysis of food intake behaviour in Caenorhabditis elegans. Sci. Rep. 8: 3633. https://doi.org/10.1038/s41598-018-21964-z Rougvie, A. E., and E. G. Moss, 2013 Developmental transitions in C. elegans larval stages. Curr. Top. Dev. Biol. 105: 153–180. https://doi.org/10.1016/B978-0-12-396968-2.00006-3 Samuel, B. S., H. Rowedder, C. Braendle, M. A. Félix, and G. Ruvkun, 2016 Caenorhabditis elegans responses to bacteria from its natural habitats. Proc. Natl. Acad. Sci. USA 113: E3941– E3949. https://doi.org/10.1073/pnas.1607183113 Spiegel,E.K.,R.F.Colman,andD.Patterson,2006 Adenylosuccinate lyase deficiency. Mol. Genet. Metab. 89: 19–31. https://doi.org/ 10.1016/j.ymgme.2006.04.018 Stenesen, D., J. M. Suh, J. Seo, K. Yu, K.-S. Lee et al., 2013 Adenosine nucleotide biosynthesis and AMPK regulate adult life span and mediate the longevity benefit of caloric restriction in flies. Cell Metab. 17: 101–112. https://doi.org/ 10.1016/j.cmet.2012.12.006 Stiernagle, T., 2006 Maintenance of C. elegans (February 11, 2006), WormBook,ed.TheC. elegans Research Community, Worm- Book, doi/10.1895/wormbook.1.101.1, http://www.wormbook.org. Tardito, S., A. Oudin, S. U. Ahmed, F. Fack, O. Keunen et al., 2015 Glutamine synthetase activity fuels nucleotide biosynthesis and supports growth of glutamine-restricted glioblastoma. Nat. Cell Biol. 17: 1556–1568. https://doi.org/10. 1038/ncb3272 Timmons, L., and A. Fire, 1998 Specific interference by ingested dsRNA. Nature 395: 854. https://doi.org/10.1038/27579 Vrablik, T. L., L. Huang, S. E. Lange, and W. Hanna-Rose, 2009 Nicotinamidase modulation of NAD+ biosynthesis and nicotinamide levels separately affect reproductive development and cell survival in C. elegans. Development 136: 3637–3646. https://doi.org/10.1242/dev.028431 Watson, E., L. T. MacNeil, A. D. Ritter, L. S. Yilmaz, A. P. Rosebrock et al., 2014 Interspecies systems biology uncovers metabolites affecting C. elegans gene expression and life history traits. Cell 156: 759–770 (erratum: Cell 156: 1336–1337). https://doi. org/10.1016/j.cell.2014.01.047 Zheng, Y., P. J. Brockie, J. E. Mellem, D. M. Madsen, and A. V. Maricq, 1999 Neuronal control of locomotion in C. elegans is modified by a dominant mutation in the GLR-1 ionotropic glutamate receptor. Neuron 24: 347–361. https://doi.org/10.1016/ S0896-6273(00)80849-1 Zikanova, M., V. Skopova, A. Hnizda, J. Krijt, and S. Kmoch, 2010 Biochemical and structural analysis of 14 mutant ADSL enzyme complexes and correlation to phenotypic heterogeneity of adenylosuccinate lyase deficiency. Hum. Mutat. 31: 445–455. https://doi.org/10.1002/humu.21212 Communicating editor: B. Grant ADSL Deficiency in C. elegans 1313 Downloaded from https://academic.oup.com/genetics/article/211/4/1297/5931512 by Universidad de Sevilla user on 16 May 2022