Genómica funcional del metabolismo del nitrógeno en relación con la fotorrespiración y estrés abiótico en plantas de Lotus Japonicus

Genómica Funcional del Metabolismo del Nitrógeno en relación con la fotorrespiración y estrés abiótico en plantas de Lotus japonicus. Carmen María Pérez Delgado de Torres. Sevilla 2014. 2 UNIVERSIDAD DE SEVILLA DEPARTAMENTO DE BIOQUÍMICA VEGETAL Y BIOLOGÍA MOLECULAR Genómica Funcional del Metabolismo del Nitrógeno en relación con la fotorrespiración y estrés abiótico en plantas de Lotus japonicus. Trabajo presentado para optar al grado de Doctora en Química por la licenciada Carmen María Pérez Delgado de Torres. Directores Dr. Marco Betti Dr. Antonio J. Márquez Cabeza. Profesor Contratado Doctor Catedrático de Bioquímica y Biología Molecular 3 A mi familia A Juandi 4 AGRADECIMIENTOS Esta Tesis Doctoral no se podría haber realizado si no hubiese tenido la ayuda de muchas personas. Quiero agradecerle, en mi primer lugar, al Profesor Antonio J. Márquez Cabeza que me diese la oportunidad de realizar la Tesis Doctoral en su laboratorio. Gracias por su gran acogida, por ser un gran jefe, cercano y sabio, y por trasmitirme la pasión por la investigación. Gracias por preocuparte tanto por nosotros, y por apoyarnos siempre. Ha sido una gran suerte tener un jefe tan dedicado a sus alumnos. Quiero agradecerle a mi otro super director de Tesis, Marco Betti, todo el tiempo y trabajo que ha derrochado conmigo hasta que me hecho una experta en placas de qRT-PCR, análisis de datos de ómicas y técnicas de bioquímica clásica. Cuando empecé la Tesis me pareció muy complicado que pudiese alcanzar el nivel de conocimiento que tengo y, en gran medida, se debe a él. Gracias por enseñarme tus conocimientos y, sobre todo, gracias por haber hecho que disfrute enormemente de mi Tesis. Ha sido un placer ser tu alumna estos cuatro años. Quiero agradecerle a mi compi de despachito Marga todo el tiempo que ha pasado conmigo ayudándome y enseñándome con todo lo que necesitaba. Gracias por tu paciencia, por tu absoluta disponibilidad, por tu simpatía y por tu entrega. Gracias por escucharme siempre y por tus grandes consejos. Gracias también a Aurora por su buen humor y buen hacer. ¡Qué eficiencia y simpatía! Ha sido una suerte tenerte como secre. Gracias también a María José por su buen hacer con la difícil labor del cultivo de plantas. Gracias por tu disponibilidad, por tu ayuda y por tu cariño. Quiero dar las gracias, también, al Profesor José María Vega por mostrarme lo maravillosa que es la Bioquímica. En sus clases descubrí hacia dónde quería dirigir mi carrera profesional. Gracias por ese amor a la ciencia que desprende y por esos cafelitos tan entretenidos. De Extremadura sólo pueden salir cosas buenas. Gracias también al Profesor Curro Galván por su simpatía y su orden. Me gustaría también darles las gracias a Alfredo y Guillermo. Con vosotros aprendí lo que supone una Tesis y, a pesar de que coincidí con vosotros en vuestras rectas finales, sacasteis tiempo para enseñarme todo vuestro conocimiento. Muchas gracias y suerte en vuestros caminos. 5 Gracias también a nuestra otra super secre, Luisa, por su eficiencia y su amabilidad. La verdad es que sólo puedo tener palabras de agradecimiento para el grupo del Profesor Antonio Márquez. Ha sido mi segundo hogar durante estos cuatro años y así me han hecho sentir, como en casa. Quiero agradecer también el financiamiento ofrecido por los Proyectos de Excelencia de la Junta de Andalucía P10-CVI-6368 y P07-CVI-03026 que han permitido llevar a cabo esta investigación. Gracias también a la beca PIF del IV Plan Propio de la Universidad de Sevilla que ha hecho que tenga un trabajo maravilloso durante estos cuatro años. Quiero agradecer también al grupo liderado por el Profesor Rodrigo Gutiérrez de la Pontificia Universidad Católica de Chile, donde he realizado dos estancias de investigación, su acogida y dedicación. He aprendido muchísimo a nivel científico y a nivel personal. En estas estancias, además de cubrir con los objetivos propuestos, he aprendido lo valiosísima que es la bioinformática. Quiero dar las gracias también al Doctor Pedro Díaz. He aprendido mucho durante los meses que estuvo con nosotros. Quiero dar las gracias también al Profesor Francisco Cánovas y al Doctor Rafael Cañas por los anticuerpos anti-AS y a la Doctora K.A. Roubelakis- Angelakis por los anticuerpos anti-GDH. Gracias también al Servicio de Biología del CITIUS por su ayuda con las medidas de qRT-PCR. No habría podido lograr realizar la Tesis Doctoral sin la ayuda de mi familia. Gracias por quererme tanto y apoyarme siempre. Con vosotros aprendí el valor de la bondad, la responsabilidad, la humildad, la honestidad y el esfuerzo. Desde pequeñita aprendí el valor del conocimiento. Ya mi abuelo comenzó con las enseñanzas de la vida y de las reglas de ortografía y mis padres, mi hermana y Tomi se han encargado de alentarme siempre en el camino. Soy muy afortunada por poder contar con vosotros. Gracias de todo corazón. Gracias también a mis amigos. A todos ellos: A mis niñas del cole, María, Ging Ging, Mar, Laura, Isa…a pesar de que nuestros caminos tomen veredas distintas estáis siempre presentes y eso es Amistad. Gracias también a mis niñas de Campa, Silvia, Ana y Anto, con vosotras además, comparto profesión. Gracias por vuestro apoyo y vuestro ánimo constante; gracias por compartir algunas lágrimas y muchas sonrisas. Y gracias también a mis compis de carrera: Javi Ramos, Javi De Pablos, Mari Carmen, Sandra, María, Alberto y Rocío. Qué 6 buenos momentos hemos pasado durante esos cinco años y qué alegría que los sigamos compartiendo. Mucha suerte también a vosotros en vuestro camino. No puedo terminar los agradecimientos sin darle las gracias a mi eterno acompañante en la vida. Muchas gracias por allanarme el camino, por tu paciencia, por tu bondad, por tu inteligencia, por estar siempre a mi lado y por hacer todo más fácil y mucho más bonito. La verdad es que se han pasado muy rápidos estos cuatro años y eso es señal de que todo ha ido bien. He disfrutado mucho en la realización de la Tesis, incluso cuando se me resistían las medidas de la maldita GDH. He tenido la suerte de poder realizar un trabajo en el que todos los días aprendía algo nuevo, en el que no todo está escrito, sino más bien al contrario, en el que hay muchas cosas por escribir, en el que no había un día igual al anterior y en el que he aprendido a aprender, porque hasta de los experimentos fallidos se aprende. En estos cuatro años he aprendido a amar más la trama que el desenlace. Muchas gracias a todos. Sin vosotros no hubiera sido posible. 7 ÍNDICE Páginas Resumen………………………….................………………….……….….8 Introducción……………………………………………..…….……….….9 Objetivos…………………………..……………………..…….……….…30 Publicaciones…………………………………..................……….….…...34 Publicación 1……………………………………….…..…………...35 Publicación 2…………………………………………...…………...92 Publicación 3……………………………….……………….……..117 Publicación 4……………………………….…………….………..148 Publicación 5……………………………………………..….....….172 Otras Publicaciones……………………………………………………...196 Publicación 6………………………………………………...……..197 Publicación 7……………………………………..…………….…..238 Publicación 8……………………………………..…………….…..269 Publicación 9……………………………………..…………….…..282 Discusión…………………………………………….……………...…….320 Conclusiones……………………………………….……………...…...…332 8 RESUMEN En esta Tesis Doctoral se ha abordado el estudio, desde el punto de vista de la genómica funcional, del metabolismo del nitrógeno y su relación con la fotorrespiración y con el estrés abiótico en la leguminosa modelo Lotus japonicus. La disponibilidad de mutantes Ljgln2-2, carentes por completo de actividad y proteína glutamina sintetasa plastídica, ha permitido avanzar en el esclarecimiento de la significación fisiológica exacta de dicha enzima en relación con la fotorrespiración y el estrés abiótico, haciendo uso de datos transcriptómicos y metabolómicos y análisis de la co-expresión de redes de genes. Entre las conclusiones más destacadas se incluyen la descripción de la existencia de una regulación coordinada de los genes fotorrespiratorios bajo condiciones de alta acumulación de NH 4+ ; la inducción de rutas alternativas al ciclo GS2 / Fd-GOGAT para la reasimilación del NH 4+ ; la interconexión de la fotorrespiración con el metabolismo central del carbono, del nitrógeno y metabolismo secundario; y el papel de la glutamina sintetasa plastídica en la respuesta al balance C / N y su relación con el metabolismo de la prolina y el estrés hídrico. ABSTRACT In this Doctoral Thesis it has been studied the nitrogen metabolism and its relationship with the photorespiration and abiotic stress in the model legume Lotus japonicus, from the point of view of the functional genomics. The availability of Ljgln2-2 mutants, lacking completely of plastidic glutamine synthetase activity and protein, allowed to achieve a significant advance in the knowledge of the exact physiological significance of this enzyme in relation to the photorespiration and abiotic stress, making use of transcriptomic and metabolomic data and analysisi of co-expression networks. The most important conclusions of this Thesis are the following: description of the existence of a coordinate regulation of the photorespiratory genes in conditions of high accumulation of NH 4+ ; the induction of alternative routes to the cycle GS2 / Fd- GOGAT for the reassimilation of the NH 4+ ; the interconnection of the photorespiration with the central carbon metabolism, nitrogen metabolism and secondary metabolism; and the role of the plastidic glutamine synthetase in the response to the C / N balance and its relation with the proline metabolism and drought stress. 9 INTRODUCCIÓN 16 Figura 2. Esquema del ciclo C 2 ó ciclo fotorrespiratorio del nitrógeno (modificado de Monza y Márquez, 2004). 1, RUBISCO; 2, fosfoglicolato fosfatasa; 3, glicolato oxidasa; 4, glioxilato transaminasas; 5, complejo multienzimático glicina descarboxilasa / serina hidroximetiltransferasa; 6, hidroxipiruvato reductasa; 7, glicerato kinasa; 8, glutamina sintetasa; 9, glutamato sintasa. RuBP, Ribulosa-1,5-bisfato En definitiva, gracias al uso de inhibidores químicos que bloquean el ciclo de la GS-GOGAT o que interfieren con otras enzimas de reacciones específicas del ciclo oxidativo C 2 , y también al uso de mutantes fotorrespiratorios, se puede afirmar que la conversión de glicina a serina es la mayor fuente de NH 3 en hojas que fotorrespiran activamente y que la GS cloroplástica es la enzima responsable de su reasimilación. 17 Edwards et al. (1990) demostraron que la GS1 y GS2 están compartimentalizadas en distintos tipos de células, no existiendo GS1 en las células en las que se lleva a cabo la fotorrespiración, lo que explicaría este papel crucial de la GS2 en la reasimilación del amonio fotorrespiratorio y que la GS1 no realice esta labor. De hecho, Oliveira et al. (2002) desarrollaron una expresión ectópica de GS1 en células del mesófilo de hojas de tabaco, y demostraron que esta expresión producía alteraciones en el proceso fotorrespiratorio que se evidenciaban por una disminución del nivel de amonio, elevados niveles de intermediarios fotorrespiratorios y un incremento de los niveles de glutamato, producto de la asimilación del amonio procedente de la fotorrespiración. Por tanto, esta expresión ectópica de GS1 en células de las hojas estaría proporcionando una ruta complementaria o alternativa de la GS2 en la reasimilación del amonio fotorrespiratorio. Por otro lado, el flujo continuo de carbono en el ciclo fotorrespiratorio antes mencionado depende de un aporte suficiente de donadores de grupos aminos para la transaminación del glioxilato a glicina en los peroxisomas. La producción de los aminoácidos necesarios que actúen de donadores de los grupos aminos depende y está íntimamente ligada también a la reincorporación del amonio derivado de la fotorrespiración (Keys et al. 1978). Igualmente, el flujo de metabolitos entre distintos orgánulos, necesario para el funcionamiento del ciclo C2, requiere de todo un amplio elenco de transportadores y lanzaderas de aminoácidos y ácidos orgánicos (Douce y Neuburger, 1999; Peterhansel et al., 2010). 3. Interconexión entre el metabolismo del nitrógeno y el estrés hídrico El crecimiento de las plantas se ve limitado por diferentes factores, entre ellos el estrés osmótico generado por déficit hídrico, bajas temperaturas, o altas concentraciones de sal. En condiciones de sequía, el potencial hídrico del suelo se hace más negativo, por lo que las plantas deben disminuir este potencial para mantener el gradiente necesario para la absorción de agua. La célula vegetal puede disminuir su potencial hídrico por la acumulación de solutos, o por pérdida de agua. En suelos en condiciones de sequía, un mecanismo que tienen las plantas para evitar la disminución del potencial hídrico es la acumulación de solutos orgánicos o inorgánicos. Los solutos orgánicos que se acumulan en el citoplasma en condiciones de estrés osmótico se denominan osmolitos compatibles, mientras que los iones inorgánicos que se acumulan en vacuola y participan también en el mantenimiento del potencial hídrico se conocen como osmolitos celulares. Entre los osmolitos compatibles más frecuentes se 18 encuentran polioles, sacarosa, glicín-betaína y prolina, que pueden acumularse a concentraciones elevadas, de manera que evitan la disminución del potencial hídrico sin interferir con el funcionamiento celular (Díaz et al., 2004). Por otro lado, el estrés osmótico, como todo estrés abiótico, induce en las plantas la formación de especies reactivas de oxígeno (ROS), como el radical superóxido, el oxígeno singlete, el peróxido de hidrógeno y el radical hidroxilo, que producen daños a fosfolípidos, ácidos nucelicos y proteínas, entre otras moléculas. La formación de ROS también la inducen el ozono, el óxido nítrico, óxido nitroso y óxido sulfuroso y cualquiera sea el desencadenante, el estrés oxidativo se genera cuando la producción de ROS por la planta es mayor a la capacidad de eliminarlas. Algunos de los osmolitos sintetizados por la planta pueden funcionar como capturadores de ROS, protegiendo a la célula del estrés oxidativo. Esos osmolitos constituyen una defensa antioxidante no enzimática, a diferencia de la defensa enzimática en la que participan la superóxido dismutasa y peroxidasas, entre otras enzimas. Por este motivo, la síntesis de osmolitos nitrogenados y glutatión juega un papel determinante en la tolerancia al estrés abiótico de las plantas a través del mantenimiento del potencial hídrico, la destoxificación de ROS y la regulación del pH celular. En otros trabajos pueden encontrarse más detalles sobre este particular (Díaz et al., 2004). En diferentes especies se ha comprobado que la asimilación de nitrógeno, y, en particular, la GS, juegan un papel determinante en relación con el estrés abiótico y, en concreto, en el estrés hídrico (Yousfi et al., 2012). De hecho, se ha descrito un claro papel de la GS citosólica en la producción de prolina (Brugiére et al., 1999). Igualmente se demostrado que la sobreexpresión de GS cloroplástica en tabaco y arroz resulta en una mayor tolerancia a la fotooxidación (Kozaki y Takeba, 1996) y al estrés salino (Hoshida et al., 2000). El trabajo de Kozaki y Takeba (1996) es particularmente interesante porque enfatiza la posible participación de la fotorrespiración y la GS2 en la protección frente al estrés abiótico, como un mecanismo para prevenir la sobrereducción del estroma, y por ende la fotoinhibición, mecanismo sugerido también por otros autores para diferentes situaciones de estrés y también para las condiciones normales de vida de las plantas (Douce y Neuburger, 1999; Maurino y Peterhansel, 2010; Osmond et al., 1997; Wingler et al., 2000). De hecho, se ha comprobado que la transferencia de equivalentes de reducción puede ser importante para la asimilación de nitrato (Rachmilevitch et al., 2004) y que que la fotorrespiración puede ser importante para evitar la supresión de la reparación del fotosistema II que ha sido fotodañado (Takahashi et al., 2007). Por otra parte, la fotorrespiración contribuye también a la homeostasis redox de las plantas a través de la producción de H 2 O 2 e implicación de los piridín nucleótidos (Foyer et al., 19 2009). Los estudios con mutantes de cebada deficientes en GS2 sugieren que el equilibrio redox en los diferentes compartimentos celulares tiene mucho que ver con los efectos adversos de la deficiencia en el metabolismo fotorrespiratorio (Igamberdiev et al., 2001). No obstante hay que mencionar también que existen autores para los que es difícil aceptar que la fotorrespiración sea un proceso esencial para proteger las plantas frente al exceso de luz (Keys, 2006). 4. Estudios previos sobre la asimilación de nitrógeno y su interrelación con la fotorrespiración y el estrés hídrico en la leguminosa modelo Lotus japonicus La planta objeto de los estudios del presente trabajo es la leguminosa modelo Lotus japonicus. Los estudios con leguminosas modelo surgieron a raíz de que las investigaciones en biología molecular, genética y genómica de la mayoría de las leguminosas de interés agrícola se veían dificultados por sus largos tamaños de genoma y otras desventajas (poliploidía, dificultad en su transfpormación y regeneración, escaso número de semillas y plántulas, duplicaciones génicas, largos tiempos de generación, etc.). Dos han sido las leguminosas modelo más ampliamente utilizadas hasta la fecha: Medicago truncatula, que posee nódulos indeterminados, y Lotus japonicus, como modelo de leguminosa con nódulos determinados, a raíz de la propuesta efectuada por Handberg y Stougaard (1992). Se trata de una planta diploide, de pequeño tamaño, que se reproduce por auto-fertilización o por esquejes, con un genoma relativamente pequeño (450 Mbp) en base a 12 cromosomas, que presenta grandes facilidades de cultivo y producción de semillas, y que se puede regenerar desde callos siendo posible la transformación con Agrobacterium tumefaciens. Desde entonces han sido muchas las herramientas moleculares que se han desarrollado para el trabajo con esta planta, incluyendo la secuenciación de su genoma llevada a cabo fundamentalmente por el instituto Kazusa de Japón, y que ha generado la base de datos 2.5 que está siendo ampliamente utilizada (http://www.kazusa.or.jp/lotus). Igualmente se han desarrollado otras herramientas de genómica funcional como secuenciación de ESTs, chips de DNA para análisis del transcriptoma, basados en dichas secuencias, proteómica, metabolómica a través de GC-MS, mapeo génico y nuevas herramientas de mutagénesis para genética inversa tales como el TILLING (targeted induced local lesions in genomes) (Perry et al., 2003) y más recientemente la mutagénesis con transposones LORE1 (Urbansky et al. 2012 ; Fukai et al. 2012). Diferentes trabajos detallan las enormes posibilidades que ofrece la leguminosa modelo Lotus japonicus para la investigación y los principales avances logrados merced al trabajo con esta leguminosa, en su mayor parte relativos a sus procesos 20 simbióticos, bien con la bacteria Mesorhizobium loti para el proceso de la fijación biológica del nitrógeno o mediante micorrización (cf. Madsen et al., 2010; Márquez, 2005; Udvardi et al., 2005; Sato y Tabata, 2005; Stacey et al., 2006). Nuestro grupo de trabajo ha venido trabajando con L. japonicus desde hace unos 20 años, poco después de la propuesta de esta planta como leguminosa modelo y merced a distintos proyectos nacionales e internacionales que se han ido sucediendo en el tiempo. Los primeros trabajos del grupo se centraron en la caracterización de los sistemas de reducción de nitrato y nitrito en L. japonicus (Márquez et al., 2004; Márquez et al., 2005a; Márquez et al., 2005b; Orea et al., 2001; Orea et al., 2005a; Orea et al., 2005b; Pajuelo et al., 2002), que se suman también a los producidos por otros autores (Harrison et al., 2004; Prosser et al., 2006). Otros trabajos más recientes han caracterizado el metabolismo de la asparragina en esta planta, con especial énfasis en el estudio de la asparraginasa (Credali et al., 2011; Credali et al., 2013), que completan otros estudios anteriores que pusieron de manifiesto la importancia de la asparragina para la translocación de nitrógeno en esta planta (Waterhouse et al., 1996). Sin embargo, los trabajos más relacionados con esta Tesis son los concernientes a la caracterización de mutantes fotorrespiratorios de L. japonicus deficientes en GS2. Este tipo de mutantes se obtuvieron (Orea et al., 2002; Márquez et al., 2005a) tras un escrutinio de semillas mutagenizadas con etil metano sulfonato (EMS) y se identificaron por su capacidad de crecimiento normal, similar al silvestre (WT), en condiciones de alto CO 2 (0,7 % v/v), donde la fotorrespiración está suprimida, pero que, a diferencia con las plantas silvestres mostraban daños importantes (clorosis y necrosis de las hojas) cuando se las transfería a una atmósfera de aire normal, que son condiciones de fotorrespiración activa (Figura 3). Las plantas pueden recuperarse perfectamente volviéndolas a la atmósfera de alto CO 2 . Este mismo procedimiento fue el que inicialmente se diseñó para la búsqueda de mutantes fotorrespiratorios en Arabidopsis (Somerville y Ogren, 1979; 1982), existiendo ya disponibles en Arabidopsis un amplio catálogo de mutantes afectados en distintas etapas del ciclo fotorrespiratorio C2 (Timm y Bauwe, 2013). Igualmente se han descrito también mutantes fotorrespiratorios en otras especies como cebada y guisante (Blackwell et al., 1988; Keys y Leegood, 2002). Sin embargo, mutantes específicamente deficientes en GS2 sólo han podido obtenerse en cebada, y fueron fundamentales, como se explicó anteriormente, para demostrar la implicación específica de la GS2 en la reasimilación del amonio fotorrespiratorio. Por esta razón, los mutantes obtenidos en nuestro grupo en L. japonicus, específicamente afectados en GS2, 21 son la primera leguminosa en la que se consiguen y permiten explorar la significación fisiológica precisa de esta isoforma particular de GS. Figura 3. Fenotipo de sensibilidad a aire de los mutantes fotorrespiratorios de L. japonicus deficientes en GS2. Las plantas muestran un aspecto normal cuando se cultivan en una atmósfera enriquecida en CO 2 pero exhiben claros síntomas de clorosis y necrosis de las hojas al cabo de 7-10 días de la transferencia a aire normal, comenzando por las hojas más jóvenes. En un principio se obtuvieron dos mutantes, inicialmente denominados Ljpr1 y Ljpr2 que fueron posteriormente caracterizados demostrándose que poseían niveles normales de GS1 y que eran alélicos y mostraban una herencia mendeliana debida a un solo carácter recesivo (Orea et al., 2002; Márquez et al., 2005a). Mediante mapeo génico pudo comprobarse en L. japonicus la existencia de un único gen GLN2 codificante para la GS2 (Sandal et al., 2006). Posteriormente, se constató que ambos mutantes estaban específicamente afectados en la región codificante del gen para GS2 (LjGLN2), por lo que dichos mutantes se denominaron respectivamente Ljgln2-1 y Ljgln2-2 (Betti et al., 2006), mostrando respectivamente mutaciones puntuales responsables de las sustituciones G85R y L278H en el polipéptido correspondiente. La producción de las proteínas recombinantes mutantes en E. coli permitió comprobar que ambas mutaciones anulan por completo la actividad GS2 pero afectan de manera diferente a la estabilidad del polipéptido para GS2 (Betti et al., 2006). En el caso del mutante Ljgln2-1 se pueden detectar pequeños niveles del polipéptido para GS2 en hojas, raíces y nódulos de las plantas mutantes, mientras que el mutante Ljgln2-2 carece por completo de proteína (Betti et al., 2006; García-Calderón et al., 2012). Este mutante Ljgln2-2 es el que se ha utilizado fundamentalmente en 22 esta Tesis. Otros estudios anteriores llevados a cabo con estos mutantes han permitido esclarecer la significación exacta de la GS2 para la nodulación de las plantas (García-Calderón et al., 2012) demostrándose una clara vinculación de esta enzima en el balance C/N de las plantas de L. japonicus, fundamental para este proceso. Por otra parte, también se han utilizado anteriormente estos mutantes para investigar su respuesta a sequía, demostrándose una clara implicación de la GS2 en la producción de prolina dado que los mutantes mostraban una menor acumulación de prolina en respuesta al estrés hídrico, acompañado de profundas alteraciones del transcriptoma de las plantas indicativa de que están percibiendo una mayor situación de estrés y que se traduce también en una menor capacidad de rehidratación de las mismas tras la sequía (Díaz et al., 2010). Otros trabajos relativos a la GS de L. japonicus llevados a cabo por otros autores son escasos y conciernen fundamentalmente a la GS1 (Limami et al., 1999; Harrison et al., 2000; 2003; Ortega et al. 2004; Suárez et al., 2003). REFERENCIAS Andrews M, Raven JA, Lea PJ (2013) Do plants need nitrate? The mechanisms by which nitrogen form affects plants. Annals of Applied Biology 163, 174-199. Bauwe H, Hageman M, Fernie AR (2010) Photorespiration: players, partners and origin. Trends in Plant Science 15, 330-336. Betti M, arcondéguy T, Márquez AJ (2006) Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase. Functional properties of purified GLN2 enzymes. Planta 224, 1068-1079. Blackwell RD, murray AJS, Lea PJ, Kendall AC, Hall NP, Turner JC, Wallsgrove RM (1988). The value of mutants unable to carry out photorespiration. Photosynthesis Research 16, 155-176. Britto DT, Kronzucker HJ (2002). NH 4+ toxicity in higher plants: a critical review. Journal of Plant Physiology 159, 567-584. Brugiére N, Dubois F, limami AM, Lelandais M, Roux Y, Sangwan RS, Hirel B (1999) Glutamine synthetase in the phloem plays a major role in controlling proline production. Plant Cell, 11, 1995-2012. Credali A, Díaz-Quintana A, García-Calderón M, de la Rosa MA, Márquez AJ, Vega JM (2011) Structural analysis of K + dependence in L-asparaginases from L. japonicus. Planta 234, 109-122. 23 Credali A, García-Calderón M, Dam S, Perry J, Díaz-Quintana A, Parniske M, Wang TL, Stugaard S, Vega JM, Márquez AJ (2013) The K + -dependent asparaginase, NSE1, is crucial for plant growth and sed production in Lotus japonicus. Plant Cell Physiology 54, 107-118. Dechorgnat J, Nguyen CT, Armengaud P, Jossier M, Diatloff E, Filleur S, Daniel-Vedele F (2011). From the soil to the seeds: the long journey of nitrate in plants. Experimental Journal of Botany 62, 1349-1359. Díaz P, Borsano I, Valpuesta V (2004) Moléculas nitrogenadas en respuesta a estrés abiótico. En El metabolismo del nitrógeno en las plantas (Monza J y Márquez AJ, eds.). Almuzara Editorial, Córdoba, pp. 139-140. Díaz P, Betti M, Sánchez DH, Udvardi MK, Monza J, Márquez AJ (2010) Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytologist 188, 1001-1013. Douce R, Neuburger M (1999) Biochemical dissection of photorespiration. Current Opinion in Plant Biology 2, 214-222. Edwards JW, Walker EL, Coruzzi GM (1990) Cell-specific expression in transgenic plants reveals nonoverlapping roles for chloroplast and cytosolic glutamine synthetase. Proceedings of the National Academy of Sciences USA 87, 3459-3463. Fernández E, Galván A (2008) Nitrate assimilation in Chlamydomonas. Eukaryotic Cell 7, 555-559. Fontaine JX, Tercé-Laforgue T, Armengaud P, Clément G, Renou J-P, Pelletier S, Catterou M, Azzopardi M, Gibon Y, Lea PJ, Hirel B, Dubois F (2012) Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. Plant Cell 24, 4044-4065. Forde BG (2000) Nitrate transporters in plants: structure, function and regulation. Biochemica et Biophysica Acta 1495, 219-235. Forde BG, Clarkson DT (1999) Nitrate and ammonium nutrition of plants: physiological and molecular perspectives. Advances in Botanical Research 30, 1-90. Forde BG, Lea PJ (2007) Glutamate in plants: metabolism, regulation and signalling. Journal of Experimental Botany 58, 2339-2358. 24 Foyer CH, Bloom AJ, Queval G, Noctor G (2009) Photorespiratory metabolism: genes, mutants, energetics, and redox signaling. Annual Review of Plant Biology 60, 455-484. Fukai E, Soyano T, Umehara Y, Nakayama S, Hirakawa H, Tabata S, Sato S, Hayashi M (2012) Establishment of a Lotus japonicus gene tagging population using the exon-targeting endogenous transposon LORE1. The Plant Journal 69, 720-730. García-Calderón M, Chiurazzi M, Espuny MR, Márquez AJ (2012) Photorespiratory metabolism and nodule function: behavior of Lotus japonicus mutants deficient in plastid glutamine synthetase. Molecular Plant-Microbe Interactions 25, 211-219. Gojon A, Krouk G, Perrine-Walker F, Laugier E (2011) Nitrate transceptor(s) in plants. Journal of Experimental Botany 62, 1103-1106. Good AG, Shrawat AK, Muench DG (2004) Can less yield more? Is reducing nutrient input into the environment compatible with maintaining crop production? Trends in Plant Science 9, 597-605. Handberg K, Stougaard J (1992) Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. The Plant Journal 2, 487- 496. Harrison J, Hirel B, Limami A (2004) Variation in nitrate uptake and assimilation between two ecotypes of Lotus japonicus L and their recombinant inbred lines. Physiologia Plantarum 120,124-131. Harrison J, Pou de Crescenzo M-A, Sené O, Hirel B (2003) Does lowering glutamine synthetase activity in nodules modify nitrogen metabolism and growth in Lotus japonicus? Plant Physiology 133, 253-262. Hirel B, Lea PJ (2002) The biochemistry, molecular biology, and genetic manipulation of primary ammonia assimilation. En Photosynthetic nitrogen assimilation and associated carbon and respiratory metabolism (Foyer CH y Noctor G, eds). Kluwer Academic Publishers, Dordrecht, The Netherlands. pp. 71-92. Hirel B, Le Gouis J, Gallais A (2007) The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. Journal of Experimental Botany 58, 2369-2387. 25 Hoshida H, Tanaka Y, Hibino T, Hayashi Y, Tanaka A, Takabe T, Takabe T (2000) Enhanced tolerance to salt stress in transgenic rice that overexpresses chloroplast glutamine synthetase. Plant Molecular Biology 43, 103-111. Igamberdiev AU, Bykova NV, Lea PJ, Gardestrom P (2001) The role of photorespiration in redox and energy balance of photosynthetic plant cells, a study with a barley mutant deficient in glycine decarboxylase. Physiologia Plantarum 111, 427-438. Kendall AC, Wallsgrove RM, Hall NP, Turner JC, Lea PJ (1986) Carbon and nitrogen metabolism in barley (Hordeum vulgare L.) mutants lacking ferredoxin-dependent glutamate synthase. Planta 168, 316-323. Keys AJ (2006) The re-assimilation of ammonia produced by photorespiration and the nitrogen economy of C 3 higher plants. Photosynthesis Research 87, 165-175. Keys AJ, Bird IF, Cornelius MJ, Lea PJ, Wallsgrove RM, Miflin BJ (1978) Photorespiratory nitrogen cycle. Nature 275, 741-743. Keys AJ, Leegood RC (2002). Photorespiratory carbon and nitrogen cycling: evidence from studies of mutants and transgenic plants. En Advances in photosynthetic nitrogen assimilation and associated carbon and respiratory metabolism (Foyer CH, Noctor G, eds). Kluwer academic publisher, Dordrecht, the Netherlands, 115-134. Kozaki A, Takeba G (1996) Photorespiration protects C3 plants from photooxidation. Nature 384, 557-560. Lam HM, Coschigano KT, Oliveira IC, Melo-Oliveira R, Coruzzi GM (1996) The molecular-genetics of nitrogen assimilation into amino acids in higher plants. annual Review of Plant Physiology and Plant Molecular Biology 47, 569-593. Lea PJ, Ireland RJ (1999) Nitrogen metabolism in higher plants. En Plant amino acids: biochemistry and biotechnology (Singh BK, ed.) Marcel Dekker, Inc., New York, pp. 1-47. Leran S, Varala K, Boyer J-C, Chiurazzi M, Crawford N, Daniel-Vedele F, David L, Dickstein R, Fernandez E, Forde B, Gassmann W, Geiger D, Gojon A, Gong J-M, Halkier BA, Harris JM, Hedrich R, Limami AM, Rentsch D, Seo M, Tsay Y-T, Zhang M, Coruzzi G, Lacombe B (2013) A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE 32 Pérez-Delgado CM, Moyano TC, García-Calderón M, Márquez AJ, Gutiérrez RA, Betti M. Unpublished. 4. Estudio comparado de la transcriptómica de los genes modulados por la fotorrespiración y la sequía en plantas silvestres y mutantes Ljgln2-2 (Publicación 4), seguido por un análisis específico de la transcriptómica de la sequía en condiciones de fotorrespiración activa (aire normal) (Publicación 5). Publicación 4: Abiotic stress in Lotus: aluminum and drought. Pal’ove-Balang, Betti M, Díaz P, Pérez-Delgado CM, García-Calderón M, Monza J, Márquez AJ (2014). En: Molecular approaches in Plant Abiotic Stress (Gaur RK, Sharma P, eds). CRC Press, Boca Raton, Florida, USA, pp. 291-303. Cf. Apartado titulado “Drought stress” Publicación 5: Cellular Stress Following Water Deprivation in the model legume Lostus japonicus. Betti M, Pérez-Delgado C, García-Calderón M, Díaz P, Monza J, Márquez AJ (2012) Cells 1, 1089-1106. Otras Publicaciones: En este apartado de la Tesis se muestran también otras publicaciones directamente relacionadas con la misma donde se incluyen resultados de los objetivos de esta Tesis en los apartados que se mencionan a continuación. Publicación 6: Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. Betti M, García-Calderón M, Pérez-Delgado CM, Credali A, Estivill G, Galván F, Vega JM, Márquez AJ (2012) International Journal of Molecular Sciences 13, 7994-8024. Cf. Apartados 2.2.1 (objetivo 1), 2.2.2 (objetivo 2), 2.2.4 (objetivo 4) y 2.2.5 (integración de todos los datos de los objetivos 1,2,3 y 4) Publicación 7: Reassimilation of Ammonium in Lotus japonicus 33 Betti M, García-Calderón M, Pérez-Delgado CM * , Credali A, Pal’ove- Balang P, Estivill G, Repčák M, Vega JM, Galván F, Márquez AJ. Journal of Experimental Botany (sometido a publicación) * co-primera autora Cf. Apartado “photorespiratory ammonium reassimilation” (objetivos 1 y 2) Publicación 8: Genes for ammonium assimilation. Pérez-Delgado CM, García-Calderón M, Credali A, Vega JM, Betti M, Márquez AJ (2014) En: The Lotus japonicus genome (Tabata S, Stougaard J, eds), Springer (en prensa). En este artículo se incluye un estudio genómico de los diferentes genes implicados en la asimilación de amonio en L. japonicus y sus niveles basales de expresión en distintos tejidos. (objetivo 2) Publicación 9: A Lotus japonicus mutant deficient in nitrate uptake is also affected in the nitrate response to nodulation. Pal’ove-Balang P, García-Calderón M, Pérez-Delgado CM*, Pávlovin J, Betti M, Márquez AJ (2014) Plant Biology doi:10.1111/plb.12169. *co- primera autora En este artículo se muestran los datos de niveles de expresión de un amplio número de genes implicados en el transporte, reducción y asimilación de nitrato, junto con otros posibles genes reguladores, obtenidos para plantas silvestres de Lotus japonicus, como complemento de los datos ilustrados en el artículo 3 (objetivo 3); estos datos se muestran en comparación con los datos obtenidos para el mutante Ljclo1 deficiente en el transporte de nitrato. 34 PUBLICACIONES 35 Publicación 1. Transcriptomic and Metabolic changes associated with photorespiratory ammonium accumulation in the model legume Lotus japonicus. Pérez-Delgado CM, García-Calderón M, Sánchez DH, Udvardi MK, Kopka J, Márquez AJ, Betti M (2013) Plant Physiology 162, 1834-1848. 36 ABSTRACT The transcriptomic and metabolic consequences of the lack of plastidic glutamine synthetase in the model legume Lotus japonicus were investigated. WT and mutant plants lacking of the plastidic isoform of glutamine synthetase were grown in conditions that suppress photorespiration (0.7% v/v CO 2 ) and then transferred for different lengths of time to photorespiratory conditions (normal air, 0.04% v/v CO 2 ). Transcript and metabolite levels were determined at the different time points considered. Under photorespiratory active conditions the mutant accumulated high levels of ammonium followed by its subsequent decline. A coordinate repression of the photorespiratory genes was observed in the mutant background. This was part of a greater modulation of the transcriptome, especially in the mutant, that was paralleled by changes in the levels of several key metabolites. The data obtained for the mutant represent the first direct experimental evidence for a coordinate regulation of photorespiratory genes over time. Metabolomic analysis demonstrated that mutant plants under active photorespiratory conditions accumulated high levels of several amino acids and organic acids, including intermediates of the Krebs cycle. An increase in glutamine levels was also detected in the mutant, that was paralleled by an increase in cytosolic GS1 gene transcription and activity levels. The global panoramic of the transcripts and metabolites that changed in L. japonicus plants during the transfer from photorespiration-suppressed to photorespiration-active conditions highlighted the link between photorespiration and several other cellular processes, including central carbon metabolism, amino acid metabolism and secondary metabolism. 37 INTRODUCTION Plant photorespiration is caused by the light-dependent uptake of oxygen and is concomitant with the release of CO 2 and ammonia. The first step of photorespiration takes place in the chloroplast, where ribulose-1,5-bisphosphate- carboxylase/oxygenase (RUBISCO, EC 4.1.1.39) oxygenates a molecule of ribulose-1,5-bisphosphate to give one molecule of 3-phosphoglycerate and one of 2-phosphoglycolate. The latter molecule enters in a complex pathway, the C 2 cycle that encompasses three compartments: chloroplasts, mitochondria and peroxisomes. The cycle serves as a carbon recovery system by transforming 2- phosphoglycolate into 3-phosphoglycerate, that goes back to the Calvin cycle (Maurino and Peterhansel, 2010). Photorespiration also generates a high flux of ammonium that, at least in C3 plants, can be 10 times higher than the originated from nitrate reduction (Hirel et al., 2007). This ammonium is then reassimilated by the plastidic isoform of glutamine synthetase (GS 2 ). Although the recovery of the carbon equivalents diverted from photosynthetic metabolism by the oxygenase activity of RUBISCO is probably the main function of photorespiratory metabolism, other roles have been proposed such as the dissipation of excessive reducing power in the chloroplast as a consequence of high light, drought or salt stress (Kozaki and Takeba, 1996; Hoshida et al., 2000; Maurino and Peterhansel, 2010). Photorespiration is also needed in order to produce metabolites for other pathways such as serine and glycine, with the latter that also serves as substrate for glutathione biosynthesis (Wingler et al., 2000). On the other hand, impairment of the photorespiratory cycle leads to increased photoinhibition of photosystem II through inhibition of the synthesis of the D1 protein (Takahashi et al., 2007). Several of the steps of the photorespiratory pathway that were first defined through classical biochemical experiments were later confirmed by the isolation of photorespiratory mutants (Keys and Leegood, 2002). A mutant screening that was first devised to isolate photorespiratory mutants from Arabidopsis was based on the fact that photorespiratory mutants are conditionally lethal. Mutant plants grow normally under a CO 2 -enriched atmosphere (>0.2%) where photorespiration is suppressed. However, when such mutants are transferred to normal CO 2 conditions they show various stress symptoms. Once the photorespiratory mutants have been identified the plants can be transferred back to CO 2 -enriched atmosphere, permitting their recovery. Several of these mutants accumulated the substrate of the reaction of the mutated enzyme (Wingler et al., 2000), indicating that the photorespiratory cycle was active, albeit impaired, in 38 the mutant plants. This approach has been applied successfully to isolate photorespiratory mutants from several other species like barley and pea (Wingler et al., 2000; Foyer et al., 2009). The genetic analysis of such mutants allowed the identification of the genes involved in photorespiratory metabolism. Knockdown approaches in other species like tobacco also helped in the characterisation of the photorespiratory genes (Ferrario-Méry et al., 2000; 2002). The photorespiratory cycle has an important impact over several other metabolic processes. First of all, mutants with reduced activity of photorespiratory enzymes often showed reduced rates of CO 2 assimilation. This can be caused either by depletion of Calvin cycle metabolites, by a decline of the nitrogen status of the leaf or by inhibition of Calvin cycle activities due to the accumulation of photorespiratory metabolites (Wingler et al., 2000). In addition, several important pathways like nitrogen assimilation, respiration, one-carbon metabolism, purine biosynthesis (Bauwe et al., 2010) and redox signalling (Foyer et al., 2009) interact in different ways with photorespiration. Despite of the impact of photorespiration on several aspects of plant metabolism and growth, the enzymes involved in this pathway have been completely identified only recently (Reumann and Weber, 2006). Moreover, there is little information about the transcriptional response of photorespiratory genes to environmental stimuli and if they may be regulated in a coordinate way (Foyer et al., 2009). In our laboratory, the first photorespiratory mutants of legumes were isolated from the model legume Lotus japonicus (Orea et al., 2002; Márquez, 2005; Márquez et al., 2005). These mutants, deficient in plastidic GS 2 , were further characterised at the molecular level (Betti et al., 2006) as well as nodule function (García-Calderón et al., 2012). Under CO 2- enriched atmosphere, the mutants did not show any visible phenotype and only a slightly lower growth rate (Orea et al., 2002). However, the mutants accumulated high levels of ammonium when transferred from CO 2 -enriched to normal CO 2 atmosphere and showed severe stress symptoms when grown for long periods of time under these conditions. One of the mutants, named Ljgln2-2, was affected in its ability to recover after drought stress and presented a distinctive transcriptional response to water deprivation, demonstrating a novel link between plastidic GS 2 and droughtinduced proline accumulation (Díaz et al., 2010). In this work, we carried out a comparative study of the response to active photorespiration in WT and Ljgln2-2 mutant plants that were previously grown under conditions where the rate of photorespiration is very low (0.7% v/v CO 2 ; Orea et al., 2002). After the transfer to active photorespiratory conditions, a concerted regulation of the photorespiratory genes, together with massive transcriptomic changes and a 39 perturbation of central metabolism were observed in the case of the Ljgln2-2 mutant. Interestingly, most changes in transcript and metabolite levels were either parallel or opposite to the ammonium ones. The data presented in this paper provide novel information on the regulation of photorespiration and on the interaction between the photorespiratory pathway and the central metabolism of legumes. RESULTS AND DISCUSSION Kinetics of ammonium accumulation in the Ljgln2-2 mutant Previous studies showed that photorespiratory mutants of L. japonicus that are deficient in plastidic GS 2 accumulated ammonium at least during the first 24 hours after exposure to normal CO 2 atmosphere (Orea et al., 2002). We aimed now to study the time-course process of ammonium accumulation and to address the effect of an impaired photorespiratory cycle on an extended time-scale. WT plants and the plastidic GS 2 mutant Ljgln2-2 were grown under high CO 2 atmosphere (where photorespiration is very low) and then transferred to normal CO 2 atmosphere (normal photorespiration) for different periods of time up to 10 days. Free ammonium levels were determined in the sampled leaf tissue (Fig. 1). Not surprisingly, ammonium content in the WT leaves was extremely low over the time span of the experiment, indicating that the photorespiratory ammonium was efficiently reassimilated by GS 2 . However, the Ljgln2-2 mutant showed an almost 20-fold increase in NH 4+ levels reaching a maximum of about 60 µmol NH 4+ ·g FW -1 after 3 days, a content about 150 times higher than that of the WT. Figure 1. Ammonium content in leaves of WT and Ljgln2-2 mutant plants. Free ammonium was determined in plant leaves at different times of the transfer from high CO 2 (time zero) to normal CO 2 conditions for the indicated periods of time. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Data are the mean ± S.D. of three independent biological replicates. At some time points the error bars are too small to be noticed. Time (days) 0 2 4 6 8 10 Ammonium (µ µ µ µmol g FW-1) 0 20 40 60 80 40 Interestingly, the ammonium concentration dropped afterwards and reached a minimum of about 20 µmol·g FW -1 after 8 days of active photorespiration, still above WT levels. Beyond 10 days of incubation under normal CO 2 conditions, Ljgln2-2 plants showed important chlorosis and necrosis of the leaves. For this reason, longer incubation times were not considered in this study. A concerted repression of photorespiratory genes is triggered by photorespiratory conditions in the Ljgln2-2 mutant The ammonium levels in the Ljgln2-2 mutant showed a drop after a maximum level has been attained (Fig. 1). This was suggestive of the existence of a regulation of the photorespiratory metabolism. In order to investigate this, the expression of L. japonicus photorespiratory genes was quantified by qRT- PCR in WT and mutant plants at the same time points considered in Fig. 1. The expression levels of most of the genes analyzed showed a sudden drop after the transfer to normal CO 2 conditions in the mutant, with a reduction in transcript levels of about 70-80% after two or three days, followed in most cases by a slow recuperation (Fig. 2). This was not the case for the WT plants, where most genes did not show any clear tendency and only three of them (LjGln2, LjGlu1 and LjGlyK1, encoding for plastidic glutamine synthetase, ferredoxin-dependent GOGAT and a glycerate kinase isoform respectively) were repressed more than two-fold after the transfer to normal CO 2 conditions (Fig. 2, Supplemental Fig. S1). The coordinate repression and the similar trend in transcript levels observed for most photorespiratory genes in the mutant indicated that L. japonicus photorespiratory genes could be regulated in a common way. This is, to our knowledge, the first direct experimental evidence for a coordinate regulation of photorespiratory genes over time. For reason of space, the complete time course of transcript levels is presented in Fig. 2 for 6 of the 23 genes analyzed. However, the common transcriptional trend of the photorespiratory genes in the mutant is also evident when considering two time points: 2 days, where transcription is often minimal, and 8 days where the transcript levels show a slight recuperation. Significant differences in transcript levels between the two genotypes at these two key time points are highlighted in bold in Table 1. The complete transcriptional time-course for all the photorespiratory genes is available online (Supplemental Fig. S1). 41 Figure 2. Expression of some photorespiratory genes in Lotus japonicus plants under active photorespiration. WT (black dots, solid line) and Ljgln2-2 (white dots, dashed line) plants grown for 35 days in high CO 2 (time zero) were transferred to normal CO 2 conditions for the indicated periods of time. Leaves were harvested at the indicated time points for the quantification of different transcripts by qRT-PCR. Transcript levels are reported as relative units (r.u.). For comparative purposes, the transcript levels measured in the WT plants under high CO 2 conditions (time 0) were taken as 1. The expression profile of the following genes is presented: RUBISCO small subunit (LjRbc_s1, probeset chr2.TM1655.9); the H subunit of glycine decarboxylase (LjGDCH1, probeset Ljwgs_010991.0.1); serine:glyoxylate aminotransferase (LjSGAT2, probeset Ljwgs_079709.1); hydroxypyruvate reductase (LjHPR, probeset Ljwgs_011418.2); glycolate oxidase (LjGO1, probeset Ljwgs_013523.1) and the plastidic isoform of glutamine synthetase (LjGln2, probesets gi18266052 and TM1765.11). Data for all the measured genes are available online (Supporting Information Fig. S1). Data are the mean ± S.D. of three independent biological replicates. Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 48 Genes modulated only in WT plants Among the genes modulated by the transfer to normal CO 2 conditions, it was interesting to analyze separately the ones that changed exclusively in the WT genotype, since they probably represent part of the normal response of the plant to active photorespiration that is directly or indirectly dependent on plastidic GS 2 activity. A first global functional analysis of this small subset of 655 probesets was carried out using Pathexpress (Goffard and Weller, 2007a), a program that identifies the most relevant metabolic pathways associated with a subset of genes. The analysis carried out however did not discover any metabolic pathway that was significantly over-represented. For this reason, a further analysis of this group of genes was carried out using Genebins (Goffard and Weller, 2007b). This tool assigns genes to hierarchical categories (BINs) based on the ontology provided by the KEGG database, thus finding not only metabolic pathways but also cellular functions that are significantly up- or down-regulated in a microarray experiment. Genebins found that the gene families coding for three of the four core histones (H2B, H3 and H4) were statistically over-represented (Supplemental Fig. S5). Analysis of the corresponding 22 probesets indicated that the transcription of these histone genes was repressed roughly about two-fold in WT plants by the transfer to normal CO 2 conditions (Supplemental Table S1). This was curious since the transcription of the genes encoding for histone proteins is modulated mainly by the entry of the cells in S phase, rather than by external conditions. This general repression of the histone genes may indicate a reduced cellular division when WT plants are shifted from high CO 2 to normal CO 2 atmosphere. Several marker genes involved in cell division and in the control of the cell cycle were also repressed, supporting this hypothesis (Supplemental Table S1). qRT-PCR analysis of selected genes encoding for different histone proteins and cyclins confirmed the down-regulation depicted by the microarray study (Supplemental Table S2). The transcription of photorespiratory genes was almost unaffected in the WT by the transfer to normal CO 2 conditions, confirming the qRT-PCR data. This probably indicates that the WT plants do not need to modulate the expression of photorespiratory genes in order to cope with the transfer to photorespiratory active conditions. The full list of genes from this subset, together with the genes modulated in both genotypes and exclusively in the mutant as well as their MapMan overview of general metabolism are available online (Supplemental Table S1, Supplemental Fig. S6). 49 Genes modulated both in WT and Ljgln2-2 mutant plants In order to study the core/common response of L. japonicus to the change from high CO 2 to normal CO 2 atmosphere that is not dependent on plastidic GS 2 , we analyzed the group of 825 probesets that were modulated in both genotypes. The analysis of the fold change of these sequences revealed that about 90% of them (739 out of 825) changed in the same direction in the two plant genotypes (Fig. 5B). Interestingly, linear regression of the log 2 of the fold change for these genes in WT and mutant plants gave an angular coefficient value of 1.39 indicating that on average, these genes were elicited more than two-fold (2 1.39 = 2.62) in Ljgln2-2 compared to the WT. Díaz et al. (2010) demonstrated that most of the genes that changed both in WT and Ljgln2-2 in response to drought were also more modulated in the mutant. This suggested proportionality between the extent of the gene modulation and the level of stress perceived/received by the Ljgln2-2 mutant plants (Diaz et al. 2010). Figure 5. Genes elicited by the transfer from high CO 2 to normal CO 2 conditions in WT and Ljgln2-2 mutant plants. (A) Venn diagram representing the number of genes elicited by the transfer from high to normal CO 2 conditions in WT and Ljgln2-2 mutant plants. Significantly modulated genes were identified by comparing the log 2 of the mean of expression levels at 2 days and time zero and applying a false discovery rate (FDR) of < 0.05. The expression levels at time zero in the WT or in the mutant were used as a control for the WT and the mutant respectively. (B) Comparison of the log 2 of fold change value for the genes significantly elicited in both genotypes that changed in the same direction. A linear regression analysis was carried out (r 2 = 0.80, m = 1.39). Analysis of the data using Pathexpress gave three significantly more represented pathways: starch and sucrose metabolism, flavonoids biosynthesis and stilbene/lignin/coumarin biosynthesis (Supplemental Fig. S7). In the first case, down-regulation of the genes for both starch and sucrose degradation was 50 observed (Supplemental Fig. S8), suggesting that the drop in CO 2 concentration may be influencing carbohydrate metabolism in both genotypes. This is consistent with a decreased starch production in conditions of lower CO 2 availability and increased photorespiration. According with this hypothesis, starch and sucrose levels in the nodules of WT and Ljgln2-2 were reduced by the transfer from high CO 2 to normal CO 2 conditions (García-Calderón et al., 2012). Several genes for both flavonoids and stilbene/lignin/coumarin biosynthesis were induced upon transfer to normal CO 2 conditions, including genes encoding for key enzymes of these routes like chalcone synthase and isoflavone reductase (Supplemental Table S3). Flavonoids are a group of secondary metabolites belonging to the family of phenylpropanoids with different functions in plants, including protection from pathogens or ultraviolet light, and they can also act as scavengers of reactive oxygen species. Previous transcriptomic experiments carried out with salt-stressed WT Lotus japonicus plants (Sánchez et al., 2008) and drought-stressed WT and Ljgln2-2 mutant plants (Díaz et al., 2010) also reported the induction of genes for flavonoids biosynthesis, indicating that this is a common response of L. japonicus to different abiotic stresses. The last more represented pathway identified, stilbene/lignin/coumarin metabolism, is part of the larger phenylpropanoid pathway. The modulated genes identified within this group were essentially the same than the ones for flavonoid biosynthesis, as they represent common steps in the synthesis of different classes of phenylpropanoids. The repression of some key genes in starch and sucrose degradation and the induction of isoforms of chalcone synthase and isoflavone reductase in both genotypes were confirmend by qRT-PCR analysis (Supplemental Table S2). Analysis of this group of genes with Genebins gave 33 over-represented pathways and cellular functions, which can be classified mainly in three groups: carbohydrate metabolism, secondary metabolism and redox-related genes (Supplemental Fig. S5). While the physiological relevance of altered carbohydrate and secondary metabolism has been discussed previously, the modulation of redox-related genes observed also indicates that the atmospheric CO 2 concentration is able to affect the cellular redox state. Recent studies with Arabidopsis confirms this hypothesis (Queval et al., 2012 and references therein). Among the group of genes recognized by Genebins the pathways for starch and sucrose metabolism, flavonoids biosynthesis and stilbene/lignin/coumarin biosynthesis were defined as over-represented, confirming the results obtained with Pathexpress. A list of the genes belonging to these three pathways according to either Genebins or Pathexpress is available online as Supplemental Table S3 for comparative purposes. 51 Genes modulated only in Ljgln2-2 mutant plants The majority of the modulated probesets (almost 6000) corresponded to genes that changed specifically in Ljgln2-2 mutant plants by the transfer from high CO 2 to normal CO 2 conditions. Since this group of genes is elicited specifically in the absence of plastidic GS 2 , it can be inferred that they are truly responding to the presence of an impaired photorespiratory cycle and/or to the high levels of ammonium accumulated by the mutant. Pathexpress analysis identified two significantly more represented pathways: porphyrin/chlorophyll metabolism and carbon fixation (essentially the Calvin cycle) (Supplemental Fig. S7). The MapMan overview of photosynthesis-related genes showed that most photosynthetic genes, as well as several photorespiratory genes, were repressed exclusively in the mutant (Supplemental Fig. S9), confirming the data obtained by qRT-PCR. Moreover, several genes of the Calvin cycle and of the biosynthesis of photosynthetic pigments were repressed, indicating that there is a general shutdown of photosynthetic metabolism in the mutant. qRT-PCR analysis confirmed that genes encoding for enzymes of the Calvin cycle like sedoheptulose-1,7-bisphosphatase and fructose-1,6-bisphosphatase and key genes in porphirin/chloroplyll metabolism like glutamyl-tRNA reductase and magnesium chelatase were repressed in the mutant genotype (Supplemental Table S2). It is worth to notice that a mutation in a gene of nitrogen metabolism like LjGln2 affects the transcription of the genes of Calvin cycle, reflecting the tight interaction between C and N metabolism. Genebins analysis of the genes specifically elicited in Ljgln2-2 detected more than 120 over-represented gene families, spanning the majority of the primary and secondary metabolism, including for example carbon and nitrogen metabolism, biosynthesis of chlorophyll, amino acids metabolism, glycolysis, the Krebs cycle and starch/sucrose metabolism, among others (Supplemental Fig. S5). This indicates that impairment of the photorespiratory cycle and/or the subsequent accumulation of ammonium have a global effect on the metabolism of the leaf, revealing the crucial importance of the reassimilation of photorespiratory NH 4+ and the multiple metabolic interconnections of it. Once again, Genebins analysis confirmed that the two pathways recognized by Pathexpress, porphyrin/chlorophyll metabolism and carbon fixation were overrepresented (Supplemental Fig. S5, Supplemental Table S3). Many genes associated with photorespiration such as those for transporters involved in substrate flow between the chloroplast, the mitochondrion and the 52 peroxisome have not been, with counted exceptions, characterised (Bauwe et al., 2010; Peterhansel et al., 2010; Weber and von Caemmer, 2010; Eisenhut et al., 2013; Pick et al., 2013). Interestingly, we found 287 transporter gene sequences within the group of genes modulated exclusively in the mutant, several of them with unknown function. Future experiments should be designed in order to characterise these transporter genes and, particularly, to determine if any of them may be involved in the transport of photorespiratory metabolites. Metabolite profiling analysis The transcriptomic analysis carried out for the Ljgln2-2 mutant was complemented with further metabolic analysis using gas chromatography-mass spectrometry technology (GC/EI-TOF-MS). Changes in the levels of soluble metabolites between WT and mutant plants were examined at the different time points considered in Figs. 1, 2, 3 and 4. For a targeted analysis of metabolites, we compiled a total of 202 mass spectral tags (MSTs, i.e. manually recognized analytes, Desbrosses et al., 2005), including known and yet unknown compounds (Supplemental Table S4). Of the latter group, 31 MSTs represented unknown metabolites which were so far found only in Lotus species (indicated by a D code, Sánchez et al., 2011). The metabolite profiles were statistically analyzed with a supervised two-factorial ANOVA at a stringent threshold (P < 0.0001), using the factors “genotype” (Ljgln2-2 and WT) and “time of exposure to normal CO 2 ” (0, 2, 3, 4, 6, 8 and 10 days after transfer from high CO 2 to normal CO 2 atmosphere). A total of 100 MSTs were found to be significantly changed, most of them due to the genotype factor (94 MSTs), thus demonstrating a profound metabolic effect of the Ljgln2-2 mutation upon exposure to photorespiratory conditions (Supplemental Table S4). 5 different patterns of behaviour were recognized as global metabolomic responses of the statistically changed MSTs (Fig. 6): (a) Metabolites that increased in the mutant upon transfer to normal CO 2 conditions with no change in the WT (40 MSTs); in many cases their content was low under a high CO 2 atmosphere. This group included several amino acids including Gly, Leu, Ile, Val, Trp, Phe and organic acids such as malate, citrate, succinate and 2-oxoglutarate. (b) Metabolites that increased in the mutant upon transfer to normal CO 2 conditions, but decreased in the WT (8 MSTs), including mannose, glucose, glucose-6-P and glutamine. 53 (c) Metabolites that showed a higher content in the mutant background under high CO 2 conditions, which sometimes increased upon transfer to normal CO 2 conditions only in the mutant (23 MSTs). These included many unknown compounds, and particular organic acids such as saccaric acid, gluconic acid, glucaric acid-1,4-lactone, 2-isopropyl-malic acid and 2-piperidine-carboxylic acid. (d and e) Metabolites that increased/decreased in WT or mutant but showed lower content in the mutant background under high CO 2 conditions (group d, 9 MSTs), or behave sometimes transiently or to a higher level in the mutant when the content at day 0 was similar between both genotypes (group e, 14 MSTs). These groups included metabolites such as proline, trehalose, putrescine, myoinositol, and also key metabolites linking nitrogen and carbon metabolism like aspartate and glutamate. Finally, four metabolites (Uric acid (4TMS), A182009, A180002 and A281001) were ruled out from our statistical analysis because their levels were below the detection limit in most WT samples, but in Ljgln2-2 they displayed a high peak at days 3-4 after transfer to normal CO 2 atmosphere (Supplemental Table S4). The first two groups suggest the existence of metabolic pathways which were secondarily elicited as a result of the metabolic toxicity due to the lack of a complete photorespiratory cycle, or in which the plastidic GS 2 is directly required for physiological acclimation to: (i) the changes induced by active photorespiration, (ii) the detoxification of ammonium, or (iii) changes in carbon level due to the transition from high CO 2 atmosphere to normal CO 2 . The increase of various amino acids (Leu, Val, Ile, Trp, Phe, Lys, Gly) found exclusively in the mutant suggests that nitrogen metabolism was not a limiting factor for the mutant fitness but rather a means to ammonium detoxification. In line with this idea, the levels of these amino acids paralleled the peak of ammonium at day 3. Curiously, glutamine showed a distinctive pattern as it remained increased until day 10 in the mutant (Fig. 6, group b). This demonstrates that the Ljgln2-2 mutant is able to produce high levels of glutamine, even in the absence of plastidic GS 2 , which is the most abundant GS isoform in L. japonicus leaves (Orea et al., 2002; Betti et al., 2006). Cytosolic GS 1 should be then responsible of the accumulation of glutamine in the mutant. The fact that glutamine levels in the mutant were high even after the drop in ammonium levels may also suggest that the cytosolic GS 1 54 isoform could be detoxifying the photorespiratory ammonium and contribute partially to the reduction of NH 4+ levels after day 3 Figure 6. Metabolite profiling of WT and Ljgln2-2 mutant plants. The metabolomic profiles of WT and Ljgln2-2 mutant plants were statistically analyzed using a supervised two-factorial ANOVA, with “genotype” and “time of exposure to normal CO 2 ” (0, 2, 3, 4, 6, 8 and 10 days after transfer from high to normal CO 2 atmosphere) as factors at a stringent threshold (P < 0.0001). 5 different groups were defined by clustering tools. Data represent the direct normalized responses of metabolite pool measures. The color bar represents this relative unit (r.u.). Further details in Materials and Methods. 55 In accordance with this hypothesis, two probesets corresponding to cytosolic GS 1 (Ljwgs_088254.1 and Ljwgs_015806.2) were induced about twofold exclusively in the mutant. A search in the gene databases of L. japonicus revealed the existence of at least three different genes encoding for cytosolic GS 1 in this model legume (not shown). The two probesets previously mentioned corresponded to the same LjGln1 gene encoding for a cytosolic GS isoform located on chromosome 6 that will be called from now on LjGln1.2. qRT-PCR analysis confirmed that this gene was induced about two-fold in the mutant under active photorespiratory conditions (Fig. 7). The increase in LjGln1.2 transcript was also paralleled by an increase in GS enzyme activity in Ljgln2-2 mutant plants, which was not observed in WT plants (Fig. 7). This induction of a cytosolic GS 1 isoform may explain the increase of the glutamine pool observed in the mutant. Moreover, the increased GS 1 activity may also be involved in the reduction of the ammonium levels after the maximum attained at day 3 (Fig. 1) Figure 7. LjGln1.2 cytosolic GS transcript levels (A) and total GS activity (B) in WT and Ljgln2-2 mutant plants. (A) The relative expression levels of the LjGln1.2 gene encoding for a cytosolic GS isoform were determined by qRT-PCR in leaves of WT (black dots, solid line) and Ljgln2-2 (white dots, dashed line). Plants were grown under high CO 2 for 35 days and transferred for the indicated periods of time to normal CO 2 atmosphere. Transcript levels are reported as relative units (r.u.). For comparative purposes, the transcript levels measured in the WT plants before the transfer to normal CO 2 conditions (time 0) were taken as 1. (B) The GS specific activity was determined in crude extracts from leaves of WT (black dots, solid line) and Ljgln2-2 (white dots, dashed line) at the same time points as in (A). Total GS activity is reported as relative units (r.u.). For comparative purposes, the specific GS activity at time zero in WT or in mutant leaves was taken as 1 for WT and mutant respectively. Total GS activity at time zero was 591 and 85 mU/mg protein in WT and mutant leaves respectively. Data are the mean ± S.D. of three independent biological replicates. Group c, composed mainly of unknown metabolites, suggests the existence of metabolic pathways in which plastidic GS 2 is constitutively required for particular metabolic processes, and may, in some cases, be involved in the 56 acclimation to changes induced by the transfer from high CO 2 to normal CO 2 conditions. The two last groups of metabolites (groups d and e) suggest the existence of general metabolic pathways required for the acclimation to the changes induced by the transition from high CO 2 to normal CO 2 atmosphere. Interestingly, in addition to several unknown compounds, various important nitrogen metabolites clustered in these two groups. Aspartate levels in the mutant were almost half of the WT under control conditions, while asparagine was only slightly lower in the mutant in the same conditions. This could indicate that in the mutant under non-photorespiratory conditions Asp and Asn may be used more extensively as amino donors. This is possibly related to the fact that asparagine constitutes most (86%) of the nitrogen translocated in L. japonicus plants (Credali et al., 2011). The decrease of glutamate in the mutant under normal CO 2 conditions is quite surprising considering that the levels of this amino acid are normally quite stable in plants (Forde and Lea, 2007), and could be explained by the great accumulation of several amino acids (Fig. 6, group a) that may drain the glutamate pool. Proline levels decreased in both genotypes as a consequence to the shift to normal CO 2 conditions. Despite of this common trend, proline levels were higher in the mutant than in the WT at all the experimental time points considered. This is surprising since it was previously described that the Ljgln2-2 mutant accumulated lower amounts of proline than the WT under drought stress conditions (Díaz et al., 2010). Plastidic GS 2 is thus important in L. japonicus proline production only under particular stress conditions such as drought, but not under the stress conditions caused by impaired photorespiration. Trehalose levels also decreased in both genotypes after shift to normal CO 2 conditions. Both proline and trehaolse are molecules that accumulate in response to different kind of stresses (Sánchez et al., 2011). The similar trend shown by these two compounds indicates that the general responses against environmental changes were conserved between WT and mutant plants and that proline levels may differ in the two genotypes even in absence of osmotic stress. While most of the metabolites analyzed belonged to different pathways, four organic acids that are also intermediates of the Krebs cycle where significantly altered in the mutant indicating a relationship between plastidic GS 2 and central carbon metabolism. Since the time-course of these four metabolites was of particular interest, their time course in both genotypes is shown more in detail in Fig. 8. Data for all the other metabolites can be found both in Fig. 6 and in Supplemental Table S4. The accumulation of NH 4+ , as well as the increase in ATP/ADP ratio and in NADH and NADPH levels in photorespiratory mutants is 57 known to inhibit the Krebs cycle at the level of pyruvate dehydrogenase and isocitrate dehydrogenase (Bykova et al., 2005; Bauwe et al., 2010). qRT-PCR analysis of genes encoding for components of the pyruvate dehydrogenase multienzyme complex (pyruvate dehydrogenase and dihydrolipoamide-S- acetyltransferase) and for the mitochondrial NAD-dependent isocitrate dehydrogenase (IDH) showed a general transcriptional repression over time, with the only exception of a very slight induction of IDH in the mutant at 2 days (Supplemental Table S2). Taking this into consideration, it seems unlikely that the accumulation of Krebs cycle intermediates may be related to transcriptional regulation of the genes involved in this pathway. Figure 8. Time-course of some organic acids in WT and mutant plants. The relative amount of some organic acids that were defined as significantly different between WT and mutant by the statistical analysis of Fig. 6 is reported at different times after the transfer of the plants to normal CO 2 conditions. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Metabolite levels are reported as relative units (r.u.). Citric acid Succinic acid Time (days) 0 2 4 6 8 10 12 2-oxoglutarate malic acid 5 10 15 20 25 10 15 20 25 5 10 15 20 5 10 15 20 Metabolite (r.u.) Citric acid Succinic acid Time (days) 0 2 4 6 8 10 12 2-oxoglutarate malic acid 5 10 15 20 25 10 15 20 25 5 10 15 20 5 10 15 20 Metabolite (r.u.) 64 spectrometry (GC-EI-TOF/MS) based plant metabolomics. Metabolomics 5: 479-496 Araújo WL, Ishizaki K, Nunes-Nesi A, Larson TR, Tohge T, Krahnert I, Witt S, Obata T, Schauer N, Graham IA, et al (2010) Identification of the 2- hydroxyglutarate and isovaleryl-CoA dehydrogenases as alternative electron donors linking lysine catabolism to the electron transport chain of Arabidopsis mitochondria. Plant Cell 22: 1549-1563 Bauwe H, Hagemann M, Fernie AR (2010) Photorespiration: players, partners and origin. Trends Plant Sci 15: 330-336 Betti M, Arcondéguy T, Márquez AJ (2006) Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase: functional properties of purified GLN2 enzymes. Planta 224: 1068-1079 Bykova NV, Keerberg O, Pärnik T, Bauwe H, Gardeström P (2005) Interaction between photorespiration and respiration in transgenic potato plants with antisense reduction in glycine decarboxylase. Planta 222: 130-140 Credali A, Díaz-Quintana A, García-Calderón M, De la Rosa MA, Márquez AJ, Vega JM (2011) Structural analysis of K + -dependence in L-asparaginases from Lotus japonicus. Planta 234: 109-122 Czechowski T, Bari RP, Stitt M, Scheible WR, Udvardi MK (2004) Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant J 38: 366–379 Desbrosses GG, Kopka J, Udvardi MK (2005) Lotus japonicus metabolic profiling. Development of gas chromatography-mass spectrometry resources for the study of plant-microbe interactions. Plant Physiol 137: 1302-1318 Díaz P, Betti M, Sánchez DH, Udvardi MK, Monza J, Márquez AJ (2010) Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytol 188: 1001-1013 Eisenhut M, Pick TR, Bordych C, Weber APM (2013) Towards closing the remaining gaps in photorespiration – the essential but unexplored role of transport proteins. Plant Biol 15: 676-685 Ferrario-Méry S, Suzuki A, Kunz C, Valadier MH, Roux Y, Hirel B, Foyer CH (2000) Modulation of amino acid metabolism in transformed tobacco plants deficient in Fd-GOGAT. Plant Soil 221: 67-79 Ferrario-Méry S, Hodges M, Hirel B, Foyer CH (2002) Photorespiration-dependent increases in phosphoenolpyruvate carboxylase, isocitrate dehydrogenase and glutamate dehydrogenase in transformed tobacco plants deficient in ferredoxin-dependent glutamine-α-ketoglutarate aminotransferase. Planta 214: 877-886 65 Forde BG, Lea PJ (2007) Glutamate in plants: metabolism, regulation and signalling. J Exp Bot 58: 2339-2358 Foyer CH, Bloom A, Queval G, Noctor G (2009) Photorespiratory Metabolism: Genes, Mutants, Energetics and Redox Signalling. Annu Rev Plant Biol 60: 455-484 Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y, Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr Opin Plant Biol 9: 436-442 García-Calderón M, Chiurazzi M, Espuny R, Márquez AJ (2012) Photorespiratory metabolism and nodule function: behaviour of Lotus japonicus mutants deficient in plastid glutamine synthetase. Mol Plant Microbe Interact 25: 211- 219 Goffard N, Weiller G (2007a) Pathexpress: a web-based tool to identify relevant pathways in gene expression data. Nucleic Acids Res 35: W176-W181 Goffard N, Weiller G (2007b) Genebins: a database for classifying gene expression data, with application to plant genome arrays. BMC Bioinformatics 8: 87 Guether M, Balestrini R, Hannah M, He J, Udvardi MK, Bonfante P (2009) Genome-wide reprogramming of regulatory networks, transport, cell wall and membrane biogenesis during arbuscular mycorrhizal symbiosis in Lotus japonicus. New Phytol 182: 200-212 Hall NP, Reggiani R, Lea PJ (1985) Molecular weights of glycollate oxidase from C 3 and C 4 plants determined during early stages of purification. Phytochem 24: 1645-1648 Handberg K, Stougaard J (1992) Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. Plant J 2: 487-496 Hirel B, Le Gouis J, Ney B, Gallais A (2007) The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. J Exp Bot 58: 2369-2387 Høgslund N, Radutoiu S, Krusell L, Voroshilova V, Hannah MA, Goffard N, SánchezDH, Lippold F, Ott T, Sato S, et al (2009) Dissection of symbiosis and organ development by integrated transcriptome analysis of Lotus japonicus mutant and wild-type plants. PLoS ONE 4: e6556 Hoshida H, Tanaka Y, Hibino T, Hayashi Y, Tanaka A, Takabe T, Takabe T (2000) Enhanced tolerance to salt stress in transgenic rice that overexpress chloroplast glutamine synthetase. Plant Mol Biol 43: 103-111 Keys AJ, Leegood RC (2002) Photorespiratory Carbon and Nitrogen Cycling: Evidence from Studies of Mutant and Transgenic Plants. In: CH Foyer, G Noctor, eds, Advances in Photosynthetic Nitrogen Assimilation and 66 Associated Carbon and Respiratory Metabolism, Ed 1 Vol 1. Kluwer Academic Publisher, Dordrecht, The Netherlands, pp 115-134 Kopka J, Schauer N, Krueger S, Birkemeyer C, Usadel B, Bergmüller E, Dörmann P, Weckwerth W, Gibon Y, Stitt M, et al (2005) [email protected]: the Golm Metabolome Database. Bioinformatics 21: 1635-1638 Kozaki A, Takeba G (1996) Photorespiration protects C3 plants from photooxidation. Nature 384: 557-560 Kusano M, Tabuchi M, Fukushima A, Funayama K, Diaz C, Kobayashi M, Hayashi N, Tsuchiya YN, Takahashi H, Kamata A, et al (2011) Metabolomics data reveals a crucial role of cytosolic glutamine synthetase 1;1 in coordinating metabolic balance in rice. Plant J 66: 456-466 Lohse M, Nunes-Nesi A, Krüger P, Nagel A, Hannemann J, Giorgi FM, Childs L, Osorio S, Walther D, Selbig J, et al (2010) Robin: An Intuitive Wizard Application for R-Based Expression Microarray Quality Assessment and Analysis. Plant Physiol 153: 642-651 Luedemann A, Strassburg K, Erban A, Kopka J (2008) TagFinder for the quantitative analysis of gas chromatography-mass spectrometry (GC-MS) based metabolite profiling experiments. Bioinformatics 24: 732-737 Maier A, Fahnenstich H, von Caemmerer S, Engqvist MKM, Weber APM, Flügge U-I, Maurino VG (2012) Transgenic introduction of a glycolate oxidative cycle into A. thaliana chloroplasts leads to growth improvement. Front Plant Sci 3: 38 Márquez AJ (2005) Lotus japonicus handbook. Dordrecht, The Netherlands: Springer Márquez AJ, Betti M, García-Calderón M, Palove-Balang P, Díaz P, Monza J (2005) Nitrate assimilation in Lotus japonicus. J Exp Bot 56: 1741-1749 Maurino MG, Peterhansel C (2010) Photorespiration: current status and approaches for metabolic engineering. Curr Opin Plant Biol 13: 249-256 Orea A, Pajuelo P, Pajuelo E, Quidiello C, Romero J, Márquez AJ (2002) Isolation of photorespiratory mutants from Lotus japonicus deficient in glutamine synthetase. Physiol Plant 113: 193-202 Peterhansel C, Horst I, Niessen M, Blume C, Kebish R, Kürkcüoglu S, Kreuzaler F (2010) Photorespiration. The Arabidopsis Book 8: e0130 TR, Bräutigam A, Schulz MA, Obata T, Fernie AR, Weber APM (2013) PLGG1, a plastidic glycolate glycerate transporter, is required for photorespiration and defines a unique class of metabolite transporters. PNAS DOI: 10.1073/pnas.1215142110 Queval G, Neukermans J, Vanderauwera S, Van Breusegem F, Noctor G (2012) Day lenght is a key regulator of transcriptomic responses to both CO 2 and 67 H 2 O 2 in Arabidopsis. Plant Cell Environ 35: 374-387 Rao MV, Lee G, Creelman RA, Mullet JE, Davis KR (2010) Jasmonic acid signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12: 1633-1646 Reumann S, Weber APM (2006) Plant peroxisomes respire in the light: some gaps of the photorespiratory C 2 cycle have been filled – Others remain. Biochim Biophys Acta 1763: 1496-1510 Rojas CM, Senthil-Kumar M, Wang K, Ryu C-M, Kaundal A, Mysore KS (2012) Glycolate oxidase modulates reactive oxygen species-mediated signal transduction during nonhost resistance in Nicotiana benthamiana and Arabidopsis. Plant Cell 24: 336-352 Saeed AI, Hagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li JW, Thiagarajan M, White JA, Quackenbush J (2006) TM4 microarray software suite. Methods Enzymol 411: 134-193 Sánchez DH, Lippold F, Redestig H, Hannah MA, Erban A, Krämer U, Kopka J, Udvardi MK (2008) Integrative functional genomics of salt acclimatation in the model legume Lotus japonicus. Plant J 53: 973-987 Sánchez DH, Szymanski J, Erban A, Udvardi MK, Kopka J (2010) Mining for robust transcriptional and metabolic responses to long-term salt stress: a case study on the model legume Lotus japonicus. Plant Cell Environ 33: 468-480 Sánchez DH, Schwabe F, Erban A, Udvardi MK, Kopka J (2011) Comparative metabolomics of drought acclimation in model and forage legumes. Plant Cell Environ 35: 136-149 Solorzano L (1969) Determination of ammonia in natural waters by the phenolhypoclorite methos. Ocean Limno Oceanogr 14: 799-801 Taler D, Galperin M, Benjamin I, Cohen Y, Kenigsbuch D (2004) Plant eR genes that encode photorespiratory enzymes confer resistance against disease. Plant Cell 16: 172-184. Takahashi S, Bauwe H, Badger M (2007) Impairment of the photorespiratory pathway accelerates photoinhibition of photosystem II by suppression of repair but not acceleration of damage processes in Arabidopsis. Plant Physiol 144: 487-494 Timm S, Mielewczik M, Florian A, Frankenbach S, Dreissen A, Hocken N, Fernie AR, Walter A, Bauwe H (2012) High-to-low CO 2 acclimation reveals plasticity of the photorespiratory pathway and indicates regulatory links to cellular metabolism in Arabidopsis. PLoS ONE 7: e42809 Usadel B, Nagel A, Thimm O, Redestig H, Blaesing OE, Palacios-Rojas N, Selbig J, Hannemann J, Piques MC, Steinhauser D, et al (2005) Extension of the visualization tool MapMan to allow statistical analysis of arrays, 68 display of corresponding genes, and comparison with known responses. Plant Physiol 138: 1195-1204 Wagner C, Sefkow M, Kopka J (2003) Construction and application of a mass spectral and retention time index database generated from plant GC/EITOF-MS metabolite profiles. Phytochemistry 62: 887-900 Weber APM, von Caemmer S (2010) Plastid transport and metabolism of C 3 and C 4 plants – comparative analysis and possible biotechnological exploitation. Curr Opin Plant Biol 13: 257-265 Wingler A, Lea PJ, Quick P, Leegood RC (2000) Photorespiration: metabolic pathways and their role in stress protection. Philos Trans R Soc Lond B Biol Sci 355: 1517-1529 69 Figure Legends: Supplemental Figure S1: Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 LjRbc_ Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 LjRbc Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 LjRbc_ Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 LjRbc_ LjPglP Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjPglP Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 LjGO 70 Time (days) 0246810 Transcript (r.u.) 0,0 0,5 1,0 1,5 2,0 Time (days) 0246810 Transcript (r.u.) 0,0 0,5 1,0 1,5 2,0 2,5 3,0 3,5 Time (days) 0246810 Transcript (r.u.) 0,0 0,5 1,0 1,5 2,0 2,5 LjGO LjSGA Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 LjSGA Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjG DC LjGDC Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGDC 71 Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGDC Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGDC Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjSHM Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjSHM Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 LjHP Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGlyK 72 Supplemental Figure S1. Expression of photorespiratory genes in Lotus japonicus plants under active photorespiration. WT (solid line, black dots) and Ljgln2-2 (dashed line, white dots) plants grown for 35 days in high CO 2 (time 0) were transferred to normal CO 2 conditions. Leaves were harvested at the indicated time points and the transcripts quantified by qRT-PCR. Transcript levels are reported as relative units (r.u.). For comparative purposes, the transcript levels measured in the WT plants under high CO 2 conditions (time 0) were taken as 1. The expression Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGly Time (days) 0246810 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjGln Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 LjGlu Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 2.5 3.0 LjDiT Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjDiT2 73 of the following genes was studied: a gene for the RUBISCO large subunit (LjRbc_l, probeset lj_rbcl); two genes for the RUBISCO small subunit (LjRbc_s1 and LjRbc_s2, probesets chr2.TM1655.9 and chr1.TM0220.16); two for phosphoglycolate phosphatase (LjPgP1 and LjPgP2, probeset Ljwgs_028307.1 and TM0684.53); two for glycolate oxidase (LjGO1 and LjGO2, probesets Ljwgs_013523.1 and Ljwgs_038509.1); two for serine:glyoxylate aminotransferase (LjSGAT1 and LjSGAT2, probesets chr6.TM0085.11 and Ljwgs_079709.1); two for the H subunit of glycine decarboxylase (LjGDCH1 and LjGDCH2, probesets Ljwgs_010991.0.1 and Ljwgs_087246.1); two for the P subunit of glycine decarboxylase (LjGDCP1 and LjGDCP2, probesets chr5.CM0019.2 and chr5.CM0569.17.1); one for the T subunit of glycine decarboxylase (LjGDCT, probeset TM1304.24) two for serine:hydroxymethiltransferase (LjSHM1 and LjSHM2, probesets Ljwgs_022333.1 and Ljwgs_020174.1); one for hydroxypyruvate reductase (LjHPR, probeset Ljwgs_011418.2); two for glycerate kinase (LjGlyK1 and LjGlyK2, probesests chr3.CM0253.10.1 and chr3.CM0226.44); one for plastidic glutamine synthetase (LjGln2, probesets gi18266052 and TM1765.11); one for ferredoxin-dependent GOGAT (LjGlu1, probesets chr1.CM0009.24, Ljwgs_090201.1 and Ljwgs_068766.1) and two different isoforms of the plastidic dicarboxylate transporter: LjDiT1 (probesets chr5.CM0089.81) and LjDiT2.1 (probesets chr6.CM0055.63.1 and chr6.CM0055.71). Glutamate:glyoxylate aminotransferase (LjGGAT, probeset chr2.CM0088.66) transcript was not detectable. Data are the mean ± S.D. of three independent biological replicates. 80 Supplemental Figure S4: Supplemental Figure S4. Validation of microarray data by qRT-PCR. A comparison of the log 2 of the fold-change in relative gene expression levels after the transfer from high CO 2 to normal CO 2 conditions according to either qRT-PCR or microarray analysis is presented. The parameters obtained with a linear regression analysis of the data are reported in the inset. Only genes that were significantly modulated according to the Affychip were validated by qRT-PCR. 56 genes whose expression levels were determined to confirm the gene ontology analysis (Supplemental Table S2) or to study photosynthetic and photorespiratory metabolism (Supplemental Figs. S1 and S3, Table 1) were chosen for this study. Data are the mean of three independent biological replicates and include both WT and mutant genotypes. 81 Supplemental Figure S5: WT only 82 Shared 83 Ljgln2-2 only 84 Ljgln2-2 only (follows from previous page) 85 Supplemental Figure S5. Genebins analysis of over-represented BINs. The over-represented BINs among the probesets modulated by the transfer from high CO 2 to normal CO 2 conditions were obtained using the program Genebins. Genes elicited exclusively in WT plants (WT only), in both genotypes (Shared) and exclusively in the mutant (Ljgln2-2 only) were analysed separately. The significant BINs (P < 0.05, Bonferroni correction) are highlighted in red. Ljgln2-2 only (follows from previous page) 86 Supplemental Figure S6: WT only 87 Amino acid synthesis Amino acid degradation WT Ljgln2-2 WT and Ljgln2-2 , shared 88 Supplemental Figure S6. MapMan metabolism overview of probesets elicited by the transfer from high CO 2 to normal CO 2 conditions. The genes modulated exclusively in WT plants, in both genotypes and exclusively in the mutant are reported in each slide. Each square corresponds to a gene. Red and blue indicate higher and lower expression than the control, respectively. The scale bar is shown in log 2 . Amino acid synthesis Amino acid degradation Ljgln2-2 only 89 Supplemental Figure S7: Supplemental Figure S7. Pathexpress analysis of overrepresented pathways. Significantly over-represented pathways (P < 0.1, FDR correction) among the probesets modulated by the transfer from high CO 2 to normal CO 2 conditions exclusively in WT plants (WT only), in both genotypes (Shared) and exclusively in the mutant (Ljgln2-2 only) are highlighted in red. Amin o Amino acid degradatio 96 Fig. 1 Experimental design used in this work and ammonium content in WT and Ljgln2-2 mutant leaves. WT and mutant plants were grown under high CO 2 conditions (0.7% v/v) and then transferred to normal CO 2 conditions (0.04% v/v). Samples for total NH 4+ determination, as well as for RNA and metabolite extraction were taken at the indicated time points. Data are the mean ± SD of three independent biological replicates. In this paper we present a complete study of all the metabolic reactions that may be involved in NH 4+ detoxification in the Ljgln2-2 photorespiratory mutant. For this, we carried out measurement of gene expression, polypeptide content, and enzyme activity as well as of the relative levels of the metabolites involved in the corresponding reactions. The data presented here demonstrate that cytosolic GS 1 , GDH and ASN are induced in the mutant in correspondence to NH 4+ accumulation, and suggest a role for these enzymes in NH 4+ detoxification in L. japonicus. A model for the distribution of the NH 4+ generated in the mutant under active photorespiratory conditions is also presented. MATERIALS AND METHODS Plant material and growth Lotus japonicus (Regel) Larsen cv. Gifu was initially obtained from Professor Jens Stougaard (Aarhus University, Denmark) and then self-propagated at the University of Seville. WT and Ljgln2-2 mutant plants were grown as described by Pérez-Delgado et al. (2013). For Ljgln2-2, the mutant progeny of two consecutive backcrosses into the WT background was used in this work. WT and mutant seeds were scarified and surface-sterilized, then germinated in 1% (w/v) agar in Petri dishes and transferred to pots using vermiculite as solid support. Five seedlings were planted in each pot and grown during 35 d in a growth chamber under 16 h : 8 h day : night, 20 : 18°C, with a photosynthetic photon flux density of 250 µmol m −2 s −1 and a constant humidity of 70%. CO 2 was automatically injected to a final concentration of 0.7% (v/v) to allow for normal growth of the Ljgln2-2 mutant in a photorespiration-suppressed atmosphere. Plants were watered with “Hornum” nutrient solution, containing High CO 2 35 Normal CO 2 10 0 2 3 4 6 8 10 97 5 mM NH 4 NO 3 and 3 mM KNO 3 (Handberg and Stougaard, 1992). After 35 days of growth under high CO 2 atmosphere, leaf tissue was harvested for each plant genotype, constituting the time zero point (photorespiration suppressed conditions). The plants were then transferred to normal air (0.04% CO 2 v/v) and each plant genotype was sampled at different time points (Fig. 1). The leaf tissue was flash-frozen in liquid N 2 , grinded with a pestle in a mortar that was precooled with liquid N 2 and the powder was stored at -80 ºC until use. Three independent biological replicates were harvested for each genotype and time point. A biological replicate consisted of tissue pooled from five plants grown in the same pot. RNA extraction, cDNA synthesis and qRT-PCR RNA extraction was carried out using the hot borate method as described by Sánchez et al. (2008). cDNA synthesis was carried out with the Superscript III reverse transcriptase exactly as described by Pérez-Delgado et al. (2013). qRT- PCR was carried out in a LightCycler 480 thermal cycler (Roche) using the SensiFAST SYBR No-ROX Kit (Bioline) also using the same conditions described by Pérez-Delgado et al. (2013). Expression levels were quantified by determining the C T cycle of each reaction with the LightCycler 480 software version 1.5.0. Analysis of expression data was performed using the geometric mean of four housekeeping genes for normalization. The housekeeping genes were LjGPI-anchored protein (probeset: chr3.CM0047.42), LjPp2A (probeset: chr2.CM0310.22), LjUbc10 (probeset: chr1.TM0487.4) and LjUbq (probeset: chr5.CM0956.27); these genes were selected amongst the most stably expressed genes in plants (Czechowski et al., 2005). A list of all the primer used for qRT- PCR is provided Table S1. Preparation of crude extracts Frozen leaf tissue was extracted with a pellet homogeniser in 5 ml / g FW of extraction buffer. The homogenated was centrifuged for 15 min at 15,000 g and 4 ºC and the supernatant constituted the crude extract. The extraction buffer for GS activity assay and immunoblot was prepared according to Orea et al., 2002. For GDH activity and immunoblot the extraction buffer was 100 mM Tris·HCl pH 8 with 1% of polyvinylpolypyrrolidone. The extraction buffer for CPS activity assay was prepared according to Pierson et al. 1980. 98 Western Blot Western blots from denaturing PAGE were performed using the ECL Western blotting system (GE Healthcare) according to the manufacturer instructions. SDS-PAGE was performed according to the method of Laemmli (1970) using a Mini-Protean Tetra Cell system (Bio-Rad). An acrylamide concentration of 12%, 10% and 12.5 (w/v) was used for the SDS-PAGE running gels used for immunodetection of GS, GDH and ASN respectively. Stacking gels were always prepared at 4% (w/v) acrylamide. 10 µg of total protein from leaf crude extracts were loaded in each well of the gels. Protein concentration was quantified using the Bradford protein assay (Bio-Rad). The polypeptide molecular weights were estimated using the broad range molecular weight standards (Bio-Rad). Anti-GS primary antibodies were raised in rabbit immunised with the recombinant homopolymeric α GS from Phaseolus vulgaris purified by metalaffinity chromatography (Betti et al. 2002) and used at 1:1,000 dilution. Anti- GDH primary antibodies (a gift from K.A. Roubelakis-Angelakis, University of Crete) were raised in rabbit using purified NADH-GDH from grapevine (Loulakakis and Roubelakis-Angelakis 1990). Anti-ASN antibodies (a gift from FM Cánovas and RA Cañas, University of Málaga) were raised in rabbit using purified ASN from Scots pine (Pynus sylvestris L.) as described by Cañas et al. (2006). Anti-rabbit secondary antibodies labelled with peroxidase were obtained from GE Healthcare. Detection of peroxidase signal in the membranes was carried out with a quimioluminescence detection system (Fujifilm LAS 3000 mini, Fujifilm). Relative quantification of the polypeptide levels was carried out for three different biological replicates for each time point and genotype. Densitometry measurements were performed with the ImageJ software (http://rsb.info.nih.gov/ij/). Enzyme activity assays GS enzyme activity was determined by measuring ATP hydrolysis as described by Márquez et al. (2005). GDH aminating and deaminating activities were measured as described by Loulakakis and Roubelakis-Angelakis, 1991, except that it was used 0.1 mM of NADH/NADPH in the aminating reaction. 99 CPS enzyme activity was determined according to Doremus (1986). Assays for ASN enzyme activity were carried out according to Sheng et al. (1993). Metabolite profiling analysis Metabolite profiling analysis was carried out using the dataset generated by Pérez-Delgado et al. (2013). Statistical differences between metabolite levels were assessed with two-way ANOVA at P < 0.001 using the Multiexperiment Viewer version 3.1 (Saeed et al. 2006) and the factors “genotype” and “time under normal CO 2 ”. Only metabolites that showed significant differences according to this analysis were considered. The relative metabolite levels presented in this paper are the direct normalized responses of metabolite pool measures, that is, mass detector signals in arbitrary units normalized to internal standard and sample fresh weigh. Ammonia determination was carried out according to the method of Solorzano (1969) with some modifications as described by Orea et al. (2002). CP content in crude extracts was determined with the same colorimetric method used for CPSase activity but using undialyzed extracts. RESULTS Ammonium accumulation and induction of cytosolic GS 1 in the Ljgln2-2 mutant The drop in ammonium levels observed after the maximum at day 3 in the mutant (Fig. 1) suggested a possible regulation of the photorespiratory cycle and/or induction of alternative routes for secondary ammonium assimilation in this genotype. Preliminary results indicated that a gene encoding for a cytosolic GS 1 isoform was induced in the Ljgln2-2 mutant after the transfer to normal CO 2 conditions, and this was paralleled by an increase in total GS activity (Pérez- Delgado et al. 2013). In order to study more in detail this response, all the sequence information available on L. japonicus cytosolic GS 1 genes was obtained from the available databases. A total of five unique gene sequences encoding for cytosolic GS 1 were found (not shown). Gene specific oligonucleotides were used in order to determine transcription levels in WT and mutant plants by qRT-PCR at the different time points considered. LjGln1.2 was the most expressed GS 1 gene in leaves and was induced almost two-folds in the mutant, with a maximum in transcript levels at day 3 followed by a slow decrease (Fig. 2a). Interestingly, 100 LjGln1.2 transcription over time followed a similar trend in the WT plants, although in this genotype the transcript levels of LjGln1.2 were always about half of the mutant ones at all the time points. Both LjGln1.1 and LjGln1.3 showed a sudden decrease in transcript levels in both genotypes, followed by a recover in transcript levels at days 6-8 exclusively in the mutant. Finally, LjGln1.4 and LjGln1.5 were expressed at very low levels and were repressed in both genotypes after the shift to normal CO 2 conditions. Western Blot analysis was carried out using Anti-GS antibodies that recognize both cytosolic and plastidic GS. While GS 1 and GS 2 could be separated according to their different molecular weights (Betti et al. 2006), it was not possible to distinguish between the different gene products of the five cytosolic GS 1 genes since their molecular weights are very similar. In agreement with the gene expression data, cytosolic GS 1 polypeptide levels were increased in the mutant during the time-course of the experiment. The maximum abundance of GS 1 was after 8 days under normal CO 2 conditions, were the polypeptide levels were about 4 times higher than in the WT (Fig. 2b). Neither GS 1 nor GS 2 polypeptide levels showed any significant change in the WT compared to high CO 2 conditions. Total GS enzyme activity was also increased exclusively in the Ljgln2-2 mutant, and was in good agreement with GS 1 polypeptide levels, indicating that the increased amount of GS 1 was represented by active enzyme (Fig. 2c). Glutamine levels were also increased in the mutant, with a maximum at day 4, just after the drop in NH 4+ levels. These data suggest a role for cytosolic GS 1 as an alternative route for photorespiratory NH 4+ detoxification. Interestingly, in the WT a drop in Gln levels to about half of the initial values was observed throughout the experiment, even if GS polypeptide levels and enzyme activity did not show significant changes. On the other hand, Glu relative levels were decreased about two-folds in both genotypes as a consequence of the transfer to normal CO 2 conditions. Induction of GDH in the Ljgln2-2 mutant Three different gene sequences encoding for NAD(H)-GDH (LjGDH1, LjGDH2 and LjGDH3) as well as a fourth gene encoding for a putative NADP(H)-dependent GDH enzyme (LjGDH4) were found in the L. japonicus genome. Two of the three genes encoding for NAD(H)-GDH in the mutant were induced after 4 days under normal CO 2 conditions (LjGDH2 and LjGDH3, Fig. 3a). On the other hand, the most expressed GDH gene in leaves (LjGDH1) was not significantly modulated in the mutant and was repressed about three fold in the WT genotype. LjGDH4 transcript levels showed in both genotypes a sudden drop at day 2 followed by a recuperation over time in both genotypes, with a trend that was almost opposite to NH 4+ levels. Two main immunoreactive bands 101 were detected by Western blot analysis, one compatible with the size of the NAD(H)-GDH polypeptides (about 44,700 Da for all the three possible isoforms) and one with higher molecular weight that was compatible with the size of the putative NADP(H)-GDH polypeptide (about 71,000 Da). Fig. 2 Regulation of GS in WT and Ljgln2-2 mutant plants after the transfer to active photorespiratory conditions. (a) Expression of the genes for cytosolic GS 1 in WT and mutant plants. Transcript levels were quantified by qRT-PCR in WT (black dots, black line) and mutant (white dots, dashed line) leaves at the same time points than in Fig. 1. Relative transcript levels are reported for each genotype compared to the housekeeping genes. (b) Immunodetection of cytosolic GS 1 and plastidic GS 2 in leaf crude extracts from WT and mutant plants. 10 µg of total protein were loaded on each lane. The position of the molecular weight markers is indicated. The table reports the densitometric quantification of the GS 1 and GS 2 bands. Data are the mean ± SD of three independent biological replicates. The blot shown in the Figure is only one of the different biological and technical replicates carried out. (c) The GS specific activity was determined in crude extracts from leaves of WT (black dots, solid line) and Ljgln2-2 (white dots, dashed line). GS activity is reported as specific activity (U/mg of total protein). Data are the mean ± S.D. of three independent biological replicates. (d) Relative amount of substrates and products of the GS reaction. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Metabolite levels are reported as relative units (r.u.) in the case of Glu and Gln or µmolˑg FW in the case of NH 4+ . 102 Quantification of the immunoblots indicated an increase of more than three times in NAD(H)-GDH polypeptide levels in the mutant, while in the WT they were almost unchanged (Fig. 3b). On the other hand, NAPD(H)-GDH polypeptide levels were slightly increased in the WT but were not significantly changed in the mutant. GDH enzyme activity was determined in both directions (aminating and deaminating activity). Both activity assays indicated an increase of about 3-4 times in GDH enzyme activity exclusively in the mutant, in very good agreement with the polypeptide levels. NADPH-GDH enzyme activity was also induced in the mutant, although with more variation between biological replicates compared to the NAD(H)-GDH activity (Fig. 3c). Curiously, the NADP-dependent deaminating activity was undetectable in WT and mutant extracts (not shown). Analysis of the metabolite levels of the substrates and products of GDH reaction showed that the levels of 2-oxoglutarate were increased in the mutant, with a trend over time very similar to the ammonium one (Fig. 3d). As described before, Glu leaf content was decreased about two-folds in both genotypes after the shift to active photorespiratory conditions. Transcriptional modulation of ASN genes Two genes were initially described as encoding for ASN in L. japonicus (Waterhouse et al. 1996): LjAS1 and LjAS2. Here we will call these two genes LjASN1 and LjASN2 respectively according to the current nomenclature for asparagine synthetase genes. However, mining of the available database information led to the identification of a third ASN gene, that we will call LjASN3. Information about the role of ASN in plants came mainly from measurements of gene expression and metabolite levels. This is because of the difficulty of determine ASN polypeptide levels and enzyme activity due to the rapid turnover of the enzyme, to the presence of asparaginase activity and of ASN inhibitors in the extracts (Azevedo et al. 2006). This was also the case of L. japonicus leaves extracts since it was not possible to determine ASN enzyme activity and no inmunoreactive bands were found using Anti-ASN primary antibodies (results nor shown). qRT-PCR analysis showed induction of the LjASN2 gene, the less expressed of the three ASN genes, exclusively in the mutant (Fig. 4a). LjASN1, the most expressed one, did not show a clear trend over the time-course of the experiment but was always more expressed in the WT than in the mutant, even at time zero (high CO 2 conditions) were most genes showed similar expression. 103 Fig. 3 Regulation of GDH in WT and Ljgln2-2 mutant plants after the transfer to active photorespiratory conditions. (a) Expression of the genes for NAD(H)-GDH (LjGDH1, LjGDH2 and LjGDH3) and NADP(H)-GDH (LjGDH4) in WT and mutant plants. Transcript levels were quantified by qRT-PCR in WT (black dots, black line) and mutant (white dots, dashed line) leaves at the same time points than in Fig. 1. Relative transcript levels are reported for each genotype compared to the housekeeping genes. (b) Immunodetection of NAD(H)-GDH and NADP(H)-GDH in leaf crude extracts from WT and mutant plants. 10 µg of total protein were loaded on each lane. The position of the molecular weight markers is indicated. The table reports the densitometric quantification of the NAD(H)-GDH and NADP(H)-GDH bands. Data are the mean ± SD of three independent biological replicates. The blot shown in the Figure is only one of the different biological and technical replicates carried out. (c) The GDH specific activity was determined in crude extracts from leaves of WT (black dots, solid line) and Ljgln2- 2 (white dots, dashed line). GDH activity is reported as specific activity (mU/mg of total protein). Data are the mean ± S.D. of three independent biological replicates. (d) Relative amount of substrates and products of the GDH reaction. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Metabolite levels are reported as relative units (r.u.) in the case of 2-oxoglutarate and Glu or µmolˑg FW in the case of NH 4+ . 104 A slight but significant accumulation of Asn was observed in the LjGln2-2 mutant under active photorespiratory conditions (Fig. 4b). On the other hand, Asp levels were always higher in the WT plants than in the mutant, showing a trend quite similar to the transcript levels of LjASN1. Fig. 4 Regulation of ASN in WT and Ljgln2-2 mutant plants after the transfer to active photorespiratory conditions. (a) Expression of the genes encoding for ASN in WT and mutant plants. Transcript levels were quantified by qRT-PCR in WT (black dots, black line) and mutant (white dots, dashed line) leaves at the same time points than in Fig. 1. Relative transcript levels are reported for each genotype compared to the housekeeping genes. (b) Relative amount of substrates and products of the NH 4+ -dependent ASN reaction. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Metabolite levels are reported as relative units (r.u.) in the case of Asp and Asn or µmolˑg FW in the case of NH 4+ . CPS gene expression and CP content in WT and Ljgln2-2 Plant CPS is similar to the bacterial enzyme and is formed by a large and a small subunit (Slocum, 2005). Most plants have two genes encoding for the small and large CPS subunits respectively, that in Arabidopsis are called carA and carB (Potel et al. 2009). In L. japonicus, two genes for CPS were found: LjcarA and LjcarB, which encode for the small and large CPS subunits respectively. The two genes showed similar levels of expression in L. japonicus leaves (Fig. 5a). Only LjcarB was modulated by the transfer to active photorespiratory conditions, with a repression of about three times in expression after 4 days followed by a recover of transcript levels in both genotpyes. CP metabolite content was slightly increased in Ljgln2-2 over time, while in the WT genotype was increased more that two-folds with a peak at day 2 followed by a sudden decrease in metabolite levels (Fig. 5b). 105 Fig. 5 Regulation of CPS in WT and Ljgln2-2 mutant plants after the transfer to active photorespiratory conditions. (a) Expression of the genes encoding for the CPS small subunit (LjcarA) and large subumit (LjcarB) in WT and mutant plants. Transcript levels were quantified by qRT-PCR in WT (black dots, black line) and mutant (white dots, dashed line) leaves at the same time points than in Fig. 1. Relative transcript levels are reported for each genotype compared to the housekeeping genes. (b) Relative amount of substrates and products of the NH 4+ -dependent ASN reaction. WT: black dots, solid line, Ljgln2-2 mutant: white dots, dashed line. Metabolite levels are reported as µmolˑg FW. DISCUSSION Ljgln2-2 mutant plants accumulated high levels of NH 4+ under active photorespiratory conditions followed by a sudden decrease in the content of this compound. This was suggestive of a regulation of photorespiratory metabolism and/or of enzymes involved in secondary NH 4+ assimilation. Since the transcriptional regulation of photorespiratory and photosynthetic genes was already described (Pérez-Delgado et al. 2013), in this paper we focused on the enzymes that may detoxify photorespiratory NH 4+ in the Ljgln2-2 mutant. In the following sections we discuss the regulation of the different enzymes considered. Glutamine synthetase Cytosolic GS 1 is encoded in plants by a small gene family that is generally formed by 3-5 members (Swarbreck et al. 2011). In the L. japonicus genome we found five different unique sequences encoding for cytosolic GS 1 . The corresponding genes showed different levels of expression as well as different responses to the transfer from high to normal CO 2 conditions in the leaves of WT Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.5 1.0 1.5 2.0 LjcarA Time (days) 0 2 4 6 8 10 Transcript (r.u.) 0.0 0.2 0.4 0.6 0.8 LjcarB Time (days) 0 2 4 6 8 10 0 20 40 60 80 Metabolite (µmol gFW -1 ) NH 4 + Time (days) 0 2 4 6 8 10 Metabolite (µmol gFW -1 ) 0.0 0.1 0.2 0.3 0.4 0.5 CP (a) (b) 112 ACKNOWLEDGMENTES We thank Dr. K.A. Roubelakis-Angelakis (University of Crete) for the gift of anti-GDH antibodies, Dr. F.M. Cánovas and Dr. R. Cañas (Unversity of Málaga) for the gift of anti-AS antibodies and for inspiring discussion on nitrogen assimilation. We would also like to thank D.H. Sánchez (University of Cambdridge) for assistance with metabolomic data analysis. This work was supported by projects P1O-CVI-6368 and P07-CVI-3026 (Programa operativo FEDER 2007-2013), and BIO-163 support from Consejería de Economía, Innovación y Ciencia, Junta de Andalucía). CMP acknowledges the support of PIF fellowship from the University of Seville. REFERENCES Andrews M, Raven JA, Lea PJ (2013) Do plants need nitrate? The mechanism by which nitrogen form affects plants. Ann Appl Biol 163:174-199 Azevedo RA, Lancien M, Lea PJ (2006) The aspartic acid metabolic pathway, an exciting and essential pathway in plants. Amino Acids 30:143-162 Betti M, Márquez AJ, Yanes C, Maestre A (2002) ATP binding to purified homopolymeric plant glutamine synthetase studied by isothermal titration calorimetry. Thermochim Acta 394:63-71. Betti M, Arcondéguy T, Márquez AJ (2006) Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase: functional properties of purified GLN2 enzymes. Planta 224:1068-1079 Betti M, García-Calderón M, Pérez-Delgado CM, Credali A, Estivill G, Galván F, Vega JM, Márquez AJ (2012a) Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. Int J Mol Sci 13:7994-8024 Betti M, Pérez-Delgado CM, García-Calderón M, Díaz P, Monza J, Márquez AJ (2012b) Cellular stress following water deprivation in the model legume Lotus japonicus. Cells 1:1089-1106 Betti M, García-Calderón M, Pérez-Delgado CM, Credali A, Pal’Ove-Balang P, Estivill G, Repčák M, Vega JM, Galván F, Márquez AJ (2014) Reassimilation of ammonium in Lotus japonicus. J Exp Bot Submitted for publication Bernard SM, Habash DZ (2009) The importance of cytosolic glutamine synthetase in nitrogen assimilation and recycling. New Phytol 182:608-620 113 Brady BS, Hyman BC, Lovatt CJ (2010) Regulation of CPSase, ACTase and OCTase genes in Medicago truncatula: Implications for carbamoylphosphate synthesis and allocation to pyrimidine and arginine de novo biosynthesis. Gene 462:18-25 Cañas RA, de la Torre F, Cánovas FM, Cantón FR (2006) High levels of asparagine synthetase in hypocotyls of pine seedlings suggest a role of the enzyme in re-allocation of seed-stored nitrogen. Planta 224:83-95 Czechowski T, Bari RP, Stitt M, Scheible WR, Udvardi MK (2004) Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant J 38:366–379 Doremus HD (1986) Organization of the pathway of de Novo pyrimidine nucleotide biosynthesis in Pea (Pisum sativum L. cv Progress No. 9) leaves. Arch Biochem Biophys 250:112-119 Fernie AR, Bauwe H, Eisenhut M, Florian A, Hanson DT, Hagemann M, Keech O, Mielewczik M, Nikoloski Z, Peterhänsel C, Roje S, Sage R, Timm S, von Cammerer S, Weber APM, Westhoff P (2013) Perspectives on plant photorespiratory metabolism. Plant Biol 15:748-753 Ferrario-Mery S, Hodges M, Hirel B, Foyer CH (2002) Photorespirationdependent increases in phosphoenolpyruvate carboxylase, isocitrate dehydrogenase and glutamate dehydrogenase in transformed tobacco plants deficient in ferredoxin-dependent glutamine-α-ketoglutarate aminotransferase. Planta 214:877-886 Fontaine J-X, Tercé-Laforgue T, Armengaud P, Clément G, Renou J-P, Pelletier S, Catterou M, Azzopardi M, Gibon Y, Lea PJ, Hirel B, Dubois F (2012) Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. Plant Cell 24:4044-4065 Fontaine J-X, Tercé-Laforgue T, Bouton S, Pageau K, Lea PJ, Dubois F, Hirel B (2013) Further insights into the isoenzyme composition and activity of glutamate dehydrogenase in Arabidopsis thaliana. Plant Signal Behav 8:e23329 Forde BG, Lea PJ (2007) Glutamate in plants: metabolism, regulation and signalling. J Exp Bot 58:2339-2358 Gaufichon L, Reisdorf-Cren M, Rothstein SJ, Chardon F, Suzuki A (2010) Biological functions of asparagine synthetases in plants. Plant Sci 179:141- 153 Gaufichon L, Masclaux-Daubresse C, Tcherkez G, Reisdorf-Cren M, Sakakibara Y, Hase T, Clément G, Avice J-C, Grandjean O, Marmagne A, Boutet- Mercey S, Azzopardi M, Soulay F, Suzuki A (2013) Arabidopsis thaliana 114 ASN2 encoding asparagine synthetase is involved in the control of nitrogen assimilation and export during vegetative growth. Plant Cell Environ 36:328-342 Gutiérrez RA (2012) System biology for enhanced plant nitrogen nutrition. Science 336:1673-1675 Handberg K, Stougaard J (1992) Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. Plant J 2:487-496 Herrera-Rodriguez MB, Maldonado JM, Pérez-Vicente R (2004) Light and metabolic regulation of HAS1, HAS1.1 and HAS1.2, three asparagine synthetases genes in Helianthus annuus. Plant Physiol Biochem 42:511-518 Hirel B, Bouet C, King B, Layzell D, Jacobs F, Verma DPS (1987) Glutamine synthetase genes are regulated by ammonia provided externally or by symbiotic nitrogen fixation. EMBO J 6:1167-1171 Labboun S, Tercé-Laforgue T, Roscher A, Bedu M, Restivo FM, Velanis CN, Skopelitis DS, Moshou PN, Roubelakis-Angelakis KA, Suzuki A, Hirel B (2009) Resolving the role of plant glutamate dehydrogenase I. in vivo real time nuclear magnetic resonance spectroscopy experiments. Plant Cell Physiol 50:1761-1773 Laemmli UK (1970) Cleavage of structural protein during the assembly of head of bacteriophage T4. Nature 251:614-616 Lam H-M, Wong P, Chan H-K, Yam K-M, Chen L, Chow C-M, Coruzzi GM (2003) Overexpression of the ASN1 gene enhances nitrogen status in seeds of Arabidopsis. Plant Physiol 132:926-935 Lea PJ, Sodek L, Parry MAJ, Shewry PR, Halford NG (2007) Asparagine in plants. Ann Appl Biol 150:1-26 Loulakakis CA, Roubelakis-Angelakis KA (1990) Immunocharacterization of NADH-glutamate dehydrogenase from Vitis vinifera L. Plant Physiol 94:109-113 Márquez AJ, Betti M, García-Calderón M, Estivill G, Credali A, Pajuelo P, Orea A, Clemente MT, Pajuelo E, Galván F (2005) Nitrate and ammonium assimilatory enzymes. In Márquez AJ (ed) Lotus japonicus handbook, 1st edn. Springer, Dordrecht, pp 315-328 Masclaux-Daubresse C, Carrayol E, Valadier M-H (2005) The two nitrogen mobilisation- and senescence-associated GS1 and GDH genes are controlled by C and N metabolites. Planta 221:580-588 Masclaux-Daubresse C, Reisdorf-Cren M, Pageau K, Lelandais M, Grandjean O, Kronenberger J, Valadier M-H, Freaud M, Jouglet T, Suzuki A (2006) Glutamine synthetase-glutamate synthase pathway and glutamate dehydrogenase play distinct roles in the sink-source nitrogen cycle in tobacco. Plant Physiol. 140:444-456 115 Masclaux-Daubresse C, Daniel-Vedele F, Dechorgnat J, Chardon F, Gaufichon L, Suzuki A (2010) Nitrogen uptake, assimilation and remobilization in plants: challenges for sustainable and productive agriculture. Ann Bot 105:1141-1157 Moffatt BA, Ashihara H (2002) Purine and pyrimidine nucleotide synthesis and metabolism. The Arabidopsis book 1:e0018 Mollá-Morales A, Sarmiento-Mañús R, Robles P, Quesada V, Pérez-Pérez JM, González-Bayón R, Hannah MA, Willmitzer L, Ponce MR, Micol JL (2010). Analysis of ven3 and ven6 reticulate mutants reveals the importance of arginine biosynthesis in Arabidopsis leaf development. Plant J 65:335- 345 Oliveira IC, Brears T, Knight TJ, Clark A, Coruzzi GM (2002) Overexpression of cytosolic glutamine synthetase. Relation to nitrogen, light and photorespiration.Plant Physiol 129:1170-1180 Orea A, Pajuelo P, Pajuelo E, Quidiello C, Romero J, Márquez AJ (2002) Isolation of photorespiratory mutants from Lotus japonicus deficient in glutamine synthetase. Physiol Plant 113:193-202 Pérez-Delgado CM, García-Calderón M, Sánchez DH, Udvardi MK, Kopka J, Márquez AJ, Betti M (2013) Transcriptomic and metabolic changes associated with photorespiratory ammonium accumulation in the model legume Lotus japonicus. Plant Physiol 162:1834-1848 Pierson DL (1980) A rapid colorimetric assay for carbamyl phosphate synthetase I. J Biochem Biophys Meth 3:31-37 Potel F, Valadier M-H, Ferrario-Méry S, Grandjean O, Morin H, Gaufichon L, Boutet-Mercey S, Lothier J, Rothstein SJ, Hirose N, Suzuki A (2009) Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthase. FEBS J 276:4061-4076 Saeed AI, Hagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li JW, Thiagarajan M, White JA, Quackenbush J (2006) TM4 microarray software suite. Methods Enzymol 411:134-193 Sánchez DH, Lippold F, Redestig H, Hannah MA, Erban A, Krämer U, Kopka J, Udvardi MK (2008) Integrative functional genomics of salt acclimatation in the model legume Lotus japonicus. Plant J 53:973-987 Seabra AR, Vieira CP, Cullimore JV, Carvalho HG (2010) Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds. BMC Plant Biol 10:183 Seabra AR, Silva LS, Carvalho HS (2013) Novel aspects of glutamine synthetase (GS) regulation revealed by a detailed expression analysis of the entire GS 116 gene family of Medicago truncatula under different physiological conditions. BMC Plant Biol 13:137 Sheng S, Kraft JJ, Schuster SM (1993) A specific quantitative colorimetric assay for L-asparagine. Anal Biochem 211:242-249 Slocum RD (2005) Genes, enzymes and regulation of arginine biosynthesis in plants. Plant Physiol Biochem 43:729-745 Skopelitis DS, Paranychianakis NV, Paschalidis KA, Pliakonis ED, Delis ID, Yakoumakis DI, Kouvarakis A, Papadakis AK, Stephanou EG, Roubelakis- Angelakis KA (2006) Abiotic stress generates ROS that signal expression of anionic glutamate dehydrogenase to form glutamate for proline synthesis in tobacco and grapevine. Plant Cell 18:2767-2781 Solorzano L (1969) Determination of ammonia in natural waters by the phenolhypoclorite methos. Ocean Limno Oceanogr 14:799-801 Swarbreck SM, Defoin-Platel M, Hindle M, Saqi M, Habash DZ (2010) New perspectives on glutamine synthetase in grasses. J Exp Bot 62:1511-1522 Tercé-Laforgue T, Bedu M, Dargel-Grafin C, Dubois F, Gibon Y, Restivo FM, Hirel B (2013) Resolving the role of plant glutamate dehydrogenase: II. Physiological characterization of plants overexpressing the two enzyme subunits individually or simultaneously. Plant Cell Physiol 54:1635-1647 Udvardi MK, Poole PS (2013) Transport and metabolism in legume-rhizobia symbiosis. Annu Rev Plant Biol 64:781-805 Wallsgrove RM, Turner JC, Hall NP, Kendall AC, Bright SWJ (1987) Barley mutants lacking chloroplast glutamine synthetase – biochemical and genetic analysis. Plant Physiol 83:155-158 Waterhouse RM, Smyth AJ, Massoneau A, Prosser IM, Clarkson DT (1996) Molecular cloning and characterisation of asparagine synthetase from Lotus japonicus: Dynamics of asparagine synthesis in N-sufficient conditions. Plant Mol Biol 30:883-897 Wong H-K, Chan H-K, Coruzzi GM, Lam H-M (2004) Correlation of ASN2 gene expression with ammonium metabolism in Arabidopsis. Plant Physiol 134:332-338 Wingler A, Lea PJ, Quick WP, Leegood RC (2000) Photorespiration: metabolic pathways and their role in stress protection. Phil Trans R Soc Lond B 355:1517-1529 117 Publicación 3. Transcriptomics of leaves of Lotus japonicus plants grown under different nitrogen regimes. Analysis of primary and secondary nitrogen assimilation. Carmen M. Pérez-Delgado, Tomás C. Moyano, Margarita García-Calderón; Antonio J. Márquez; Rodrigo A. Gutiérrez, Marco Betti. Unpublished. 118 ABSTRACT Nitrogen (N) is one of the most important nutrients for plants and, in natural soils, its availability is often a major limiting factor for plant growth. Legume plants are able to grow using atmospheric N 2 fixed in root nodules or by using mineral sources of nitrogen. Primary nitrogen assimilation by plants involves the use of different forms of inorganic nitrogen (NO 3- and/or NH 4+ ). In addition, efficient secondary NH 4+ assimilation must also exist in plants in order to reassimilate the ammonium ions that can be produced endogenously in the plants from processes such as photorespiration, being this ammonium as much as 10 times higher than the one trough primary assimilation. First, in this paper it was evaluated the effect of the different nitrogen sources on gene expression in leaves of the model legume Lotus japonicus and it was demonstrated that several important transcriptomic changes occurred when plants were cultivated with different nitrogen sources compared to purely symbiotic conditions, including genes involved in nitrogen, carbon and secondary metabolism and some transcription factors with a possible key role in the regulation of these processes. In addition, it was also studied the effect of the photorespiration and the deficiency of plastidic GS on gene expression in leaves of L. japonicus. This paper provides novel information of the possible role of plastidic GS in the response to different nitrogen sources and C/N balance of L. japonicus plants.The use of gene co-expression networks indentify possible transcription factors that may be involved in the response to different nitrogen nutritions and / or photorespiratory metabolism and the lack of plastidic GS. 119 INTRODUCTION Nitrogen (N) is one of the most important nutrients for plants and, in natural soils, its availability is often a major limiting factor for plant growth. The use of nitrogen by plants involves several steps, including uptake, assimilation, translocation and different forms of recycling and remobilization processes, all of them of crucial importance in terms of nitrogen utilization efficiency (Hirel et al., 2007; Masclaux-Daubresse et al., 2010). Primary nitrogen assimilation by plants involve the use of different forms of inorganic nitrogen (NO 3- and/or NH 4+ ), depending on nitrogen availability, plant species and adaptations. Alternatively, the symbiosis with bacteria enables also to several plant species, most notably legumes, to use atmospheric N 2 which is reduced to NH 4+ in the nodules by the action of bacterial nitrogenase. In addition, efficient secondary NH 4+ assimilation must also exist in plants in order to reassimilate the ammonium ions that can be produced endogenously in the plants from processes such as photorespiration, phenylpropanoid biosynthesis, or amino acid catabolism (Betti et al., 2012a). Lotus japonicus is a temperate legume that can grow using the atmospheric N 2 fixed in the nodules or by using external sources of nitrogen, like nitrate or ammonium, in roots. The utilization of NO 3- requires its reduction to NH 4+ produced by the consecutive action of nitrate reductase (NR; EC 1.7.99.4) and nitrite reductase (NiR; EC 1.7.1.4) enzymes, prior to ammonium assimilation. Then, the NH 4+ synthesized as a result of both primary and secondary assimilation is assimilated into glutamine and then into glutamate by the enzymes glutamine synthetase (GS; EC 6.3.1.2) and glutamate synthase (GOGAT; EC 1.4.7.1 or EC 1.4.1.14). In addition to GS and GOGAT, which catalyse irreversible reactions, a third enzyme, glutamate dehydrogenase (GDH; EC 1.4.1.2/4) catalyses a reversible amination/deamination reaction, which could lead to either the synthesis or the catabolism of glutamate from 2-oxoglutarate and NH 4+ . In most temperate legumes, it is proposed that asparagine, rather than glutamine, is the principal molecule used to transport reduced nitrogen within the plant, in contrast to many other plant species (Credali et al., 2013). This is the case for L. japonicus where it has been shown that asparagine can account for almost 90 % of the nitrogen transported from root to shoot (Waterhouse et al,. 1996). Asparagine synthetase (AS, EC 6.3.5.4) is the main enzyme in charge of asparagine biosynthesis in plants. This enzyme catalyzes the transfer of the amide group from glutamine (or, in minor proportion, ammonium) to aspartate in an ATP-dependent reaction. The presence of nitrogen is sensed by the roots and produces early local transcriptional changes. However, there are also long-range signals related with N availability that go on both ways, from root to shoot and viceversa. 120 Despite of the fact that more energy is needed for the assimilation of nitrate, most plants prefer NO 3- over NH 4+ . With the exception of ammonium tolerant species, the availability of NH 4+ alone as nitrogen source, as well as the internal production of NH 4+ by processes like photorespiration (Keys et al., 1978) may result toxic to the plant. Notably, the toxic effect of external NH 4+ can be relieved by co-provision of nitrate, the so called mixed nutrition. A fascinating and still poorly understood aspect of nitrogen nutrition is that in most cases the growth of a plant on NH 4 NO 3 can surpass the maximal growth compared to either NO 3- or NH 4+ alone. This relief of NH 4+ toxicity by NO 3- may be related to a synergism between the signalling routes of NH 4+ and NO 3- (Britto et al., 2002). Moreover, several genes are modulated exclusively when the nitrogen source is NH 4+ , NO 3- or NH 4 NO 3 (Lopes and Araus, 2008; Ruffel et al., 2008). On the other hand, recent data suggested that not only primary nitrogen assimilation, but also the secondary ammonium produced by the photorespiratory cycle, can cause important modulation in the leaf transcriptome of L. japonicus, affecting several genes for nitrogen, secondary and central carbon metabolism (Pérez-Delgado et al., 2013). Photorespiration is the most important process in which high amounts of ammonium are released at a rate that can exceed by 10- fold the rate of primary nitrate assimilation in plants (Keys et al., 1978). Ammonium is produced as a result of the decarboxylation of two molecules of glycine to yield one molecule of serine in a reaction catalyzed by glycine decarboxylase (GDC) and serine-hydroxymethyl transferase (SHMT) enzymatic complex in the mitochondria. This ammonium is then reassimilated in the chloroplast by the plastidic glutamine synthetase (GS2) and ferredoxin-glutamate synthase (Fd-GOGAT). These reactions forms part of a more complex process called as the photorespiratory nitrogen cycle. Photorespiration starts by means of the oxygenase activity of RUBISCO in the chloroplasts, which produces 2- phosphoglycolate (a 2C compound), and is aimed to retrieve 3 out of each 4 carbon atoms entering this pathway as 2-phosphoglycolate in order to yield 3- phosphoglycerate which goes back to the Calvin cycle (Bauwe et al., 2010; Keys et al., 1978; Maurino and Peterhansel, 2010; Wingler et al., 2000). Several important pathways like nitrogen assimilation, respiration, one-carbon metabolism, purine biosynthesis (Bauwe et al., 2010) and redox signalling (Foyer et al., 2009) interact in different ways with photorespiration. The first GS photorespiratory mutants isolated from legume plants were identified several years ago in our laboratory from the model legume Lotus japonicus (Orea et al., 2002; Márquez et al., 2005). These mutants were shown to be specifically deficient in GS2 and have been substantially characterized at the molecular and physiological levels (Orea et al., 2002; Márquez et al., 2005; 121 Betti et al., 2006; Díaz et al., 2010; García-Calderón et al., 2012; Betti et al., 2012a; Pérez-Delgado et al., 2013). Under CO 2- enriched atmosphere, the mutants did not show any visible phenotype and only a slightly lower growth rate (Orea et al., 2002). In order to study the effect of the different nitrogen sources on gene expression in leaves of the model legume L. japonicus, a comparative transcriptomic study was carried out in leaves of plants grown with different nitrogen sources (NO 3- , NH 4+ or NH 4 NO 3 ) or under conditions of biological nitrogen fixation. As the ammonium assimilated trough photorespiration may be 10 times higher than the one trough primary assimilation (Keys et al., 1978), it has, also, been evaluated the effect of the photorespiration and the deficiency of plastidic GS on gene expression in leaves of L. japonicus. This paper demonstrate that several important transcriptomic changes ocurred in leaves of L. japonicus when plants were cultivated with different nitrogen sources compared to purely symbiotic conditions, including genes involved in nitrogen, carbon and secondary metabolism and some transcription factors with a possible key role in the nitrogen signaling. Also, this paper provides novel information of the possible role of plastidic GS in the signaling of different nitrogen sources and in the signaling of the C/N balance of L. japonicus. MATERIAL AND METHODS Growth conditions and harvesting of plant material Lotus japonicus (Regel) Larsen cv. Gifu (B-129-S9) was initially obtained from Professor Jens Stougaard (Aarhus University, Aarhus, Denmark) and then self-propagated at the University of Seville. The Ljgln2-2 mutant, which lacks of plastidic GS2 protein and activity (Betti et al., 2006) was isolated from the photorespiratory mutant screening carried out using ethyl methanesulfonate as described previously (Orea et al., 2002). The mutant progeny of two consecutive backcrosses into the WT background were used. WT and mutant seeds were scarified and surface-sterilized, then germinated in 1% agar in Petri dishes and transferred to pots using vermiculite as solid support. Five seedlings were planted in each pot and grown until plants had 7 trifoils in a growth chamber under 16 h : 8 h day : night, 20 : 18°C, with a photosynthetic photon flux density of 250 µmol m −2 s −1 and a constant humidity of 70%. When required, CO 2 was automatically injected to a final concentration of 0.7% (v/v) (high CO 2 photorespiration-suppressed atmosphere) 128 were found to be differentially elicited when comparing the different nitrogen sources. Table 1. Number of probesets differentially expressed in WT plants grown in different nitrogen sources compared with nodulated WT plants with FDR<0.1 with a Rank Product analysis. Changes in gene expression were analysed by Rank Product applying a FDR < 0.1. No fold-change threshold was applied since recent transcriptomic studies in L. japonicus demonstrated that subtle transcriptional changes, if statistically significant, are often biologically relevant and represent robust responses to stress conditions. Statistically changed genes were visualized and functionally characterized using MapMan and PathExpress (Usadel et al., 2005; Goffard and Weiller, 2007). In most cases, the genes involved in these responses were specific to the local nitrogen source, as it happened in other studies (Ruffel et al., 2008). Each group of differentially expressed genes on each different nitrogen source is described below. The first group, include genes that were more expressed in leaves of plants cultivated with nitrate than in leaves of nodulated plants. This group contain 38 probesets and the Pathexpress tool showed that “nitrogen metabolism” pathway was significantly over-represented in this group of genes, including the genes encoding for nitrite reductase (probesets chr4.CM0227.40 and gi9968472) and for one particular high-affinity NO 3- transporter (chr4.CM0161.9) (Fig S1). L. japonicus assimilates NO 3- mainly in the roots (Márquez et al., 2005) but these data suggest that there are some NO 3- -responsive genes in leaves. Among less expressed genes in NO 3- -fed plants several pathways were over-represented such as those for phenylalanine metabolism and for stilbene, coumarine and lignin biosynthesis, belonging both to phenylpropanoid metabolism (Fig. S1). Genes encoding for key enzymes for phenylpropanoids and flavonoid biosynthesis were in this group, like phenylalanine ammonia lyase (probeset Ljwgs_078032.1), 4-coumarate-CoA ligase (probeset chr4.CM0061.26) and anthocyanin acyltransferase (probeset Ljwgs_018221.1). Flavonoids are a vast class of secondary metabolites involved in an ample number of processes, including plant–pathogen interactions, pollination, light screening, seed development and allellopathy. Moreover, most flavonoids show an important anti-oxidant capacity (Hernández et al., 2008). Many of the genes Up Down Total NO 3 - 38 153 191 NH 4 + 156 214 370 NH 4 NO 3 145 126 271 Total 339 493 832 129 involved in flavonoid biosynthesis are induced under biotic or abiotic stress. The higher expression of these genes in nodulated plants confirms previous results indicative of the existence of important differences in redox metabolism in nodulated plants compared to those cultivated with nitrate. Also, it is well known that flavonoids have a key role in nodulation (Falcone Ferreyra et al., 2012) and this may be also another explanation for the over-representation of this group of genes in nodulated plants. Regarding to the up-regulatory changes in gene expression detected in leaves of plants cultivated with NH 4+ it was found again that the nitrogen assimilatory pathway was over-represented compared to nodulated plants. On the other hand, there was an induction of glutathione metabolism (probests Ljwgs_030344.1 and Ljwgs_018510.1 encode for glutathione-S-tranferase) and flavonoid biosynthesis (Fig. S2), that could be related with a higfher level of oxidative stress present inplants growing under NH 4+ . These changes are possibly due to the toxicity generated under NH 4+ nutrition in many plants (Britto et al., 2002). Among less expressed genes in NH 4+ fed plants it has been found an overrepresentation of secondary metabolism. Key enzymes of flavonoid biosynthesis like PAL1 (probeset Ljwgs_078032.1) and 4-Coumarate:CoA ligase (probeset chr4.CM0061.26) were down-regulated (Fig. S2). These changes may also form part of the response of the plants to the presence of NH 4+ as unique nitrogen source. Under mixed nutrition, the main over-expressed pathways compared to nodulated plants were those corresponding to starch and sucrose metabolisms. This group included key genes for starch biosynthesis like starch synthase (probest chr5.TM0431.23) and starch branching enzyme (probeset chr1.CM0178.37), suggesting that the carbon assimilatory process was increased under these conditions (Fig. S3). It is also interesting to notice that probesets corresponding to two genes encoding for AS (probesets gi897770 and gi897772) in L. japonicus were up-regulated under mixed nutrition. Another interesting observation was that most of the nitrogen assimilatory genes were not overrepresented under mixed nutrition in contrast to what it was observed for NO 3- and NH 4+ -fed plants. Among less expressed genes in plants cultivated in mixed nutrition, several genes related to secondary metabolism were found as well as genes for starch and sucrose metabolism, although, in this case, the genes were betaglucosidases, which are more related to cell wall metabolism and ABA biosynthesis than with the main carbohydrates metabolism (Fig. S3). 130 As a summary of the transcriptomic results, it is concluded that important transcriptomic changes were observed in leaves of L. japonicus grown with different N sources compared to purely symbiotic conditions. Also, each nitrogen source had a specific response considering that only a minoritary proportion of genes were shared between more than one condition as also reported in other works (Lopes and Araus, 2008; Ruffel et al., 2008). It is very interesting to note that nitrate and ammonium nutritions reflected an over-representation of the genes involved in nitrogen metabolism, while the results obtained under mixed nutrition point out mainly genes related to carbon metabolism. In addition, it is also shown that there are important changes in genes for the secondary metabolism associated to the different nitrogen sources. In particular, NH 4+ -fed plants showed an over-representation of genes related to oxidative stress. The fact that secondary metabolites in legumes are very important for the establishment of symbiosis, especially flavonoids, suggests that the changes in secondary metabolites observed may be also related to the effects produced by the external nitrogen sources on nodulation, a topic that will require further investigation. Influence of photorespiration on nitrogen nutrition: studies with Ljgln2-2 mutants Recent data from our lab showed that not only primary nitrogen assimilation but also the secondary ammonium produced by the photorespiratory cycle can cause an important modulation in the leaf transcriptome of L. japonicus, including changes in the expression of several genes for nitrogen metabolism (Pérez-Delgado et al., 2013). An experiment was performed to further investigate the influence of photorespiration on the different nitrogen nutritions examined before. For this purpose WT and Ljgln2-2 plants were grown under these four nitrogen conditions previously studied but under either normal air atmosphere (active photorespiration) or high CO 2 (photorespiration suppressed conditions). The expression levels of genes encoding for the different isoforms of glutamine synthetase, glutamate synthase, asparagine synthetase and glutamate dehydrogenase were determined by qRT-PCR. Fig. 2 shows the transcript levels found for some of the measured genes The transcript levels of genes of WT plants grown in high-CO 2 or air atmospheres were compared (Fig. 2a) together with those of WT and Ljgln2-2 plants grown in a high-CO 2 atmosphere (Fig. 2b). 131 Figure 2. (a) Expression levels of some key genes of N metabolism in WT plants under normal air ( A, white bars) or CO 2 -enriched atmosphere (CO 2 , grey bars) and different N sources. (b) Expression levels of the same genes in WT (WT, grey bars) and Ljgln2-2 plants (M, grey dotted bars) grown under different nitrogen nutrition but in both cases in CO 2 -enriched atmosphere. LjASN1: asparagine synthetase; LjGLN2: plastidic glutamine synthetase; LjGLU1: Fd-dependent GOGAT. Data are the mean ± SD of three independent biological replicates. *Indicates significant difference between high-CO 2 in a) and between WT and Ljgln2-2 in b) determined by student’s test (P < 0.05). The results obtained indicated that, in all N-nutritions, there was a close similarity in the differential responses of WT plants in high-CO 2 versus air treatments (Fig. 2a) compared to WT versus Ljgln2-2 mutant plants in high-CO 2 (Fig. 2b), suggesting that the deficiency in GS2 has a similar effect on the transcript levels than the diminishment of CO 2 concentration in the WT plants in all the nitrogen nutritions studied. Other studies also confirmed the clear association between plastidic GS and carbon metabolism in L. japonicus plants (Fig. 2) (Betti et al., 2012a; García-Calderón et al., 2012; Pérez-Delgado et al., 2013). In addition, it is interesting to notice that for the three genes analysed in Fig. 2B the transcriptional effects produced in the Ljgln2-2 GS2-deficient mutant plants compared to the WT were very similar in the case of plants grown under NO 3- and NH 4+ but different, and in fact opposite to the effect produced in NH 4 NO 3 -grown plants. These results suggest a role for plastidic GS in the distinctive response to mixed nutrition of the nitrogen assimilatory genes in L. japonicus, and may imply a role of plastidic GS in the signalling events related to the presence of different nitrogen sources for the plant (see also Betti et al., 2012a). 132 Study of the relation of the photorespiration and the deficiency of GS2. The microarray data from the experiment published in Díaz et al., 2010 and Betti et al., 2012b which are available in the public microarrays database EBI with the accession codes E-MEXP-2690 and E-MEXP-3710 respectively were further explored to study more in detail the relationship between GS2 and carbon metabolism it was used. The transcriptomic changes produced in the WT by the diminishment of CO 2 atmospheric concentration were compared with the transcriptomic changes produced by plastidic GS deficiency in Ljgln2-2 mutant plants grown under non-photorespiratory conditions (high CO 2 ). 1668 probesets were differentially modulated when comparing WT plants grown either in high CO 2 or normal air conditions, which means genes that can be modulated by carbon and/or active photorespiratory conditions. On the other hand, 1200 probesets were differentially expressed as a result of the lack of GS2 (FDR < 0.1). 288 probesets were modulated in both conditions (Fig. 3a). Interestingly, these commonly regulated probesets showed a strong linear correlation (r 2 = 0.91) between log 2 of the fold change in gene expression between the two different comparisons carried out. In fact, the slope of the regression line was 0.9, indicating that the level of the changes in transcript levels were very similar in both conditions (Fig. 3b). Only 6% of genes, corresponding to 18 probesets, showed an opposite response to the diminishment of CO 2 concentration and the lack of GS2. Figure 3. (a) Venn Diagram showing the number of probesets modulated by diminishment of CO 2 concentration and/or the absense of plastidic GS (FDR < 0.1). (b). Comparison of the log 2 of fold change value for the probesets that are significantly elicited by both conditions. A co-expression network was constructed using these 288 shared probesets previously analyzed (Fig. 4; Supplemental Table S4). Interestingly, many genes involved in carbon were visualized from this network. Also, other genes and transcription factors with important connections were detected. 133 Figure 4. Networks analysis of genes modulated by the diminishment of CO 2 concentration and by the lack of GS2. The colored squares represent the modulated genes and the lines represent the connections of the above mentioned genes. Genes marked with the same color has a transcriptional regulation similar bearing all the experiments included to construct the network. One particular gene stood out in the network attending to its high degree of connectivity. This was one gene for pyruvate decarboxylase (probeset Ljwgs_007060.2), one of the genes of the central carbon metabolism with a very high importance in all organisms and which has also been reported to have a role in stress tolerance (Pinhero et al., 2011). Other genes related to carbon metabolism were found such as a sugar transporter (probeset Ljwgs_136027.1), a diacylglycerol kinase (probeset Ljwgs_067758.1) and an alpha-galactosidase (probeset Ljwgs_025958.1), amongst others. In addition, several other genes were noted as those for for glutathione S-transferase (probesets Ljwgs_037557.1 and Ljwgs_027688.1), cytochrome P450 (probesets chr1.CM0591.58 and Ljwgs_099719.2) and glutaredoxine (probeset chr1.CM0109.23.1), suggesting the interconnection of carbon, photorespiration and the lack of GS2 with redox metabolism and/or stress responses. It is very interesting to note that there was a modulation of a glycolate oxidase (LjGO1) gene (probeset Ljwgs_013523.1) with a high number of connections with the other modulated genes. This gene has recently been described to may have a role in stress response in L. japonicus in relation with photorespiratory ammonium accumulation (Pérez-Delgado et al., 2013). Finally, there were several transcription factors modulated with high connectivity like a bHLH transcription factor (probeset Ljwgs_015129.1) and a zinc finger protein (probeset Ljwgs_105843.1.1). These transcription factors may be of crucial importance in the C/N balance and photorespiratory metabolism of L. japonicus plants in relation to the crucial role of GS2 found in both processes. Previous studies showed that most of the genes differentially expressed in Ljgln2-2 and WT plants were elicited by drought stress specifically in the Ljgln2- 134 2, thus confirming the existence of a relationship between GS2 and the stress responsive machinery in L. japonicus (Diaz el at., 2010). The present study established a novel link between the plastidic GS and the response to changes in external CO 2 provided to the plants, which further illustrates the relationship among GS2 and carbon metabolism in L. japonicus plants. The results shown in this paper emphasize how a defect in nitrogen assimilation affects carbon metabolism in leaves as it was also concluded in other previous studies in regard to the nodulation of this plant. CONCLUSION In summary, in this paper, it was demonstrated that several important transcriptomic changes occurred in leaves of L. japonicus when plants were cultivated with different nitrogen sources compared to purely symbiotic conditions, including genes involved in nitrogen, carbon and secondary metabolism and some transcription factors with a possible key role in the nitrogen signalling like bHLH029, TGA4, two nodulins of the family nodulin21, WRKY50 and two WRKY70. This study, also conclude, that each nitrogen source had a specific response in leaves of L. japonicus. Also, the study of the Ljgln2-2 mutants, under non photorespiratory conditions, gave several novel insights on the possible role of plastidic GS in the signaling events related to the presence of different nitrogen sources and in the signaling of the C/N balance of Lotus japonicus. ACKNOWLEDGEMENTS Consejería de Economía, innovación y Ciencia, Junta de Andalucía (Spain) Project P10-CVI-6368 and BIO-163. CMP acknowledges a PIF fellowship from University of Seville. We also thank Dr. Javier Canales for his help with Networks Analysis.The authors would like to thank the CITIUS Biology facilities of the University of Seville for qRT-PCR measurements and MJ Cubas and A Gómez for technical and secretarial assistance. REFERENCES Álvarez, J.; Riveras, E.; Aceituno, F.; Tamayo, K.; Gutierrez, R. TGA1 and TGA4 transcription factors control nitrate responses in Arabidopsis thaliana root organs. 21 st International Conference on Arabidopsis. 2010. Publication:501737439. 135 Bauwe, H.; Hageman, M.; Fernie, A.R. Photorespiration: players, partners and origin. Trends in Plant Sciences 2010, 15, 330-336. Betti, M.; Arcondéguy, T.; Márquez, AJ. Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase. Functional properties of purified GLN2 enzymes. Planta 2006, 224, 1068-1079. Betti, M.; García-Calderón, M.; Pérez-Delgado, C.M.; Credali, A.; Estivill, G.; Galván, F.; Vega, J.M.; Márquez, A.J. Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. International Journal of Molecular Sciences 2012a, 13, 7994-8024. Betti, M.; Pérez-Delgado, C.; García-Calderón, M.; Díaz, P.; Monza, J.; Márquez, A.J. Cellular Stress Following Water Deprivation in the Model Legume Lotus japonicus. Cells 2012b, 1, 1089-1106. Breitling, R.; Armengaud, P.; Amtmann, A.; Herzyk, P. Rank products: a simple, yet powerful, new method to detect differentially regulated genes in replicated microarray experiments. FEBS Lett. 2004, 573, 83-92. Britto, D,T.; Kronzucker, H.J. NH 4+ toxicity in higher plants: a critical review. J. Plant Physiol. 2002, 159, 567-584. Credali, A.; García-Calderón, M.; Dam, S.; Perry, J.; Díaz-Quintana, A.; Parniske, M.; Wang, T.L.; Stougaard, J.; Vega, J.M.; Márquez, A.J. The K + -dependent asparaginase NSE1 is crucial for plant growth and seed production in Lotus japonicus. Plant and Cell Physiology 2013, 54, 107- 118. Czechowski, T.; Bari, R.P.; Stitt, M.; Scheible, W.R.; Udvardi, M.K. Real-time RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. Plant J. 2004, 38, 366–379. Díaz, P.; Betti, M.; Sánchez, D.H.; Udvardi, M.K.; Monza, J.; Márquez, A.J. 2010. Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytologist 2010, 188, 1001-1013. Doncheva, N.T.; Assenov, Y.; Domingues, F.S.; Albrecht, M. Topological analysis and interactive visualization of biological networks and protein structures. Nat Protoc. 2012, 15, 670-85. 136 Falcone Ferreyra, M.L.; Rius, S.P.; Casati, P. Flavonoids: biosynthesis, biological functions, and biotechnological applications. Front. Plant Sci. 2012, doi: 10.3389/fpls.2012.00222 Foyer, C.H.; Bloom, A.; Queval, G.; Noctor, G. Photorespiratory Metabolism: Genes, Mutants, Energetics and Redox Signalling. Annu. Rev. Plant Biol. 2009, 60, 455-484. García-Calderón, M.; Chiurazzi, M.; Espuny, M.R.; Márquez, A.J. Photorespiratory metabolism and nodule function: behavior of Lotus japonicus mutants deficient in plastid glutamine synthetase. Molecular Plant-Microbe Interactions 2012, 25, 211-219. Gautier, L.; Cope, L.; Bolstad, B.M.; Irizarry, R.A. Affy-analysis of Affymetrix GeneChip data at the probe level. Bioinformatics 2004, 20, 307-315. Goffard, N.; Weiller, G. Pathexpress: a web-based tool to identify relevant pathways in gene expression data. Nucleic Acids Res. 2007, 35, W176-W181. Handberg, K.; Stougaard, J. Lotus japonicus, an autogamous, diploid legume species for classical and molecular genetics. Plant J. 1992, 2, 487-496. Hernández, I.; Alegre, L.; van Breusegem, F.; Munné-Bosch, S. How relevant are flavonoids as antioxidants in plants. Trends Plant Sci. 2008, 14, 125–132. Hirel, B.; Le Gouis, J.; Gallais, A. The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. J. Exp. Bot. 2007, 58, 2369-2387. Høgslund, N.; Radutoiu, S.; Krusell, L.; Voroshilova,V.; Hannah, M.A.; Goffard, N.; Sanchez, D.H.; Lippold, F.; Ott, T.; Sato, S.; Tabata, S.; Liboriussen, P.; Lohmann, G.V.; Schauser, L.; Weiller, G.F.; Udvardi, M.K.; Stougaard, J. Dissection of symbiosis and organ development by integrated transcriptome analysis of Lotus japonicus mutant and wild-type plants. PLoS One 2009, doi:10.1371/journal.pone.0006556 Kawaguchi, M.; Imaizumi-Anraku, H.; Koiwa, H.; Niwa, S.; Ikuta, A.; Syono, K.; Akao, S. Root, root hair and symbiotic mutants of the model legume Lotus japonicus. Mol. Plant-Microbe Interact. 2002, 15, 17- 26. 137 Keys, A.J.; Bird, I.F.; Cornelius, M.J.; Lea, P.J.; Wallsgrove, R.M.; Miflin, B.J. Photorespiratory nitrogen cycle. Nature 1978, 275, 741–743. Lam, H.M.; Coschigano, K.T.; Oliveira, I.C.; Melo-Oliveira, R.; Coruzzi, G.M. The molecular-genetics of nitrogen assimilation into amino acids in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology 1996, 47, 569-593. Langfelder, P.; Zhang, B.; Horvath, S. Defining clusters from a hierarchical cluster tree: the Dynamic Tree Cut package for R. Bioinformatics 2008, 24, 719-20. Langfelder, P.; Horvath, S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinformatics 2008, 9, 559. Lodwig, E.M.; Hosie, A.H.F.; Bourdès, A; Findlay, K; Allaway, D.; Karunakavan, R., Downie, J.A., Polle, P.S. Amino-acid cycling drives nitrogen fixation in the legume-Rhizobium symbiosis. Nature 2003, 422, 722-726. Lopes, M.; Araus, J.L. Comparative genomic and physiological analysis of nutrient response to NH 4+ , NH 4+ :NO 3- and NO 3- in barley seedlings. Physiol. Plant. 2008, 134, 134-150. Márquez, A.J.; Betti, M.; García-Calderón, M.; Pal'ove-Balang, P.; Díaz, P.; Monza, J. Nitrate assimilation in Lotus japonicus. Journal of Experimental Botany 2005, 56, 1741-1749. Masclaux-Daubresse, C.; Daniel-Vedele, F.; Dechorgnat, J.; Chardon, F.; Gaufichon, L.; Suzuki, A. Nitrogen uptake, assimilation and remobilization in plants: challenges for sustainable and productive agriculture. Ann. Bot. 2010, 105, 1141-1157. Maurino, V.G.; Peterhansel, C. Photorespiration: current status and approaches for metabolic engineering. Current Opinion in Plant Biology 2010, 13, 249-256. Takenaka, Y.; Nakano, S.; Tamoi, M.; Sakuda, S.; Fukamizo, T. Chitinase gene expression in response to environmental stresses in Arabidopsis thaliana: chitinase inhibitor allosamidin enhances stress tolerance. Bioscience, biotechnology and biochemistry 2009, 73, 1066-71. 144 145 146 Supplemental Table S1. Oligos for qRT-PCR measurements. Gene Kazusa 2.5 code Primers Forward Reverse LjGLN1.1 chr2.CM0312.1480.r2. m TGGACCACAGGGCCCATAC AATGTCACGCCCATAGGCTTT LjGLN1.2 chr6.CM0014.300.r2.m TGAGGTGTGGGTTGCTCGTT AAGGACCACCCCAGCAATCT LjGLN1.3 LjSGA_030247.1 TAACCTCTCCGAGACCACCG CCAATCCATATGTATTCGGCG LjGLN1.4 LjSGA_058827.1 AGAGAGACTGAGAAAGATGGAA AATGT CAGGCCTCCTCTGTCCTCAA LjGLN1.5 LjSGA_019428.1 GGGTAGGCAGGGAGACTGAAA GAAGCTGGCCTCCTGTCCTC LjGLN2 chr6.CM0139.890.r2.m GGAAGAGGGAGGCTTTGAGGT CTGGTGGCGAAGGGATAGATT LjGLU1 chr1.CM0009.170.r2.d ATTCAACGAGTAACAGCGCCA CATGGGCTTCAATAAGGCTTCTC LjGLT1 LjSGA_035611.1 TGGTGCTGATGCTATATGCCC GTCAACCTGCAGTCGCCAA LjGLT2 LjSGA_037992.1 TTGGCAATGTGGCACTGTATG GCTGCCATCCCGTTGAAAT LjGDH1 chr1.CM0104.2530.r2. m GGAGATGTGCAAAACCCATGA CGGTTAACTCCCAGGGTGAAA LjGDH2 chr4.CM2142.210.r2.a ACATGACAATGCTCGTGGTCC AGGGTCAACCTCAGGGTGGTA LjASN1 chr5.CM0071.330.r2.d TGGAGGACCAACTGTTGCATG AGACCAAGCAGCATCCCACTC LjASN2 LjT47C13.80.r2.d TCAGTGAGCAAAGGTGTTGAAC C CAAGAGGAGAAACTTCCATCTTG G LjASN3 LjT09J04.190.r2.d CGAACTGGCAGTGATTGTGAAG TG ATGCCAATAGCATCACGAGCAG 147 Supplemental Table S2. List of genes that had higher expression level in plants cultivated with any of the N mineral nutrition (NO 3- , NH 4+ or NH 4 NO 3 ) compared with nodulated plants. It is available in the electronical version. Supplemental Table S3. List of genes that had lower expression level in plants cultivated with any of the N mineral nutrition (NO 3- , NH 4+ or NH 4 NO 3 ) compared with nodulated plants. It is available in the electronical version. Supplemental Table S4. List of genes elicited by the diminishment of CO 2 concentration and by the lack of GS2. It is available in the electronical version. 148 Publicación 4. Abiotic stress in Lotus: aluminum and drought. Pal’ove-Balang, Betti M, Díaz P, Pérez-Delgado CM, García-Calderón M, Monza J, Márquez AJ (2014). En: Molecular approaches in Plant Abiotic Stress (Gaur RK, Sharma P, eds). CRC Press, Boca Raton, Florida, USA, pp. 291-303. Cf. Apartado titulado “Drought stress” 149 ABSTRACT Different species of Lotus are currently used to improve pastures and hay quality where other forage legume species are not suitable, particularly in a diverse range of landscapes, including some often subjected to extreme environments and soil conditions. Among the forage legumes, Lotus sp. is moderately tolerant in areas constrained with low pH and Al toxicity. Cellular responses to Al toxicity are analyzed in Lotus, with an special focus to the changes produced at the root plant cell level, oxidative stress and other metabolic processes, as well as the possible role of proline, tannins and/or phytochelatins. On the other hand, drought stress is also another interesting topic of research in Lotus because it has been shown to substantially affect the productivity and persistence of Lotus species used in forage production. The recent transcriptomic and metabolic data obtained regarding drought stress responses in Lotus are summarized. Work carried out with either model or cultivated Lotus species and mutants is described, emphasizing the potential of results obtained with the model legume L. japonicus. 150 1. INTRODUCTION Numerous abiotic impediments continue to limit yield potential in legumes, including: drought, soil salinity, acidity, aluminum and nutrient limitation. Legumes account for approximately a third of the world's primary crop production, human dietary protein and processed vegetable oil. Considering that legumes are second after grasses in importance to agriculture and cover around 15 % of farmed land, there is a crucial need to increase stress tolerance in legumes whether by traditional breeding or molecular engineering (Udvardi et al., 2005; Graham and Vance, 2003). Among legumes, the genus Lotus includes more than 100 species that are found world wide except in very cold regions and the low land tropical areas of Southeast Asia and Central America. This worldwide distribution is partially due to their introduction to non-native areas by human activities and its adaptability to different environmental stresses. The adaptive characteristics shown by several Lotus species make them good candidates for restoration and phytoremediation of degraded environments (Belesky, 1999; Blumenthal and McGraw, 1999). Different species of Lotus are currently used to improve pastures and hay quality where other forage legume species are not suitable, particularly in a diverse range of landscapes, including some often subjected to extreme environments and soil conditions (Díaz et al., 2005a; Escaray et al., 2012). Consequently, the knowledge of the specific responses of Lotus plants to various types of stress and the corresponding molecular mechanisms lying down these responses, as well as the possible improvement of stress performance, is a subject of extraordinary interest. Recent projects, such as the European Union-funded project LOTASSA, coordinated by Drs. Juan Sanjuán and Monica Rebuffo, were aimed to join facilities, expertise and efforts in this direction (Rebuffo et al., 2008; LOTASSA, 2010). The most important Lotus species from an agronomical point of view are Lotus corniculatus L. (birds-foot trefoil), Lotus uliginosus Schkuhr. (greater lotus), Lotus tenuis Waldst et Kit. (narrowleaf trefoil, also called Lotus glaber Mill.) and Lotus subbiflorus Lagasca (hairy birdsfoot trefoil, also denoted for many years as Lotus pedunculatus). Moreover, L. corniculatus is considered one of the major forage legumes after lucerne (Medicago sativa) and white clover (Trifolium repens). Main regions where Lotus species are exploited for agronomical purposes are South America, North America and Europe. 10 countries sow about 95 % of Lotus species in the world, and more than 90 % of this area is planted with L. corniculatus. However, L. tenuis is being increasingly used for forage production in temperate or subtemperate areas in Argentina (particularly in the Salado region), Chile, Uruguay and USA, mostly in Western 151 and Northeastern states. In turn, L. uliginosus is sown in New Zealand and coastal Sotheast Australia, whereas L. subbiflorus, the only annual Lotus species with agronomical importance, is primarily sown in Uruguay (Díaz et al.,2005a ; Escaray et al., 2010). Lotus breeding programs can be assisted by the utilization of other closely related Lotus model legume species such as L. japonicus (ecotypes Gifu and MG- 20), L. filicaulis, and L. burtii, as a result of recent advancements (Udvardi et al., 2005; Márquez, 2005) and has produced recently major breakthroughs in legume plant molecular biology (Udvardi et al., 2005; Stacey et al., 2006). Studies on most of the major leguminous crops are hampered by large genome sizes and other disadvantages (polyploidy, transformation or regeneration recalcitrancies, few or large seeds and seedlings, genome duplications, long generation times, etc). The work with model legumes overcomes many of these problems. Therefore, work with abiotic stress in Lotus, and particularly in the model legume L. japonicus, may be also extremely helpful not only for Lotus but also for the general progress achievements that can be obtained in other legume plants. In this chapter we summarize the results recently obtained concerning two of the major sources of abiotic stress that affect cultivated Lotus plants worldwide: that is, aluminum and drought. 2. ALUMINUM STRESS 2.1. Al toxicity Aluminum is the third most abundant element in the Earth crust and exists in soils in various forms that are in correlation with pH. In mineral soils at neutral pH it is present as insoluble aluminosilicates, aluminophosphates and hydroxyoxides. In acidic conditions (pH < 5.0) dissolution of Al is enhanced into the soil solution as Al(H 2 O) 6 3+ that is strongly toxic for plants (Kinraide et al.,1991). The root is the most easily affected part of the plant by Al and inhibition of root elongation is one of the most evident badges of Al toxicity. Al strongly interacts with cell membranes and is also toxic for a wide range of cellular and metabolical processes including synthesis of nuclear DNA (Inostroza-Blancheteau et al., 2012). Cultivated pastures often occur in areas constrained with low pH and Al toxicity. Among the forage legumes, Lotus sp. is moderately tolerant to low pH in the soils (Blumenthal and Mc Graw 1999), therefore it is not only an interesting model plant for Al-stress response studies, 152 but also a promising species for improvements of the pastures productivity where other forage legumes are not suitable (Díaz et al.,2005a). 2.2. Cellular responses of Lotus to Al toxicity The most extensive root injury caused by Al occurs in the distal transition zone in the root tip, where the cell division terminated and the cells are under preparation of a rapid elongation, but root cap, meristem and elongation zone are also sensitive and can accumulate Al (Sivaguru 1998, Panda et al., 2009). The highly reactive Al compounds are able to bind to several sites including cell wall, plasma membrane, cytoskeleton and also nucleus. The most affected are rhizodemal and cortical cells. The primary binding sites of Al 3+ in the apoplast are probably the negative charged groups in the cell wall, such as pectins, xyloglucans or proteins that may immobilise about up to 99.9 % of the total Al fraction in root tissue (Poschenrieder 2008). However, the rate of Al accumulation is dependent not only on the pectin content, but also on its negative charge determined by its degree of methylation (Horst et al 2010). In the cell wall, insoluble Al 4 (PO 4 ) 3 complexes can be formed to retard the transport of Al but also inorganic P into the cytosol, causing phosphate deficiency symptoms (Zheng and Yang 2005) and activation of some isoenzymes of root acid phosphatase in model Lotus japonicus (Zelinová et al.,2009). Increase of activity and expression of acid phosphatase as well as its secretion are responses to phosphate deficiency which help in the mobilisation of Pi from organophosphates (Wasaki et al., 2009). Inhibition of root elongation is a primary and rapid symptom of exposure of plant roots to Al. Although different mechanisms can be involved including strong binding of Al to pectins (Horst et al.,2010 ), inhibition of auxin transport into root apices (Kollmeier et al.,2000) or disruption of cytosolic Ca 2+ homeostasis (Zhang and Rengel 1999), recent findings suggest an important role of ethylene evolution. In Lotus japonicus, similarly strong inhibition of root elongation was observed by Sun et al., (2007) after exposure to Al, ethylenereleasing substance, ethephon or to ethylene precursor, 1-aminocyclopropane-1- carboxylic acid (ACC). The Al 3+ induced inhibition of root elongation was substantially ameliorated in the presence of antagonists of ethylene biosynthesis, Co 2+ and aminoethoxyvinylglycine. Furthermore, in the same work, the overexpresion of two genes for the key enzymes of ethylene synthesis, MtACS and MtACO was proved in Medicago truncatula, because the homologues gene 153 sequence data for Lotus japonicus were not available. Proteomic profiling in Lotus suggested also a disruption of cytoskeleton due to decline of α and β tubulin (Navascués et al., 2012), that have important function in cell wall synthesis and organisation (Wasteneis et al., 2004). The common structural response to Al observed in Lotus sp. is an increase of vacuolar volume in young meristematic cells, formation of strong cell wall protuberances and callose depositions in the cell wall (Pal’ove-Balang et al., 2012). Callose deposits may accumulate in plasmodesmata, thus blocking the cell to cell trafficking, as it was postulated by Sivaguru et al., (2000). In Lotus, cell wall protuberances and callose deposits are not uniformly present throughout the cortex, but are irregularly distributed, with decreasing frequency centripetaly. Formation of such structures is likely related to cell defence mechanism to Al and has never been observed in low pH stress alone. The cells without such structures were deadly damaged (Pal’ove-Balang et al., 2012). One possible explanation of this phenomenon is a programmed cell death that was previously observed in barley (Pan et al., 2001). Mosaic-like structure of cell damage can affect the results of several physiological measurements, if performed in root-tip extracts. Inorganic Al has a very strong affinity for the plasma membrane, where interacts with carboxylic groups, phosphate groups and lipids. Membrane bound Al causes rigidification of membranes and can stimulate Fe 2+ -supported lipid peroxidation through binding to the membrane and promotion of changes in the arrangement of membrane lipids including packing of fatty acids that will facilitate the propagation of lipid peroxidation (Oteiza 1994). Plasma membrane potential has a crucial role for ion homeostasis of the cells and nutrient transport. This potential is dependent on the net movement of nutrients across the plasma membrane (diffusion potential E D ) and on the activity of H + -ATP-ases (proton pump) which moves the H + out of the cells increasing the positive charge of apoplast (the energy dependent component E P ). Both mechanisms form the resting membrane potential (E M ,) that is tissue and species specific, but is also relatively stable in certain conditions unless the cell membrane is damaged. In Lotus corniculatus cultivars, Al caused a strong decrease of E D , but also affected E P via decrease of activity of H + -ATP-ases. Furthermore, this effect was in good correlation with a difference in sensitivity between cultivars (Pavlovkin et al., 2009). These changes in plasma membrane properties by Al affect its ion transport properties, mainly secondary active transport of nutrients. 256 The existence of an asparaginase isoform with a higher enzyme activity and higher affinity for asparagine must be of crucial importance for plants that use asparagine as a N transport compound, such as L. japonicus, and suggests that LjNSE1 must be the main enzyme responsible for the utilization of asparagine in this plant, in accordance with the highest level of expression of this particular isoform in sink tissues of the plant (Credali et al., 2011). The high K m value for asparagine observed for LjNSE2 (around 30 mM), suggests that this particular isoenzyme may have a physiological role unrelated to the hydrolysis of asparagine in vivo, particularly because the asparagine concentration in xylem sap from L. japonicus is in the range of 6-17 mM (Waterhouse et al., 1996). However, LjNSE2 enzyme shows an efficient βaspartyl-hydrolase activity (K m = 0.54 ± 0.02 mM for β-asp-his). This was not the case for the K + -dependent isoform LjNSE1. The catalytic efficiency of the LjNSE2 isoform is 12-fold higher with β-aspartyl-histidine hydrolase than asparaginase activity. As various isoaspartyl peptides are known to arise from proteolytic degradation of post-translationally altered proteins containing isoaspartyl residues, plant-type asparaginases may not only function in asparagine catabolism but also as detoxifying enzymes (Bruneau et al., 2006). According to this proposal, K + -independent LjNSE2 is probably a detoxifying enzyme in L. japonicus. However, the K + -independent (ASPGA1) and K + - dependent (ASPGB1) asparaginases from Arabidopsis thaliana were found to be catalytically active with both L-asparagine and β-Asp-His as substrates, having ASPGB1 a 45-fold higher specific activity with asparagine as substrate than ASPGA1 (Gabriel et al., 2012). These results establish some differences with regard to asparaginase behaviour in L. japonicus compared to A. thaliana, in spite of the presence in both species of K + -dependent and K + -independent isoforms (Bruneau et al., 2006; Credali et al., 2011). Mass spectrometric analysis of purified asparaginase protein preparations revealed a molecular mass of 20.90 ± 0.15 kDa and 17.11 ± 0.15 kDa for α and β subunits of recombinant LjNSE1 respectively (including an His-tag tail), and 20.18 ± 0.15 kDa and 17.33 ± 0.15 for the same subunits in LjNSE2. These results are compatible with the existence of a single protein cleavage site placed at the peptide bond next to the expected highly conserved Thr residue previously reported to be catalytically active (Thr196 for LjNSE1 and Thr187 for LjNSE2), similarly to other plant asparaginases described (Credali et al., 2011). 257 So far Lupinus luteus K + -independent asparaginase is the only plant asparaginase that has been crystallized (Michalska et al., 2006). Using L. luteus crystal structure as a template, models of L. japonicus K + -dependent (LjNSE1) and K + -independent (LjNSE2) asparaginases have been created and the two proteins belonging to the different plant asparaginase subfamilies have been compared (Credali et al., 2011). As expected, the (αβ) heterodimers have the classical αββα sandwich Ntn-hydrolase fold with a protein core composed of two open β-sheets surrounded on each side by an α-helix layer. The (αβ)–(αβ) interface is additionally cemented by a number of hydrophobic interactions, with contribution from all four subunits. The hydrophobic side-chains are scattered throughout the entire interface. The two β-sheets at the core of the LjNSE1 and LjNSE2 proteins were highly similar. In contrast, two low identity regions were found. The first corresponds to residues 16-35 (loop 1 in α-helix 1 in α-subunit) whose structure is conserved but with a different net charge. The second low identity stretch spans from residues 158 to 195 in LjNSE1, which correspond to the variable loop at the C-end in the α-subunit. Electrostatic surface potentials (ESP) of the two proteins were similar but LjNSE1 showed negative patches that were absent in LjNSE2. The most significant one was located at the rim of the active site crevice and is formed by Glu248, Asp285 and Glu286 (Fig. 7), that are replaced in LjNSE2 by Lys239, Pro276 and Lys277 respectively. These three amino acid residues were found to be crucial for K + interactions with LjNSE1 as determined by site-directed mutagenesis (Credali et al., 2011). It is frequent that metal binding sites in proteins are formed by small loops in the polypeptide that provide a set of 3-4 ligands and thus define the site (Williams, 1998). K + -dependent LjNSE1 asparaginase appears to be another of such examples where the above mentioned ligands must contribute to the coordination of K + . Considered that 6 ligands in octahedral configuration is the most commonly observed geometry for the monovalent cation coordination (Page and Di Cera, 2006), it is likely that at least one and possibly two water molecules could be involved in the completion of the K + coordination in the LjNSE1 from L. japonicus and may be in other K + - dependent plant asparaginases. Other molecular dynamics and docking studies further confirmed the crucial relevance of K + for the proper orientation of asparagine substrate within the enzyme molecule and other features of LjNSE1 protein structure (Credali et al., 2011). Recently, Gabriel et al. (2012) have suggested a role also for the asparaginase variable loop in the determination of substrate preference in the plant asparaginases. Homology modelling identified in the K + -dependent asparaginase from A. thaliana (ASPGB1) the Phe162 residue, preceding the variable loop, whose side chain is located in proximity to 258 the β-carboxylate group of the product aspartate, and Gly246, a residue participating in an oxyanion hole, which stabilizes a negative charge forming on the side chain oxygen of asparagine during catalysis. Fig. 7. Negative patch region within the LjNSE1 asparaginase molecule that binds K + . Concerning the potassium effect, enzymes can be classified into those that rely on high and relatively stable concentrations of K + in certain cellular compartments and those that depend on K + mobility between different compartments, cells, or tissues. Our results indicate that K + -dependent asparaginase will belong to the first class function that includes enzyme activation, stabilization of protein synthesis, and neutralization of protein negative charges (Marschner, 1995). Use of TILLING mutants for the study of K + -dependent LjNSE1 asparaginase functionality L. japonicus contains three asparaginase isoforms, named respectively LjNSE1, LjNSE2 and LjNSE3. According to their protein sequence data, two of these isoforms look to be K + -dependent (LjNSE1 and LjNSE3), and the other one is K + -independent (LjNSE2). A differential expression of these isoforms was observed in different organs of this plant (Credali, 2011). K + -dependent LjNSE1 is by far the most highly expressed in many tissues of the plant. The reverse genetics TILLING tool (Targeted Induced Local Lesions IN Genomes, Perry et al., 2003) enabled to identify several mutants affected in the LjNSE1 gene from L. japonicus (Credali et al., 2013). Four different mutants were found and characterized, two of which (L230F and G206R) were affected in the structure and function of the asparaginase molecule and caused asparagine accumulation. The Leu230 residue is located at the interface of the two αβ dimers, and replacement of Leu230 by the aromatic residue phenylalanine results in several 259 steric constraints. On the other hand, Gly206 residue is positioned in the turn of two β strands and replacement of the small residue Gly206 by arginine affects the electrostatic environment within the protein and alters the structure of asparaginase. Analysis of these deleterious mutations enabled to show that LjNSE1 is not determinant for the nodulation of L. japonicus plants. Several studies were carried out to test if the nodulation performance was affected in the mutant plants. Although the L. japonicus NSE1 deficient mutants showed a much lower number and fresh weight of nodules compared to the WT, however, the specific ratio between fresh weight of nodules and fresh weight of roots was not significantly altered, indicating that the lower nodulation performance of the mutants must be due to their smaller size, but not to an essential requirement of LjNSE1 for nodulation (Credali et al., 2013). In contrast, LjNSE1 protein seems to be crucially relevant for plant growth and seed production. In fact, the size of NSE1 deficient mutant plants was much smaller than the WT at different times of growth. Stem length and leaf fresh weight were about 60-90% reduced at 35 days after sowing. A 70-80% decrease in root weight was also observed. Other growth parameters (stem number, trifoliate leaf number and root length) were also lower in the mutant plants affected in NSE1. Regarding to the effects produced by LjNSE1 deficiency on seed production, it was found that the mutant pods were shorter and contained a high proportion (up to 45%) of abnormal seeds, which were significantly smaller and had a shape completely different to that of the normal L. japonicus seeds. Aborted seed formation was also detected in the NSE1 deficient mutant plants. In addition, thin sections of normal seeds from WT and mutants resulted fairly similar, but, in contrast, histological sections of abnormal seeds indicated that no embryos were visible. Further work was carried out to investigate the effects of asparaginase deficiency on seed storage protein accumulation. It is known that mature WT L. japonicus seeds contain approximately 40% protein mainly in the form of the storage globulins (legumin and convicilin) (Dam et al., 2009). It could be demonstrated that the NSE1 mutant seeds had lower storage globulins content than the WT seeds. However, the ratio between legumin (LLPs) and convicilin (LCPs) storage proteins was not significantly altered (Credali et al., 2013). All these results on the analysis of Ljnse1 mutants point out a key difference between legumes such L. japonicus and other plants such as A. thaliana, where it was recently shown that asparaginase mutants develop normally, but exhibited enhanced root inhibition by exogenous asparagine (Ivanov et al., 2011). This weak phenotype in Arabidopsis was attributed to the fact that asparagine only accounts for approximately 5% of total amino acids in 260 the phloem sap of Brassicaceae, whereas it accounts for 86% of nitrogen translocated in L. japonicus. Asparagine and photorespiration It has been well known for a long time that asparagine can be used as nitrogen donor for transaminase reactions associated with the nitrogen photorespiratory cycle (Givan et al., 1988; Joy, 1988). Asparagine aminotransferase was characterized from pea leaves and appeared to be the same protein as the peroxisomal photorespiratory enzyme serine-glyoxylate aminotransferases (SGAT) (EC 2.6.1.45), based on its substrate preference and subcellular localization (Ireland and Joy, 1983a and 1983b). Indeed, tobacco and barley mutants lacking SGAT were devoid of asparagine aminotransferase activity (Havir and McHale, 1988; Murray et al., 1987). In addition, it has been recently demonstrated that a recombinant SGAT enzyme has a 5-20 fold higher V max and a higher catalytic efficiency for asparagine compared to serine or alanine (Zhang et al., 2013). All these results encourage further work to be carried out in order to determine the exact significance of asparagine transamination in photorespiration. The availability now of Ljnse1 mutants from L. japonicus that accumulate higher amounts of asparagine, makes it very interesting to determine if there is some interconnection between asparaginase deficiency and SGAT or other photorespiration-related processes in L. japonicus plants. CONCLUDING REMARKS In this review we have summarized the recent progress made on the characterization of two of the major sources of endogenous ammonium in plants, such as photorespiration and the asparaginase reaction. We used for this purpose the model legume L. japonicus, which is the focus for modern genome sequencing and functional genomics programs (Márquez, 2005, Udvardi et al., 2005, and references therein). The results described in this paper highlight the crucial importance of ammonium reassimilation in the legume plants and the usefulness of the mutants analyzed for future studies on plant nitrogen nutrition. 261 ACKNOWLEDGEMENTS Authors thank financial support given by Consejería de Economía, Innovación y Ciencia, Junta de Andalucía, Spain (project P10-CVI-6368 and group BIO-163), as well as the European Union project EXPERT (ITMS Code 26110230056) and VEGA project 1/0046/14 from Slovakia. C.M.P. acknowledges the receipt of a PIF fellowship from University of Seville (Spain). Technical and secretarial assistance of María José Cubas and Aurora Gómez is also gratefully recognized. REFERENCES Agati G, Brunetti C, Di Fernando M, Ferrini F, Pollastri S, Tattini M. 2013. Functional roles of flavonoids in photoprotection: New evidence, lessons from the past. Plant Physiology and Biochemistry 72, 35-45. Andrews M. 1986. Nitrate and reduced-N concentrations in the xylem sap of Stellaria media, Xanthium strumarium and six legume species. Plant Cell and Environment 9, 605-608. Bauwe H, Hageman M, Fernie AR. 2010. Photorespiration: players, partners and origin. Trends in Plant Sciences 15, 330-336. Besseau S, Hoffman L, Geoffroy P, Lapierre C, Pollet B, Legranda H. 2007. Flavonoid accumulation in Arabidopsis repressed in lignin synthesis affects auxin transport and plant growth. Plant Cell 19, 148-162. Betti M, Arcondéguy T, Márquez AJ. 2006. Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase. Functional properties of purified GLN2 enzymes. Planta 224, 1068-1079. Betti M, García-Calderón M, Pérez-Delgado CM, Credali A, Estivill G, Galván F, Vega JM, Márquez AJ. 2012. Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. International Journal of Molecular Sciences 13, 7994-8024. Blackwell RD, Murray AJS, Lea PJ, Kendall AC, Hall NP, Turner JC, Wallsgrove RM. 1988. The value of mutants unable to carry out photorespiration. Photosynthesis Research 16, 155-176. Borek D, Jaskolski M. 2001. Sequence analysis of enzymes with asparaginase activity. Acta Biochimica Polonica 48, 893-902. Borek D, Michalska K, Brzecinski K, Kisiel A, Podkowinski J, Bonthron DT Krowarsch D, Otlewski J, Jaskolski M. 2004. Expression, purification and catalytic activity of Lupinus luteus asparagine β-amidohydrolase and its 262 Escherichia coli homolog. European Journal of Biochemistry 271, 3215- 3226. Britto DT, Kronzucker HJ. 2002. NH 4+ toxicity in higher plants: a critical review. Journal of Plant Physiology 159, 567-584. Bruneau L, Chapman R, Marsolais F. 2006. Co-occurrence of both L- asparaginase subtypes in Arabidopsis: At3g16150 encodes a K + -dependent L-asparaginase. Planta 224, 668-679. Buer ChS, Imin N, Djordjevic MA. 2010. Flavonoids: New Roles for Old Molecules. Journal of Integrative Plant Biology 52, 98–111. Bykova NV, Keerberg O, Pärnik T, Bauwe H, Gardeström P. 2005. Interaction between photorespiration and respiration in transgenic potato plants with antisense inhibition of glycine decarboxylase. Planta 222, 130-140. Cánovas FM, Ávila C, Cantón FR, Cañas RA, De la Torre F. 2007. Ammonium assimilation and amino acid metabolism in conifers. Journal of Experimental Botany 58, 2307-2318. Cañas RA, de la Torre F, Cánovas FM, Cantón FR. 2007. Coordination of PsAS1 and PsASPG expression controls timing of re-allocated N utilization in hypocotyls of pine seedlings. Planta 225, 1205-1219. Carvalho HG, Lopes-Cardoso IA, Lima LM, Melo PM, Cullimore JV. 2003. Nodule-specific modulation of glutamine synthetase in transgenic Medicago truncatula leads to inverse alterations of asparagine synthetase expression. Plant Physiology 133, 243-252. Castelluccio C, Paganga G, Melikian M, Bolwell P, Pridham, J, Sampson J, Rice Evans C. 1995. Antioxidant potential of intermediates in phenylpropanoid metabolism in higher plants. FEBS Letters 368, 188-192. Costa MA, Bedgar DL, Moinuddin SGA, Kim KW, Cardenas CL, Cochrane FC, Shockey JM, Helms GL, Amakura Y, Takahashi H, Milhollan JK, Davin LB, Browse J, Lewis NG. 2005. Characterization in vitro and in vivo of the putative multigene 4-coumarate:CoA ligase network in Arabidopsis: syringil lignin and sinapate/sinapyl alcohol derivate formation. Phytochemistry 66, 2072-2091. Credali A. 2011. Metabolismo de la asparragina en Lotus japonicus: Estructurafunción de las L-asparraginasas. PhD thesis, University of Seville, Spain. Credali A, Díaz-Quintana A, García-Calderón M, De la Rosa MA, Márquez AJ, Vega JM. 2011. Structural analysis of K + dependence in L-asparaginases from Lotus japonicus. Planta 234, 109-122. Credali A, García-Calderón M, Dam S, Perry J, Díaz-Quintana A, Parniske M, Wang TL, Stougaard J, Vega JM, Márquez AJ. 2013. The K + -dependent asparaginase NSE1 is crucial for plant growth and seed production in Lotus japonicus. Plant and Cell Physiology 54, 107-118. 263 Cui MH, Yoo KS, Hyoung S, Nguyen HTK, Kim YY, Kim HJ, Ok SH, Yoo SD, Shin JS. 2013. An Arabidopsis R2R3-MYB transcription factor, AtMYB20, negatively regulates type 2C serine/threonine protein phosphatases to enhance salt tolerance. FEBS Letters 587, 1773–1778. Dam S, Laursen BS, Ornfelt JH, Jochimsen B, Staerfeldt HH, Friis C, Nielsen K, Goffard N, Besenbacher S, Krusell L, Sato S, Tabata S, Thøgersen IB, Enghild JJ, Stougaard J. 2009. The proteome of seed development in the model legume Lotus japonicus. Plant Physiology 149, 1325-1340. Díaz P, Betti M, Sánchez DH, Udvardi MK, Monza J, Márquez AJ. 2010. Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytologist 188, 1001-1013. Ding Z, Li S, An X, Liu X, Qin H, Wang D. 2009. Transgenic expression of MYB15 confers enhanced sensitivity to abscisic acid and improved drought tolerance in Arabidopsis thaliana. Journal of Genetics and Genomics 36, 17-29. Duggleby HJ, Tolley SP, Hill CP, Dodson ES, Dodson G, Moody PCE. 1995. Penicillin acilase has a single-aminoacid catalytic center. Nature 373, 264- 268. Ehlting J, Büttner D, Wang Q, Douglas CJ, Somssich IE, Kombrink E. 1999. Tree 4-coumarate: coenzyme a ligases in Arabidopsis thaliana represent two evolutionarily divergent classes in angiosperms. The Plant Journal 19, 9-20. Ferrer JL, Austin MB, Steward Jr. C, Noel JP. 2008. Structure and function of enzymes involved in the biosynthesis of phenylpropanoids. Plant Physiology and Biochemistry 46, 356–370. Gabriel M, Telmer PG, Marsolais F. 2012. Role of asparaginase variable loop at the carboxyl terminal of the alpha subunit in the determination of substrate preference in plants. Planta 235, 1013-1022. García-Calderón M, Chiurazzi M, Espuny MR, Márquez AJ. 2012. Photorespiratory metabolism and nodule function: behavior of Lotus japonicus mutants deficient in plastid glutamine synthetase. Molecular Plant-Microbe Interactions 25, 211-219. Givan CV, Joy KW, Kleczkowski LA. 1988. A decade of photorespiratory nitrogen cycling. Trends in Biochemical Sciences 13, 433-437. Guo HC, Xu Q, Buckley D, Guan C. 1998. Crystal structures of flavobacterium glycosylasparaginase. An N-terminal nucleophile hydrolase activated by intramolecular proteolisis. Journal of Biological Chemistry 273, 20205- 20212. 264 Havir EA, McHale NA. 1988. A mutant of Nicotiana sylvestris lacking serine:glyoxylate aminotransferase: substrate specificity of the enzyme and gate of [2- 14 C] glycolate in plants with genetically altered enzyme levels. Plant Physiology 87, 806-808. Hirel B, Le Gouis J, Gallais A. 2007. The challenge of improving nitrogen use efficiency in crop plants: towards a more central role for genetic variability and quantitative genetics within integrated approaches. Journal of Experimental Botany 58, 2369-2387. Husted S, Mattson M, Möllers C, Walbraun M, Schjoerring JK. 2002. Photorespiratory NH 4+ production in leaves of wild-type and glutamine synthetase 2 antisense oilseed rape. Plant Physiology 130, 989-998. Ivanov A, Kameka A, Pajak A, Bruneau L, Beyaert R, Hernández-Sebastiá C, Marsolais F. 2011. Arabidopsis mutants lacking asparaginases develop normally but exhibit enhanced root inhibition by exogenous asparagine. Amino Acids 42, 2307-2318. Ireland RJ, Joy KW. 1983a. Purification and properties of an asparagine aminotransferase from Pisum sativum leaves. Archives of Biochemistry and Biophysics 1, 291-296. Ireland RJ, Joy KW. 1983b. Subcellular localization of asparaginase and asparagine aminotransferase in Pisum sativum leaves. Plant Physiology 72, 1127-1129. Joy KW. 1988. Ammonia, glutamine, and asparagine: a carbon-nitrogen interface. Canadian Journal of Botany 66, 2103-2109. Keys AJ. 2006. The re-assimilation of ammonia produced by photorespiration and the nitrogen economy of C 3 higher plants. Photosynthesis Research 87, 165-175. Keys AJ, Leegood RC. 2002. Photorespiratory carbon and nitrogen cycling: evidence from studies of mutants and transgenic plants. In: Foyer CH, Noctor G, eds. Advances in photosynthetic Nitrogen Assimilation and Associated Carbon and respiratory Metabolism. Ed 1, Vol. 1. Kluwer Academic Publisher, Dordrecht, the Netherlands, 115-134. Keys AJ, Bird IF, Cornelius MJ, Lea PJ, Wallsgrove RM, Miflin BJ. 1978. Photorespiratory nitrogen cycle. Nature 275, 741-743. Khan JA, Dunn BM, Tong L. 2005. Crystal structure of human Taspase1, a crucial protease regulating the function of MLL. Structure 13, 1443-1452. Kim Y, Yoon K, Khang Y, Turley S, Hol WG. 2000. The 2.0 Å crystal structure of cephalosporin acylase. Structure Folding and Design 8, 1059-1068. Kissen R, Winge P, Tran DHT, Jørstad TS, Størseth TR, Christensen T, Bones AM. 2010. Transcriptional profiling of an Fd-GOGAT1/GLU1 mutant in 265 Arabidopsis thaliana reveals a multiple stress response and extensive reprogramming of the transcriptome. BMC Genomics 11, 190. Kusano M, Tabuchi M, Fukushima A, Funayama K, Díaz C, Kobayashi M, Hayashi N, Tsuchiya YN, Takahashi H, Kamata A, Yamaya T, Saito K. 2011. Metabolomics data reveal a crucial role of cytosolic glutamine synthetase 1;1 in coordinating metabolic balance in rice. The Plant Journal 66, 456-466. Lam HM, Coschigano KT, Oliveira IC, Melo-Oliveira R, Coruzzi GM. 1996. The molecular-genetics of nitrogen assimilation into amino acids in higher plants. Annual Review of Plant Physiology and Plant Molecular Biology 47, 569-593. Lea PJ, Sodek L, Parry MAJ, Shewry PR, Halford NG. 2007a. Asparagine in plants. Annals of Applied Biology 150, 1-26. Lea US, Slimestad R, Smedvig P, Lillo C. 2007b. Nitrogen deficiency enhances expression of specific MYB and bHLH transcription factors and accumulation of end products in the flavonoid pathway. Planta 225, 1245– 1253. Leigh RA, Wyn Jones RG. 1984. A hypothesis relating critical potassium concentrations for growth to the distribution and functions of this ion in the plant cell. New Phytologist 97, 1-13. Lillo C, Lea US, Ruoff P. 2008. Nutrient depletion as a key factor for manipulating gene expression and product formation in different branches of the flavonoid pathway. Plant Cell and Environment 31, 587-601. Márquez AJ. 2005. Lotus japonicus handbook. Springer, Dordrecht, The Netherlands. Márquez AJ, Betti M, García-Calderón M, Pal'ove-Balang P, Díaz P, Monza J. 2005. Nitrate assimilation in Lotus japonicus. Journal of Experimental Botany 56, 1741-1749. Marschner H. 1995. Mineral nutrition of higher plants, 2nd ed. Academic Press: London, England, 1-889. Masclaux-Daubresse C, Daniel-Vedele F, Dechorgnat J, Chardon F, Gaufichon L, Suzuki A. 2010. Nitrogen uptake, assimilation and remobilization in plants: challenges for sustainable and productive agriculture. Annals of Botany 105, 1141-1157. Maurino VG, Peterhansel C. 2010. Photorespiration: current status and approaches for metabolic engineering. Current Opinion in Plant Biology 13, 249-256. Michalska K, Brzezinski K, Jaskolski M. 2005. Crystal structure of Isoaspartylaminopeptidase in complex with L-aspartate. Journal of Biological Chemistry 280, 28484-28491. 272 G S Level of expression (relative units) Level of expression Symbol 0 - 0.001 Undetectable ND 0.001 - 0.01 Very Low VL 0.01 - 0.1 Low L 0.1 - 1 High H 1 - 10 Very High VH Table 1. Genes for ammonium assimilation in L. japonicus 2. Enzymes involved in ammonium assimilation 2.1. The GS-GOGAT cycle Glutamine is the first organonitrogen compound that is synthesized in the plants as a result of both primary and secondary ammonium assimilation, by means of the glutamine synthetase (GS) / glutamate synthase (GOGAT) cycle. Glutamine synthetase (EC 6.3.1.2) catalyses the biosynthesis of L-glutamine from L-glutamate, ATP and NH 4+ according to the following reaction, that requires also Mg 2+ cations as cofactors: Gene Name Code in Kazusa 2.5 Levels of expression Ortholog genes in A. thaliana Leaves Roots Nodules LjGln1.1 chr2.CM0312.1480.r2.m H H H At5g37600 (AtGln1.1) At1g66200 (AtGln1.2) At3g17820 (AtGln1.3) At5g16570 (AtGln1.4) At1g48470 (AtGln1.5) LjGln1.2 chr6.CM0014.300.r2.m VH VH VH LjGln1.3 LjSGA_030247.1 L VL VL LjGln1.4 LjSGA_058827.1 L ND ND LjGln1.5 LjSGA_019428.1 VL ND ND LjGln2 chr6.CM0139.890.r2.m VH VH VH At5g35630 (AtGln2) LjGlu1 chr1.CM0009.170.r2.d VH H H At5g04140 (AtGlu1) At2g41220 (At Glu2) LjGlt1 LjSGA_035611.1 VL L L At5g53460 (AtGlt1) LjGlt2 LjSGA_037992.1 H H H LjGdh1 chr1.CM0104.2530.r2.m H VH L At5g18170 (AtGdh1) At5g07440 (AtGdh2) At3g03910 (AtGdh3) LjGdh2 chr4.CM2142.210.r2.a VL L VL LjGdh3 chr2.CM0021.1320.r2.m ND VL ND LjGdh4 chr3.CM1488.210.r2.d chr3.CM1488.260.r2.d chr3.CM1488.250.r2.d chr3.CM1488.230.r2.d H H H At1g51720 (AtGdh4) LjAsn1 chr5.CM0071.330.r2.d VH VH H At3g47340 (AtAsn1) At5g65010 (AtAsn2) At5g10240 (AtAsn3) LjAsn2 LjT47C13.80.r2.d VL VH VH LjAsn3 LjT09J04.190.r2.d L L L LjNse1 chr5.CM0096.20.r2.m VH H L At3g16150 (AtAspGB1) LjNse2 chr4.CM0087.1740.r2.m L H H At5g08100 (AtAspGA1) LjNse3 LjSGA_021574.1 H L VL At3g16150 (AtAspGB1) 273 GOGAT G S - GOGAT G DH L-glutamate + ATP + NH 4 +  L-glutamine + ADP + P i Subsequently, the glutamate synthase enzyme (EC 1.4.7.1 or EC 1.4.1.14) catalyses the transfer of the amide group of glutamine into 2-oxoglutarate, yielding two molecules of glutamate, a reaction requiring also two electrons coming either from reduced ferredoxin (Fd-GOGAT) or pyridine nucleotides (NADH-GOGAT), as follows: L-glutamine + 2-oxoglutarate + 2 e - + 2 H +  2 L-glutamate The global balance of the consecutive action of these two enzymes forms the GS-GOGAT cycle by which one of the two molecules of glutamate formed by the GOGAT would be used by the reaction of GS. Consequently the GSGOGAT pathway results in the net formation of one molecule of L-glutamate at the expenses of one molecule of 2-oxoglutarate, one molecule of NH 4+ and one molecule of ATP as follows: 2-oxoglutarate + NH 4 + + 2 e - + 2 H + + ATP  L-glutamate + ADP + P i 2.2. Glutamate dehydrogenase In addition to GS and GOGAT, which catalyse irreversible reactions, a third enzyme, glutamate dehydrogenase (GDH; EC 1.4.1.2/4) catalyses a reversible amination/deamination reaction, which could lead to either the synthesis or the catabolism of glutamate, according to the following equation: 2-oxoglutarate + NH 4 + + NAD(P)H + H + L-glutamate + NAD(P) + The role of GDH in glutamate catabolism is quite well established. Instead, the possible anabolic role of GDH for the assimilation of ammonium has been the subject of continuous controversy because most lines of evidence support that glutamate biosynthesis takes place through the GS-GOGAT pathway although it has been also reported a role for GDH under different plant stress situations. It has been proposed that GDH has an important meaning in terms of metabolic signaling in relation to partitioning of C and N assimilates being likely that GDH contributes to the control of the homeostasis of leaf glutamate, a process of crucial importance (Fontaine et al. 2012). 2.3. Asparagine metabolism: asparagine synthetase and asparaginase In most temperate legumes, it is proposed that asparagine, rather than glutamine, is the principal molecule used to transport reduced nitrogen within the plant, in contrast to many other plant species (Credali et al. 2013). This is the case for L. japonicus where it has been shown that asparagine can account for 274 NSE almost 90 % of the nitrogen transported from root to shoot (Waterhouse et al. 1996). Asparagine synthetase (AS, EC 6.3.5.4) is the main enzyme in charge of asparagine biosynthesis in plants. This enzyme catalyzes the transfer of the amide group from glutamine to aspartate in an ATP-dependent reaction: It has been also proposed that the enzyme can use high concentrations of ammonia directly as substrate, but this is not clearly demonstrated (Lea et al. 2007). Considering that asparagine is a nitrogen transport compound in Lotus, asparagine breakdown is also a process of crucial importance for this plant (Credali et al. 2013). Asparaginase (NSE, EC 3.5.1.1) catalyses the hydrolysis of asparagine to yield aspartate and ammonia as follows: Asparagine + H 2 O  Aspartate + NH 4 + The ammonia released by the asparaginase reaction has to be subsequently reassimilated by GS (Lea et al. 2007) 3. Genes for ammonium assimilation 3.1. Glutamine synthetase (GS) As in other plant species, a small multigene family is responsible for GS enzymatic activity in L. japonicus. Five gene sequences encoding for cytosolic GS (also called GS1 or Gln1) and another one for plastidic GS (also called GS2 or Gln2) were found in the available databases. Two of the cytosolic genes are expressed at high (LjGln1.1) or very high (LjGln1.2) levels in leaves, roots and nodules from this plant (Table 1). The level of expression of the LjGln1.2 gene is about 3-fold higher in nodules than in roots or leaves, while for the case of LjGln1.1 gene, the level of expression is lower in nodules and leaves than in roots (results not shown). The third gene (LjGln1.3) is expressed at low level in leaves and at very low levels in roots and nodules. A fourth and a fifth cytosolic gene (LjGln1.4 and LjGln1.5) are only expressed at low (LjGln1.4) or very low (LjGln1.5) levels in leaves. Cytosolic GS polypeptides are the most abundant both in roots and nodules of L. japonicus plants (García-Calderón et al. 2012; Orea et al. 2002). Previous studies in L. japonicus had indicated that a high level of GS activity in the root is negatively correlated with above-ground biomass (Limami et al. 1999). On the other hand, lowering GS activity in nodules results 275 in an increase in fresh weight in nodules, roots and shoots (Harrison et al. 2003). This change in biomass could be explained by more efficient ammonium assimilation in the nodules of transformed plants, as indicated by a large increase in amino acids (mostly asparagine) with a concomitant decrease in carbohydrate content (Harrison et al. 2000). Other results established that constitutive overexpression of GS1 in Lotus produce higher amino acid levels and soluble protein concentration, higher chlorophyll content and a higher biomass accumulation in the transgenic plants (Ortega et al. 2004) while overexpression in shoots may accelerate plant development, leading to early senescence and premature flowering when plants are grown on an ammonium-rich medium (Vincent et al. 1997). In addition, it was also described that overexpression of GS1 in reproductive organs critically affects their development and might be a reason for sterility of L. japonicus plants (Suárez et al. 2003). In other plant species 2-5 functional Gln1 genes have been generally reported. Different versions of these genes have been found to be associated with different roles in primary ammonium assimilation and other forms of N recycling in response to nitrogen availability in the external medium, plant nitrogen status, light/dark conditions or abiotic/biotic stressors (Bernard and Habash 2009). Cytosolic GS assimilates ammonium from the three major types of nitrogen-fixing symbiotic association involving plants and either Rhizobium, actinomycetes such as Frankia, or cyanobacteria. In some species a specific cytosolic GS isoenzyme is induced in nitrogen-fixing root nodules, whereas, in others, cytosolic GS already present is involved (Bernard and Habash 2009). Regarding to Gln2, a single gene has been detected in L. japonicus, which has very high levels of expression either in leaves, roots or nodules (Table 1). Nevertheless, the levels of transcript detected in leaves were found to be about 5- fold higher than those present in roots or nodules from this plant (results not shown). In most plant species plastidic GS (GS2) is exclusively or very predominantly expressed in green tissues. However, the presence of GS2 was clearly demonstrated in non-photosynthetic tissues of temperate legumes (García-Calderón et al. 2012). In Medicago truncatula, a second Gln2 gene was recently shown to be exclusively expressed in developing seeds (Seabra et al. 2010). The first gln2 mutants available from legume plants were isolated from L. japonicus belonging to the class of photorespiratory mutants previously described in other plant species (Márquez et al. 2005; Orea et al. 2002;). The Ljgln2 mutants were further characterised at the molecular level showing to be affected by single point mutations within the structural part of the LjGln2 gene, which lead to amino acid replacements that abolish GS2 enzymatic activity completely (Betti et al. 2006). These mutants were used to analyze how photorespiratory metabolism affects nodule function in L. japonicus plants 276 (García-Calderón et al. 2012). The results obtained indicated that in this plant photorespiration, and, particularly, GS2 deficiency result in profound limitations in carbon metabolism that affect the nodulation process and nitrogen fixation. An anticipated senescence phenotype linked to an important reduction in starch and sucrose levels was observed (García-Calderón et al. 2012). On a separate work, a single LjGln2 locus encoding for GS2 was mapped together with other symbiotic loci (Sandal et al. 2006). More recently, GS2 was also involved in drought stress, nitrogen nutrition and photorespiratory metabolism transcriptomic responses in L. japonicus plants (Betti et al. 2012; Díaz et al. 2010; Pérez-Delgado et al. 2013). 3.2. Glutamate synthase (GOGAT) One LjGlu1 gene encoding for Fd-GOGAT and two different genes for NADH-GOGAT (LjGlt1 and LjGlt2) were identified in Kazusa database. Expression levels of LjGlu1 were very high in photosynthetic tissues but also were high in roots and nodules, as it also happened with LjGlt2 whose expression levels were also high in the three types of tissues. However, this was not the case for LjGlt1 gene which was poorly expressed in roots, nodules and leaves (Table 1). Early studies indicated that NADH-GOGAT appeared to play a major role in legume root nodules, in which the activity increases dramatically following the onset of nitrogen fixation. Two different isoforms of NADH-GOGAT have been described in other plant species, one of them clearly associated to effective nodules (Ireland and Lea 1999, and references therein). Measurements of mRNA levels and promoter-GUS fusions of the NADH-GOGAT genes in alfalfa and Lotus have shown the tight relationship of the regulated expression of NADHGOGAT to the nodulation process in legumes (Vance et al. 1995). 3.3. Glutamate dehydrogenase (GDH) Three different genes encoding for the NAD + -dependent GDH were identified in L. japonicus (Table 1). One of them (LjGdh1) showed high or very high levels of expression in leaves and roots respectively and low level in nodules. The other two genes (LjGdh2 and LjGdh3) were poorly expressed in these tissues. The majority of recent studies performed on NAD + -GDH in higher plants have been focused on deciphering the role of the α- and β-subunits in the formation of seven isoenzymes which are encoded by two distinct nuclear genes, Gdh2 and Gdh1, respectively. More recently it has been found that in Arabidopsis there is a third gene (AtGdh3) encoding a putative NAD + -GDH that is actively transcribed and perhaps regulated by cytokinin. Similarly, in rice three genes encoding NAD + -GDH, were reported, and also in soybean, although it seems that the physiological functions of the GDH isoenzymes is a complex 277 issue and may vary from one species to another (Fontaine et al. 2012, and references therein). A NADP + -dependent form of GDH also exists, which appears to be localized in the chloroplast (in contrast to NAD + -GDH which appears to be localized in mitochondria). However, the role of NADP + -GDH is not clear. Consequently, a fourth expressed gene (AtGdh4) encoding a putative NADP + - GDH has been identified in Arabidopsis and rice, being 50 % longer than the NAD + -GDH (Fontaine et al. 2012, and references therein). This is the case also in L. japonicus, where a LjGdh4 gene was also identified in Kazusa, which is associated to 4 different code names (Table 1). There is a high level of expression of the LjGdh4 gene in leaves, roots and nodules from this plant. 3.4. Asparagine synthetase (AS) Three genes for asparagine synthetase (LjAsn1, LjAsn2 and LjAsn3) have been identified in L. japonicus (also called respectively LjAS1, LjAS2, LjAS3). LjAsn1 is highly or very highly expressed in mature leaves, roots and nodules. LjAsn2 is very highly expressed in roots and nodules and barely detectable in leaves.The third gene (LjAsn3) is poorly expressed in the three types of tissues (Table 1). The molecular cloning and characterisation of AS from L. japonicus in relation to the dynamics of asparagine biosynthesis in N-sufficient conditions, has been reported previously (Waterhouse et al. 1996). Three genes encoding AS have been identified in other plant species, such as A. thaliana which appear to be regulated in different manners (Lea et al. 2007). Although there is considerable variation between plants in the exact mechanisms involved in the regulation of the expression of AS, there is an overall consensus: the expression of one gene (often that which is most highly expressed) is induced by a reduction in soluble carbohydrate supply and in some cases darkness, while a second gene is more widely expressed but may be stimulated by carbohydrate and light. An increased supply of reduced nitrogen, either as ammonium or amino acids, induces expression of AS genes (Lea et al. 2007). Analysis of the amino acid sequences of plant ASs shows that the proteins contain glutamine, aspartate and AMP binding sites and are related to the E. coli asparagine synthetase ASB glutamine-dependent enzymes (Lea et al. 2007). 3.5. Asparaginase (NSE) Three different Nse genes encoding for asparaginase have been identified in L. japonicus, which showed a different pattern of expression among leaves, roots and nodules of the plants (Table 1). The LjNse1 gene is by far the most highly expressed one, particularly in leaves. Two of the genes present in L. 278 japonicus, named LjNse1 and LjNse3, encode for different K + -dependent versions of the asparaginase enzyme, while a third one, named LjNse2 corresponds to a K + -independent isoform. All these enzymes have a α 2 β 2 tetrameric quaternary structure, where the α and β subunits correspond respectively to the N-terminal (20 kDa) or C-terminal (17 kDa) domains arising from a single proteolytic event of each precursor which is encoded by the different Nse genes. Structural and kinetic studies revealed the crucial importance of K + for the higher enzymatic activity and stability as well as lower K m for asparagine and proper orientation of asparagine substrate within the LjNSE1 enzyme molecule (Credali et al. 2011). It was proposed that LjNSE1 must be the main enzyme responsible for the utilization of asparagine in L. japonicus plants, while the K + -independent isoform LjNSE2 is probably a detoxifying enzyme in charge of the release of isoaspartyl peptides arising from proteolytic degradation of post-tranlationally altered proteins. TILLING mutants affected in LjNSE1 asparaginase isoform were recently used to demonstrate by reverse genetics the importance of this particular isoform in plant growth and seed production. In fact, the level of both legumin and convicilin seed storage proteins were affected in the mutants (Credali et al. 2013). Nevertheless nse1 mutants indicated that there was no apparent involvement of NSE1 protein in nodulation. Interestingly, these results illustrate on a key difference between L. japonicus and Arabidopsis where asparaginase activity seems to be dispensable; in fact aspG insertional mutants from Arabidopsis lacking of one or both K + -dependent (AspGB1) and K + -independent (AspGA1) asparaginases develop normally (Ivanov et al. 2011). This differential behaviour among Lotus and Arabidopsis regarding to asparaginases was attributed to the fact that asparagine only accounts for approximately 5 % of total amino acids in the phloem sap of Brassicaceae, whereas it accounts for almost 90 % of nitrogen translocated in L. japonicus (Waterhouse et al. 1996), thus highlighting the importance of asparagine for nitrogen remobilization in L. japonicus plants (Credali et al. 2013). ACKNOWLEDGEMENTS Authors acknowledge the funding by Consejería de Economía, Innovación y Ciencia from Junta de Andalucía (project P10-CVI-6368 and BIO-163). CMP acknowledges the receipt of PIF fellowship from University of Seville. 279 REFERENCES Bernard SM, Habash DZ (2009) The importance of cytosolic glutamine synthetase in nitrogen assimilation and recycling. New Phytol 182:608-620 Betti M, Arcondeguy T, Marquez AJ (2006) Molecular analysis of two mutants from Lotus japonicus deficient in plastidic glutamine synthetase: functional properties of purified GLN2 enzymes. Planta 224:1068-1079 Betti M, García-Calderón M, Pérez-Delgado CM et al (2012) Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. Int J Mol Sci 13:7994-8024 Credali A, Díaz-Quintana A, García-Calderón M et al (2011) Structural analysis of K + -dependence in L-asparaginases from Lotus japonicus. Planta 234:109-122 Credali A, García-Calderón M, Dam S et al (2013) The K + -dependent asparaginase, NSE1, is crucial for plant growth and seed production in Lotus japonicus. Plant Cell Physiol 54:107-118 Díaz P, Betti M, Sánchez D et al (2010) Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytol 188:1001-1013 Fontaine J-X, Tercé-Laforgue T, Armengaud P et al (2012) Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. Plant Cell 24:4044-4065 García-Calderón M, Chiurazzi M, Espuny MR et al (2012) Photorespiratory metabolism and nodule function: behavior of Lotus japonicus mutants deficient in plastid glutamine synthetase. Mol Plant-Microbe Interact 25:211-219 Harrison J, Brugière N, Phillipson B et al (2000) Manipulating the pathway of ammonia assimilation through genetic engineering and breeding: consequences to plant physiology and plant development. Plant Soil 221: 81-93 Harrison J, Pou de Crescenzo M-A, Sené O et al (2003) Does lowering glutamine synthetase activity in nodules modify nitrogen metabolism and growth in Lotus japonicus? Plant Physiol 133:253-262 280 Harrison J, Hirel B, Limami A (2004) Variation in nitrate uptake and assimilation between two ecotypes of Lotus japonicus L and their recombinant inbred lines. Physiol Plant 120:124-131 Ivanov A, Kameka A, Pajak A et al (2011) Arabidopsis mutants lacking asparaginases develop normally but exhibit enhanced root inhibition by exogenous asparagine. Amino Acids 42:2307-2318 Lea PJ, Sodek L, Parry MAJ et al (2007) Asparagine in plants. Ann Appl Biol 150:1-26 Limami A, Phillipson B, Ameziane R et al (1999) Does root glutamine synthetase control plant biomass in Lotus japonicus L.? Planta 209:495-502 Márquez AJ , Betti M, García-Calderón M et al (2005) Nitrate assimilation in Lotus japonicus. J Exp Bot 56:1741-1749 Orea A, Pajuelo P, Pajuelo E et al (2001) Characterisation and expression studies of a root cDNA encoding for ferredoxin-nitrite reductase from Lotus japonicus. Physiol Plant 113:193-202 Orea A, Pajuelo P, Pajuelo E et al (2002) Isolation of photorespiratory mutants from Lotus japonicus deficient in glutamine synthetase. Physiol Plant 115:352-361 Orea A, Pajuelo P, Romero JM et al (2005) Nitrate assimilation: influence of nitrogen supply. In: Márquez AJ (ed) Lotus japonicus handbook. Springer, Dordrecht, p 295-313 Ortega JL, Temple SJ, Bagga S et al (2004) Biochemical and molecular characterization of transgenic Lotus japonicus plants constitutively overexpressing a cytosolic glutamine synthetase gene. Planta 219:807-818 Pajuelo P, Pajuelo E, Orea A et al (2002) Influence of plant age and growth conditions on nitrate assimilation in roots of Lotus japonicus plants. Funct Plant Biol 29:485-494 Pérez-Delgado CM, García-Calderón M, Sánchez DH et al (2013) Transcriptomic and metabolic changes associated to photorespiratory ammonium accumulation in the model legume Lotus japonicus. Plant Physiol doi: 10.1104/pp.113.217216 Prosser IM, Massonneau A, Smyth AJ et al (2006) Nitrate assimilation in the forage legume Lotus japonicus L. Planta 223:821-834 281 Sandal N, Petersen TR, Murray J et al (2006) Genetics of symbiosis in L. japonicus: recombinant inbred lines, comparative genetic maps and map position on 35 symbiotic loci. Mol. Plant-Microbe Interact 19:80-91 Seabra AR, Vieira CP, Cullimore JV et al (2010) Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds. BMC Plant Biol 10:183 Suárez R, Márquez J, Shishkova S et al (2003) Overexpression of alfalfa cytosolic glutamine synthetase in nodules and flowers of transgenic Lotus japonicus plants. Physiol Plant 117:326-336 Vance CP, Miller SS, Gregerson RG et al (1995) Alfalfa NADH-dependent glutamate synthase: structure of the gene and importance in symbiotic N 2 fixation. Plant J 8:345-348 Vincent R, Fraisier V, Chaillou S et al (1997) Overexpression of a soybean gene encoding glutamine synthetase in shoots of transgenic Lotus corniculatus L. plants triggers changes in assimilation and plant development. Planta 201:424-433 Waterhouse RM, Smyth AJ, Massoneau A et al (1996) Molecular cloning and characterisation of asparagine synthetase from Lotus japonicus: dynamics of asparagine synthesis in N-sufficient conditions. Plant Mol Biol 30:883- 897 288 techniques which have been described in detail by Pavlovkin et al. (1993). Measurements were performed in the outermost layer of the root cortex 2 mm behind the root cap. Nitrate, chlorophyll and enzyme assays determinations Colorimetric determinations of nitrate content in root crude extracts were performed as described by Cataldo et al. (1975), with slight modifications (Pajuelo et al. 2002): 200 l of 5 % (p/v) salicylic acid dissolved in 96 % (p/v) sulphuric acid was added to aliquots of 50 l from the root crude extracts and left to react for 20 min. 4.75 ml of 2 M NaOH was added to the reaction mixtures and then the absorbance was read at 405 nm after cooling. A calibration curve of known amounts of nitrate dissolved in the standard extraction buffer was used for analytical determinations. Controls were set up without salicylic acid. Chlorophyll content was determined according to Arnon (1949). Shoots from 15 days old L. japonicus plants were ground in a mortar in presence of liquid nitrogen. Then, 20 ml of 80 % (v/v) acetone were added to 1 g of ground material and shaken vigorously. The homogenates were centrifuged for 10 min at 15,000 x g and insoluble material was removed. The absorbance was read at 652 nm in supernatants. NR enzyme assays were carried out as described previously (Pajuelo et al. 2002). RNA extraction and qRT-PCR measurements Leaf or root material was flash frozen in liquid nitrogen, homogenized with a mortar and pestle, and kept at −80°C until use. Three independent biological replicates were used for the transcriptomic and quantitative real-time RT-PCR (qRT-PCR) analyses as well as for metabolite profiling analysis. Total RNA was isolated using the hot borate method (Sánchez et al. 2008). The integrity and concentration of the RNA preparations were checked using an Experion bioanalyzer (Bio-Rad, http://www.bio-rad.com) with RNA StdSens chips and a Nano-Drop ND-1000 (Nano-Drop Technologies, http://www.nanodrop.com), respectively. qRT-PCR analysis was carried out as described elsewhere (Díaz et al. 2010; Pérez-Delgado et al. 2013). For qRT-PCR analysis, total RNA was treated with the TURBO DNA-free DNAse (Ambion). Reverse transcription was carried 289 out using SuperScript III reverse transcriptase (Invitrogen), OligodT and RNAsin RNAse inhibitor (Ambion). DNA contamination and RNA integrity were checked by carrying out qRT-PCR reactions with oligonucleotides that amplified an intron in the L.japonicus Hypernodulation Aberrant Root (LjHAR1) gene and the 3’ and 5’ extremity of the L. japonicus glyceraldehyde-3-phosphate dehydrogenase respectively. qRT-PCR reactions were carried out in 10 µL in a Lightcycler 480 thermal cycler (Roche) using a SensiFAST SYBR No-ROX Kit (Bioline). Expression data were normalized using the geometric mean of four housekeeping genes: L. japonicus glycosylphosphatidyl inositol (LjGPI)- anchored protein (chr3.CM0047.42), L. japonicus protein phosphatase 2A (LjPP2A; chr2.CM0310.22), L. japonicus ubiquitin carrier protein 10 (LjUBC10; chr1.TM0487.4), and L. japonicus polyubiquitin 4 (LjUBQ4; chr5.CM0956.27), that were selected amongst the most stably expressed genes in plants (Czechowski et al. 2004). A list of all the oligonucleotides used is provided in Supplemental Table S1. Sequence data and nomenclature that is used in this article can be found in the Kazusa 2.5 database (www.kazusa.or.jp/lotus/). RESULTS Characterization of growth and chlorophyll content in Ljclo1 mutants Fig. 1 shows the typical picture of Ljclo1 mutant used in the present work. This mutant was rescued from a chlorate resistance screening carried out previously (Márquez et al. 2005). As shown in Fig. 1, mutant plants were able to grow quite satisfactorily for one week under the presence of chlorate concentrations ranging 0.5-10 mM KClO 3 , while these conditions killed the wild type L. japonicus plants. Growth parameters of WT and Ljclo1 mutant were determined under the presence of different nitrogen nutrition regimes in the absence of chlorate. The results obtained are summarised in Fig. 2. Roots and shoots from mutant plants showed about 60 % inhibition in terms of fresh weight when the plants were grown in the presence of nitrate as a single nitrogen source, in comparison with the WT. 290 Fig. 1. Phenotype of the Ljclo1 chlorate resistant mutant analysed in this work, compared to WT plants, after 5 days in the presence of 5 mM KClO 3 plus 5 mM KNO 3 . The inhibition of growth in the mutant plants was significantly lower when the plants were grown under mixed ammonium plus nitrate nutrition. In contrast, no significant difference was observed between WT and mutant plants when the plants were grown under ammonium as the single nitrogen source, in spite of the fact that growth in ammonium for the WT was much lower than in the presence of nitrate. All the differences observed in fresh weight of roots (Fig. 2A) and shoots (Fig. 2B) were also confirmed in dry weight determinations (Figs. 2C and 2D, respectively). Interestingly, some differences were observed with regard to the younger leaves of Ljclo1 mutant plants which looked pale green when compared to the WT. Fig. 3 shows that the chlorophyll content of the leaves from the shoot tip of the mutant plants was about 50 % lower than for the WT in the same growing conditions in the presence of nitrate. However, no significant difference to the WT was observed with regard to the chlorophyll content of the lower (mature) leaves (Fig. 3). Considering that the detrimental effects on growth of Ljclo1 plants were mostly noticeable in the presence of nitrate it was therefore hypothesised that Ljclo1 mutant could be affected in nitrate uptake or utilisation. 291 Fig. 2 Comparison of fresh and dry weight of roots (A,C) and shoots (B,D) of 2-month old WT and Ljclo1 plants grown on different nitrogen sources. Plants were grown on standard Hornum media containing 5 mM NH 4 NO 3 and 3 mM KNO 3 (mixed), or 8 mM NH 4 Cl (ammonia) or 8 mM KNO 3 (nitrate) as the N source. The results are the means of 6 different plants (± SE) for FW and 3 different plants for DW. Fig. 3. Difference in chlorophyll content in young or mature leaves from Ljclo1 mutant plants, compared to the WT. 292 Nitrate reductase and nitrate / chlorate uptake measurements According to present knowledge, chlorate resistance in higher plants can be caused mainly by two different mechanisms: by reduced reduction of chlorate to chlorite due to a mutation on NR or related genes, or a reduced increase in tissue chlorate content caused by a mutation of a nitrate transporter gene with some affinity for chlorate (Navarro et al. 2005 and references therein). In the case of Ljclo1 mutant plants it was determined that total NR activity and nitrate content of the plants were not significantly different to the WT (results not shown). Therefore, the uptake of nitrate was analysed at 0.15 and 2 mM external nitrate concentrations in order to characterise either the high- or low-affinity nitrate uptake systems. At low nitrate concentration (0.15 mM) it was not possible to observe any significant difference in nitrate uptake rate between the WT and Ljclo1 mutant (Fig. 4A). However, nitrate uptake was strongly reduced in Ljclo1 plants in high (2 mM) external nitrate concentration (Fig. 4B). In addition, it was also determined that the uptake of chlorate observed in Ljclo1 plants in the presence of 1 mM chlorate was less than half of that obtained for the WT (Fig. 4C). Therefore it could be concluded that the Ljclo1 mutant may be deficient in a low-affinity nitrate transport system which can be also used for chlorate uptake, thus explaining the chlorate resistance phenotype. A series of electrophysiological measurements were also carried out in order to confirm the nitrate and chlorate uptake defects of Ljclo1 mutant plants (Fig. 5). A rapid electrical response of Lotus cortical root cells to nitrate and chlorate was observed. Nitrate, applied as 5 mM Ca(NO 3 ) 2 , caused a membrane depolarisation of ∆E M = 51 mV ± 0.48 (SE) in WT and 28 mV ± 1.03 in Ljclo1 (Fig. 5, top) (experiment was repeated four times). The same kind of experiment was also performed by replacing the nitrate by 5 mM NaClO 3 , which caused a membrane depolarisation by ∆E M = 20 mV ± 1.9 (SE) in WT and 9 mV ± 1.04 in Ljclo1. (Fig. 5,bottom). In conclusion, the electrophysiological results confirmed that the uptake rate of nitrate (and chlorate) was reduced in Ljclo1 mutants. 293 Fig. 4. Nitrate (A,B) and chlorate (C) uptake by WT and Ljclo1 mutant plants. Measurements of nitrate and chlorate uptake were done by nitrate or chlorate depletion from the medium as described in Materials and Methods. Nitrate depletion was determined in solutions containing either 0.15 mM (A) or 2 mM (B) external nitrate concentrations for measurements of HATS (0.15 mM) or LATS (2 mM) respectively. Chlorate uptake was determined in media containing 1 mM KClO 3 . The results are the means (± SE) of three experiments (each containing two replicates). 294 Fig. 5. Electrophysiological measurements of nitrate and chlorate uptake. Plasma membrane potential measurements of outer cortex cell, 2 mm from the tip of Lotus roots. Effect of the 5 mM nitrate (top panel) or 5 mM chlorate (bottom panel) addition/withdrawal on the electrophysiological signals obtained for Ljclo1 mutant (trace A) compared to the WT (trace B). Each experiment was repeated 4 times, and one representative result is shown. Recorded values are in mV. Other details of these experiments are given in Materials and Methods. All these results suggest that the mutation produced in Ljclo1 may be related to some of the LATS nitrate transporters, or to any of the regulatory mechanisms that may be related to nitrate/chlorate uptake. The inheritance of all the different phenotypes observed for Ljclo1 plants was examined throughout the progeny of a back-cross of Ljclo1 (♀) x WT (♂). A 3:1 segregation ratio for the inheritance of a single Mendelian recessive trait was obtained in all cases, including nitrate uptake, electrophysiological and plant growth measurements. This is shown in supplemental Fig. S1 where a clear cosegregation of the different mutant characters can be observed among the progeny. 295 Nodulation studies Table 1 shows the results of different nodulation studies carried out in WT and Ljclo1 mutant plants, both in the presence or absence of nitrate and at two different times after inoculation with Mesorhizobium loti. Total number and fresh weight of nodules, as well as the specific ratios of nodule fresh weight per nodule number and nodule fresh weight per root fresh weight were determined in nodulation studies carried out in the absence of any added nitrogen source , or in the presence of 0.5 mM, 1 mM or 2 mM nitrate. It was necessary to allow for any possible reduced growth of Ljclo1 plants that could be taking place in the presence of nitrate, as described above. Therefore, nodulation parameters were determined at 40 dpi and 60 dpi for the WT, and 50 and 70 dpi for the Ljclo1 mutant, respectively, in order to compare WT and mutant plants with a similar size and developmental stage. The ratios of fresh weight of nodules to fresh weight of roots was considerably lower both in the WT and Ljclo1 mutant plants at all nitrate concentrations tested when compared to nodulation tests carried out in the absence of nitrate. This decrease in the ratios of nodules was higher at higher nitrate concentrations in both genotypes. The comparison of the ratios of fresh weight of nodules to fresh weight of roots among WT and Ljclo1 plants showed no significant differences at either 40-50 or 60-70 dpi when nodulation took place either in the absence of any added exogenous nitrogen or in the presence of 0.5 mM NO 3- . In contrast, several differences in the specific ratios of fresh weight of nodules per fresh weight of roots were observed among WT and Ljclo1 plants at higher tested NO 3- concentrations (1 and 2 mM). The results obtained in mutant plants indicated that reduced nodulation was produced in the presence of 1-2 mM nitrate in the Ljclo1 mutants compared to the wild type. In fact, no visible nodules were observed at 50 dpi in the mutant plants in the presence of either 1 mM or 2 mM nitrate, while some nodulation was still detectable in the WT (Table 1). Furthermore, at 60-70 dpi, approximately 70% reduction in the ratio between fresh weight of nodules and fresh weight of roots was observed in the Ljclo1 mutant at 1 mM NO 3- , compared to nodulation in the absence of exogenous nitrate, while this inhibition was only about 30% in the WT (Table 1, 60-70 dpi). In addition, it was also observed that the low number of nodules still present at 2 mM NO 3- for the mutant plants at 70 dpi was almost the half than those of the WT at 60 dpi. Measurements of transcript levels in WT and Ljclo1 mutants A wide range of nitrate-related gene transcripts were analysed by qRT- PCR in both WT and Ljclo1 mutant plants. A total of 35 genes were examined 296 which comprised genes encoding for nitrogen assimilatory enzymes (NR, NiR, cytosolic and plastidic GS, Fd- and NADH-GOGATs), as well as the members of NPF and NRT2 nitrate transporters families recently described by Criscuolo et al. (2012), together with other nitrate transporters or regulatory genes found in the Kazusa database that have been shown to be nitrate responsive in Lotus or other plant species. The basal levels of expression for the different genes analysed was determined in leaves and roots of both the wild type and Ljclo1 mutants under standard N-sufficient conditions, and the results obtained are shown in Table 2. nod.number/pl. FW nod.(mg)/pl. FW nod.(mg)/ nod.number FW nod./FW root 40/50 dpi - NO 3 - WT Ljclo1 15.30 ± 1.55* 23.83 ± 2.41 11.50 ± 1.44 11.43 ± 1.33 0.762 ± 0.070* 0.500 ± 0.075 0.435 ± 0.043 0.440 ± 0.053 0.5mM NO 3 - WT Ljclo1 18.75 ± 4.43 20.44 ± 3.54 6.75 ± 2.06 15.50 ± 3.50 0.350 ± 0.017* 0.710 ± 0.058 0.127 ± 0.031 0.188 ± 0.023 1 mM NO 3 - WT Ljclo1 22.33 ± 3.61 - 9.00 ± 1.83 - 0.390 ± 0.043 - 0.076 ± 0.016 - 2 mM NO 3 - WT Ljclo1 - - - - - - - - 60/70 dpi - NO 3 - WT Ljclo1 57.67 ± 6.20 47.60 ± 6.49 99.56 ± 14.21 64.80 ± 15.71 1.698 ± 0.133 1.303 ± 0.197 0.589 ± 0.036 0.655 ± 0.026 0.5mM NO 3 - WT Ljclo1 70.10 ± 8.87 64.50 ± 8.00 117.40 ± 24.33 97.25 ± 20 .65 1.510 ± 0.196 1.407 ± 0.166 0.506 ± 0.026 0.482 ± 0.019 1 mM NO 3 - WT Ljclo1 81.89 ± 5.12* 34.67 ± 3.87 151.00 ± 19.19* 20.84 ± 4.81 1.830 ± 0.175* 0.569 ± 0.087 0.430 ± 0.018* 0.171 ± 0.023 2 mM NO 3 - WT Ljclo1 38.50 ± 8.45* 15.00 ± 2.45 20.75 ± 6.84* 5.80 ± 1.23 0.490 ± 0.075 0.377 ± 0.200 0.080 ± 0.017* 0.035 ± 0.007 Table 1. Nodulation parameters of Lotus japonicus WT and Ljclo1 mutant plants in the absence or presence of different concentrations of nitrate. The table shows the nodulation parameters obtained from plants of WT and Ljclo1 at two different times after inoculation with M. loti (40 dpi and 60 dpi for the WT and 50 and 70 dpi for Ljclo1 mutant respectively) to allow for any possible lower growth of Ljclo1 plants in the presence of nitrate). Different columns show the total nodule number per plant, total fresh weight of nodules per plant, ratio between the fresh weight of nodules to the nodule number and ratio of the fresh weight of nodules to the fresh weight of roots. Values are the means for three determinations for each of three biological replicates ± standard error. * indicates significant difference between WT and Ljclo1 mutant in each condition as determined by Student test (P<0.05). - indicates that no significant nodulation was detected. In general very important changes were not observed in the levels of expression of those genes examined in Ljclo1 plants compared to the WT. Several of the genes showed very high levels of expression in both genotypes in either leaves and in roots, for example, genes for NR (LjNIA), NiR (LjNII), cytosolic GS1.2 (LjGLN1.2), plastid GS (LjGLN2) and Fd-GOGAT (LjGLU1). Among nitrate transporters, one of the members of the NPF family (chr2.CM0826.350, a close homologue to MtNPF6.8) showed its highest level of 297 expression in leaves, while another one (chr4.CM247.130, a close homologue to AtNPF7.3) was also relatively abundant both in leaves and in roots. With regard to the NRT2 family, chr3.CM0649.30 (also named LjNRT2.2) was the most highly expressed in roots. The main relevant differences observed in the expression of the genes analysed in WT and Ljclo1 mutants are shown in Table 2. Several genes were about 2-fold more highly expressed in leaves of Ljclo1 than in the WT leaves, such as those for plastid GS (LjGLN2), Fd-GOGAT (LjGLU1) and NiR (LjNII). In contrast, other genes showed more than 2-fold reduction in expression in Ljclo1 compared to the WT, either in leaves (such as LjGLN1.2 and LjGLN1.3, both encoding for cytosolic GS, and chr4.CM0161.180 a transporter closely homologous to AtNRT2.5) or in roots (such as genes for transporters chr2.CM0826.350, LjB20H09.30 and chr1.CM0001.20). Level of expression (relative units) WT Ljclo1 mutant Type of gene (gene name or family) Kazusa 2.5 code (closest homologue) Leaves Roots Leaves % Roots % A (LjNIA) LjT01E03.110.r2.m 4.8433 ± 0.3269 4.1762 ± 0.3990 4.5433 ± 1.0871 93.8 3.5727 ± 0.8438 85.5 A (LjNII) chr4.CM0227.280.r2.d 1.2099 ± 0.2276 2.5651 ± 0.1675 2.9407 ± 0.4650 243.0 2.2718 ± 0.2602 88.6 A (LjGLN1.1) chr2.CM0312.1480.r2.m 0.1860 ± 0.0667 0.8656 ± 0.1054 0.2110 ± 0.0152 113.5 0.8686 ± 0.0712 100.4 A (LjGLN1.2) chr6.CM0014.300.r2.m 3.5210 ± 1.3755 5.9084 ± 1.0915 1.3166 ± 0.2783 37.4 6.4865 ± 0.4366 109.8 A (LjGLN1.3) LjSGA_030247.1 0.0506 ± 0.0165 0.0010 ± 0.0002 0.0243 ± 0.0012 48.0 0.0010 ± 0.0005 93.8 A (LjGLN1.4) LjSGA_058827.1 0.0003 ± 0.0001 0.0006 ± 0.0001 0.0004 ±0.0001 125.2 0.0009 ± 0.0004 139.5 A (LjGLN1.5) LjSGA_019428.1 0.0034 ± 0.0024 n.d. 0.0009 ± 0.0008 25.9 n.d. n.d. A (LjGLN2) chr6.CM0139.890.r2.m 6.6710 ± 1.2614 1.3161 ± 0.0257 16.1139 ± 0.9837 241.6 1.4585 ± 0.1112 110.8 A (LjGLU1) chr1.CM0009.170.r2.d 2.6475 ± 0.2080 0.9873 ± 0.1013 5.1697 ± 0.0709 195.3 0.8750 ± 0.0845 88.6 A (LjGLT1) LjSGA_035611.1 0.0070 ± 0.0017 0.0175 ± 0.0068 0.0057 ± 0.0009 82.2 0.0173 ± 0.0023 99.3 A (LjGLT2) LjSGA_037992.1 0.1333 ± 0.0219 0.4032 ± 0.0905 0.1253 ± 0.0213 94.0 0.3730 ± 0.0456 92.5 T (NPF) chr2.CM0021.2180 (AtNPF6.3) 0.1035 ± 0.0108 0.8377 ± 0.1950 0.0908 ± 0.0149 87.7 0.5588 ± 0.0631 66.7 T (NPF) chr2.CM0021.2200 (At NPF6.3) 0.0612 ± 0.0227 0.0002 ± 0.0002 0.0851 ± 0.0145 138.9 0.0004 ± 0.0001 156.2 T (NPF) chr2.CM0021.3040 (At NPF6.3) 0.1450 ± 0.0215 0.0039 ± 0.0005 0.1978 ±0.0014 136.6 0.0033 ± 0.0010 83.8 T (NPF) chr2.CM0608.1210 0.3784 ± 0.0244 0.4697 ± 0.0227 0.3078 ± 0.0316 81.3 0.3593 ± 0.0264 76.5 T (NPF) chr2.CM0608.1290 0.0762 ± 0.0158 0.0084 ± 0.0011 0.0633 ± 0.0063 83.0 0.0060 ± 0.0002 72.1 304 legumes: recent advances in enzyme structure and functional genomics. International Journal of Molecular Sciences, 13, 7994-8024. Castaings L., Camargo A., Pocholle D., Gandon V., Texier Y., Boutet-Mercey S., Taconnet L., Renou F., Fernández E., Meyer C., Krapp A. (2009) The nodule inception-like protein 7 modulates nitrate sensing and metabolism in Arabidopsis. The Plant Journal, 57, 426-435. Cataldo D.A., Haroon M., Schrader L.E and Youngs, V.L. (1975) Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Communications in Soil Science and Plant Analysis, 6, 71-80. Czechowski T., Bari R.P., Stitt M., Scheible W.R., Udvardi M.K. (2004) Realtime RT-PCR profiling of over 1400 Arabidopsis transcription factors: unprecedented sensitivity reveals novel root- and shoot-specific genes. The Plant Journal, 38, 366-379. Criscuolo G., Valkov, V.T., Parlati, A., Martin Alves, L., Chiurazzi, M. (2012) Molecular characterization of the Lotus japonicus NRT1(PTR) and NRT2 families. Plant, Cell & Environment, 35, 1567-1581. Deane-Drummond, C. (1984) Nitrate transport into Chara choralina cells using 36 ClO 3- as an analogue for nitrate. I. Interaction between 36 ClO 3- and NO 3- and characterization of 36 ClO 3- /NO 3- influx. Journal of Experimental Botany, 35, 1289-1298. Díaz P., Betti M., Sánchez D.H., Udvardi M.K., Monza J., Márquez A.J. (2010) Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytologist, 188, 1001-1013. Doddema H., Hofstra J.J., Feenstra W.J. (1978) Uptake of nitrate by mutants of Arabidopsis thaliana, disturbed in uptake or reduction of nitrate. Physiologia Plantarum, 43, 343-350. Fernández E., Galván A. (2008) Nitrate assimilation in Chlamydomonas. Eukaryotic Cell, 7, 555-559. Forde B.G. (2000) Nitrate transporters in plants: structure, function and regulation. Biochemica et Biophysica Acta,, 1495, 219-235. Glass A.D.M., Kotur Z. (2013) A reevaluation of the role of Arabidopsis NRT1.1 in high-affinity nitrate transport. Plant Physiology, 163, 1103-1106. Gojon A., Krouk G., Perrine-Walker F., Laugier E. (2011) Nitrate transceptor(s) in plants. Journal of Experimental Botany, 62, 2299-2308. Handberg K., Stougaard J. (1992) Lotus japonicus an autogamous, diploid legume species for classical and molecular genetics. The Plant Journal, 2, 487-496. 305 Hoff T., Troung H.-N., Caboche M. (1994) The use of mutants and transgenic plants to study nitrate assimilation. Plant, Cell & Environment, 17, 489- 506. Huang N.-C., Chiang C.-S., Crawford N.M., Tsay Y.-F. (1996) CHL1 encodes a component of the low-affinity nitrate uptake system in Arabidopsis and shows cell type-specific expression in roots. Plant Cell, 8, 2183-2191. Imsade J., Touraine B. (1994) N demand and the regulation of nitrate uptake. Plant Physiology, 105, 3-7. Jeudy C., Ruffel S., Freixes S., Tillard P., Santoni A.L., Morel S., Journet E-P., Duc G., Gojon A., Lepetit M., Salon C. (2010) Adaptation of Medicago truncatula to nitrogen limitation is modulated via local and systemic nodule developmental responses. New Phytologist, 185, 817-828. Kawaguchi M., Imaizumi-Anraku H., Koiwa H., Niwa S., Ikuta A., Syono K., Akao S. (2002) Root, root hair and symbiotic mutants of the model legume Lotus japonicus. Molecular Plant-Microbe Interactions, 15, 17-26. Leran S., Varala K., Boyeri J.C., Chiurazzi M., Crawford N., Daniel-Vedele F., David L., Dickstein R., Fernández E., Forde B.G., Grassman W., Geiger D., Gojon A., Gong J.M., Halkier B.A., Harris J.M., Heldrich R., Limami A.M., Rentsch D., Seo M., Tsay Y.F., Zhang M., Coruzzi G., Lacombe B. (2013) A unified nomenclature of nitrate transporter 1/peptide transporter family members in plants. Trends in Plant Sciences doi: 10.1016/j.tplants.2013.08.008 Masclaux-Daubresse C., Daniel-Vedele F., Dechorgnat J., Chardon F., Gaufichon L., Suzuki A. (2010) Nitrogen uptake, assimilation and remobilization in plants: challenges for sustainable and productive agriculture. Annals of Botany, 105, 1141-1157. Márquez, A.J., Betti, M., García-Calderón, M., Palove-Balang, P., Díaz, P., Monza, J. (2005). Nitrate assimilation in Lotus japonicus. Journal of Experimental Botany, 56, 1741-1749. Miller A.J., Fan X., Orsel M., Smith S.J., Wells D.M. (2007) Nitrate transport and signalling. Journal of Experimental Botany, 58, 2297-2306. Morère-Le Paven M-C., Viau L., Hamon A., Vandecasteele C., Pellizzaro A., Bourdin C., Laffont C., Lapied B., Lepetit M., Frugier F., Legros C., Limami A.M. (2011) Characterization of a dual-affinity nitrate transporter MtNRT1.3 in the model legume Medicago truncatula. Journal of Experimental Botany, 62, 5595-5605. Navarro MT, Mariscal V, Macías MI, Fernández E, Galván A (2005) Chlamydomonas reinhardtii strains expressing nitrate reductase under control of the cabII-1 promoter: isolation of chlorate resistant mutants and 306 identification of new loci for nitrate assimilation. Photosynthesis Research, 83, 151-161. Okamoto S., Ohnishi E., Sato S., Takahashi H., Nakazono M., Tabata S., Kawaguchi M. (2009) Nod factor/nitrate induced CLE genes that drive HAR-1 mediated systemic regulation of nodulation. Plant & Cell Physiology, 50, 67-77. Omrane S., Chiurazzi, M. (2009) A variety of regulatory mechanisms are involved in the nitrogen-dependent modulation of the nodule organogenesis program in legume roots. Plant Signalling & Behaviour, 4, 1066-1068. Omrane S., Ferrarini A., D'Apuzzo, E., Rogato, A., Delledonne M., Chiurazzi, M. (2009) Symbiotic competence in Lotus japonicus is affected by plant nitrogen status: transcriptomic identification of genes affected by a new signalling pathway. New Phytologist, 183, 380-394. Oostinder-Braaksma F.J., Feenstra W.J. (1973) Isolation and characterisation of chlorate-resistant mutants of Arabidopsis thaliana. Mutation Research 19, 175-185. Orsel M., Filleur, S., Fraisier, V. and Daniel-Vedele, F. (2002) Nitrate transport in plants: which gene and which control? Journal of Experimental Botany, 53, 825-833. Pajuelo P., Pajuelo E., Orea A., Romero J.M., Márquez, A.J. (2002) Influence of plant age and growth conditions on nitrate assimilation in roots of Lotus japonicus plants. Functional Plant Biology 29, 485-494. Pal’ove-Balang P., Mistrík I. (2002) Control of nitrate uptake by phloemtranslocated glutamine in Zea mays L. seedlings. Plant Biology, 4, 440-445. Pavlovkin, J., Mistrík I., Zajchenko A.M., Dugovič L. (1993) Some aspects of phytotoxic action of trichothecene mycotoxin roridin H on corn roots. Biologia, Bratislava 48, 435-439. Pérez-Delgado C.M., García-Calderón M., Sánchez D., Udvardi M., Kopka J., Márquez A.J., Betti M. (2013) Transcriptomic and metabolic changes associated to photorespiratory ammonium accumulation in the model legume Lotus japonicus. Plant Physiology, 162, 1834-1848. Prieto R., Fernández E. (1993) Toxicity of and mutagenesis by chlorate are independent of nitrate reductase in Chlamydomonas reinhardtii. Molecular and General Genetics, 237, 429-438. Rubin G., Tohge T., Matsuda F., Saito K., Scheible W.R. (2009) Members of the LBD family of transcription factors repress anthocyanin synthesis and affect additional nitrogen responses in Arabidopsis. Plant Cell, 21, 3567- 3584. Ruffel S., Freixes S., Balzergue S., Tillard P., Jeudy C., Martin-Magniette M.L., van der Merwe M.J., Kakar K., Gouzy J., Ferrnie A.L., Udvardi M., Salon 307 C., Gojon A., Lepetit M. (2008) Systemic signaling of the plant nitrogen status triggers specific transcriptome responses depending on the nitrogen source in Medicago truncatula. Plant Physiology, 146, 2020-2035. Ruffel S., Krouk G., Ristova D., Shasha D., Birnbaum K.D., Coruzzi G.M. (2011) Nitrogen economics of root foraging: transitive closure of the nitrate-cytokinin relay and distinct systemic signaling for N supply vs. demand. Proceedings of the National Academy of Sciences, 108, 18524- 18529. Sánchez D.H., Lippold F., Redestig H., Hannah M.A., Erban A., Krämer U., Kopka J., Udvardi M.K. (2008) Integrative functional genomics of salt acclimatatization in the model legume Lotus japonicus. The Plant Journal, 53, 973-987. Tsay Y-F., Chiu C-C., Tsai C-B., Ho C-H, Hsu P-K (2007) Nitrate transporters and peptide transporters. FEBS Letters, 581, 2290-2300. Vincent, J.M. (1970) The cultivation, isolation and maintenance of rhizobia. In: Vincent J.M., (Ed) A Manual for the Practical Study of the Root-Nodule Bacteria. Blackwell Scientific Publications, Oxford. United Kingdom, pp 1- 13. Vincill E.D., Szczyglowski K., Roberts, D.M. (2005) GmN70 and LjN70 Anion transporters of the symbiosome membrane of nodules with a transport preference for nitrate. Plant Physiology, 137, 1435-1444. Wang Y.Y., Hsu P-K, Tsay Y-F. (2012) Uptake, allocation and signalling of nitrate. Trends in Plant Sciences, 18, 458-467. Wilkinson, J.Q., Crawford, N.M. (1993) Identification and characterization of a chlorate resistant mutant of Arabidopsis thaliana with mutation in both nitrate reductase structural genes NIA1 and NIA2. Molecular and General Genetics, 239, 289-297. 308 SUPPORTING INFORMATION Supplemental Table. S1: Gene name or family Kazusa 2.5 code Primers Forward Reverse LjNIA LjT01E03.110.r2.m GCCAATGCCAATGCATCATCCC TCGTCACGGAGGGTGTTATGAG LjNII chr4.CM0227.280.r2.d AGCAGATGAGATGGACGAGCTG ACAGTGAGCCTCAGTTCACCAG LjGLN1.1 chr2.CM0312.1480.r2.m TGGACCACAGGGCCCATAC AATGTCACGCCCATAGGCTTT LjGLN1.2 chr6.CM0014.300.r2.m TGAGGTGTGGGTTGCTCGTT AAGGACCACCCCAGCAATCT LjGLN1.3 LjSGA_030247.1 TAACCTCTCCGAGACCACCG CCAATCCATATGTATTCGGCG LjGLN1.4 LjSGA_058827.1 AGAGAGACTGAGAAAGATGGAA AATGT CAGGCCTCCTCTGTCCTCAA LjGLN1.5 LjSGA_019428.1 GGGTAGGCAGGGAGACTGAAA GAAGCTGGCCTCCTGTCCTC LjGLN2 chr6.CM0139.890.r2.m GGAAGAGGGAGGCTTTGAGGT CTGGTGGCGAAGGGATAGATT LjGLU1 chr1.CM0009.170.r2.d ATTCAACGAGTAACAGCGCCA CATGGGCTTCAATAAGGCTTCTC LjGLT1 LjSGA_035611.1 TGGTGCTGATGCTATATGCCC GTCAACCTGCAGTCGCCAA LjGLT2 LjSGA_037992.1 TTGGCAATGTGGCACTGTATG GCTGCCATCCCGTTGAAAT NPF chr2.CM0021.2180 CCCTGACCCAACAAAGAAGAAC TG CAAAGGCGAAGATGTCACTGAGC NPF chr2.CM0021.2200 AATATCGTCGTCTTTGCCGC CGTACCTTCCATGCATTTTGG NPF chr2.CM0021.3040 GCGGTTTTGAGTGGTTTGGA GGAACGGAGGGAGTAATAAAGAA NPF chr2.CM0608.1210 GTGTTTGCTGAGTGGGTTGA CCTTTTGAAGAATGGCTTGG NPF chr2.CM0608.1290 TGAGGGAGCAAAATTGTGTG AAATAAATTCGTGCAACACATGA NPF chr2.CM0826.350 TGATGGCAAATGAGGTCAAA CAGCATAACAATTGGCTTGG NPF chr2.CM0826.370 GCTGTGCTGGGAGTACTGAA TGCTTCTTGCACACCAATGT NPF chr4.CM0170.40 GGCCCAAGAATGAAATCTGA TGACGGTTCCCTTTCCTAAA NPF chr4.CM0247.130 GCTTACATTGCAGTCGCAAA CGGGTAAAAAGGGCTTCTCT NPF chr4.LjB20H09.30 AAGGACAAAAGGCTTGGCTCA TGATCGATTTTTCGGGACTAA NPF chr6.CM0118.580 AGGCCTCAAGCCCTTACAGT TCCCCAAATTGTCTTATTTTTCA LjNPF1.7 LjSGA_046844.2 ACCATGAGACGAAATGTCGCC CGAGCAAGACAAACTCCGGAA NRT2 chr1.CM0001.20 GAGGCATGTTTTGTGGTCCT GCCATACAGGGTATAGGTTGG 309 LjNRT2.1 chr3.CM0649.40 CTGCTCCAACTCCTCCAAAC AGACCCACACTCCCACAGAC LjNRT2.2 chr3.CM0649.30 TAATGGATTCCCTGGCTGAA ATGGCAAAACCAACATGTGA NRT2 chr4.CM0161.180 GGAGCAGCAGAAAGGATCAC GGTTGTGCTACAAGGGAGGA LjCLCa chr1.CM0064.1040.r2.m ACAAGATCAAATGGCGCTGG GCGAAACGCTGCACAAACT LjN70 LjSGA_018310.1 ATTCCCAACTGTGGCACATGT TCAAATACCCCTCTGCAATGC LjLBD38 chr4.CM0128.420.r2.m AACGACCCGCTCTGTTTCAGTC TTGACCGGGTTCACCGTTCTTC LjCIPK8 LjSGA_048938.1 TGATCAAGCTCTTGCGGCTGTG AGCTCGAAGGCTTTCAGTCGTG LjCIPK23 chr6.CM0037.1410.r2.m CAGAGTATCTCCTTCAGACTTGC G TTGGAGGTGGCTCCTTCACTTC LjANR1 chr6.CM0055.400.r2.m AAGCCAGCCACAGCCTCAATTC CAGCTGTAATCCCAGTTTCACTGC LjCLE-RS2 chr3.CM2103.25.r2.a GCTCGTAATCTCCAAATCATTCA CA GGTGAGAGTCTTTGCTGTTGATAT CC LjNLP7/NIN chr5.CM0148.170.r2.a AATGAAGCGCATCTGTAGGCA TGGACGGATTCAATAACACGC Supplemental Table S1. List of oligonucleotides used for qRT-PCR measurements. Sequence data and codes for each gene can be found in the Kazusa 2.5 database (http://www.kazusa.or.jp/lotus). Other details as described in legend for Table 2. 310 Supplemental Fig. S1 Supplemental Fig. S1. Analysis of the back cross progeny of Ljclo1 (♀) x WT (♂). The figure shows the measurements of membrane potential (∆E m ) for nitrate uptake electrophysiological measurements (A), as well as LATS nitrate uptake by nitrate depletion (B) and shoot-tip chlorophyll content (C) for each of 16 independents F2 plants from backcross progeny, together with WT and parental Ljclo1 controls. D and E panels show average plant growth parameters determined in F2 plants showing either WT (b1-b13) or Ljclo1 mutant (b14-b16) phenotypes together with parental lines. 311 Supplemental Fig. S2 312 313 320 DISCUSIÓN 321 La realización de esta Tesis Doctoral perseguía como objetivo principal el estudio del metabolismo del nitrógeno en relación con la fotorrespiración y el estrés abiótico empleando herramientas de genómica funcional. Tanto la asimilación de nitrógeno como el estrés abiótico, particularmente la sequía, son dos de los factores que más limitan el crecimiento de las plantas en el género Lotus y de ahí el interés de utilizar la leguminosa modelo Lotus japonicus para este trabajo, ya que para esta planta se han desarrollado recientemente numerosas herramientas de genómica funcional (LOTASSA, 2010; Márquez, 2005) La posibilidad de contar en nuestro laboratorio con mutantes fotorrespiratorios deficientes en GS2 de plantas de L. japonicus, facilitó el estudio de la fotorrespiración, desde el punto de vista de su interconexión con el metabolismo del nitrógeno, y de la relación a su vez del metabolismo del nitrógeno con el estrés abiótico. 1. Reasimilación de amonio fotorrespiratorio. Una de las características principales descrita en plantas mutantes fotorrespiratorias de cebada deficientes en GS2, es la gran acumulación de amonio que experimentan cuando son transferidas desde la atmósfera de alto CO 2 (fotorrespiración suprimida) a una atmósfera de aire donde comienzan a fotorrespirar (Wallsgrove et al., 1987; Blackwell et al., 1988). En base a estos resultados se sugirió por primera vez que era la GS2, y no la GS1, la enzima responsable de la asimilación del amonio producido durante la fotorrespiración. En esta Tesis se han llevado a cabo nuevos estudios con mutantes deficientes en GS2 de la leguminosa modelo L. japonicus que es la segunda especie vegetal y primera leguminosa donde se han descrito estos mutantes (cf. introducción). Para los mutantes Ljgln2-2 de Lotus japonicus, al igual que para los mutantes deficientes en GS2 de cebada, también se observó una elevada acumulación de amonio cuando las plantas se transferían desde una atmósfera de alto CO 2 a una atmósfera de aire, donde la fotorrespiración está activa. Sin embargo, se detectó que los niveles de amonio alcanzaban un máximo a los tres días de dicha transferencia, tras el cual se daba una disminución progresiva de los mismos hasta estabilizarse a los ocho días de la transferencia a aire. Esta caída de los niveles de amonio sugería que las plantas mutantes estaban poniendo en marcha mecanismos de destoxificación para disminuir los niveles de este metabolito. Se estudió más en detalle esta caída de los niveles de amonio y se postuló que podía ser debida a dos efectos. Por un lado, se demostró que se producía una represión coordinada de la transcripción de los genes fotorrespiratorios en las plantas mutantes, de manera que los niveles de transcrito 322 de estos genes tenían una tendencia opuesta a los niveles de amonio en dicho genotipo al transferirlas plantas a condiciones donde la fotorrespiración está activa. Este "apagado" coordinado de la fotorrespiración contribuiría a que no se produjese más amonio fotorrespiratorio en las plantas deficientes en GS2 (publicación 1). Por otro lado, se ha demostrado que existe una inducción de rutas alternativas que podían contribuir a que descendiesen los niveles de amonio en las plantas mutantes. Se comprobó que había una inducción de glutamina sintetasa citosólica (GS1), glutamato deshidrogenasa (GDH) y aparragina sintetasa (AS) que podían favorecer esta disminución de los niveles de amonio (publicación 2), lo que implicó a su vez un análisis exhaustivo de todos los genes del genoma de L. japonicus que codifican para éstas y otras enzimas implicadas en la asimilación de amonio (Publicación 8). Estos resultados son particularmente interesantes pues existen otros estudios que han descrito que existe una inducción de GS1, ASN y GDH en hojas senescentes para reasimilar el amonio producido por la degradación de proteínas (Masclaux-Daubresse et al., 2010). Nuestros resultados indican que es posible que los procesos de destoxificación de amonio fotorrespiratorio y reasimilación de amonio resultante de degradación proteica puedan compartir mecanismos similares. En cuanto a la glutamina sintetasa, varios estudios de localización tisular de las diferentes isoenzimas de GS (Edwards et al., 1990; Tobin y Yamaya, 2001; Teixeira et al., 2005) han revelado que las GS1 tienden a estar presentes en tipos celulares distintos a los de las GS2. Mientras que las primeras se encuentran en células del tejido vascular, las segundas son características de tejidos fotosintéticos como las células del mesófilo. Esta circunstancia explicaría presumiblemente que las GS1 no puedan compensar completamente la deficiencia en GS2 en los mutantes fotorrespiratorios por el hecho de expresarse en tipos celulares diferentes. A pesar de ello, los estudios abordados en L. japonicus indican que la GS1 sí puede contribuir significativamente a disminuir los niveles de amonio fotorrespiratorio que se acumula en la planta. Por otro lado, se han descrito altos niveles de NH 4+ y glutamina en plantas transformadas de tabaco deficientes en la actividad Fd-GOGAT transferidas a aire. Dado que estas plantas poseían niveles estables de glutamato, se sugería la existencia de una ruta alternativa para la síntesis de este aminoácido en estas plantas transgénicas con baja actividad Fd-GOGAT. Los autores pensaron que esta ruta podría ser la NAD(H)-GDH ya que mostraba una actividad elevada en las plantas transformadas. De esta forma, se asignó un papel a la NAD(H)-GDH en la síntesis compensatoria de glutamato cuando la actividad de la Fd-GOGAT se encuentra disminuida y el amonio actuaría como señal responsable de la 323 inducción de la actividad de la enzima (Ferrario-Mery et al., 2002). Sin embargo, evidencias recientes sugieren que la GDH trabaja en la dirección de la desaminación de glutamato para producir 2-oxoglutarato, cuyo destino será el ciclo de Krebs (Fontaine et al., 2012; Labboun et al., 2009). Teniendo en cuenta los altos niveles de NH 4+ presentes en las hojas de Ljgln2-2, una posibilidad es que se dé un incremento de la desaminación de glutamato para proveer de esqueletos carbonados para su reasimilación. En cuanto a la asparragina sintetasa, se sabe que el sustrato donador de grupos amino para la reacción catalizada por esta enzima es la glutamina. Sin embargo, está descrito que esta enzima puede usar también NH 4+ para la síntesis de asparragina siempre que la concentración de éste sea lo suficientemente grande (Lea et al., 2007; Coruzzi et al., 2000). Este hecho se ha descrito especialmente en situaciones de estrés, donde la ASN facilitaría la destoxificación de amonio (Wong et al., 2004). Además, un estudio en hojas de tabaco ha demostrado que el 15 NH 4+ se incorpora a asparragina por la acción de la ASN (Masclaux-Daubresse et al., 2006). La toxicidad por amonio y los posibles mecanismos de destoxificación subyacentes a la misma, constituyen un tema de bastante interés en la bioquímica de la nutrición nitrogenada en las plantas. Se han descrito un gran número de explicaciones sobre los posibles mecanismos de toxicidad del NH 4+ , aunque en muchos casos algunas de las teorías existentes aportan explicaciones insuficientes, parciales o incorrectas (Britto et al., 2002). Entre éstas se encuentran el efecto desacoplante del NH 4+ en la fotofosforilación; el efecto de la disminución del pH externo o balance del pH interno como resultado de la adquisición de NH 4+ ; la acumulación per se de NH 4+ libre en tejidos de la planta (incluyendo, expresamente, el citosol); y la necesidad de una mayor demanda de carbono de la raíz para la síntesis de aminoácidos bajo nutrición con NH 4+ . Explicaciones más plausibles y que requieren aún más investigación incluyen la participación de la síntesis y acción del etileno en la respuesta de la planta a la situación de estrés producida por NH 4+ ; los procesos de flujo a través de la membrana del NH 4+ , y, en particular, la salida ("efflux") del mismo que puede ser demandante de energía; efectos fotosintéticos, relacionados particularmente con la fotoprotección; y la alteración de las concentraciones de posibles cationes esenciales de sus niveles homeostáticos en distintos compartimentos subcelulares. Además, se podría aprender mucho sobre la toxicidad del amonio examinando el alivio de su toxicidad, particularmente a través de la co-presencia de nitrato (Britto et al., 2002). De hecho, en la publicación 3 de la Tesis se muestran interesantes diferencias en la expresión de los genes entre las plantas cultivadas exclusivamente con amonio o con nitrato amónico, siendo esta última 324 la fuente nitrogenada óptima para el cultivo de la mayoría de las plantas, incluida Lotus japonicus (Márquez, 2005). En el caso de mutantes fotorrespiratorios deficientes en la asimilación de amonio en cebada se ha postulado que las deficiencias de crecimiento en condiciones de fotorrespiración activa pueden ser debidas a una deficiencia de nitrógeno más que a una acumulación de amonio per se (Häuser et al., 1994; Joy et al., 1992). Sin embargo, los estudios abordados con los mutantes Ljgln2-2 parecen excluir la posibilidad de una deficiencia de nitrógeno en estas plantas ya que, por el contrario, con la transferencia a condiciones de fotorrespiración activa se incrementaban los niveles de varios aminoácidos en este genotipo (publicación 1 y 2), en contra de lo descrito en cebada. Por este motivo, los resultados mostrados en esta Tesis Doctoral sugieren que la respuesta de las plantas mutantes a condiciones de fotorrespiración activa está determinada, directa o indirectamente, por el NH 4+ fotorrespiratorio acumulado en las hojas. No obstante, no podemos decir con claridad si este efecto se produce sólo por el amonio fotorrespiratorio per se o si es general para todas las situaciones en las que hay alta concentración de amonio en hojas de L. japonicus. Otra serie de experimentos serían necesarios para examinar en mayor profundidad esta cuestión como los que se citan a continuación: a) una posibilidad sería el estudio de plantas silvestres tratadas con un un inhibidor de glutamina sintetasa como la metionina sulfoximina (MSX) o la fosfinotricina (PPT); en nuestro laboratorio hemos comprobado que plantas de L. japonicus sometidas a estos tratamientos incrementan notablemente su contenido en NH 4+ , tal y como se ha descrito en otras plantas (Walker et al., 1984; Husted y Schjoerring, 1995), pero esto es debido a una inhibición tanto de la GS1 como de la GS2 con lo que no sería un modelo comparable a la situación de los mutantes fotorrespiratorios examinados que sólo están afectados en GS2; b) otra posibilidad sería el estudio de plantas cultivadas con NH 4+ como fuente de nitrógeno pero se ha comprobado que estas plantas no acumulaban amonio en hojas, ya que Lotus japonicus asimila el nitrógeno en raíces y lo transporta a las hojas, mayoritariamente, en forma de asparragina, con lo cual tampoco son de utilidad para la comparación con los mutantes fotorrespiratorios deficientes en GS2 que acumulan altas cantidades de amonio en hojas; y c) una tercera posibilidad sería el cultivo de plantas Ljgln2-2 en atmósfera de alto CO 2 y la pulverización de las hojas con un spray que contenga NH 4+ de forma que éste pueda penetrar y acumularse en las hojas en condiciones de fotorrespiración suprimida hasta niveles comparables con los generados en el mutante Ljgln2-2 en condiciones de fotorrespiración activa. Aún no ha podido comprobarse si con este procedimiento se daría el resultado esperado dada la posible toxicidad del amonio para las hojas siendo, en todo 325 caso, necesario encontrar la concentración externa adecuada del mismo, lo que requeriría largo tiempo de puesta a punto. Es interesante mencionar que los mutantes de GS de cebada también mostraban una alta acumulación de amonio, sin embargo, presentaban una curva de acumulación gradual de este compuesto hasta alcanzar un nivel máximo de saturación posiblemente provocada por el equilibrio entre la producción interna de amonio y la difusión de éste al exterior por los estomas de las hojas (Blackwell et al., 1987). Sin embargo, estos estudios no mostraron ninguna disminución posterior de los niveles de amonio, como la observada para el mutante Ljgln2-2 estudiado en esta Tesis. No obstante, el estudio realizado en plantas de cebada se realizó en intervalos de transferencia a aire muy cortos comparados con los nuestros, por lo que no es posible saber con certeza si el comportamiento y los mecanismos de posible destoxificación de amonio observados en los mutantes deficientes en GS2 de L. japonicus podrían darse también en otras plantas. 2. Interacción de la GS2 con el metabolismo del carbono y del nitrógeno. La publicación 1 muestra que hay una gran modulación del transcriptoma de plantas silvestres y Ljgln2-2 cuando éstas se transfieren desde una atmósfera de alto CO 2 a una atmósfera de niveles normales de CO 2 . Esta modulación se da en mucho mayor grado en las plantas mutantes, en las que se detectan más de 120 familias génicas con genes modulados específicamente en el mutante Ljgln2- 2 y no en las plantas silvestres. La mayoría de dichos genes pertenecen al metabolismo primario y secundario, incluyendo, por ejemplo, la biosíntesis de clorofila, el metabolismo de aminoácidos, la glucolisis, el ciclo de Krebs y el metabolismo de la sacarosa y el almidón u otros aspectos del metabolismo de carbono, entre otros. En esta publicación se muestra claramente que la fotorrespiración está relacionada con muchas rutas metabólicas y que la deficiencia en GS2 afecta en gran medida a la asimilación de carbono en plantas de Lotus japonicus. En este sentido, los datos presentados en esta Tesis concuerdan a su vez con otros estudios recientemente obtenidos en nuestro laboratorio. En el trabajo de García-Calderón et al. (2012) se describe que la transferencia de plantas silvestres y Ljgln2-2 desde una atmósfera enriquecida en alto CO 2 a aire afecta al proceso de nodulación, especialmente en los mutantes deficientes en GS2, debido a una reducción de la disponibilidad de carbono, especialmente en Ljgln2-2. De hecho, incluso en atmósfera de alto CO 2 , en los mutantes deficientes en GS2 se detectan niveles menores de almidón, sacarosa, glucosa y fructosa que en las plantas silvestres, confirmando así la implicación de la GS2 en el balance de carbono de la planta 326 Por otro lado, en la publicación 3 se evidencia que hay un gran número de genes que se modulan en las hojas de L. japonicus tanto por la deficiencia de GS2 en condiciones de fotorrespiración suprimida como por la disminución de la concentración de CO 2 atmosférico en las plantas silvestres. Además, los genes modulados en ambas condiciones tienen una magnitud de cambio muy similar. Entre estos genes se encuentran varios que están directamente relacionados con el metabolismo del carbono. También se ha demostrado que la deficiencia en GS2 provocaba una respuesta diferente u opuesta en hojas de plantas cultivadas con nutrición mixta que en hojas de plantas cultivadas con nitrato o con amonio como fuentes nitrogenadas (publicaciones 3 y 6). Cabe destacar, asimismo, que la comparación de los transcriptomas de hojas cultivadas en nutrición mixta con con los de hojas de plantas noduladas, muestra que hay una expresión diferencial de genes del metabolismo de carbono en estas dos condiciones. Este comportamiento no lo adoptaban ni las plantas cultivadas únicamente con nitrato ni con amonio en comparación con las plantas noduladas. Todas estas evidencias ponen de manifiesto cómo un defecto en la asimilación de nitrógeno afecta al metabolismo del carbono en Lotus japonicus. Es, pues, probable, que la GS2 tenga un papel crucial en la señalización del balance C/N en las plantas de L. japonicus. En otras publicaciones de la Tesis se ha hecho además un estudio exhaustivo sobre los niveles de expresión de genes implicados en la utilización de nitrato o amonio en las plantas de L. japonicus. Por ejemplo, en la publicación 9 se ilustran los niveles de expresión de 35 genes implicados en el transporte, reducción o regulación de nitrato en las plantas silvestres de L. japonicus, en comparación con los datos obtenidos para el mutante Ljclo1 afectado en el consumo de nitrato. Igualmente, la publicación 8 recoge los niveles de expresión de los distintos genes implicados en la asimilación de amonio para distintos órganos de las plantas de L. japonicus. 3. Interacción entre el metabolismo del nitrógeno y el estrés abiótico. En las publicaciones 4 y 5 se muestran los efectos que produce la sequía en el transcriptoma de las hojas de L. japonicus. Cuando dichas plantas se sometían a sequía se modulaban varias rutas metabólicas, entre las que se incluían el metabolismo del almidón y la sacarosa, el metabolismo de aminoácidos y el metabolismo de clorofila y porfirina. Las plantas de L. japonicus sometidas a estrés hídrico experimentaban una represión de los genes de la fotosíntesis. Esta respuesta se ha observado en otras plantas (Saibo et al., 327 2009). El metabolismo central del carbono se afectaba con una represión general de los genes del ciclo de Krebs. Considerando que los bajos niveles de fotosíntesis darán lugar a una reducida disponibilidad de energía y de carbono, es fácilmente explicable la modulación del metabolismo del almidón y sacarosa, cuya finalidad es movilizar las reservas de carbono. Además, los cambios transcriptómicos asociados con el metabolismo de aminoácidos podría ser otro modo de abastecer el ciclo de Krebs bajo condiciones de sequía (publicación 5). Estos estudios y otros recientes (Yousfi et al., 2012) han mostrado una interconexión entre el metabolismo de nitrógeno y la adaptación de las plantas al estrés hídrico. Además, en las publicaciones 4 y 5 de la Tesis se ha mostrado también un estudio comparado sobre el efecto de la sequía en el transcriptoma de hojas de plantas silvestres y mutantes deficientes en GS2 de L. japonicus. El mayor número de genes modulados por sequía exclusivamente en los mutantes deficientes en GS2, así como la intensidad en la modulación de los mismos., comparadas con las del organismo silvestre en las mismas condiciones, confirma la clara interconexión existente entre el estrés hídrico y el metabolismo del nitrógeno en las plantas de L. japonicus. Además, las rutas metabólicas más moduladas de manera específica en los mutantes deficientes en GS2 coincidían en gran parte con las que eran específicamente moduladas en dichos mutantes en condiciones de fotorrespiración activa y sin sequía, anteriormente mencionadas. Así, las principales rutas moduladas por sequía en los mutantes deficientes en GS2 incluían el metabolismo de la porfirina y la clorofila, el metabolismo del almidón y sacarosa, el metabolismo de aminoácidos y el metabolismo de los alcaloides. Otros trabajos anteriores demostraron una clara implicación de la GS2 en la síntesis de prolina (Díaz et al., 2010). La prolina es un aminoácido producido por las plantas como respuesta a diferentes situaciones de estrés abiótico (Szabados & Savoure, 2010). En el caso de las plantas del género Lotus, podemos decir que la prolina participa en distintas respuestas a estrés que incluyen no solamente, como el estrés por aluminio (publicación 5). Todas estas evidencias ponen de manifiesto que existe una interconexión entre el metabolismo del nitrógeno y el estrés abiótico, particularmente el estrés hídrico, y que la GS2 está relacionada con ambos procesos en L. japonicus. 4. Visión global y nuevas perspectivas. En esta Tesis Doctoral se han obtenido resultados que ponen de manifiesto la existencia de una interesante relación entre el balance C/N de las plantas de L. japonicus con el metabolismo fotorrespiratorio (publicaciones 1, 2 y 3) y con el estrés abiótico, concretamente, con el estrés hídrico (publicaciones 4 y 5) 328 señalándose un papel fundamental de la GS2 en ambos procesos (Figura 1). Las publicaciones 6, 7, 8 y 9 también aportan valiosa información sobre estos tópicos. Figura 1. Tópicos de estudio de esta Tesis Doctoral. Por último, cabe destacar también que en los trabajos que componen esta Tesis Doctoral se describen varios factores de transcripción que pueden tener papeles clave en la respuesta a las condiciones de fotorrespiración activa, a la presencia / ausencia de nitrógeno externo, a las diferentes fuentes nitrogenadas minerales, a los cambios en la relación C/N o a la sequía. Actualmente, se dispone de una colección de mutantes por transposones LORE1 (Urbanski et al., 2012) que puede ser de gran utilidad para el esclarecimiento de las funciones de dichos factores de transcripción en estudios futuros. Además, se está colaborando con el grupo de investigación del Dr. Rodrigo Gutiérrez de la Pontificia Universidad Católica de Chile para poner a punto dos herramientas bioinformáticas que permitirán establecer predicciones de genes relacionados con un conjunto de genes de interés en L. japonicus. Dichas herramientas facilitarán el estudio de estos factores de transcripción. Referencias. Betti M, García-Calderón M, Pérez-Delgado CM, Credali A, Estivill G, Galván F, Vega JM, Márquez AJ (2012) Glutamine synthetase in legumes: recent advances in enzyme structure and functional genomics. International Journal of Molecular Sciences 13, 7994-8024. Blackwell RD, Murray AJS, Lea PJ (1987) Inhibition of photosynthesis in barley with decreased levels of chloroplastic glutamine synthetase activity. J. Exp. Bot. 38, 1799-1809. Blackwell RD, Murray AJS, Lea PJ, Kendall AC, Hall NP, Turner JC, Wallsgrove RM (1988) The value of mutants unable to carry out photorespiration. Photosynthesis Research 16, 155-176. 329 Britto DT, Kronzucker HJ (2002) NH 4+ toxicity in higher plants: a critical review. Journal of Plant Physiology 159, 567-584. Coruzzi G, Last R (2000) Amino Acids. En "Biochemistry and Molecular Biology of Plants" (Buchanan B, Gruissem W, jones R, eds.) American Society of Plant Physiologists, Chapter 8. Díaz P, Betti M, Sánchez DH, Udvardi MK, Monza J, Márquez AJ (2010) Deficiency in plastidic glutamine synthetase alters proline metabolism and transcriptomic response in Lotus japonicus under drought stress. New Phytologist 188, 1001-1013. Edwards JW, Walker EL, Coruzzi GM (1990) Cell-specific expression in transgenic plants reveals nonoverlapping roles for chloroplast and cytosolic glutamine synthetase. Proc. Natl. Acad. Sci. USA 87, 3459-3463. Ferrario-Mery S, Hodges M, Hirel B, Foyer CH (2002) Photorespirationdependent increases in phosphoenolpyruvate carboxylase, isocitrate dehydrogenase and glutamate dehydrogenase in transformed tobacco plants deficient in ferredoxin-dependent glutamine-α-ketoglutarate aminotransferase. Planta 214, 877-886. Fontaine J-X, Tercé-Laforgue T, Armengaud P, Clément G, Renou J-P, Pelletier S, Catterou M, Azzopardi M, Gibon Y, Lea PJ, Hirel B, Dubois F (2012) Characterization of a NADH-dependent glutamate dehydrogenase mutant of Arabidopsis demonstrates the key role of this enzyme in root carbon and nitrogen metabolism. Plant Cell 24, 4044-4065 García-Calderón M, Chiurazzi M, Espuny MR, Márquez AJ (2012) Photorespiratory metabolism and nodule function: behavior of Lotus japonicus mutants deficient in plastid glutamine synthetase. Molecular Plant-Microbe Interactions 25, 211-219. Häuser RE, Blackwell RD, Lea PJ, Leegood RC (1994) Control of photosynthesis in barley leaves with reduced activities of glutamine synthetase or glutamate synthase. Plant characteristics and changes in nitrate, ammonium and amino acids. Planta 194, 406-417. Husted S, Schjoerring JK (1995) Apoplastic pH and ammonium concentration in leaves of Brassica napus. Plant Physiol. 109, 1453-1460. Joy KW, Blackwell RD, Lea PJ (1992) Assimilation of nitrogen in mutants lacking enzymes of the glutamate synthase cycle. J. Exp. Bot. 43, 139-145. 336 indicating that GS2 must have a key role in the C/N balance in Lotus japonicus plants. 7. Drought transcriptomics studies of WT and mutant plants show that the response to drought conditions is interconnected with several aspects of cellular metabolism, including modulation of genes involved in photosynthesis, amino acid metabolism, cell wall metabolism, oxidative stress and carbon metabolism. In addition, it is also shown that the transcriptomic changes produced by drought in GS2-deficient mutant plants were similar to the transcriptomic changes produced by the transfer of these mutants to photorespiratory active conditions. All these data indicate a clear interconnection between nitrogen metabolism, photorespiration and drought, with an outstanding implication of GS2 in the transcriptomic changes observed. 8. Transcriptomic studies and the use of co-expression networks allow to identify several transcription factors that could have key roles either in the responses to the different nitrogen nutritions (transcription factors bHLH029, TGA4, two nodulins of the family nodulin21, WRKY50 and two WRKY70), to the diminishment of atmospheric CO 2 concentration and lack of GS2 (transcription factor bHLH020 and a zinc finger) or to drought stress (transcription factors NAC47, ABR1, WRKY40, LBD37 and LBD38, among others) in Lotus japonicus.