TET2 Regulates the Neuroinflammatory Response in Microglia

Article TET2 Regulates the Neuroinflammatory Response in Microglia Graphical Abstract Highlights dTET2 is upregulated in microglia cells upon various inflammatory stimuli dTET2 regulates TLR-4-induced type I IFN response and LPS- induced aerobic glycolysis dTET2 regulates the proinflammatory response induced by LPS in vitro and in vivo dTET2 is expressed by amyloid bplaque-associated microglia in AD brains Authors Alejandro Carrillo-Jimenez, O ¨zgen Deniz, Maria Victoria Niklison-Chirou, ..., Jose Luis Venero, Miguel Ramos Branco, Miguel Angel Burguillos Correspondence [email protected] (M.R.B.), [email protected] (M.A.B.) In Brief Microglia play a key role in neuroinflammation and neurodegeneration in different neurodegenerative diseases, but little is known about the epigenetic modifying enzymes regulating their inflammatory response. Carrillo-Jimenez et al. identify TET2 as a major regulator of the microglia proinflammatory response and suggest that, by targeting this protein, microglial activation could be impaired. 7(7 *OXFRVH 0HWDEROLVP 7\SH,,)1 5HVSRQVH ,QÀDPPDWRU\ 5HVSRQVH 7HW 7/5 S S ,N% S S 1)N% &RPSOH[ Carrillo-Jimenez et al., 2019, Cell Reports 29, 697–713 October 15, 2019 ª2019 The Author(s). https://doi.org/10.1016/j.celrep.2019.09.013 Cell Reports Article TET2 Regulates the Neuroinflammatory Response in Microglia Alejandro Carrillo-Jimenez, 1,2,9 O ¨zgen Deniz, 3,9 Maria Victoria Niklison-Chirou, 3,9 Rocio Ruiz, 1,2,9 Karina Bezerra-Salom~ ao, 3,11 Vassilis Stratoulias, 4 Rachel Amouroux, 5 Ping Kei Yip, 3 Anna Vilalta, 6 Mathilde Cheray, 4 Alexander Michael Scott-Egerton, 3 Eloy Rivas, 7 Khadija Tayara, 1,2 Irene Garcı ´a-Domı´nguez, 1,2 Juan Garcia-Revilla, 1,2 Juan Carlos Fernandez-Martin, 1,2 Ana Maria Espinosa-Oliva, 1,2 Xianli Shen, 4 Peter St George-Hyslop, 8 Guy Charles Brown, 6 Petra Hajkova, 5 Bertrand Joseph, 4 Jose Luis Venero, 1,2,10 Miguel Ramos Branco, 3,10, * and Miguel Angel Burguillos 1,2,3,10,12, * 1 Instituto de Biomedicina de Sevilla (IBiS), Hospital Universitario Virgen del Rocı ´o/CSIC/Universidad de Sevilla, 41013 Sevilla, Spain 2 Departamento de Bioquı ´mica y Biologı ´a Molecular, Facultad de Farmacia, Universidad de Sevilla, 41012 Sevilla, Spain 3 Blizard Institute, Barts and The London School of Medicine and Dentistry, QMUL, London E1 2AT, UK 4 Institute of Environmental Medicine, Toxicology Unit, Karolinska Institutet, 171 77 Stockholm, Sweden 5 MRC London Institute of Medical Sciences/Institute of Clinical Sciences Faculty of Medicine, Imperial College London, Du Cane Road, London W12 0NN, UK 6 Department of Biochemistry, University of Cambridge, Tennis Court Road, Cambridge CB2 1QW, UK 7 Department of Pathology, Instituto de Biomedicina de Sevilla, Hospital Universitario Virgen del Rocı ´o/CSIC/Universidad de Sevilla, 41013 Sevilla, Spain 8 Department of Clinical Neurosciences, Cambridge Institute for Medical Research, University of Cambridge, Cambridge CB2 0SP, UK 9 These authors contributed equally 10 Senior author 11 Present address: Department of Genetics, Ribeir~ ao Preto School of Medicine, University of S~ ao Paulo, 3900 Bandeirantes Avenue, 14049-900 Ribeir~ ao Preto, SP, Brazil 12 Lead Contact *Correspondence: [email protected] (M.R.B.), [email protected] (M.A.B.) https://doi.org/10.1016/j.celrep.2019.09.013 SUMMARY Epigenomic mechanisms regulate distinct aspects of the inflammatory response in immune cells. Despite the central role for microglia in neuroinflammation and neurodegeneration, little is known about their epigenomic regulation of the inflammatory response. Here, we show that Ten-eleven translocation 2 (TET2) methylcytosine dioxygenase expression is increased in microglia upon stimulation with various inflammogens through a NF-kB- dependent pathway. We found that TET2 regulates early gene transcriptional changes, leading to early metabolic alterations, as well as a later inflammatory response independently of its enzymatic activity. We further show that TET2 regulates the proinflammatory response in microglia of mice intraperitoneally injected with LPS. We observed that microglia associated with amyloid bplaques expressed TET2 in brain tissue from individuals with Alzheimer’s disease (AD) and in 5xFAD mice. Collectively, our findings show that TET2 plays an important role in the microglial inflammatory response and suggest TET2 as a potential target to combat neurodegenerative brain disorders. INTRODUCTION Microglia, the resident immune cells in the CNS, are key players in maintaining homeostasis in the brain. Microglia play a wide variety of roles under physiological and pathological conditions. In the healthy brain, microglia are responsible for neuronal activitydependent synapse pruning during postnatal development (Schafer et al., 2012; Wu et al., 2015). Upon neuronal injury or infection, microglia become rapid responders that initiate an innate inflammatory response (Hanisch and Kettenmann, 2007). If the inflammatory response is exaggerated or chronic, it becomes detrimental for the surrounding neuronal population, as in Parkinson’s disease (PD) and Alzheimer’s diseases (AD) (Burguillos et al., 2011; Perry and Holmes, 2014; Abeliovich and Gitler, 2016; Ransohoff, 2016), as well as ischemic stroke (Lambertsen et al., 2012; Burguillos et al., 2015). In PD or AD, only a minor subset of patients carry genetic mutations contributing to disease development (Pickrell and Youle, 2015; Abeliovich and Gitler, 2016; Van Cauwenberghe et al., 2016). Most cases appear to be a combination of genetic predisposition and exposure to environmental risk factors. The identification of mutations in innate immunity-related genes that confer higher risk for developing neurodegenerative diseases supports the idea of microglia playing a key role in driving disease pathogenesis (Malik et al., 2015). Hence, epigenetic mechanisms are prime candidates for mediating environmentally driven alterations to immune homeostasis. Indeed, the contribution of epigenetic modifications in PD (Park et al., 2016; W€ ullner Cell Reports 29, 697–713, October 15, 2019 ª2019 The Author(s). 697 This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). et al., 2016) and AD (Phipps et al., 2016; Watson et al., 2016), has been addressed in a number of studies. However, despite the key role of microglia in the neuroinflammatory response in those neurodegenerative diseases, little is known about the epigenetic regulation of the inflammatory response in these cells. Major epigenetic mechanisms include post-translational modification of histones, DNA methylation at CpG dinucleotides, and regulation by non-coding RNAs (Bonasio et al., 2010). Interestingly, the age-dependent increase in microglial IL-1blevels is associated with DNA hypomethylation within the IL-1bpromoter (Matt et al., 2016), which is seemingly driven by the age-depen- dent loss of SIRT1 (a NAD-dependent deacetylase) (Cho et al., 2015). DNA methylation could therefore play key roles in regulating the inflammatory state in microglia. Importantly, DNA methylation can be removed by the action of Ten-eleven translocation (TET) enzymes, which are dioxygenases that catalyze the oxidation of 5-methylcytosine (5mC) into 5-hydroxymethylcyto- sine (5hmC) and other oxidative derivatives (Branco et al., 2011). Recently, TETs have been shown to play various roles in the physiology of immune cells, including thymocytes (Tsagaratou et al., 2017), T helper cells (Ichiyama et al., 2015), dendritic cells (Zhang et al., 2015), and bone marrow-derived macrophages (Zhang et al., 2015; Cull et al., 2017). Here, we investigated the role of TET enzymes in the inflammatory response in microglia cells upon Toll-like receptor 4 (TLR-4) activation. We found that TET2 regulates both early transcription (after only a few hours) of genes affecting several pathways (including control of the immune response and cell cycle) and the late inflammatory response. We confirmed in vivo that TET2 regulates the proinflammatory response in microglia cells. Furthermore, we show that TET2 is expressed in microglia close to amyloid b(Ab) plaques in both human AD subjects and in 5xFAD mice. All these results highlight the potential of TET2 as a novel drug target for neurodegenerative diseases, including AD. RESULTS TLR Activation in Microglia Induces Upregulation of Tet2 Expression To assess the effect of TLR-4 activation on the expression of TET enzymes in microglia, we treated the murine BV2 microglial cell line with LPS. We found that LPS (1 mg/mL) induced both an early 2h(Figure 1A) and sustained 24 h (Figure 1B) upregulation of Tet2 expression. However, the expression of the other two members of the TET family (TET1 and TET3) either did not vary upon LPS treatment (Tet3;Figure 1A) or was not detectable (Tet1; not shown) before or after LPS treatment. In concordance with the RNA data, we detected an increase of TET2 expression at the protein level 6 h after LPS treatment (Figure 1C). Interestingly, a lower dose of LPS (0.1 mg/mL) also induced Tet2 expression as early as 2 h after treatment (Figure 1D). To rule out the possibility that LPS-induced TET2 expression might be due to the transformed origin of our murine microglia cell line (Butovsky et al., 2014), we analyzed the expression of Tet2 in primary adult and postnatal primary microglia cells from mouse and rat origin 6 h after LPS treatment and obtained similar results to those seen in BV2 microglia cells (Figure 1E). Notably, we also observed a mild but significant upregulation of TET2 in human microglia cells (CHME3 human microglia cell line) (Figure 1E). We further validated our observations by analyzing RNA sequencing (RNA-seq) data from postnatal primary microglia cell culture experiments (Janova et al., 2016), which showed that Tet2 expression was increased both at low and high levels of LPS treatment, as well as after treatment with fibronectin, which also promotes inflammation (Figure S1A). Fibronectin-mediated regulation of Tet2 suggests that Tet2 upregulation might not only be driven by TLR-4 activation. For this reason, we challenged our BV2 cells with lipoteichoic acid (LTA), a known TLR-2 ligand, and observed a similar pattern in the expression of Tet2 and Tet3 to that seen in LPS-treated cells (Figures S1B and S1C). These data show that multiple TLR agonists drive Tet2 upregulation in microglia from different species. NF-kB p65 Mediates LPS-Induced Tet2 Expression We then sought to investigate the mechanisms responsible for the transcriptional regulation of Tet2 upon TLR-4 activation. We first took advantage of published chromatin immunoprecipitation sequencing (ChIP-seq) data on the TLR-4-induced ‘‘enhancer landscape‘‘ in macrophages (Kaikkonen et al., 2013). We used these data as a model for TLR-4-induced regulatory events that may also be occurring in microglia cells. We mapped data for the activating histone mark H3K27ac, as well as various transcription factors, and visually inspected the promoter and upstream regions of Tet2 (profiles in Figure 2AandFigure S2A). In untreated macrophages, H3K27ac was enriched both at the promoter region of Tet2 and a region lying 40 kb upstream, thus constituting a putative distal enhancer element (Figure 2A). Notably, the levels of H3K27ac increased in the upstream region (E1 and E2) after 1 h treatment with Kdo2-lipid A (KLA) (a TLR-4 agonist), and this was concomitant with the recruitment of p65 to both the promoter and upstream regions upon KLA treatment (Figure 2C). In contrast, the binding of CEBPA and PU.1 was largely unaffected by KLA treatment (Figure S2A), suggesting that p65 is a major driver of TLR-4-dependent activation of Tet2. To test whether similar patterns can be observed in BV2 cells, we performed ChIP followed by qPCR analysis at the promoter and upstream regions of Tet2. In concordance with the results obtained from bone marrow-derived macrophages (Figure 2A), BV2 cells are enriched for H3K27ac at the Tet2 promoter and at the putative regulatory region upstream of Tet2 (Figure 2B). Interestingly, H3K27ac levels specifically increased in the upstream region upon LPS treatment (Figure 2B). Moreover, we detected enrichment for H3K4me1, a histone mark associated with both poised and active enhancer elements, providing support for the upstream region being an enhancer element that becomes active upon TLR-4 activation (Creyghton et al., 2010). We then analyzed p65 enrichment in the promoter and enhancer regions of Tet2 upon LPS treatment in BV2 cells and observed a clear increase in p65 binding at the enhancer region, whereas LPS more subtly modulated the binding of p65 at the promoter region (Figure 2D). We analyzed the promoter regions of NF-kB inhibitor alpha (NFkBia)andIl-1bas positive controls for LPS- dependent p65 binding (Figure S2B). These results suggest a 698 Cell Reports 29, 697–713, October 15, 2019 potential role of p65 inTet2 expression through binding to an upstream enhancer element, increasing its activity, which is reflected by the higher H3K27ac levels in LPS-treated cells. To test the functional relevance of increased p65 binding to the upstream region of Tet2 in regulating Tet2 expression upon LPS treatment, we pre-treated BV2 cells for 1 h with wedelolactone, A Tet2/3 gene expression (Fold of Control) 5 LPS (1Pg/ml) 4 3 2 1 0 1h -+ 1h -+ 2h -+ 2h -+ 6h -+ 6h -+ Tet2 Tet3 BV2 cells n.s * n.s * 6 BBV2 cells Tet2 gene expression (Fold of Control) 5 4 3 2 1 0 24h -+ * LPS (1Pg/ml) 6 D 0 3 6 Tet2 gene expression (Fold of Control) 2h * LPS (Pg/ml) -++ 0.01 0.1 1.0 +++ 0.001 0.0005 BV2 cells n.s n.s * 43 kDa 130 kDa 230 kDa + 0.1 + 1.0 - TET2 NOS-2 E-Actin LPS (Pg/ml) C 6h BV2 cells Primary Adult Pglia Tet2 gene expression (Fold of Control) 4 ** 0 1 2 3 CHME3 -+ LPS (0.1Pg/ml) + - ** E * 6h -+ Primary Postnatal Pglia Human Mouse Rat n.s n.s ** * n.s Figure 1. LPS Induces an Early and Sustained Expression of Tet2 in Microglia Cells (A and B) Tet2 and Tet3 expression in BV2 microglia cells treated with LPS (1 mg/mL) at 1, 2 and 6 h (A) and Tet2 expression after 24 h treatment with LPS (1 mg/mL) (B). (C) Representative immunoblot showing increase of TET2 and NOS-2 expression (a positive control of microglia activation) at 6 h after LPS treatment (0.1 and 1 mg/mL) in BV2 cells. (D) Tet2 LPS-induced dose-response in BV2 microglial cells at 2 h. (E) Tet2 gene expression after 6 h LPS (0.1 mg/mL) treatment in human microglial cell line (CHME3), primary adult microglia in mouse, and primary postnatal microglia culture in rat. Statistical analysis was performed using one-way ANOVA with Scheffe ´(A and B) and LSD (D) corrections or two-tailed Student’s t test (E). Data shown are mean ± SD of three (A, D, and E) and five (B) independent experiments. *p < 0.05 and **p < 0.01. See also Figure S1. Cell Reports 29, 697–713, October 15, 2019 699 D-NF-NB p65 ChIP (generated from Kaikkonen et al.,) Untreated LPS D-H3K4me1 and D-H3K27ac ChIP (generated from Kaikkonen et al.,) A P1 H3K27ac H3K4me1 H3K27ac H3K4me1 P2 Enrichment relative to H3 0 3 2 1 H3K27ac H3K4me1 H3K27ac H3K4me1 0 H3K27ac H3K4me1 0 Tet2 H3K27ac Ctrl P1 P2 E1 E2 M P1 P2 E1 E2 M P1 P1 P1 P2 P2 P E1 E1 E1 E1 E1 E1 E1 E E E1 E1 E 1 E2 E2 2 E2 E2 E2 E2 E2 E E2 2 M M M P1 P2 E1 E2 M p65 Ctrl p65 KLA P1 P2 E1 E2 M P1 P2 E1 E2 M Tet2 % of Input Untreated LPS M C Untreated LPS Untreated LPS NF-NB p65 Mock B D M E1 E2 H3K27ac KLA 0 0 400 400 0 0 2000 2000 3 2 1 3 2 1 * ** n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0.0 1.0 0.6 0.8 0.2 0.4 n.s. n.s. n.s. E1 E2 % of Input 0.0 1.0 0.6 0.8 0.2 0.4 Untreated LPS Untreated LPS NF-NB p65 Mock n.s. n.s. * * ** * NF-NB p65 Mock P1 LPS Untreated Untreated LPS P2 0.0 1.0 0.6 0.8 0.2 0.4 n.s. n.s. ** * ** n.s. BV2 BV2 BV2 BV2 BV2 BV2 Enrichment relative to H3 Enrichment relative to H3 (legend on next page) 700 Cell Reports 29, 697–713, October 15, 2019 an inhibitor of the IKK complex, followed by treatment with LPS for 6 h. We used Il-1bas a positive control, as its transcription has been shown to be regulated by NF-kB(Cogswell et al., 1994) (Figure S2C). In line with our ChIP-qPCR data, LPS-induced expression of Tet2 was abrogated in the presence of wedelolactone (Figure S2D), suggesting that the NF-kB complex plays a role in regulating Tet2 expression (either directly or indirectly) upon LPS treatment. TET2 Helps Drive the Expression of Genes Induced by TLR-4 Stimulation Given the reported involvement of TET2 in the regulation of immune functions, we asked whether it also plays a role during the neuroinflammatory response. For this purpose, we depleted Tet2 in BV2 microglia cells using a small interfering RNA (siRNA; siTET2) strategy prior to LPS treatment (Figure 3A). To confirm that TET2 depletion resulted in decreased enzymatic activity, we measured global 5hmC levels using mass spectrometry and observed a significant 5hmC reduction in Tet2-knockdown cells compared with a non-targeting control (Figure 3B). Interestingly, LPS treatment did not change global 5hmC levels, despite the increase in TET2 expression. We then performed RNA-seq on TET2-depleted cells, before and after 3 h of LPS treatment, and compared them against a non-targeting control. First, we checked that the expression pattern in our BV2 cells after LPS treatment is very similar to previously published RNA-seq data from LPS-treated primary microglia cells in (Janova et al., 2016)(Figure S3A). To identify genes whose activation or repression during LPS treatment depends on TET2, we intersected LPS-regulated genes with TET2-regulated ones. Of 1,565 genes that were upregulated by LPS, 140 (9%) had reduced expression in TET2-depleted cells (Figure S3B). Conversely, of 1,110 genes repressed by LPS, 38 (3%) had increased expression in TET2- depleted cells (Figure S3B). Both groups of TET2-regulated genes displayed an impaired response to LPS in Tet2-knock- down cells, as judged by significant differences in the expression fold change upon LPS treatment (Figure 3C). We validated several of the gene expression changes mediated by TET2 depletion in LPS-treated cells (Figure S3C) by qPCR. Gene Ontology analyses revealed that the 140 siTET2-downregulated genes are associated mainly with the control of the innate immune response, including the response to interferon (IFN)-b(or type I IFN response), whereas the 38 siTET2-upregulated genes are associated with cell cycle regulation (Figure 3D). A manual classification of gene function on the basis of literature searches confirmed an enrichment for inflammatory and cell cycle-related genes in TET2-regulated targets, followed by genes related to intracellular signaling and transcription factors (Figure 3E). Interestingly, Gene Ontology analysis on siTET2-downregulated genes that are not modified by LPS treatment revealed a similar enrichment for genes involved in the immune response (Figure 3F). This result suggests that the effect of TET2 over the inflammatory response is not unique to LPS treatment but can also potentially affect other immune signaling pathways. To rule out the possibility that the observed gene deregulation was due to increased cell death, we performed fluorescenceactivated cell sorting (FACS) analyses of control and TET2- depleted cells. We could not find any indication of induction of cell death (Figures S3D–S3G) or major change in morphology (Figure S3H), suggesting a direct effect of TET2 over many of those genes upon treatment. TET2 Does Not Affect DNA Methylation Levels at Target Genes TET2 has been shown to act via both 5mC oxidation and catalytic-independent mechanisms, such as recruitment of epigenetic modifiers (Ichiyama et al., 2015; Zhang et al., 2015). Therefore, we investigated whether the regulatory effect of TET2 on LPS-driven gene expression in microglia was dependent on its catalytic activity. We first analyzed global 5mC levels by mass spectrometry in LPS-treated cells, comparing TET2- depleted cells with controls (Figure S4A). Neither LPS treatment nor knockdown of TET2 resulted in a significant change in global 5mC levels (Figure S4A), despite the fact that global 5hmC levels were altered in siTET2 cells (Figure 3B). In order to determine whether TET2-mediated 5mC oxidation occurs in a locus-spe- cific manner, we used oxidative bisulfite sequencing (oxBS- seq) (de la Rica et al., 2016; Booth et al., 2012) and measured 5mC and 5hmC levels at the promoters of six target genes whose expression levels were altered by TET2 knockdown (Figures 4A– 4F; Figures S4B–S4G). No significant changes were detected in the levels of 5mC (Figures 4A–4F). In 5hmC levels, we observed some statistically significant but very minor differences (Figure S4C). These results suggest that the action of TET2 on these genes does not involve its catalytic activity at these gene promoters. In line with this, our mass spectrometry data show that LPS treatment does not induce global changes in 5hmC levels, suggesting that increased TET2 catalytic activity is not necessary to mediate gene expression changes upon LPS treatment. The effect of TET2 on the expression of selected genes could also be explained by indirect effects. To test whether TET2 was bound to the promoters of genes affected by TET2 depletion, we Figure 2. NF-kBp65 Regulates LPS-Induced Tet2 Transcription (A) Profile of H3K27ac marking at the Tet2 promoter and upstream regions after 1 h treatment of macrophages with KLA, generated from published ChIP-seq data (Kaikkonen et al., 2013). (B) ChIP-qPCR results for H3K27ac and H3K4me1 at the promoter (P1 and P2), middle (M), and enhancer (E1 and E2) regions in BV2 cells treated with LPS (1 mg/mL). (C) Profile of NF-kB p65 binding at the Tet2 promoter and upstream regions after 1 h treatment of macrophages with KLA, generated from published ChIP-seq data (Kaikkonen et al., 2013). (D) ChIP-qPCR results for NF-kB p65 in the same regions as in (B) in BV2 cells treated with LPS (1 mg/mL). Tet2 middle region (M) represents a region between the promoter and the enhancer used as negative control for ChIP. Data represented as mean ±SD. The results in (B) are the average of three (for H3K4me1) and four (for H3K27ac) independent experiments. The results in (D) are the average of three independent experiments. Statistical analysis was performed using two-tailed Student’s t test. *p < 0.05 and **p < 0.01. See also Figure S2. Cell Reports 29, 697–713, October 15, 2019 701 Inflammation Cell Cycle Transcription Intracellular signalling Tyrosine PP/Pk DNA repair Endocytosis Ubiquitin pathway Ret. Endoplasm. Adhesion Others Glycolysis ATP-binding cassette E A ** Tet2 gene expression (Fold of siControl) 12 6 0 ** +- siControl -- -- - - ++ siTET2 LPS (1Pg/ml) + - - + + 3h 0.000 0.040 % 5-hmC/dG 0.030 0.010 n.s n.s ** 0.020 B +- siControl -- -- - - ++ siTET2 LPS (1Pg/ml) + - - + + 3h GO Term (in Basal conditions): p-value Enrichment Immune system process 1.10E-10 3.54 Immune Response 1.30E-6 4.10 Positive regulation of response to stimulus 1.30E-6 3.33 Regulation of immune system process 2.20E-6 3.95 Positive regulation of biological process 3.70E-6 2.04 Downregulated Cell Cycle <1.00E-30 8.59 Cell Cycle Process <1.00E-30 9.48 Mitotic cell cycle process <1.00E-30 12.26 Mitotic cell cycle <1.00E-30 11.33 Nuclear division <1.00E-30 13.68 Upregulated F LPS/Control log2 Fold Change 8 6 4 2 0 -2 + siControl - - -- + - + siTET2 + C ** * LPS DOWN LPS UP D GO Term (in LPS treated cells): Innate Immune Response 6.90E-26 12.21 Immune Response 1.10E-25 8.00 Immune System Process 4.90E-24 5.12 Defence Response 1.40E-22 6.89 Response to Interferon Beta 5.30E-18 68.42 Cell Cycle 1.50E-12 9.75 Cell Cycle Process 1.50E-12 12.24 DNA replication 1.40E-08 25.64 DNA metabolic process 1.90E-07 10.74 Mitotic Cell Cycle 5.40E-07 11.32 p-value Enrichment DownregulatedUpregulated (legend on next page) 702 Cell Reports 29, 697–713, October 15, 2019 performed TET2 ChIP-qPCR. Our data show that, indeed, TET2 binding increases substantially at target genes upon LPS treatment, whereas a control locus (Oct4) shows no alterations (Figure 4G). Importantly, LPS-driven TET2 recruitment can be reversed upon knockdown of Tet2 (Figure 4H; Figure S4H). These results suggest that TET2 acts directly on these genes but that its effect upon LPS is not predominantly mediated through its catalytic activity. TET2 Regulates the ‘‘Classical’’ Inflammatory Response and the Metabolic Reprogramming Induced by LPS The RNA-seq data suggested that TET2 plays a role in the LPS- induced inflammatory response, in particular the response to IFN-b(or type I IFN response) (Figure 3E). It was previously shown that TET2 is required for the repression of IL-6 upon LPS treatment in peripheral macrophages to ensure termination of inflammation (Zhang et al., 2015). IL-6 expression was unchanged in our RNA-seq, which was performed 3 h after LPS treatment. Given that 3 h is too early for the inflammatory resolution process to start, we analyzed the expression levels of IL-6 and other players related to the ‘‘classical’’ proinflammatory response (IL-1band NOS-2 expression) at later time points upon LPS treatment (Figures 5A–5E). We observed in BV2 cells that although there was no difference at 3 h after LPS treatment, the expression of Il-1b,Il-6 and Nos-2 was reduced at 6 and 24 h post-LPS treatment upon TET2 depletion (Figures 5A–5C). Knockdown of TET2 led to significantly less IL-6 release into the media upon LPS treatment at 6 and 24 h in BV2 cells (Figure 5D). To validate our observations in primary microglia cell cultures, we crossed conditional Tet2 floxed mice (Tet2 flox/flox ) with Cx3cr1 Cre mice (Cx3cr1 CreERT2/WT ) to enable the production of inducible microglia-specific deletion of Tet2 (Figures S5A– S5C). We isolated primary microglia from both Tet2 flox/flox Cx3cr1 Cre-positive (henceforth referred to as Tet2 flox/flox Cx3cr1 Cre/WT ) and negative mice (referred as Tet2 flox/flox Cx3cr1 WT/WT ) and treated cells with 4-OH-tamoxifen for 48 h, producing a partial genomic deletion of Tet2 (Figures S5A and S5B). Importantly, this led to decreased Tet2 expression in Tet2 flox/flox Cx3cr1 Cre/WT in basal conditions and complete abrogation of Tet2 upregulation upon treatment with 100 ng/mL of LPS for 24 h (Figure S5C). To analyze the effects of Tet2 deletion over the inflammatory response, we compared the expression levels of different proinflammatory markers between primary Tet2 flox/flox Cx3cr1 Cre/WT and Tet2 flox/flox Cx3cr1 WT/WT microglia in response to LPS. In accordance with our results from BV2 cells, Nos-2 expression decreased by about 50% in Tet2 flox/flox Cx3cr1 Cre/WT compared with Tet2 flox/flox Cx3cr1 WT/WT primary microglia 24 h after LPS challenge (Figure 5E). We also analyzed the release of IL-6 and TNF-ainto the media 24 h after LPS treatment and observed a statistically significant inhibition of IL-6 release and TNF-ain primary microglia cell cultures supernatants (Figures 5F and 5G). Collectively, our data suggest that in microglial cells, TET2 is not involved in the resolution of the inflammatory response as reported in peripheral immune cells (Zhang et al., 2015). Instead, microglial TET2 modulates the classical inflammatory response upon direct stimulus by LPS treatment. However, this timedependent effect of TET2 on the LPS-induced expression of ‘‘classical’’ proinflammatory markers suggests an indirect effect. Therefore, we aimed to dissect the mechanisms that could affect the delayed expression of different inflammatory cytokines in activated microglia. TLR-4 stimulation induces a rapid and robust transcriptional response that involves genes that regulate metabolic reprogramming (Medzhitov and Horng, 2009). Treatment with LPS in macrophages and dendritic and microglia cells provokes a metabolic shift from oxidative phosphorylation (OXPHOS) toward aerobic glycolysis, a process required to quickly supply high-energy demands of the inflammatory response (Ruiz-Garcı ´a et al., 2011; Galva ´n-Pen ˜a and O’Neill, 2014; Ganeshan and Chawla, 2014; Orihuela et al., 2016). In proinflammatory (M1) macrophages, aerobic glycolysis is a consequence of glucose uptake and the conversion of pyruvate into lactate (Galva ´n-Pen ˜a and O’Neill, 2014). Interestingly, two of the targets that were deregulated by Tet2 knockdown in our RNA-seq data were hexokinase 3 (Hk3) and 6-phosphofructo- 2-kinase/fructose-2,6-biphosphatase 3 (Pfkfb3), both playing an important role during the aerobic glycolysis process (Ruiz- Garcı ´a et al., 2011; Galva ´n-Pen ˜a and O’Neill, 2014). We therefore asked if TET2 was involved in the early stages of the metabolic reprogramming induced by LPS. In BV2 cells, we measured the extracellular acidification rate (ECAR) as an indicator of lactate production and the mitochondrial oxygen consumption rate (OCR) as an indicator of the mitochondrial energy production in siControl and siTET2 BV2 cells with and without LPS at different time points (Figures 5H and 5I). A functional bioenergetics profile of siControl, siTET2 cells with and without LPS treatment in response to sequential treatment with oligomycin, FCCP, and rotenone/antimycin A was carried out (Figures S5D and S5E). Our results show reduced lactate production after Tet2 knockdown at 3 and 24 h of LPS treatment at basal conditions (Figure 5H) and after oligomycin treatment, indicating reduced glycolysis (Figure S5D). We then asked whether this decrease in lactate formation at 3 h was correlated with a decrease in the glucose consumption. We analyzed the extracellular glucose levels after 3 h LPS treatment and found that siControl LPS-treated cells consume glucose from the media but that LPS-treated siTET2 cells show a substantial reduction in the glucose uptake (Figure 5J). Because Tet2 knockdown Figure 3. TET2 Regulates Signaling Pathways Induced by LPS (A and B) Effect of siRNA Tet2 knockdown on Tet2 gene expression (A) and on the global levels of 5hmC (B) with or without 3 h treatment with LPS (1 mg/mL). (C) Expression change of LPS-responsive TET2-regulated genes (see Venn diagrams in Figure S3B) upon LPS treatment in siRNA control and TET2-treated cells. (D) Table representing Gene Ontology (GO) analysis of all genes affected by Tet2 knockdown after LPS treatment. (E) Manual annotation representing different functional groups (and some examples of the genes) affected by Tet2 knockdown after LPS treatment. (F) Manual annotation representing different functional groups (and some examples of the genes) affected by Tet2 knockdown under basal conditions. Data shown are represented as mean ±SD from five (A) and three (B and C) independent experiments. Two-tailed Student’s t test. *p < 0.05 and **p < 0.01. See also Figure S3. Cell Reports 29, 697–713, October 15, 2019 703 G 0.000 0.016 % of Input 0.012 0.004 IPTET2 Mock Irf1 Cd274 Cxcl10 Pfkb3 -- LPS ------ Oct4 -- 0.008 D-TET2 ChIP -++ -+ -+ -+ - 0.00 0.03 % of Input 0.02 0.01 Irf1 Cd274 Cxcl10 Pfkb3 siControl LPS siControl siTET2 LPS Oct4 D-TET2 ChIP siControl siControl LPS siTET2 LPS siControl siControl LPS siTET2 LPS siControl siControl LPS siTET2 LPS siControl siControl LPS siTET2 LPS H Position relative to TSS Axl Cxcl10 Position relative to TSS Position relative to TSS Position relative to TSS Mmp14 Tnfsf12a Position relative to TSS Position relative to TSS Cd274 Irf1 AB CD EF Control LPS Control LPS Control LPS Control LPS Control LPS Control LPS (legend on next page) 704 Cell Reports 29, 697–713, October 15, 2019 SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. celrep.2019.09.013. ACKNOWLEDGMENTS We would like to thank to Dr. de la Rica (Queen Mary University of London) for technical support and Dr. Hornedo-Ortega (University of Seville) for providing us with the a-synuclein. A.C.-J. is supported by a pre-doctoral fellowship from the Spanish Ministerio de Educacio ´n, Cultura y Deporte. O ¨.D. has received funding from the People Programme (Marie Curie Actions) of the European Union’s Seventh Framework Programme (FP7/2007-2013) under REA grant agreement 608765. M.V.N.-C. received a Children with Cancer UK fellowship (14-178). This work was supported by grants from Blizard Research Theme grants Queen Mary University of London; Blizard Institute; Spanish Ministerio de Ciencia, Innovacio ´n y Universidades/FEDER/UE RTI2018-098645-B-100; Swedish Research Council; ERA-NET TracInflam; Swedish Brain Foundation; and Karolinska Institutet Foundations. M.R.B. is a Sir Henry Dale Fellow (101225/Z/13/Z), jointly funded by the Wellcome Trust and the Royal Society. M.A.B. has been funded by the Barts Charity Centre for Trauma Sciences (C4TS), the Wellcome Trust Institutional Strategic Support Fund (ISSF), and the Spanish Ministry of Economy and Competitivity (Programa Ramo ´n y Cajal: RYC-2017-21804). AUTHOR CONTRIBUTIONS M.A.B. and M.R.B. designed the study. A.C.-J., J.L.V., I.G.-D., J.G.-R., J.C.F.-M., and R.R. performed all the experiments with the Tet2 flox/flox ; Cx3Cr1 Cre/wt and Tet2 flox/flox ;Cx3Cr1 wt/wt mice. O ¨.D. performed the ChIP analysis for NF-kB p65 and H3K27ac and H3K4me1 antibodies. O ¨.D. and M.A.B. performed the ChIP analysis for TET2 antibody. M.V.N.-C. determined the ECAR and OCR index and glucose consumption in BV2 cells. K.B.-S. performed the oxBS sequencing experiments. V.S. and X.S. performed the staining and analysis of TET2 expression in AD subjects. R.A. and P.H. performed the mass spectrometry analysis for global levels of 5mC and 5hmC. A.V. and G.C.B. performed the analysis of TET2 in rat postnatal primary microglia. P.K.Y. performed the analysis of TET2 in mouse adult primary microglia. M.C. performed the analysis of TET2 in the human microglia cell line CHME3. R.R. performed the analysis of TET2 in the 5xFAD mice brain tissue and in Tet2 flox/flox ;Cx3Cr1 WT/WT and Tet2 flox/flox ;Cx3Cr1 Cre/WT injected with LPS. R.R. also performed the confocal analysis of microglia morphology and COX-2. A.M.S.-E. analyzed TET2/3 expression in BV2 cells after LTA treatment. K.T. and A.M.E.-O. and P.S.-H. analyzed the expression levels of TET2 in BV2 upon a-synuclein and b-oligomer treatments. E.R. provided the AD subject tissue. I.G.-D., J.G.-R., J.C.F.-M. performed the isolation of RNA from SN from mice injected with LPS and performed the qPCR analysis for the different cytokines and COX2 and NOX2. M.R.B. performed the RNA- seq experiments and analyzed the data. M.A.B. performed the qPCR analysis and immunoblots for the study of the inflammatory response in BV2 cells. J.L.V. and B.J. were involved in the study design. M.A.B. and M.R.B. wrote the manuscript with all the authors. All authors discussed the results and commented on or edited the manuscript. DECLARATION OF INTERESTS The authors declare no competing interests. Received: October 24, 2017 Revised: April 18, 2019 Accepted: September 6, 2019 Published: October 15, 2019 REFERENCES Abeliovich, A., and Gitler, A.D. (2016). Defects in trafficking bridge Parkinson’s disease pathology and genetics. Nature 539, 207–216. Alhadidi, Q., and Shah, Z.A. (2018). Cofilin mediates LPS-induced microglial cell activation and associated neurotoxicity through activation of NF-kB and JAK-STAT pathway. Mol. Neurobiol. 55, 1676–1691. Bal-Price, A., and Brown, G.C. (2001). Inflammatory neurodegeneration mediated by nitric oxide from activated glia-inhibiting neuronal respiration, causing glutamate release and excitotoxicity. J. Neurosci. 21, 6480–6491. Bal-Price, A., Matthias, A., and Brown, G.C. (2002). Stimulation of the NADPH oxidase in activated rat microglia removes nitric oxide but induces peroxynitrite production. J. Neurochem. 80, 73–80. Benusa, S.D., George, N.M., Sword, B.A., DeVries, G.H., and Dupree, J.L. (2017). Acute neuroinflammation induces AIS structural plasticity in a NOX2- dependent manner. J. Neuroinflammation 14, 116. Bodea, L.G., Wang, Y., Linnartz-Gerlach, B., Kopatz, J., Sinkkonen, L., Musgrove, R., Kaoma, T., Muller, A., Vallar, L., Di Monte, D.A., et al. (2014). Neurodegeneration by activation of the microglial complement-phagosome pathway. J. Neurosci. 34, 8546–8556. Bonasio, R., Tu, S., and Reinberg, D. (2010). Molecular signals of epigenetic states. Science 330, 612–616. Booth, M.J., Branco, M.R., Ficz, G., Oxley, D., Krueger, F., Reik, W., and Balasubramanian, S. (2012). Quantitative sequencing of 5-methylcytosine and 5-hydroxymethylcytosine at single-base resolution. Science 336, 934–937. Boza-Serrano, A., Reyes, J.F., Rey, N.L., Leffler, H., Bousset, L., Nilsson, U., Brundin, P., Venero, J.L., Burguillos, M.A., and Deierborg, T. (2014). The role of galectin-3 in a-synuclein-induced microglial activation. Acta Neuropathol. Commun. 2, 156. Branco, M.R., Ficz, G., and Reik, W. (2011). Uncovering the role of 5-hydrox- ymethylcytosine in the epigenome. Nat. Rev. Genet. 13, 7–13. Burguillos, M.A., Deierborg, T., Kavanagh, E., Persson, A., Hajji, N., Garcia- Quintanilla, A., Cano, J., Brundin, P., Englund, E., Venero, J.L., and Joseph, B. (2011). Caspase signalling controls microglia activation and neurotoxicity. Nature 472, 319–324. Burguillos, M.A., Svensson, M., Schulte, T., Boza-Serrano, A., Garcia-Quinta- nilla, A., Kavanagh, E., Santiago, M., Viceconte, N., Oliva-Martin, M.J., Osman, A.M., et al. (2015). Microglia-secreted galectin-3 acts as a toll-like receptor 4 ligand and contributes to microglial activation. Cell Rep. 10, 1626–1638. Burm, S.M., Zuiderwijk-Sick, E.A., ’t Jong, A.E., van der Putten, C., Veth, J., Kondova, I., and Bajramovic, J.J. (2015). Inflammasome-induced IL-1bsecre- tion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases. J. Neurosci. 35, 678–687. Butovsky, O., Jedrychowski, M.P., Moore, C.S., Cialic, R., Lanser, A.J., Gabriely, G., Koeglsperger, T., Dake, B., Wu, P.M., Doykan, C.E., et al. (2014). Identification of a unique TGF-b-dependent molecular and functional signature in microglia. Nat. Neurosci. 17, 131–143. Chen, Z., Jalabi, W., Shpargel, K.B., Farabaugh, K.T., Dutta, R., Yin, X., Kidd, G.J., Bergmann, C.C., Stohlman, S.A., and Trapp, B.D. (2012). Figure 7. Microglial TET2 Expression in 5xFAD Mice and Alzheimer’s Disease Brain Tissue (A–D) Colocalization analysis of TET2, Iba-1, and Abplaques in the hippocampus of 18-month-old 5xFAD mice (A and B) and three AD subjects (C and D). (E) Details of age, gender, and Braak stage for each AD subject. Data shown in (B) are mean ±SEM of three independent experiments. Arrowheads indicate microglial cells. In (D), each shape represents intensity from some single microglia found either in the white matter (black circles) or inside a plaque (red squares). Statistical analysis used for (B) was two-tailed Student’s t test and for (D) was one-way ANOVA with Sidak’s multiple-comparison test. CTCF, corrected total cell fluorescence. *p < 0.05 and ****p < 0.0001. Scale bar for (A)is10mm and for (C) is 50 mm. See also Figure S7. Cell Reports 29, 697–713, October 15, 2019 711 Lipopolysaccharide-induced microglial activation and neuroprotection against experimental brain injury is independent of hematogenous TLR4. J. Neurosci. 32, 11706–11715. Cho, S.-H., Chen, J.A., Sayed, F., Ward, M.E., Gao, F., Nguyen, T.A., Krabbe, G., Sohn, P.D., Lo, I., Minami, S., et al. (2015). SIRT1 deficiency in microglia contributes to cognitive decline in aging and neurodegeneration via epigenetic regulation of IL-1b. J. Neurosci. 35, 807–818. Cogswell, J.P., Godlevski, M.M., Wisely, G.B., Clay, W.C., Leesnitzer, L.M., Ways, J.P., and Gray, J.G. (1994). NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site. J. Immunol. 153, 712–723. Creyghton, M.P., Cheng, A.W., Welstead, G.G., Kooistra, T., Carey, B.W., Steine, E.J., Hanna, J., Lodato, M.A., Frampton, G.M., Sharp, P.A., et al. (2010). Histone H3K27ac separates active from poised enhancers and predicts developmental state. Proc. Natl. Acad. Sci. U S A 107, 21931–21936. Cull, A.H., Snetsinger, B., Buckstein, R., Wells, R.A., and Rauh, M.J. (2017). Tet2 restrains inflammatory gene expression in macrophages. Exp. Hematol. 55, 56–70.e13. de la Rica, L., Deniz, O ¨., Cheng, K.C.L., Todd, C.D., Cruz, C., Houseley, J., and Branco, M.R. (2016). TET-dependent regulation of retrotransposable elements in mouse embryonic stem cells. Genome Biol. 17, 234. Deierborg, T. (2013). Preparation of primary microglia cultures from postnatal mouse and rat brains. In Microglia. Methods in Molecular Biology (Methods and Protocols), Volume 1041, B. Joseph and J. Venero, eds. (Humana Press). Doulias, P.-T., Tenopoulou, M., Greene, J.L., Raju, K., and Ischiropoulos, H. (2013). Nitric oxide regulates mitochondrial fatty acid metabolism through reversible protein S-nitrosylation. Sci. Signal. 6, rs1. Dzitoyeva, S., Chen, H., and Manev, H. (2008). Effect of aging on 5-hydroxy- methylcytosine in brain mitochondria. Neurobiol. Aging 86, 3279–3288. Fellner, L., Irschick, R., Schanda, K., Reindl, M., Klimaschewski, L., Poewe, W., Wenning, G.K., and Stefanova, N. (2013). Toll-like receptor 4 is required for a-synuclein dependent activation of microglia and astroglia. Glia 61, 349–360. Galva ´n-Pen ˜a, S., and O’Neill, L.A.J. (2014). Metabolic reprograming in macrophage polarization. Front. Immunol. 5, 420. Ganeshan, K., and Chawla, A. (2014). Metabolic regulation of immune responses. Annu. Rev. Immunol. 32, 609–634. Hanisch, U.-K.K., and Kettenmann, H. (2007). Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci. 10, 1387–1394. Hornedo-Ortega, R., A ´lvarez-Ferna ´ndez, M.A., Cerezo, A.B., Richard, T., Troncoso, A.M.A., and Garcia-Parrilla, M.A.C. (2016). Protocatechuic acid: inhibition of fibril formation, destabilization of preformed fibrils of amyloid-band a-synuclein, and neuroprotection. J. Agric. Food Chem. 64, 7722–7732. Ichiyama, K., Chen, T., Wang, X., Yan, X., Kim, B.S., Tanaka, S., Ndiaye-Lobry, D., Deng, Y., Zou, Y., Zheng, P., et al. (2015). The methylcytosine dioxygenase Tet2 promotes DNA demethylation and activation of cytokine gene expression in T cells. Immunity 42, 613–626. Impellizzeri, D., Ahmad, A., Di Paola, R., Campolo, M., Navarra, M., Esposito, E., and Cuzzocrea, S. (2015). Role of Toll like receptor 4 signaling pathway in the secondary damage induced by experimental spinal cord injury. Immunobiology 220, 1039–1049. Janova, H., Bo ¨ttcher, C., Holtman, I.R., Regen, T., van Rossum, D., Go ¨tz, A., Ernst, A.S., Fritsche, C., Gertig, U., Saiepour, N., et al. (2016). CD14 is a key organizer of microglial responses to CNS infection and injury. Glia 64, 635–649. Kaikkonen, M.U., Spann, N.J., Heinz, S., Romanoski, C.E., Allison, K.A., Stender, J.D., Chun, H.B., Tough, D.F., Prinjha, R.K., Benner, C., and Glass, C.K. (2013). Remodeling of the enhancer landscape during macrophage activation is coupled to enhancer transcription. Mol. Cell 51, 310–325. Kelly, B., and O’Neill, L.A. (2015). Metabolic reprogramming in macrophages and dendritic cells in innate immunity. Cell Res. 25, 771–784. Keren-Shaul, H., Spinrad, A., Weiner, A., Matcovitch-Natan, O., Dvir-Sztern- feld, R., Ulland, T.K., David, E., Baruch, K., Lara-Astaiso, D., Toth, B., et al. (2017). A unique microglia type associated with restricting development of Alzheimer’s disease. Cell 169, 1276–1290.e17. Kovarik, P., Castiglia, V., Ivin, M., and Ebner, F. (2016). Type I interferons in bacterial infections: A balancing act. Front. Immunol. 7, 652. Krasemann, S., Madore, C., Cialic, R., Baufeld, C., Calcagno, N., El Fatimy, R., Beckers, L., O’Loughlin, E., Xu, Y., Fanek, Z., et al. (2017). The TREM2-APOE pathway drives the transcriptional phenotype of dysfunctional microglia in neurodegenerative diseases. Immunity 47, 566–581.e9. Krueger, F., and Andrews, S.R. (2011). Bismark: a flexible aligner and methylation caller for Bisulfite-Seq applications. Bioinformatics 27, 1571–1572. Lambertsen, K.L., Biber, K., and Finsen, B. (2012). Inflammatory cytokines in experimental and human stroke. J. Cereb. Blood Flow Metab. 32, 1677–1698. Landel, V., Baranger, K., Virard, I., Loriod, B., Khrestchatisky, M., Rivera, S., Benech, P., and Fe ´ron, F. (2014). Temporal gene profiling of the 5XFAD transgenic mouse model highlights the importance of microglial activation in Alzheimer’s disease. Mol. Neurodegener. 9,33. London, A., Cohen, M., and Schwartz, M. (2013). Microglia and monocytederived macrophages: functionally distinct populations that act in concert in CNS plasticity and repair. Front. Cell. Neurosci. 7,34. Luu, K., Greenhill, C.J., Majoros, A., Decker, T., Jenkins, B.J., and Mansell, A. (2014). STAT1 plays a role in TLR signal transduction and inflammatory responses. Immunol. Cell Biol. 92, 761–769. Malik, M., Parikh, I., Vasquez, J.B., Smith, C., Tai, L., Bu, G., LaDu, M.J., Fardo, D.W., Rebeck, G.W., and Estus, S. (2015). Genetics ignite focus on microglial inflammation in Alzheimer’s disease. Mol. Neurodegener. 10,52. Mathys, H., Adaikkan, C., Gao, F., Young, J.Z., Manet, E., Hemberg, M., De Jager, P.L., Ransohoff, R.M., Regev, A., and Tsai, L.H. (2017). Temporal tracking of microglia activation in neurodegeneration at single-cell resolution. Cell Rep. 21, 366–380. Matt, S.M., Lawson, M.A., and Johnson, R.W. (2016). Aging and peripheral lipopolysaccharide can modulate epigenetic regulators and decrease IL-1b promoter DNA methylation in microglia. Neurobiol. Aging 47, 1–9. McCloy, R.A., Rogers, S., Caldon, C.E., Lorca, T., Castro, A., and Burgess, A. (2014). Partial inhibition of Cdk1 in G 2 phase overrides the SAC and decouples mitotic events. Cell Cycle 13, 1400–1412. McDonough, A., Lee, R.V., Noor, S., Lee, C., Le, T., Iorga, M., Phillips, J.L.H., Murphy, S., Mo ¨ller, T., and Weinstein, J.R. (2017). Ischemia/reperfusion induces interferon stimulated gene expression in microglia. J. Neurosci. 37, 8292–8308. Medzhitov, R., and Horng, T. (2009). Transcriptional control of the inflammatory response. Nat. Rev. Immunol. 9, 692–703. Meunier, E., Dick, M.S., Dreier, R.F., Sch€ urmann, N., Kenzelmann Broz, D., Warming, S., Roose-Girma, M., Bumann, D., Kayagaki, N., Takeda, K., et al. (2014). Caspase-11 activation requires lysis of pathogen-containing vacuoles by IFN-induced GTPases. Nature 509, 366–370. Mi, Y., Gao, X., Dai, J., Ma, Y., Xu, L., and Jin, W. (2015). A novel function of TET2 in CNS: Sustaining neuronal survival. Int. J. Mol. Sci. 16, 21846–21857. Moran-Crusio, K., Reavie, L., Shih, A., Abdel-Wahab, O., Ndiaye-Lobry, D., Lobry, C., Figueroa, M.E., Vasanthakumar, A., Patel, J., Zhao, X., et al. (2011). Tet2 loss leads to increased hematopoietic stem cell self-renewal and myeloid transformation. Cancer Cell 20, 11–24. Nishizawa, T., Kanter, J.E., Kramer, F., Barnhart, S., Shen, X., Vivekanandan- Giri, A., Wall, V.Z., Kowitz, J., Devaraj, S., O’Brien, K.D., et al. (2014). Testing the role of myeloid cell glucose flux in inflammation and atherosclerosis. Cell Rep. 7, 356–365. Noppert, S.J., Fitzgerald, K.A., and Hertzog, P.J. (2007). The role of type I interferons in TLR responses. Immunol. Cell Biol. 85, 446–457. Oakley, H., Cole, S.L., Logan, S., Maus, E., Shao, P., Craft, J., Guillozet-Bon- gaarts, A., Ohno, M., Disterhoft, J., Van Eldik, L., et al. (2006). Intraneuronal b-amyloid aggregates, neurodegeneration, and neuron loss in transgenic mice with five familial Alzheimer’s disease mutations: potential factors in amyloid plaque formation. J. Neurosci. 26, 10129–10140. 712 Cell Reports 29, 697–713, October 15, 2019 Orihuela, R., McPherson, C.A., and Harry, G.J. (2016). Microglial M1/M2 polarization and metabolic states. Br. J. Pharmacol. 173, 649–665. Park, G., Tan, J., Garcia, G., Kang, Y., Salvesen, G., and Zhang, Z. (2016). Regulation of Histone Acetylation by Autophagy in Parkinson Disease. J. Biol. Chem. 291, 3531–3540. Perry, V.H., and Holmes, C. (2014). Microglial priming in neurodegenerative disease. Nat. Rev. Neurol. 10, 217–224. Phipps, A.J., Vickers, J.C., Taberlay, P.C., and Woodhouse, A. (2016). Neurofilament-labeled pyramidal neurons and astrocytes are deficient in DNA methylation marks in Alzheimer’s disease. Neurobiol. Aging 45, 30–42. Pickrell, A.M., and Youle, R.J. (2015). The roles of PINK1, parkin, and mitochondrial fidelity in Parkinson’s disease. Neuron 85, 257–273. Ransohoff, R.M. (2016). How neuroinflammation contributes to neurodegeneration. Science 353, 777–783. Reed-Geaghan, E.G., Savage, J.C., Hise, A.G., and Landreth, G.E. (2009). CD14 and toll-like receptors 2 and 4 are required for fibrillar Abeta-stimulated microglial activation. J. Neurosci. 29, 11982–11992. Rodrı ´guez-Prados, J.-C., Trave ´s, P.G., Cuenca, J., Rico, D., Aragone ´s, J., Martı ´n-Sanz, P., Cascante, M., and Bosca ´, L. (2010). Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation. J. Immunol. 185, 605–614. Ruiz-Garcı ´a, A., Monsalve, E., Novellasdemunt, L., Navarro-Sabate ´, A., Manzano, A., Rivero, S., Castrillo, A., Casado, M., Laborda, J., Bartrons, R., and Dı ´az-Guerra, M.J. (2011). Cooperation of adenosine with macrophage Toll-4 receptor agonists leads to increased glycolytic flux through the enhanced expression of PFKFB3 gene. J. Biol. Chem. 286, 19247–19258. Schafer, D.P., Lehrman, E.K., Kautzman, A.G., Koyama, R., Mardinly, A.R., Yamasaki, R., Ransohoff, R.M., Greenberg, M.E., Barres, B.A., and Stevens, B. (2012). Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner. Neuron 74, 691–705. Shen, X., Burguillos, M.A., Osman, A.M., Frijhoff, J., Carrillo-Jime ´nez, A., Kanatani, S., Augsten, M., Saidi, D., Rodhe, J., Kavanagh, E., et al. (2016). Glioma-induced inhibition of caspase-3 in microglia promotes a tumor-sup- portive phenotype. Nat. Immunol. 17, 1282–1290. Siegfried, A., Berchtold, S., Manncke, B., Deuschle, E., Reber, J., Ott, T., Weber, M., Kalinke, U., Hofer, M.J., Hatesuer, B., et al. (2013). IFIT2 is an effector protein of type I IFN-mediated amplification of lipopolysaccharide (LPS)-induced TNF-asecretion and LPS-induced endotoxin shock. J. Immunol. 191, 3913–3921. Stifter, S.A., and Feng, C.G. (2015). Interfering with immunity: detrimental role of type I IFNs during infection. J. Immunol. 194, 2455–2465. Tannahill, G.M., Curtis, A.M., Adamik, J., Palsson-McDermott, E.M., McGettrick, A.F., Goel, G., Frezza, C., Bernard, N.J., Kelly, B., Foley, N.H., et al. (2013). Succinate is an inflammatory signal that induces IL-1bthrough HIF-1a. Nature 496, 238–242. Taylor, J.M., Minter, M.R., Newman, A.G., Zhang, M., Adlard, P.A., and Crack, P.J. (2014). Type-1 interferon signaling mediates neuro-inflammatory events in models of Alzheimer’s disease. Neurobiol. Aging 35, 1012–1023. Trapnell, C., Pachter, L., and Salzberg, S.L. (2009). TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 25, 1105–1111. Tsagaratou, A., Gonza ´lez-Avalos, E., Rautio, S., Scott-Browne, J.P., Togher, S., Pastor, W.A., Rothenberg, E.V., Chavez, L., La ¨hdesma ¨ki, H., and Rao, A. (2017). TET proteins regulate the lineage specification and TCR-mediated expansion of iNKT cells. Nat. Immunol. 18, 45–53. Ugalde, C.L., Finkelstein, D.I., Lawson, V.A., and Hill, A.F. (2016). Pathogenic mechanisms of prion protein, amyloid-band a-synuclein misfolding: the prion concept and neurotoxicity of protein oligomers. J. Neurochem. 139, 162–180. Van Cauwenberghe, C., Van Broeckhoven, C., and Sleegers, K. (2016). The genetic landscape of Alzheimer disease: clinical implications and perspectives. Genet. Med. 18, 421–430. Vilalta, A., and Brown, G.C. (2014). Deoxyglucose prevents neurodegeneration in culture by eliminating microglia. J. Neuroinflammation 11,58. Voloboueva, L.A., Emery, J.F., Sun, X., and Giffard, R.G. (2013). Inflammatory response of microglial BV-2 cells includes a glycolytic shift and is modulated by mitochondrial glucose-regulated protein 75/mortalin. FEBS Lett. 587, 756–762. Wang, S., Zhang, X., Zhai, L., Sheng, X., Zheng, W., Chu, H., and Zhang, G. (2018). Atorvastatin attenuates cognitive deficits and neuroinflammation induced by Ab 1-42 involving modulation of TLR4/TRAF6/NF-kB Pathway. J. Mol. Neurosci. 64, 363–373. Watson, C.T., Roussos, P., Garg, P., Ho, D.J., Azam, N., Katsel, P.L., Haroutunian, V., and Sharp, A.J. (2016). Genome-wide DNA methylation profiling in the superior temporal gyrus reveals epigenetic signatures associated with Alzheimer’s disease. Genome Med. 8,5. Wu, Y., Dissing-Olesen, L., MacVicar, B.A., and Stevens, B. (2015). Microglia: dynamic mediators of synapse development and plasticity. Trends Immunol. 36, 605–613. W€ ullner, U., Kaut, O., deBoni, L., Piston, D., and Schmitt, I. (2016). DNA methylation in Parkinson’s disease. J. Neurochem. 139 (Suppl 1), 108–120. Yip, P.K., Kaan, T.K., Fenesan, D., and Malcangio, M. (2009). Rapid isolation and culture of primary microglia from adult mouse spinal cord. J. Neurosci. Methods 183, 223–237. Zarruk, J.G., Greenhalgh, A.D., and David, S. (2018). Microglia and macrophages differ in their inflammatory profile after permanent brain ischemia. Exp. Neurol. 301 (Pt B), 120–132. Zhang, Q., Zhao, K., Shen, Q., Han, Y., Gu, Y., Li, X., Zhao, D., Liu, Y., Wang, C., Zhang, X., et al. (2015). Tet2 is required to resolve inflammation by recruiting Hdac2 to specifically repress IL-6. Nature 525, 389–393. Cell Reports 29, 697–713, October 15, 2019 713 STAR+METHODS KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies b-Actin (clone AC-74) Sigma Aldrich Cat.# A5316; RRID:AB_476743 b-Amyloid (clone 4G8) Biolegend Cat.# 800701; RRID:AB_2564633 b-Amyloid (clone BAM-10) Sigma Aldrich Cat.# A3981; RRID:AB_1078153 COX-2 R & D systems Cat.# AF4198; RRID:AB_2229909 Donkey anti-Goat IgG, Alexa Fluor 568 Invitrogen Cat# A-11057; RRID: AB_142581 Donkey anti-Rabbit IgG, Alexa Fluor 488 Invitrogen Cat# A-21206; RRID: AB_141708 Donkey anti-Mouse IgG, CF633 Biotium Cat# 20124; RRID: AB_10853607 Goat Anti-Mouse Immunoglobulins/HRP (affinity isolated) Dako (Agilent) Cat# P044701-2; RRID: AB_2617137 Goat Anti-Rabbit Immunoglobulins/HRP (affinity isolated) Dako (Agilent) Cat.# P044801-2; RRID: AB_2617138 Histone-3 (H3) Abcam Cat.# ab1791; RRID:AB_302613 H3K4me1 Diagenode Cat.# C15410194; RRID:AB_2637078 H3K27ac Diagenode Cat.# C15410196; RRID:AB_2637079 Iba-1 Abcam Cat.# ab5076; RRID:AB_2224402 Iba-1 Wako Cat.# 019-19741; RRID:AB_839504 NF-kB p65 (C-20) Santa Cruz Biotech. Cat.# sc-372; RRID:AB_632037 NOS2 (M-19) Santa Cruz Biotech. Cat.# sc-650; RRID:AB_631831 TET2 Abcam Cat.# ab94580; RRID:AB_10887588 TET2 Abcam Cat.# ab124297; RRID:AB_2722695 Biological Samples Human Temporal lobes belonging to AD patients University Hospital Virgen del Rocio, Seville (Spain) A17-8, A14-78, A12-103 Chemicals, Peptides, and Recombinant Proteins LPS (from Escherichia coli, serotype 026:B6), -in vitro studies-. Sigma Aldrich Cat.# L8274 LPS (from Salmonella abortus equi S-form), -in vivo studies-. Enzo LifeSciences Cat.# ALX-581-009-L001 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat.# L3000015 TRI ReagentSigma Aldrich Cat.# T9424 Autofluorescence Eliminator Reagent Millipore Cat.# 2160 RevertAid First Strand cDNA Synthesis Kit ThermoFisher Scientific Cat.# K1622 MESA BLUE qPCR 2X MasterMix Plus for SYBREurogentec Cat.# 05-SY2X-03+WOUB Potassium perruthenate(VII), 97% (KRuO 4 ) Alfa Aesar Cat. # 11877.03 Micro Bio-Spin Size Exclusion Spin Columns Bio-Rad Cat.# Micro Bio-SpinColumns with Bio-GelP-XX Target Retrieval Solution, Citrate pH 6.1 (10x) Agilent Cat.# S1699 Fluoromount-G SouthernBiotech Cat.# 0100-01 Seahorse XF24 Cell Culture Microplates Agilent Cat.# 0100-01100882-004 BD Cell-Tak BD Biosciences Cat.# 354240 Seahorse Bioscience XF Calibrant Agilent Cat.# 100840-000 Seahorse XF assay media Agilent Cat.# 102365-100 Oligomycin Sigma-Aldrich Cat.# 75351 FCCP Sigma-Aldrich Cat.# C2920 (Continued on next page) e1 Cell Reports 29, 697–713.e1–e8, October 15, 2019 Continued REAGENT or RESOURCE SOURCE IDENTIFIER Rotenone Sigma-Aldrich Cat.# R8875 Antimycin A Sigma-Aldrich Cat.# A8674 Human recombinant a-synuclein monomers Alexo Tech AB Cat.# AS-600-XX Siliconized Low-Retention Microcentrifuge Tubes (Fisherbrand) Fisher Scientific Cat.# 2.0MLGRD FLTP LW RT Di(N-succinimidyl) glutarate (DSG) R97.0% (CHN) Sigma-Aldrich Cat.# 80424 Formaldehyde Solution, 16%, Fisher Scientific Uk Ltd Cat.# 10751395 GeneJET PCR Purification Kit ThermoFisher Scientific Cat.# K0701 Dynabeads Protein G for Immunoprecipitation ThermoFisher Scientific Cat.# 10003D 20-deoxycytidine Berry & Associates Cat.# PY 7216 20-deoxyguanosine Berry & Associates Cat.# PR 3452 C5-hydroxymethyl-20-deoxycytidine Berry & Associates Cat.# PR 7588 C5-methyl-20-deoxycytidine (5-mC) Carbosynth Cat.# ND06242 QuickExtract DNA Extraction solution Epicenter Cat.# QE09050 MyTaq Red DNA Polymerase Bioline Cat.# BIO-211XX Amyloid b-Protein (1-42) (HFIP-treated) Bachem Cat.# 4090148.XXXX Bovine serum albumin (BSA) Sigma-Aldrich Cat.# A2153 Critical Commercial Assays Dynabeads mRNA DIRECT Purification Kit ThermoFisher Scientific Cat.# 61011 ScriptSeq Complete Gold Kit Epicenter Cat. # BEP1224 EpiTect Bisulfite Kits QIAGEN Cat. # 59104 eBioscience Annexin V-FITC Apoptosis Detection Kit ThermoFisher Scientific Cat.# BMS500FI-XXX CellTiter-GloLuminescent Cell Viability Assay Promega Cat.# G7570 Deposited Data Murine BV2 RNA seq data (Raw data) This paper GEO: GSE105155 Experimental Models: Cell Lines Mouse: BV2. Passage %25 (Female) Bertrand Joseph0s lab (Shen et al., 2016) RRID:CVCL_0182 Human: CHME3 (also known as HMC3). Passage %25 (Undetermined sex) ATCC ATCCCRL-3304; RRID:CVCL_II76 Experimental Models: Organisms/Strains Mouse: 5xFAD: B6. SJL-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax) (Male) The Jackson Laboratory Cat.# 34840-JAX Mouse: TET2 floxed/floxed : B6;129STet2tm1.1Iaai/ J (Male) The Jackson Laboratory Cat.# 017573 Mouse: CX3CR1 CreERT2/WT : B6.129P2(Cg) Cx3cr1tm2.1(cre/ERT)Litt/WganJ (Male) The Jackson Laboratory Cat.# 021160 Rat: Wistar IGS (Male) Charles River Cat.# Crl:WI Mouse: CD-1IGS (Male) Charles River Cat.# Crl:CD1(ICR) Oligonucleotides See Table S1 (For primer list for RT-qPCR) This paper N/A See Table S2 (For primer list for ChIP) This paper N/A See Table S3 (For primers list for Ox-Bs sequencing) This paper N/A siGENOME Non-Targeting siRNA #2 Dharmacon Cat.# D-001210-02-xx SilencerSelect Pre-Designed siRNA-Tet2 Life Technologies Cat.# S103016 Flox Tet2 (Forward primer for genotyping) AAGAATTGCTACAGGCCTGC This paper Sequence obtained from (Moran-Crusio et al., 2011) (Continued on next page) Cell Reports 29, 697–713.e1–e8, October 15, 2019 e2 LEAD CONTACT AND MATERIALS AVAILABILITY This study did not generate new unique reagents. Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Miguel Angel Burguillos ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines and siRNA Transfection Human CHME3 (undetermined sex) and murine microglial BV2 (female) cell line were cultured as described in Shen et al. (2016). Briefly, the cells were maintained in 10% fetal calf serum (FCS) in DMEM and reduced to 5% FCS during the experiments supplemented with penicillin/streptomycin (100 U/ml and 100 mg/ml respectively). Transfection of BV2 cells was carried out using Lipofectamine 3000 (Invitrogen) following the manufacturer’s instructions. Animals and Subject tissue 18-month-old male B6. SJL-Tg (APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax), called 5xFAD (generously provided by Dr. Javier Vitorica) and 8 to 12-week-old male B6;129STet2tm1.1Iaai/J, called TET2 floxed/floxed , B6.129P2(Cg) Cx3cr1tm2.1(cre/ERT) Litt/WganJ, called CX3CR1 CreERT2/WT (both Jackson Laboratories), and CD-1IGS mice and Wistar IGS rats (both Charles River) were kept under controlled light (12-hr light/dark cycles) and temperature (22C-24C) and with free access of food and water. For the generation of primary microglia cultures, both male and female pups were used. For the LPS intraperitoneal experiment in mice, we followed the procedure detailed in Bodea et al. (2014). Briefly, injections in Tet2 flox/flox Cx3cr1 Cre/WT and Tet2 flox/flox Cx3cr1 WT/WT mice consisted in four daily injections with 1 mg per g of body mass per day of LPS or vehicle (PBS), and the analysis was performed on the fifth day since the start of the treatment (LPS in vivo experiments were carried out with LPS from Salmonella abortus equi while for the in vitro experiments, we used LPS from Escherichia coli, serotype 026:B6). All experiments conducted with animals were previously approved by the different Ethical Committee for Experimental Research from University of Seville and University of Cambridge and fulfilled the requirements for experimental animal research in accordance with in accordance with the UK Animals (Scientific Procedures) Act (1986) and the Guidelines of the European Union Council (86/609/EU) and the Spanish and UK regulations (BOE 34/11370–421, 2013) for the use of laboratory animals. Continued REAGENT or RESOURCE SOURCE IDENTIFIER Flox Tet2 (Reverse primer for genotyping) TTCTTTAGCCCTTGCTGAGC This paper Sequence obtained from (Moran-Crusio et al., 2011) Deleted TET2 (LoxP3R for genotyping) TAGAGGGAGGGGGCATAAGT This paper Sequence obtained from (Moran-Crusio et al., 2011) Software and Algorithms Statgraphics Centurion XVII Statgraphics RRID:SCR_015248 Trim Galore https://www.bioinformatics.babraham. ac.uk/projects/trim_galore/ RRID:SCR_011847 Bismark https://www.bioinformatics.babraham. ac.uk/projects/bismark/ RRID:SCR_005604 Tophat https://ccb.jhu.edu/software/tophat/ index.shtml RRID:SCR_013035 Seqmonk https://www.bioinformatics.babraham. ac.uk/projects/seqmonk/ RRID:SCR_001913 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_016533 topGO http://bioconductor.org/packages/ release/bioc/html/topGO.html RRID:SCR_014798 Fiji ImageJ http://fiji.sc/ RRID:SCR_002285 GraphPad Prism 7 https://www.graphpad.com/scientificsoftware/prism/ RRID:SCR_002798 ZEN Zeiss software (version 14.0.18.201) https://www.zeiss.com/microscopy/us/ products/microscope-software/zen. html#introduction RRID:SCR_013672 e3 Cell Reports 29, 697–713.e1–e8, October 15, 2019 Human brain tissue was obtained from 1 male (subject 3) and 2 females (subject 1 and 2) subjects who suffered and died from AD. The region investigated was the Temporal lobe. All sections were stained with hematoxylin and eosin and with antibodies against TET2, Iba-1 and Ab. They were microscopically reviewed for verification of pathology. Before the investigation, the entire collection of brain sections, were subjected to a neuropathological whole-brain analysis for clinical diagnostic purposes, according to routine procedures at the University Hospital Virgen del Rocio, Seville (Spain). The project procedures involving human brain tissue was approved by the Regional Ethical Review Board, reference number C.P. 33170015 - C.I. 0422-N-17. METHOD DETAILS Generation of microglia Tet2-deficient mice Tet2 flox/flox C57BL/6 mice with the Tet2 allele floxed at exon 3 (Jackson Laboratories, B6;129S-Tet2tm1.1Iaai/J) and C57BL/6 mice containing a Cre recombinase under the control of Cx3cr1 promoter and enhancer elements (Jackson Laboratories, B6.129P2(Cg)-Cx3cr1tm2.1(cre/ERT)Litt/WganJ), were crossed to generate Tet2 flox/flox ;Cx3Cr1 Cre/WT (experimental mice) and Tet2 flox/flox ;Cx3Cr1 WT/WT (control mice). The genotype of Tet2 flox/flox ;Cx3Cr1 WT/WT and Tet2 flox/flox ;Cx3Cr1 Cre/WT mice was determined by analysis of DNA extracted from the fingers using a QuickExtract (Epicenter) and amplified with MyTaq Red DNA Polymerase (Bioline). The deletion of the Tet2 gene was determined by analysis of DNA extracted from isolated primary microglia using a QuickExtract DNA Extraction solution (Epicenter) and amplified with MyTaq Red DNA Polymerase (Bioline). The PCR consisted of 94C for 1min, then 35 cycles with denaturation at 95C for 15 s, annealing at 58C for 15 s, and elongation at 72C for 10 s. The primer sequences used were obtained from a previous study (Moran-Crusio et al., 2011). Primary microglia cell culture preparations Rat glial cultures were prepared from postnatal day 5-7 rat cerebral hemispheres as described previously (Bal-Price and Brown, 2001). Cortical hemispheres were dissected and meninges, blood vessels as well as white matter were removed. Tissue was transferred to pre-warmed HBSS containing 0.17% trypsin (37C), chopped thoroughly and incubated for 15-20 min.s at 37C, 5% CO 2 . Supernatant was removed and remaining trypsin was neutralized by addition of an equal amount of deoxyribonuclease I solution (0.02 mg/ml) in glial culture medium: DMEM supplemented with 10% FCS and antibiotics gentamicin (50 mg/ml) or penicillin/streptomycin (100 U/ml and 100 mg/ml respectively). Tissue was mechanically dissociated by repeated trituration through fire-polished glass Pasteur pipettes of two decreasing aperture sizes; and the suspension was centrifuged at 150 3g for 7 min.s at room temperature (RT). The pellet was resuspended in glial culture medium, and this suspension was sequentially passed through a 100 mm and 40 mm cell-strainers (BD Biosciences). Cells were plated at a density of 10 5 cells/cm 2 onto 24-well plates or into T75 cell culture flasks (Nunc) that were coated with poly-L-lysine (0.0005% in PBS) for at least 30 min at RT. After 24 h plates or flasks were carefully tapped to dislodge sedimentary cell debris, and medium was exchanged. Cultures were maintained at 37C in a humidified atmosphere of 5% CO 2 / 95% O 2 . Cells were stimulated after 7-9 days in vitro (DIV). Pure microglial cultures were obtained from mixed glial cultures (7-9 DIV). Culture flasks were gently vortexed for 1 min., supernatant containing detached microglial cells was collected and centrifuged at 150 3g for 7 min at RT. Microglia cells were resuspended in conditioned glial medium mixed with fresh glial medium (at the ratio 2:1) and plated at a density of 2.5-5 310 4 cells/cm 2 onto 6- or 24-well plates (Nunc) coated with 0.0005% poly-L-lysine. Primary adult murine microglia cultures from 10-12-week old adult mouse cortices were carried out as previously described (Yip et al., 2009). Briefly, adult CD1 male mice were deeply anaesthetized with sodium pentobarbital, then perfused with saline to remove peripheral monocytes/macrophages. The cortical region was dissected out and placed into ice-cold Hanks Balanced Salt Solution (HBSS) media. The meninges were removed prior cutting into longitudinally segments using a tissue chopper. After digestion in papain followed by dissociation, the cell suspension was passed through a 70 mm sieve. The cells were plated into each well containing an ethanol-cleaned coverslip. After 2 h, unattached cells were washed away with DFP media (containing Dulbecco’s modified eagle medium (DMEM)), 15% heat-inactivated fetal bovine serum (HI-FBS) and penicillin-streptomycin; 100 IU/ml), and allowed to incubate overnight at 37C and 5% CO 2 and were used the next following day for experimental studies. Primary postnatal mouse microglial cells were prepared from P1-4 experimental and control mouse brain following described protocol (Deierborg, 2013). Postnatal P1-4 mice were decapitated and brains were carefully dissected removing all the meninges and the cortices were washed in ice-cold Ca 2+ - and Mg 2+ -free Hanks’ buffered salt solution (HBSS; Biowest). Later on, they were minced, and resuspended in ice-cold HBSS. After being washed, tissues were incubated for 15 min in HBSS containing 0.1% trypsin and DNase 0.05%, and resuspended in DMEM medium containing 10% FBS and 1% P/S (DMEM high glucose, Biowest). Cells were cultivated in a T25 flask. Medium was replaced completely after 1 day seeding and 7 days after seeding. Deletion was induced upon 4-OH-tamoxifen treatment for 48 h before harvesting of microglia. Microglial cells were harvested from confluent astrocyte monolayers, 14 days after the initial seeding, by tapping the side of the culture flask. These microglial cells found in the medium were plated into 12-well dishes. Experiments were performed 24 h after the final plating. We regularly tested the purity of our primary microglia cell cultures and observed consistently that over 80% of our cultures were positive to Iba-1 staining, and therefore microglia cells. Cell Reports 29, 697–713.e1–e8, October 15, 2019 e4 RT-qPCR analysis Total RNA was extracted using the TRIzol reagent (Sigma Aldrich) following the manufacturer’s instructions. Using the RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, UK), 1 mg of the total RNA was transformed into cDNA. qPCR was performed using the MESA BLUE SYBRAssay (Eurogentec, UK). Results were calculated using delta Ct method and represented as absolute values with arbitrary units. Atp5b and Actb genes were used as housekeeping genes in murine samples, Actb was used as a housekeeping gene in rat samples and PGK1 was used as housekeeping gene in human samples. Immunofluorescence for mouse material 5xFAD mice (18 months old; kindly provided by Dr. Javier Vitorica), a model for Alzheimer disease and LPS intraperitoneally injected mice, were transcardially perfused under deep anesthesia with 4% paraformaldehyde and PBS, pH 7.4. Brains were removed, cryoprotected in sucrose and frozen in isopentane at 15C and serial coronal sections (30 mm thick) were cut with a cryostat, and further processed. Briefly, the tissue was subjected to antigen retrieval (10mM citrate buffer pH 6.0. 80C in a water bath for 30 min). Later on, the brain sections were permeabilized with 1% (v/v) Triton X-100 in PBS for 1 h, and then incubated in 5% (w/v) BSA, 1% Triton X-100 in PBS for 1 h, to prevent unspecific staining. The tissue was then incubated overnight at 4C with the primary antibodies against Ab(1:1000, Sigma-Aldrich), Tet2 (1:250, Abcam), Iba 1 (1:500, Wako) and Cox-2 (1:100 R&D System) and the following day, the brain section was rinsed for 1 h in PBS containing 0.1% Triton X-100. After incubating for 1 h with the corresponding secondary antibodies (1:500; Alexa antibodies, Invitrogen), and rinsed again with PBS containing 0.1% Triton X-100 for 60 min. For staining with Hoechst (1mg/ml; Sigma Aldrich) sections were first washed in PBS containing 0.1% Triton X-100 and then incubated for 5 min. Next, we washed sections 2x10 min in in PBS containing 0.1% Triton X-100. The brain sections were mounted in Glycerol 50% for visualization in an inverted ZEISS LSM 7 DUO confocal laser-scanning microscope using a 63x oil objective with a numerical aperture of 1.3. Images from all experimental groups were obtained at the same day and under equal conditions (laser intensities and photomultiplier voltages). Immunofluorescence for the subject material Brain tissue sections were deparaffinized in xylene (15 min each) followed by two 10-min washes with ethanol 100%, two 10 min washes with ethanol 95% and three 5-min washes with distilled water. Tissue was subjected to heat-induced antigen retrieval with DAKO solution (pH 6.0; DAKO #S1699) for 40 min using a steamer. Subsequently, the tissue was left in the same solution until it reached room temperature. Next, three 10 min washes with TBS, followed by a 10 min TBS-Triton X-100 0.1% (v/v) and a final 10 min TBS were performed. The tissue was immersed in blocking solution (5% donkey serum in TBS-T 0.1%) for 1 h at room temperature). The antibodies were diluted in blocking solution overnight at 4C. The next day the slides were washed 5 times in TBS, incubated 1 h with the corresponding secondary antibodies, followed by five 10 min TBS washes. Finally, the tissue was processed following manufacturer’s recommendation with Autofluorescence Eliminator Reagent (Millipore Catalogue number 2160) and mounted with Mount slides in Fluoromount-G (AH Diagnostics #0100-01) for confocal microscopy analysis. Images were acquired by Zeiss LSM700 confocal laser scanning microscope equipped with ZEN Zeiss software (version 14.0.18.201) and processed with Photoshop CC 2017. Fluorescent intensity (CTCF) of Tet2 staining was measured using Fiji ImageJ, as described previously (McCloy et al., 2014) with modifications. In more details, single in-focus planes were captured using x 40 objective. Tet2 staining was converted to grayscale using Photoshop. Using ImageJ, an outline was drawn around the soma of each microglia and values including area and mean intensity were measured, along with 4 background readings from the same field of view. The corrected total cellular fluorescence (CTCF) = Integrated Density – (Area of selected cell (x) Mean fluorescence of background readings). At least 5 different plaques and at least 26 microglia from these plaques or 5 white matter single planes and at least 24 microglia per subject were scored for intensity. All microglia found in the plaques or in the white matter plane were scored. Areas where chosen based on Abstaining in random. Analysis and plot was performed using GraphPad Prism 7. RNA-seq mRNA-seq libraries were prepared from 1 mg of total RNA using the Dynabeads mRNA purification kit (ThermoFisher Scientific) and the low input ScriptSeq Complete Gold Kit (Epicenter). Libraries were sequenced on an Illumina NextSeq 500 with single-end 75 bp reads. Reads were trimmed using Trim_galore! v0.3.3 and mapped using Tophat v2.0.9 (Trapnell et al., 2009) to the mm9 genome assembly. Raw read counts for each gene were generated in Seqmonk with the RNA-seq quantitation pipeline. DESeq2 was then used for differential expression analysis and for generating normalized gene expression values. Gene ontology analysis was performed using the R package topGO. e5 Cell Reports 29, 697–713.e1–e8, October 15, 2019 OxBS-seq Deep sequencing of PCR products from BS- and oxBS-converted DNA was performed as previously described (de la Rica et al., 2016). Briefly, precipitated DNA (without glycogen) was resuspended in water and further purified using Micro Bio-Spin columns (Bio-Rad), after which half of the DNA was oxidised with 15 mM KRuO4 (Alfa Aesar) in 0.5 M NaOH for 1 h. Following bisulfite conversion of both DNA fractions with the EpiTect Bisulfite kit (QIAGEN), a two-step PCR amplification was used: a first PCR amplifies the region of interest and adds part of the sequencing adaptors; a second PCR on pooled amplicons then completes the adaptors and adds sample barcodes, allowing for multiplexing. Paired-end sequencing of pooled samples was done using an Illumina MiSeq. Data were aligned using Bismark (Krueger and Andrews, 2011) to a custom genome containing the amplicon sequences; only CpGs covered by at least 100 reads were used to calculate 5mC/5hmC levels. Measurements of OCR and ECAR Real-time measurements of oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) were performed on a Seahorse XF-24 extracellular flux Analyzer (Seahorse Biosciences) according to manufacturer’s instructions and as previously described (Voloboueva et al., 2013). BV2 treated cells were detached with the pipette after treatment and re-seeded 30,000 cells/well to precoated Seahorse XF-24 plates, are for metabolic analysis. The XF24 cell culture microplate was coated with BD Cell-Tak (BD Biosciences, cat# 354240). The day before the metabolic assay, 1 mL of Seahorse Bioscience XF Calibrant (pH 7.4) was added to each well of the XF-24 utility plate, position the sensor cartridge on top of the utility plate, and incubated at 37C overnight. BD Cell-Tak solution was prepared by adding 73 mL of 1.5 mg/ml stock concentration BD Cell-Tak to 1.1 mL sterile H 2 O into a final concentration of 0.1 mg/ml. After that, 20 mL of the VD Cell-Tak solution was added to each well of a XF-24 cell culture plate, followed by 40 mL of 0.1M NaHCO 3 (pH 8.0) to each well to neutralize and promote BD Cell-Tak adsorption to the microplate. The microplate was incubated at 37C minimum for 1 hour. Seahorse XF assay media (supplemented with 25 mM glucose, 2 mM glutamine and 1 mM sodium pyruvate) was prewarmed to 37C prior to use. After cell count, cells were centrifuged at 300 g for 5 min and resuspend in the supplemented XF assay media at 3000 cells/ml. Each well of the Cell-Tak coated XF-24 cell culture microplate was washed with 200 mL of sterile water and 100 mL of cell suspension added, followed by centrifugation of the microplate at 700 g for 5 min to facilitate cell attachment. Cells were incubated at 37C for at least 1 h to allow cell attachment. The different drugs were added automatically during measurement, after establishing baseline of oxygen consumption rates. We measured the OCR and ECAR in response to sequential treatment with the ATPase inhibitor oligomycin (2.5 mM), the uncoupling agent FCCP (1 mM) and the electron-trans- port-chain inhibitors rotenone (2 mM) and Antimycin A (1 mM). Measurement of extra-cellular glucose Glucose measurement was determined in the Department of Clinical Biochemistry, Royal London Hospital, UK. Briefly, medium from BV2 siControl and siTET2 cells alone or after LPS treatment was centrifuged and the supernatant was analyzed using the AccutrendPlus System (Roche) according to the manufacturer’s instructions. Preparation of a-synuclein and Ab-oligomers For the preparation of a-synuclein fibrils, a-synuclein monomers were purchased from (Alexo Tech AB, Sweden). Briefly, a stock solution of a-synuclein (140 mM final concentration) was incubated for 6 days at 37C, under continuous agitation as described previously in Hornedo-Ortega et al. (2016). For the preparation of Aboligomers, 1mg of HFIP-Ab1-42 (Bachem, H7442.1000) was carefully mix through pipetting in 200 mL of DMSO. Later on, 9800 mL of PBS was added to get a final concentration of 22 mM and it was aliquoted in siliconized Low-Retention Microcentrifuge Tubes (Fisherbrand TM ) and incubated at 37C for 3h. After that aliquots were kept frozen at 80C. Cells were incubated in the presence of a-synuclein fibrils and Ab-oligomers to a final concentration of 5mM and 2mM respectively. Immunoblotting All cell extracts were processed for immunoblotting with a SDS-polyacrylamide gel electrophoresis as described previously (Burguillos et al., 2015). Briefly, Laemmli’s loading buffer (100 ml/10 6 cells) was added to harvested cells and samples were boiled for 3 min. Thirty ml of protein extracts were resolved on 8, 0r 12% SDS polyacrylamide gel at 150 V and transblotted onto nitrocellulose membranes (0.2 mm) for 2 h at 200 mA. Membranes were blocked overnight in a buffer (50 mM Tris, pH 7.5, 500 mM NaCl) supplemented by 5% non-fat milk powder and probed with primary antibody for overnight, in blocking solution with 1% Bovine serum albumin, followed by the incubation with secondary antibody for 1 h at room temperature. After repeated washing in PBS bands were visualized by ECL according to the manufacturer’s instruction. A complete list of primary antibodies can be found in the Key resources table. b-actin antibody (Sigma-Aldrich) was used to verify equal loading of the gel. Secondary horseradish peroxidase-conjugated anti-rab- bit and anti-mouse antibodies were obtained from Dako. Microglia cell counting BV2 cell number quantification was performed using a NucleoCounterNC-100 (Chemometec) according to manufacturer’s instructions. Cell Reports 29, 697–713.e1–e8, October 15, 2019 e6 Apoptosis determination Apoptosis was quantified using the Annexin V-FITC Determination Kit (eBioscience) according to the manufacturer’s instructions. Briefly, cells medium and the cells were collect in a FACS tube. Annexin V-FITC (25 mg/ml) was added to the cell suspension. The cells were incubated for 10 min in darkness at RT. 1 mg/ml propidium iodide staining solution was then added and FACS was carried out using a BD FACS CANTO II flow cytometer. Cell viability Cell viability was quantified by CellTiter-GloLuminescent Cell Viability Assay according to the manufacturer’s instructions. Detection is based on using the luciferase reaction to measure the amount of ATP from viable cells. The plate used was opaque to limit interference from external light. The intensity of the emitted light due to the degradation of D-Luciferin and ATP by the enzyme Luciferase is proportional to the amount of free ATP present at that moment in the cells. Chromatin Immunoprecipitation BV2 cells were treated with 1mg/ml of LPS during 6h. For each histone modification ChIP, the cells were washed with PBS and fixed by 1% formaldehyde for 12 min at RT. For NF-kB ChIP, the cells were first fixed with 2 mM DSG in PBS for 45 min at RT followed by 1% of formaldehyde fixation for 12 min. After stopping the fixation with 0.125 M glycine, the cells were washed with cold PBS and collected by centrifugation. Subsequently, the cells were washed with wash buffer (10 mM HEPES/KOH at pH 7.9, 85 mM KCl, 1mM EDTA, 0.5% IGEPAL) once, lysed with lysis buffer (50 mM Tris at pH 7.4, 1% SDS, 0.5% Empigen, 10 mM EDTA, 1mM PMSF) supplemented by protease inhibitors for 30 min on ice and the chromatin was sonicated to an average size of 300-700 bp. For immunoprecipitation, the soluble chromatin was diluted ten times in dilution buffer (50 mM Tris at pH 8.0, 0.5% NP-40, 0.2 M NaCl and 0.5 mM EDTA) and incubated with 5 mg of antibodies selective for NF-kB p65, H3K27ac, H3K4me1 or TET2 overnight at 4C. The immune complexes were collected with protein G beads for 2 h at 4C, washed with low salt buffer (50 mM Tris at pH 8.0, 0.1% SDS, 1% NP-40, 2 mM EDTA, 0.5% Deoxycholate and 0.15 M NaCl), high salt buffer (50 mM Tris at pH 8.0, 0.1% SDS, 1% NP-40, 2 mM EDTA, 0.5% Deoxycholate and 0.5 M NaCl) and LiCl buffer (50 mM Tris at pH 8.0, 1% NP-40, 2 mM EDTA, 0.5% Deoxycholate and 0.25 M LiCl), respectively. Immunoprecipitates were eluted in 1% SDS and 0.1 M sodium bicarbonate and the crosslinks were reversed overnight. After proteinase K digestion, DNA was extracted using GeneJET PCR purification kit. Immunoprecipitated DNA was analyzed by real time PCR using specific primers Liquid chromatography-mass spectrometry 20-deoxycytidine (dC), 20-deoxyguanosine (dG) and C5-hydroxymethyl-20-deoxycytidine (5-hmC) were purchased from Berry & Associates; C5-methyl-20-deoxycytidine (5-mC) was purchased from CarboSynth. Genomic DNA was digested to nucleosides for a minimum of 9 h at 37C using a digestion enzymatic mix (kind gift from NEB). All samples and standard curve points were spiked with a constant amount of isotope-labeled synthetic nucleosides: 100 fmol of dC* (13C,15N-dC) and dG* (13C,15N-dG) purchased from Silantes, 5 fmol of 5-mC* (d3-5-mC) and 250 amol of 5-hmC* (d2,15N2-5-hmC) obtained from T. Carell (Center for Integrated Protein Science at the Department of Chemistry, Ludwig-Maximilians-Universita ¨tM € unchen, M€ unchen, Germany). The nucleosides were separated on an Agilent RRHD Eclipse Plus C18 2.1 3100 mm 1.8u column by using the HPLC 1290 system (Agilent) and analyzed using Agilent 6490 triple quadrupole mass spectrometer. To calculate the concentrations of individual nucleosides, standard curves representing the ratio of the peak response of known amounts of synthetic nucleosides and the peak response of the isotope-labeled nucleosides were generated and used to convert the peak-area values to corresponding concentrations. The threshold for peak detection is a signal-to-noise (calculated with a peak-to-peak method) above 10. Microglia morphology The proportion of the different microglial morphology was estimated according with the follow classification (see Figure 6, insets): (1) Quiescent microglia with small cell bodies, fine cytoplasmic ramifications, and low to moderate Iba1 expression; (2) microglia with early-stage activation characterized by increased ramification of cytoplasmic processes and cell size, and enhanced Iba1 labeling; (3) Microglia corresponding to next step of activation is characterized by further thickening of processes and retraction of the thinest ones, as well as increased cell body size and Iba1 expression; and finally, (3) amoeboid cells, showing complete retraction of cytoplasmic processes with maintained high levels of Iba1 expression. Images quantification The proportion of microglia in the SN in each LPS experiment experimental group was estimated using cell counter plugin included in Fiji ImageJ (W. Rasband, National Institutes of Health) software. In the SN of the different experimental groups we measured the mean intensity of the specific fluoresce markers (TET2 and COX-2), in Iba1 positive cells. To do that, we performed mask outlined of Iba1 area using exactly the same value of threshold in each image and then, we measured automatically the mean intensity inside of these areas using, again, the Fiji software. e7 Cell Reports 29, 697–713.e1–e8, October 15, 2019