Characterization of Nuclear Microsatellite Markers for Rumex bucephalophorus (Polygonaceae) Using 454 Sequencing

1 of 4 Applications in Plant Sciences 2015 3 ( 12 ): 1500088 Applications in Plant Sciences 2015 3 ( 12 ): 1500088; http://www.bioone.org/loi/apps © 2015 Viruel et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons Attribution License (CC-BY-NC-SA). Ap Applica ti ti ons ons in in Pl Plan t t Scien Scien ces ces The genus Rumex L. (Polygonaceae) includes nearly 200 species mostly distributed in both Europe and North America with an intricate taxonomy ( Talavera et al., 2011 ). Rumex bucephalophorus L. is a Mediterranean-Macaronesian species with mostly annual, hermaphrodite or gynomonoecious, selfincompatible, and anemophilous populations. It shows an enormous heterocarpic diversity, in which up to four different diaspore types have been described ( Talavera et al., 2011 ). Indeed, based on diaspore morphology, the most recent systematic treatment encompassed its variability into four subspecies ( Press, 1988 ): R. bucephalophorus subsp. bucephalophorus (heterocarpic with larger diaspores than in other taxa and with two to three pairs of wide teeth per valve); subsp. canariensis (Steinh.) Rech. f. (homocarpic with entire valves or having four to eight pairs of straight teeth); subsp. gallicus (Steinh.) Rech. f. (heterocarpic with both entire and toothed valves); and subsp. hispanicus (Steinh.) Rech. f. (homocarpic with four to six pairs of uncinated teeth per valve). Additionally, lower taxonomic entities were proposed in two subspecies to describe perennial and suffrutescent populations (subsp. canariensis var. fruticescens (Bornm.) Press) or plants with basal fruits (subsp. gallicus var. subaegaeus Maire; Talavera et al., 2011 ). However, previous molecular attempts based on amplifi ed fragment length polymorphism (AFLP) and internal transcribed spacer (ITS) markers failed at delimiting these taxa ( Talavera et al., 2011 ). Concretely, two subspecies (subsp. gallicus and subsp. hispanicus ) are not clearly distinguished. We have characterized 16 nuclear microsatellite loci from R. bucephalophorus subsp. canariensis and analyzed their transferability into closely related taxa, with the aim of assessing population genetic diversity levels and genetic structure, and delimiting systematic taxa. METHODS AND RESULTS Total DNA was extracted from silica gel–dried leaves using the Invisorb Spin Plant Mini Kit (Invitek, Berlin, Germany) from one individual of R. bucephalophorus subsp. canariensis (Appendix 1). Size-selected microsatellite enrichment was performed following a Dynabeads-based protocol ( Glenn and Schable, 2005 ) that has been successfully applied in other plants ( Sánchez- Robles et al., 2012 ; Jiménez-López et al., 2015 ). Genomic DNA was digested with Rsa I and Bst UI (New England Biolabs, Ipswich, Massachusetts, USA) and enriched for (AC) 12 , (AG) 12 , (AAC) 6 , (AAG) 8 , (AAT) 12 , (ACT) 12 , (ATC) 8 , (AAAG) 6 , (ACCT) 6 , (ACTC) 6 , (AATC) 6 , (ACAG) 6 , (ACTG) 6 , (AAAC) 6 , (AATG) 6 , (AGAT) 8 , (AACT) 8 , (AAGT) 8 , (AAAT) 8 , and (ACAT) 8 . Fragments were sequenced on a 454 Genome Sequencer FLX System (454 Life Sciences, a Roche Company, Branford, Connecticut, USA) at the Savannah River Ecology Laboratory (Aiken, South Carolina, USA; see Abdelkrim et al., 2009 ). The 454 sequencing reads were assembled into contigs using CAP3 at 98% sequence identity and a minimum overlap of 75 bp ( Huang and Madan, 1999 ). Microsatellite repeat arrays were found in 3173 contigs (2206 di-, 416 tri-, and 551 tetranucleotides), from which 451 contained enough fl anking sequences to design primers (191 di-, 117 tri-, and 143 tetranucleotides). Primers were designed with 5 ′ -tails (CAG or M13R; Boutin-Ganache et al., 2001 ; Glenn and Schable, 2005 ) and 5 ′ -PIG-tail (GTTT) to the second primer to promote adenylation ( Brownstein et al., 1996 ). We discarded pairs of primers with high self- and pair product complementary parameters, inadequate product size (upper limit 400 bp), or melting temperature difference higher than 1 ° C, and obtained 157 optimal primers (72 di-, 24 tri-, and 61 tetranucleotides). We tested up to 34 pairs of primers until we obtained a set of 16 polymorphic loci. PCRs were optimized for each locus under the following conditions ( Table 1 ) : an initial denaturation step of 4 min at 95 ° C; followed by 35 cycles of 95 ° C for 30 s, 49–55 ° C for 30 s, and 72 ° C for 60 s, or by a touchdown procedure of 1 Manuscript received 3 August 2015; revision accepted 28 August 2015. This work was supported with Fondo Europeo de Desarrollo Regional (FEDER) funds and grants to M.A. from the Ministerio de Ciencia, Tecnología e Innovación Productiva (MINCyT; CGL2009-08257) and the Ministerio de Economía y Competitividad (MINECO; CGL2012-33270, including postdoctoral grants to J.V. and M.T.). 3 Author for correspondence: [email protected] doi:10.3732/apps.1500088 P RIMER NOTE C HARACTERIZATION OF NUCLEAR MICROSATELLITE MARKERS FOR R UMEX BUCEPHALOPHORUS (POLYGONACEAE) USING 454 SEQUENCING 1 J UAN V IRUEL 2,3 , P EDRO L. ORTIZ 2 , M ONTSERRAT A RISTA 2 , AND M ARÍA T ALAVERA 2 2 Departamento Biología Vegetal y Ecología, Universidad de Sevilla, Avda. Reina Mercedes, 41012 Seville, Spain • Premise of the study: Nuclear microsatellite markers were developed in Rumex bucephalophorus subsp. canariensis (Polygonaceae) to investigate its genetic diversity and structure. • Methods and Results: Sixteen polymorphic microsatellite markers were obtained using 454 next-generation sequencing with di-, tri-, and tetranucleotide repeats. The average number of alleles was 5.688 and 3.813 for R. bucephalophorus subsp. canariensis var. canariensis and var. fruticescens , respectively. Slightly higher levels of mean genetic diversity were found in var. canariensis (expected heterozygosity = 0.600) than in var. fruticescens (expected heterozygosity = 0.514). Cross-amplifi cations in related taxa within R. bucephalophorus showed good amplifi cation and polymorphic patterns. • Conclusions: These 16 novel nuclear microsatellite markers are the fi rst in the genus Rumex and may serve as valuable tools to carry out studies on genetic diversity and structure as well as progeny studies. Key words: heterocarpy; Macaronesian; Mediterranean; Polygonaceae; Rumex bucephalophorus ; simple sequence repeat (SSR). 2 of 4 Applications in Plant Sciences 2015 3 ( 12 ): 1500088 Viruel et al.— Rumex bucephalophorus microsatellites doi:10.3732/apps.1500088 http://www.bioone.org/loi/apps volume of 25 μ L, contained 2.5 μ L of PCR Buffer 10 × , 1 μ L of MgCl 2 (25 mM), 1 μ L of dNTP (10 mM), 0.2 μ L of KAPA Taq DNA polymerase (5 U/ μ L) (Kapa Biosystems, Wilmington, Massachusetts, USA), 1 μ L of primer 21 cycles of 95 ° C for 20 s, 60 ° C for 20 s (decreased 0.5 ° C per cycle), and 72 ° C for 30 s; followed by 21 cycles of 95 ° C for 20 s, 49.5 ° C for 30 s, and 72 ° C for 30 s; and in both cases a fi nal step of 10 min at 72 ° C. PCR reactions, for a total T ABLE 1. Characteristics of 16 microsatellite loci developed in Rumex bucephalophorus subsp. canariensis . Locus Primer sequences (5 ′ –3 ′ ) a Repeat motif T a ( ° C) Allele size range (bp) GenBank accession no. 441 Fm: GGAAACAGCTATGACCAT CACTCGACATCACTCCAATC (AG) 9 TD 49.5 181–193 KT351066 R: GTTT AGCGAATGATGAAGAATGAC 510 Fm: GGAAACAGCTATGACCAT AATGAAGGAAATGACGACTG (AC) 9 52 127–181 KT351068 R: GTTT AGGTCAGTTCGATTGTGTTG 679 Fm: GGAAACAGCTATGACCAT ACTCACACTCACGCATGTC (ACT) 7 49 148–202 KT351064 R: GTTT GTTGATCCTGTCGAATGTTG 1087 F: GTTT ACCGTCCGATAACAATCTAG (ACTC) 6 52 196–204 KT351056 Rm: GGAAACAGCTATGACCAT CTATAAGTATCGTGCGTGTTG 1322 F: GTTT ATTTACATGGTGCGAGAAAG (AG) 10 55 301–403 KT351065 Rm: GGAAACAGCTATGACCAT CACAATGCATGACGTTTAAC 1327 F: G TTTCCACGAGTTGTAACACAC (AC) 12 52 88–153 KT351067 Rm: GGAAACAGCTATGACCAT CTATAAGTATCGTGCGTGTTG 1648 Fc: CAGTCGGGCGTCATCA AATTCGAGCAACAGTAAG (AAAC) 7 52 176–204 KT351061 R: GTTT GGCACCTTAGACACATTCAC 1806 Fm: GGAAACAGCTATGACCAT CCCACACTCTTCTGTCATG (AAC) 15 55 264–294 KT351053 R: GTT TAGAGGCTGCATACAACAAG 1959 F: GTTT GAGTCACAGCCCAAGATTAG (AAC) 7 55 304–340 KT351055 Rc: CAGTCGGGCGTCATCA GGTGGTCGAGAAAGTAGTG 1965 F: GTTT GGCGAGTTATTCCTCTTATG (AAAC) 7 52 160–180 KT351062 Rm: GGAAACAGCTATGACCAT AATCCAAGACTTCTGCAATC 2031 Fm: GGAAACAGCTATGACCAT CTATAAGTATCGTGCGTGTTG (ACTC) 15 52 124–128 KT351057 R: GTTT AACTCTATATGTTTGCCTCCTC BHZNV Fm: GGAAACAGCTATGACCAT TCCCTCCACCTAACAAAG (ACAT) 8 TD 49.5 124–128 KT351060 R: GTTT ATCACACGCCGTTAAATATC CUN6O Fm: GGAAACAGCTATGACCAT CCACCCTACAAATCATGAG (AAC) 9 55 165–201 KT351054 R: GTTT ACCTTCATAATCTGCCAAAG D8UYR Fm: GGAAACAGCTATGACCAT TTAATCCCTTGCATTCTTC (AAAG) 7 52 160–196 KT351058 R: GTT TACCCAAGAGAGCTGGTTAG D90ZA F: GTT TCTGATTACACCTTCGGAAC (AAAG) 8 49 119–263 KT351063 Rc: CAGTCGGGCGTCATCA TTTGTCTAAGCCGTTCAAG EJ5P7 F: GTTT ATGAGGTTCCTACGTTGTTG (ACAT) 8 TD 49.5 188–216 KT351059 Rm: GGAAACAGCTATGACCAT ACGTACCGATGAAGAAGTTG Note : T a = annealing temperature; TD = touchdown PCR procedure. a m = modifi ed primer with underlined M13R motif; c = modifi ed primer with underlined CAG motif. PIG-tail primers are set boldface . T ABLE 2. Results of initial primer screening in two populations of Rumex bucephalophorus subsp. canariensis. a var. canariensis ( N = 22) var. fruticescens ( N = 11) Locus A H o H e PIC r F IS b A H o H e PIC r F IS b 441 4 0.682 0.739 0.671 0.016 0.079** 6 0.455 0.823 0.673 0.247 0.459 ns 510 5 0.636 0.547 0.484 −0.122 −0.169 ns 3 0.909 0.610 0.508 −0.2510 −0.527 ns 679 5 0.476 0.592 0.529 0.112 0.200 ns 3 0.200 0.279 0.247 0.246 0.294 ns 1087 2 1.000 0.519 0.375 −0.333 −1.000** 2 1.000 0.556 0.375 — −1.000 ns 1322 12 0.409 0.818 0.782 0.309 0.506** 7 0.364 0.866 0.803 0.393 0.592** 1327 4 0.773 0.697 0.580 0.133 −0.112** 7 0.818 0.831 0.701 — 0.016** 1648 7 0.546 0.650 0.607 0.083 0.164 ns 1 0.000 0.000 0.000 — — 1806 7 0.500 0.554 0.520 0.043 0.099 ns 8 0.727 0.866 0.805 0.070 0.167* 1959 8 0.500 0.801 0.752 0.231 0.382* 5 0.455 0.801 0.726 0.245 0.444* 1965 6 0.550 0.603 0.532 0.058 0.089 ns 2 0.250 0.250 0.195 — 0.000 ns 2031 2 0.136 0.130 0.119 −0.027 −0.050 ns 1 0.000 0.000 0.000 — — BHZNV 2 0.227 0.206 0.181 −0.055 −0.105 ns 1 0.000 0.000 0.000 — — CUN60 6 0.381 0.767 0.711 0.320 0.509* 2 0.000 0.173 0.152 0.888 1.000 ns D8UYR 5 0.364 0.328 0.306 −0.091 −0.113 ns 4 0.818 0.680 0.582 −0.123 −0.216* D90ZA 9 0.500 0.852 0.813 0.251 0.419** 6 0.636 0.801 0.693 0.045 0.213 ns EJ5P7 7 0.818 0.795 0.745 −0.024 −0.030 ns 3 0.636 0.688 0.583 0.016 0.079 ns Mean 5.688 0.531 0.600 0.544 0.057 0.054 3.813 0.454 0.514 0.440 0.178 0.117 SD 2.701 0.218 0.218 0.210 0.172 0.360 2.373 0.351 0.338 0.299 0.315 0.506 Note : A = number of alleles; F IS = inbreeding within populations; H e = unbiased expected heterozygosity; H o = observed heterozygosity; PIC = polymorphic information content; r = null allele frequency. a See Appendix 1 for voucher specimens and locality information. b Signifi cant departure from Hardy–Weinberg equilibrium: * P < 0.05, ** P < 0.01; ns = not signifi cant . Applications in Plant Sciences 2015 3 ( 12 ): 1500088 Viruel et al.— Rumex bucephalophorus microsatellites doi:10.3732/apps.1500088 3 of 4http://www.bioone.org/loi/apps coinfraspecifi c taxa was successful in both amplifi cation and polymorphism patterns. These are the fi rst SSR markers described for the genus Rumex , and may constitute a remarkable tool for population genetic studies of related taxa. Concretely, these markers may also be valuable in studies of the mating system in heterocarpic taxa and in unravelling the systematics of the R. bucephalophorus complex. LITERATURE CITED A BDELKRIM , J. , B. C. ROBERTSON , J. L. STANTON , AND N. J. GEMMELL . 2009 . Fast, cost-effective development of species-specifi c microsatellite markers by genomic sequencing. BioTechniques 4 6 : 185 – 192 . B ELKHIR , K . , P . B ORSA , L . C HIKHI , N . R AUFASTE , AND F . B ONHOMME . 2004 . GENETIX 4.05, logiciel sous Windows pour la génétique des populations . Laboratoire Génome, Populations, Interactions, CNRS-UPR, Université de Montpellier II, Montpellier, France. B OUTIN-GANACHE , I . , M . R APOSO , M . R AYMOND , AND C. F. DESCHEPPER . 2001 . M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques 31 : 24 – 28 . B ROWNSTEIN , M. J. , J. D. CARPENTER , AND J. R. SMITH . 1996 . Modulation of nontemplated nucleotide addition by Taq polymerase: Primer modifi cations that facilitate genotyping. BioTechniques 2 0 : 1004 – 1010 . G LENN , T. C. , AND N. A. SCHABLE . 2005 . Isolating microsatellite DNA loci. Methods in Enzymology 395 : 202 – 222 . H UANG , X . , AND A . M ADAN . 1999 . CAP3: A DNA sequence assembly program. Genome Research 9 : 868 – 877 . J IMÉNEZ-LÓPEZ , J . , M . T ALAVERA , P. L. ORTIZ , AND M . A RISTA . 2015 . Nuclear microsatellite primers in the annual herb Lysimachia arvensis (Myrsinaceae) and closely related taxa. Biochemical Systematics and Ecology 58 : 242 – 246 . K ALINOWSKI , S. T. , M. L. TAPER , AND T. C. MARSHALL . 2007 . Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Molecular Ecology 16 : 1099 – 1106 . M ARSHALL , T. C. , J. SLATE , L. E. B. KRUUK , AND J. M. PEMBERTON . 1998 . Statistical confi dence for likelihood-based paternity inference in natural populations. Molecular Ecology 7 : 639 – 655 . P RESS , J. R. 1988 . Intraspecifi c variation in Rumex bucephalophorus L. Botanical Journal of the Linnean Society 97 : 344 – 355 . with 5 ′ -GTTT tail (10 μ M), 0.3 μ L of primer with 5 ′ -CAG or M13R tail (10 μ M), and 0.5 μ L of CAG or M13R with FAM, NED, PET, or VIC fl uorescent label (10 μ M). Sixteen primer pairs correctly amplifi ed with the expected size and were run on an ABI 3730 automated sequencer (Applied Biosystems, Foster City, California, USA) using LIZ 500 as the internal lane size standard. Fragment lengths were assigned to allelic classes with GeneMarker 1.71 software (SoftGenetics, State College, Pennsylvania, USA). Genotypic data were obtained for two populations of R. bucephalophorus subsp. canariensis , including the population chosen for the microsatellite enrichment (var. canariensis ) and a second population of var. fruticescens (Appendix 1). Genetic diversity indexes (number of alleles [ A ], observed and unbiased expected heterozygosities [ H o and H e ], and polymorphic information content [PIC]) and null allele frequencies ( r ) were calculated in GENETIX 4.05 ( Belkhir et al., 2004 ) and CERVUS 3.0.7 ( Marshall et al., 1998 ; Kalinowski et al., 2007 ). Deviations from Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were calculated with GENEPOP version 4.0 ( Rousset, 2008 ) using 1000 permutations. All of the 16 simple sequence repeat (SSR) loci amplifi ed in both varieties of R. bucephalophorus subsp. canariensis , although the var. fruticescens population showed three monomorphic loci. None of the 120 pairwise comparisons showed signifi cant LD ( P < 0.5) for both populations after Bonferroni correction. Considering the polymorphic loci, the number of alleles per locus ranged from two to 12 in var. canariensis and from two to eight in var. fruticescens , with means of 5.688 and 3.813, respectively. Without considering locus 1087 with alleles fi xed in all individuals (see Table 2 ) , H o , H e , and PIC per locus ranged from 0.227 to 0.818, from 0.130 to 0.852, and from 0.119 to 0.813 in var. canariensis and from 0.000 to 0.909, from 0.173 to 0.866, and from 0.152 to 0.805 in var. fruticescens , respectively. Mean genetic diversity values were slightly higher in var. canariensis than in var. fruticescens ( Table 2 ). Both populations showed signifi cant deviations from HWE ( Table 2 ) that could be explained through subpopulation structuring or by the presence of null alleles. The null allele frequencies varied from 0.016 to 0.393 in those loci that signifi cantly deviated from HWE ( Table 2 ). Cross-amplifi cations of these 16 loci into other R. bucephalophorus taxa (Appendix 1) were completely successful in subsp. bucephalophorus , whereas amplifi cations failed in two loci in subsp. gallicus and in three loci in subsp. hispanicus ( Table 3 ) . The 16 SSR loci were polymorphic in subsp. bucephalophorus , with two to 11 alleles per locus. However , in subsp. gallicus and subsp. hispanicus , two and three loci were monomorphic, and considering the remaining polymorphic markers, alleles per locus ranged from two to 11 and two to 12, respectively ( Table 3 ). CONCLUSIONS Sixteen SSR loci have been characterized in R. bucephalophorus subsp. canariensis . Transferability of these loci into T ABLE 3. Cross-amplifi cation and transferability results of 16 microsatellite loci in closely related taxa of Rumex bucephalophorus. a subsp. bucephalophorus ( N = 15) subsp. hispanicus ( N = 14) subsp. gallicus var. gallicus ( N = 13) subsp. gallicus var. subaegaeus ( N = 12) Locus A Allele size range (bp) A Allele size range (bp) A Allele size range (bp) A Allele size range (bp) 441 10 153–207 3 183–195 5 181–189 4 185–193 510 2 127–129 2 127–129 2 127–129 2 127–129 679 5 184–196 0 — 3 184–196 2 184–196 1087 7 184–196 0 — 0 — 0 — 1322 7 251–449 12 303–423 8 299–403 11 333–519 1327 3 85–112 2 99–112 2 85–99 0 — 1648 3 176–192 1 180 3 176–196 3 180–192 1806 6 276–288 4 279–291 7 264–291 2 279–282 1959 7 310–331 6 313–343 5 313–343 11 306–355 1965 5 168–208 0 — 6 160–180 2 172–176 2031 2 128–130 1 128 1 128 1 128 BHZNV 3 124–132 1 124 1 124 1 124 CUN6O 11 153–201 5 177–192 2 192–198 3 186–195 D8UYR 2 164–166 3 156–166 4 160–168 3 156–166 D90ZA 8 119–185 2 127–129 5 121–129 5 125–263 EJ5P7 5 184–200 4 184–200 4 184–196 3 184–196 a See Appendix 1 for voucher specimens and locality information. 4 of 4 Applications in Plant Sciences 2015 3 ( 12 ): 1500088 Viruel et al.— Rumex bucephalophorus microsatellites doi:10.3732/apps.1500088 http://www.bioone.org/loi/apps R OUSSET , F. 2008 . GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8 : 103 – 106 . S ÁNCHEZ-ROBLES , J . M . , F . B ALAO , J. L. GARCÍA-CASTAÑO , A . T ERRAB , L . N AVARRO-SAMPEDRO , AND S . T ALAVERA . 2012 . Nuclear microsatellite primers for the endangered relict fi r, Abies pinsapo (Pinaceae) and cross-amplifi cation in related Mediterranean species. International Journal of Molecular Sciences 13 : 14243 – 14250 . T ALAVERA , M . , F . B ALAO , R . C ASIMIRO-SORIGUER , M. A. ORTIZ , A . T ERRAB , M . A RISTA , P. L. ORTIZ , ET AL . 2011 . Molecular phylogeny and systematics of the highly polymorphic Rumex bucephalophorus complex (Polygonaceae). Molecular Phylogenetics and Evolution 61 : 659 – 670 . A PPENDIX 1 . Voucher and location information for Rumex bucephalophorus populations used in this study. All vouchers were deposited in the herbarium of the Universidad de Sevilla (SEV), Seville, Spain. Voucher no. Taxon Locality Geographic coordinates Altitude (m a.s.l.) SEV279249–279254 R. bucephalophorus subsp. bucephalophorus Greece: Crete , Genari 38 ° 21 ′ 66 ″ N, 24 ° 20 ′ 32 ″ E1 SEV249375–249376 R. bucephalophorus subsp. canariensis var. canariensis Spain: Tenerife, Icod de los Vinos 28 ° 21 ′ 31 ″ N, 16 ° 42 ′ 47 ″ W 447 SEV285642 R. bucephalophorus subsp. canariensis var. fruticescens Portugal: Madeira, between Poiso and Pico de Arieiro 32 ° 43 ′ 58.31 ″ N, 16 ° 55 ′ 47.46 ″ W 1500 SEV275565–275567 R. bucephalophorus subsp. hispanicus Portugal: Azores, Terceira, Porto Judeu 38 ° 38 ′ 53 ″ N, 27 ° 08 ′ 36 ″ W50 SEV285914 R. bucephalophorus subsp. gallicus var. gallicus France: Les Mayons, Réserve Naturelle Plaine des Maures 43 ° 20 ′ 32.34 ″ N, 6 ° 23 ′ 46.58 ″ E95 SEV285913 R. bucephalophorus subsp. gallicus var. subaegaeus Spain: Huelva, Almonte, Doñana 37 ° 7 ′ 48.44 ″ N, 6 ° 31 ′ 30.34 ″ W12