Halorubrum Californiense sp. nov., an Extreme Archaeal Halophile Isolated from a Crystallizer Pond at a Solar Salt Plant in California, USA

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is an Accepted Manuscript of an article published in INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY on 2008, available at: https://doi.org/10.1099/ijs.0.2008/002410-0.” Halorubrum californiense sp. nov., an extreme archaeal halophile isolated 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 from a crystallizer pond at a solar salt plant in California Peter T. Pesenti1, Masoumeh Sikaroodi1, Patrick M. Gillevet1, Cristina Sánchez-Porro2, Antonio Ventosa2 and Carol D. Litchfield1 1Department of Environmental Science and Policy, George Mason University, Manassas, VA 20110 USA 2Department of Microbiology and Parasitology, Faculty of Pharmacy, University of Sevilla, 41012 Sevilla, Spain Running title: Halorubrum californiense sp. nov. Subject category: New Taxa-Archaea Author for correspondence: Carol Litchfield, tel: (703) 993-4402, Fax: (703) 993-1066, E-mail: [email protected] 27 28 29 30 The GenBank/EMBL/DDBJ accession number for the 16S rRNA gene sequence of strain SF3- 213T is EF139654. 1 A motile, rod shaped, pink pigmented extremely halophilic archaeon, strain SF3-213T, was isolated from a crystallizer pond at the Cargill Solar Salt Plant, Newark, California (USA). Analysis of the almost-complete 16S rRNA gene sequence showed that the isolate was phylogenetically related to species of the genus Halorubrum with a close relationship to Halorubrum trapanicum NCR 34021 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 T( 98.6% similarity), Halorubrum sodomense ATCC 33755T (98.3%), and Halorubrum xinjiangense AS 1.3527T (98.2%). The polar lipids of strain SF3- 213T were C20C20 derivatives of phosphatidylglycerol phosphate (PG) and phosphatidylglycerol phosphate methyl ester (PGP-Me), phosphatidylglycerol sulfate (PGS) and a sulfated diglycosyldiether (S-DGD). Strain SF3-213T grows over a range of 2.5-5 M NaCl. Temperature range for growth was 25-42 ºC with a pH range of 6.8-8.5. Optimal growth was reached at 3.5-4.5 M NaCl, 37 ºC, and pH 7.3. Mg2+ is required. The DNA G+C content is 69.4 mol%. DNA-DNA hybridization values lower than 70% were obtained between strain SF3-213T and the closely related Halorubrum species. Based on the data presented in this study, SF3-213T represents a novel species, for which the name Halorubrum californiense sp. nov. is proposed. The type strain is SF3-213T (= CECT 7256T = DSM 19288T = JCM 14715T). Solar salterns harbor a diverse community of halophilic microorganisms that represent the three domains of life: Archaea, Bacteria and Eukarya (Oren, 2002a). The archaeal members of the order Halobacteriales, family Halobacteriaceae, are significant components of higher salinity pans (Benlloch et al., 2002). The genus Halorubrum (McGenity & Grant, 2001) is a member of the family and widely distributed in hypersaline environments, notably solar salterns (Kamekura 1998; Ochsenreiter et al., 2002 ; Oren, 2002a; Oren, 2002b). The generic name Halorubrum was 2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 first proposed by Grant and Ross (Grant & Ross, 1985) for a distinct grouping of species within the genus Halobacterium. However, the genus Halorubrum was not officially recognized until the subsequent work of McGenity and Grant which proposed the transfer of four species of Halobacterium to the new genus Halorubrum (McGenity & Grant, 1995). The transfer was based on distinct phylogenetic clustering of the 16S rRNA gene sequence of all four species, with the type species H. saccharovorum (McGenity & Grant, 1995). Currently, 19 species are recognized within the genus Halorubrum: H. saccharovorum (Tomlinson & Hochstein, 1976), H. lacusprofundi (Franzmann et al., 1988), H. coriense (Kamekura & Dyall-Smith, 1995; McGenity & Grant, 1995), H. distributum (Oren & Ventosa, 1996), H. sodomense (Oren, 1983; Oren & Ventosa, 1996), H. tebenquichense (Lizama et al., 2002), H. terrestre (Ventosa et al., 2004), H. trapanicum (McGenity & Grant, 1995), H. xinjiangense (Feng et al., 2004), H. alkaliphilum (Feng et al., 2005), H. tibetense (Fan et al., 2004), H. vacuolatum (Kamekura et al., 1997; Mwatha & Grant, 1993), H. lipolyticum (Cui et al., 2006), H. aidingense (Cui et al., 2006), H. ezzemoulense (Kharroub et al., 2006), H. orientale (Castillo et al., 2006), H. arcis (Xu et al., 2007), H. litoreum (Cui et al., 2007), and H. ejinorense (Castillo et al., 2007). In this study we characterized a new strain that belongs to the genus Halorubrum and we show that based on phylogenetic, phenotypic, polar lipid composition, and genotypic features it represents a new species, for which we propose the name, Halorubrum californiense sp. nov. Strain SF3-213T was isolated from water samples taken from a crystallizer pond at the Cargill Solar Salt Plant, Newark, California (37° 29’N 122° 1'W) in spring, 1997. Samples were isolated on agar plates under aerobic conditions at 37 0C using a modified casamino acid medium (MCAT) (Litchfield et al., 2005) containing the following ingredients (l -1): casamino acids, 7.3 g; yeast extract, 0.51 g; Na citrate, 3 g; solar salt, 250 g; MgSO4 · 7H2O, 20 g; FeCl3, 0.02 g. The 3 pH was adjusted to 7.3 with 1 M NaOH. The isolation methods were described previously (Litchfield et al., 2005). Salt and temperature ranges were determined using a microtiter plate format with three replicates of treatment read using a Packard SpectraCount microplate reader at 590 nm. Salinity was tested at 0.5 M, 1.5 M, 2 M, 2.5 M, 3 M, 3.5 M, 4 M, and 5 M. Separate plates with the above range of salt concentrations were incubated at 10˚C, 25˚C, 37˚C, and 42 ˚C and also read on the SpectraCount. The range of pH was tested in buffered media at pH 5.0, 6.0, 6.5, 6.8, 7.0, 7.3, 7.8, 8.0, 8.5, 9.0, 9.5. Strain SF3-213 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 T grew over a temperature range of 25-42 °C (optimum 37 °C) with no growth below 20˚C, at pH range 6.8-8.5 (optimum pH 7.3) when tested in buffered media. Routine cultivation was accomplished at 37 °C and pH 7.3. Strain SF3-213T grew over a wide range of NaCl concentrations from 2.5 M to 5.0 M with optimal growth at 3.5-4.5 M NaCl. Mg2+ is required for growth with an optimum at 0.2 M and growth over the range 0.17-1.7 M. A polyphasic taxonomic approach was followed for the phenotypic and genotypic characterization of strain SF3-213T. All tests were performed in accordance with the proposed minimal standards for the description of new taxa in the order Halobacteriales (Oren et al., 1997). We used as reference the type species H. saccharovorum NCMB 2081T, as well as positive and negative controls. Cell motility, morphology, and Gram staining were examined using a Leica DM LB2 phase-contrast equipped light microscope with an integrated Qimage camera (Retiga 1300) running the BioQuant Nova Prime image analysis software v 6.90. The cells were taken from liquid media during early exponential growth. The cells were motile and rod shaped by the hanging drop method. The cells are Gram negative. The colony morphology was observed after growth on MCAT agar with 4.5 M solar salt with incubation at 37 0C for 7 days. Colonies of strain SF3-213T were circular, slightly raised, light pink pigmentation, and are 4 1-1.5 mm in size. Anaerobic growth was tested with L-arginine in screw top sealed vials. Phenotypic characteristics were tested as described by Oren et al. (1997) and included the following tests: hydrolysis of starch, gelatin, casein, chitin, cellulose, and Tween 80; nitrate reduction; the production of H 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 2S, indole, catalase, and Kovac’s oxidase ; the utilization of sugars and amino acids as carbon and energy sources. In parallel, API 20 NE test strips (bioMérieux) were used for confirmation with a slight modification to the inoculum concentration to reduce high salt interference. Strain SF3-213T was catalase and Kovacs’ oxidase positive. Indole from tryptophan was produced. Nitrate was reduced to nitrite. H2S was not produced. Casein was hydrolyzed; however starch, gelatin, chitin, cellulose, and Tween 80 were not. In addition, the API 20 strips gave positive tests for aesculin and 4-nitrophenyl-βD-galactopyranoside hydrolysis. The assimilation of sugars as single carbon sources was tested with modified Bushnell-Haas medium (Brown & Braddock, 1990) supplemented with 0.05% yeast extract (w/v), 2% MgCl2 (w/v), 0.01% (w/v) sugar (D-glucose, D-fructose, lactose, D-galactose or mannose) and 25% NaCl Strain SF3-213T was positive for the assimilation of D-glucose, lactose, and D-galactose and negative for D-fructose and mannose. No acid was detected via pH meter readings for any of the sugars. Methyl red and Voges-Proskauer were negative. Utilization of various substrates and tests are summarized in the species description and Table 1. Antibiotic susceptibilities were determined by the Kirby-Bauer (Bauer et al., 1966) method on large MCAT agar plates (3.5 M NaCl) with the antibiotic discs containing the following concentrations: ampicillin (10 μg), bacitracin (10 IU), chloramphenicol (5 μg), erythromycin (15 μg), kanamycin (30 μg), nalidixic acid (30 μg), rifampin (5 μg), and streptomycin (10 μg). The results are included in the species description. 5 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Polar lipids were extracted using a chloroform/methanol system as described previously (Litchfield & Oren, 2001). One dimensional thin-layer chromatography (TLC) was performed on 19-channel Silica gel-G plates from Whatman (lot #33096) in a solvent system of chloroform/methanol/acetic acid/water (85:22.5:10:4, v:v:v:v) in lined tanks. For the two dimensional TLC single sheet Silica gel-G plates were employed with the first dimension solvents of chloroform/methanol/acetic acid/water (80:12:15:4, v: v: v: v) and the second was chloroform/methanol/water (65:25:4, v:v:v.) (Litchfield & Oren, 2001). Polar lipid fractions were detected with spray reagents: orcinol for glycolipids followed by heating to 110 °C; ammonium molybdate for phospholipids (Tindall, 1990) and cresyl violet for sulfolipids (Soto et al., 2000). The polar lipids of strain SF3-213T (see supplementary Fig. S1 available in IJSEM Online) are C20C20 derivatives of phosphatidylglycerol phosphate (PG), phosphatidylglycerol phosphate methyl ester (PGP-Me), and phosphatidylglycerol sulfate (PGS). In addition, a single sulfated diglycosyl-diether (S-DGD) was also detected. Methods employed for genomic DNA extraction/preparation, PCR amplification of the 16S rRNA gene sequence, and gene sequencing have been previously described (Litchfield et al., 2006). The haloarchaeal primers used for the PCR were HK 1F ATTCCGGTTGATCCTGCCGG) and H1492R (GTTACCTTGCCCGTTCCTTC) (Litchfield et al., 2006). The almost complete 16S rRNA gene sequence (1436 bp) of strain SF3-213T was determined and compared via BLAST to other members of the family Halobacteriaceae. Sequence consensus was accomplished using Sequencher (Gene Code Corp.). This was output as a FASTA file for alignment employing CLUSTAL X. The final phylogenetic trees were constructed using maximum-likelihood method from PAUP. The phylogenetic tree (Figure 1) shows that strain SF3-213T clusters within the species of the genus Halorubrum with the closer relationships to H. trapanicum NCR 34021T( 6 98.6% similarity), H. sodomense ATCC 33755T (98.3%), and H. xinjiangense AS 1.3527T (98.2%). In addition, the 16S rRNA gene sequence of strain SF3-213 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 T matched the signature sequences for the genus Halorubrum at positions 199–229, 656–672 and 1242–1259 (positions based on the sequence of Escherichia coli) (Grant et al., 2001). DNA-DNA hybridization and G+C content were performed as previously described (Fan et al., 2004). The G+C content of strain SF3-213T was relatively high at 69.4 mol% when compared to the close relatives mentioned above (Table 1). Strain SF3-213T showed low DNA–DNA hybridization percentages to the closely related type strains of Halorubrum distributum JCM 10118T (44%), Halorubrum trapanicum JCM 10477T (37%), Halorubrum terrestre VKM B- 1739T (33%), Halorubrum tebenquichense JCM 12290T (24%), Halorubrum saccharovorum ATCC 29252T (21%), Halorubrum sodomense JCM 8880T (18%) or Halorubrum xinjiangense JCM 12388T (4%). These data show that strain SF3-213T represents a different species, since the threshold value to separate two species is 70% (Stackebrandt & Goebel, 1994). The above phenotypic, genotypic, chemotaxonomic and phylogenetic data indicate that strain SF3-213T represents a novel species within the genus Halorubrum for which we propose the name Halorubrum californiense sp. nov. Differential characteristics of the new species and of Halorubrum species are shown in Table 1. 7 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Description of Halorubrum californiense sp. nov. Halorubrum californiense (ca.li.for.ni.en’se, N.L. neut. adj, californiense pertaining to California, [USA] where the strain was isolated from a solar saltern). Cells are short rod-shaped (0.5 x 1.0-1.5 μm). Gram negative. Motile. Colonies are small (1-1.5 mm) pink, smooth, round and slightly raised. Extreme halophile. Growth occurs optimally at 3.5 to 4.5 M NaCl over a range of 2.5- 5.0 M. The pH range for growth is 6.8 – 8.5 with optimum at pH 7.3. The temperature range is 25 to 42ºC; optimal temperature for growth is 37 0C . Magnesium is required for growth with an optimum at 0.2 M and growth over the range 0.17-1.7 M. Chemoorgano-heterotrophic and strictly aerobic. Catalase and Kovacs’ oxidase positive. Casein is hydrolyzed, but gelatin, starch, cellulose, chitin, and Tween 80 are not hydrolyzed. H2S is not produced. Nitrate is reduced to nitrite. Indole is produced. D-Glucose, lactose, and D-galactose are used as single carbon sources. Mannose, D-fructose, and acetate are not utilized. No acid production from sugars. Sensitive to bacitracin, kanamycin, and nalidixic acid. Resistant to ampicillin, chloramphenicol, erythromycin, rifampin, and streptomycin. The polar lipids are C20C20 diether derivatives of phosphatidylglycerol phosphate (PG), phosphatidylglycerol phosphate methyl ester (PGP-Me), phosphatidylglycerol sulfate (PGS) and a single glycolipid, sulfated diglycosyl-diether (S-DGD). The G+C content of the DNA is 69.4 mol% (Tm). The type strain, SF3-213T was isolated from the crystallizer pond at the Cargill Solar Salt Plant in Newark, California, USA and has been deposited in the Colección Española de Cultivos Tipo, Valencia, Spain as CECT 7256T (= DSM 19288T = JCM 14715T). . 8 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 Kamekura, M. & Dyall-Smith, M. L. (1995). Taxonomy of the family Halobacteriaceae and the description of two new genera Halorubrobacterium and Natrialba. J Gen Appl Microbiol 41, 333- 350. Kamekura, M., Dyall-Smith, M. L., Upasani, V., Ventosa, A. & Kates, M. (1997). Diversity of alkaliphilic halobacteria: proposals for transfer of Natronobacterium vacuolatum, Natronobacterium magadii, and Natronobacterium pharaonis to Halorubrum, Natrialba, and Natronomonas gen. nov., respectively, as Halorubrum vacuolatum comb. nov., Natrialba magadii comb. nov., and Natronomonas pharaonis comb. nov., respectively. Int J Syst Bacteriol 47, 853-857. Kamekura , M. (1998). Diversity of extremely halophilic bacteria. Extremophiles 2, 289-295. Kharroub, K., Quesada, T., Ferrer, R., Fuentes, S., Aguilera, M., Boulahrouf, A., Ramos- Cormenzana, A. & Monteoliva-Sanchez, M. (2006). Halorubrum ezzemoulense sp. nov., a halophilic archaeon isolated from Ezzemoul sabkha, Algeria. Int J Syst Evol Microbiol 56, 1583- 1588. Litchfield, C. D. & Oren, A. (2001). Polar lipids and pigments as biomarkers for the study of the microbial community structure of solar salterns. Hydrobiologia 466, 81-89. Litchfield, C. D., Sikaroodi, M. & Gillevet, P. (2005).The microbial diversity of a solar saltern on San Francisco Bay. In Adaptation to Life at High Salt Concentrations in Archaea, Bacteria, and Eukarya, pp. 59-69 Edited by N. Gunde-Cimerman, A. Oren & A. Pemenitas. The Netherlands: Springer Dordrecht,. Lizama, C., Monteoliva-Sanchez, M., Suarez-Garcia, A., Rosello-Mora, R., Aguilera, M., Campos, V. & Ramos-Cormenzana, A. (2002). Halorubrum tebenquichense sp. nov., a novel halophilic archaeon isolated from the Atacama Saltern, Chile. Int J Syst Evol Microbiol 52, 149-155. McGenity, T. & Grant, W. D. (1995). Transfer of Halobacterium saccharovorum, Halobacterium sodomense, Halobacterium trapanicum NRC 34021 and Halobacterium lacusprofundi to the genus Halorubrum gen. nov., as Halorubrum saccharovorum comb. nov., Halorubrum sodomense comb. nov., Halorubrum trapanicum comb. nov., and Halorubrum lacusprofundi comb. nov. Syst Appl Microbiol 18, 237-243. McGenity, T. J. & Grant, W. D. (2001). Genus VII. Halorubrum. In 2 nd ed Vol 1 Bergey’s Manual of Systematic Bacteriology, pp. 320-324. Edited by D. R. Boone, R. W. Castenholz & G. M. Garrity. New York: Springer. Mwatha, W. E. & Grant, W. D. (1993). Natronobacterium vacuolata sp. nov., a haloalkaliphilic archaeon isolated from Lake Magadi, Kenya. Int J Syst Bacteriol 43, 401-404. Ochsenreiter, T., Pfeifer, F. & Schleper, C. (2002 ). Diversity of Archaea in hypersaline environments characterized by molecular-phylogenetic and cultivation studies. Extremophiles 6, 267-274. Oren, A. (1983). Halobacterium sodomense sp. nov., a Dead Sea halobacterium with an extremely high magnesium requirement. Int J Syst Bacteriol 33, 381-386. 18 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 Oren, A. & Ventosa, A. (1996). A proposal for the transfer of Halorubrobacterium distributum and Halorubrobacterium coriense to the genus Halorubrum as Halorubrum distributum comb. nov. and Halorubrum coriense comb. nov., respectively. Int J Syst Bacteriol 46, 1180. Oren, A., Ventosa, A. & Grant, W. D. (1997). Proposed minimal standards for description of new taxa in the order Halobacteriales. Int J Syst Bacteriol 47, 233-238. Oren, A. (2002a). Diversity of halophilic microorganisms: Environments, phylogeny, physiology, and applications. J Indus Microbiol Biotechnol 28, 56-63. Oren, A. (2002b). Molecular ecology of extremely halophilic Archaea and Bacteria. FEMS Microbiol Ecol 39, 1-7. Soto, C. Y., Cama, M., Gibert, I. & Luquin, M. (2000). Application of an easy and reliable method for sulfolipid-I detection in the study of its distribution in Mycobacterium tuberculosis strains. FEMS Microbiol Lett 187, 103-107. Stackebrandt, E. & Goebel, B. M. (1994). Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol 44, 846-849. Tindall, B. J. (1990). Lipid composition of Halobacterium lacusprofundi. FEMS Microbiol Lett 66, 199-202. Tomlinson, G. A. & Hochstein, L. I. (1976). Halobacterium saccharovorum sp. nov., a carbohydrate-metabolizing, extremely halophilic bacterium. Can J Microbiol 22, 587-591. Ventosa, A., Gutierrez, M. C., Kamekura, M., Zvyagintseva, I. S. & Oren, A. (2004). Taxonomic study of Halorubrum distributum and proposal of Halorubrum terrestre sp. nov. Int J Syst Evol Microbiol 54, 389-392. Xu, X.-W., Wu, Y.-H., Zhang, H.-b. & Wu, M. (2007). Halorubrum arcis sp. nov., an extremely halophilic archaeon isolated from a saline lake on the Qinghai-Tibet Plateau, China. Int J Syst Evol Microbiol 57, 1069-1072.