Perturbing HIV-1 Ribosomal Frameshifting Frequency Reveals a cis Preference for Gag-Pol Incorporation into Assembling Virions

Perturbing HIV-1 Ribosomal Frameshifting Frequency Reveals a cis Preference for Gag-Pol Incorporation into Assembling Virions Bayleigh E. Benner, a , b James W. Bruce, a , c Jacob R. Kentala, a Magdalena Murray, a Jordan T. Becker, a Pablo Garcia-Miranda, a , d Paul Ahlquist, a , c Samuel E. Butcher, d Nathan M. Sherer a a Department of Oncology (McArdle Laboratory for Cancer Research), Institute for Molecular Virology, and Carbone Cancer Center, University of Wisconsin—Madison, Madison, Wisconsin, USA b UW—Madison Microbiology Doctoral Training Program, Madison, Wisconsin, USA c John and Jeanne Rowe Center for Research in Virology, Morgridge Institute for Research, Madison, Wisconsin, USA d Department of Biochemistry, University of Wisconsin—Madison, Madison, Wisconsin, USA ABSTRACT HIV-1 virion production is driven by Gag and Gag-Pol (GP) proteins, with Gag forming the bulk of the capsid and driving budding, while GP binds Gag to deliver the essential virion enzymes protease, reverse transcriptase, and integrase. Virion GP levels are traditionally thought to reflect the relative abundances of GP and Gag in cells (;1:20), dictated by the frequency of a 21 programmed ribosomal frameshifting (PRF) event occurring in gag-pol mRNAs. Here, we exploited a panel of PRF mutant viruses to show that mechanisms in addition to PRF regulate GP incorporation into virions. First, we show that GP is enriched ;3-fold in virions relative to cells, with viral infectivity being better maintained at subphysiological levels of GP than when GP levels are too high. Second, we report that GP is more efficiently incorporated into virions when Gag and GP are synthesized in cis (i.e., from the same gag-pol mRNA) than in trans,suggesting that Gag/GP translation and assembly are spatially coupled processes. Third, we show that, surprisingly, virions exhibit a strong upper limit to trans-delivered GP incorporation; an adaptation that appears to allow the virus to temper defects to GP/Gag cleavage that may negatively impact reverse transcription. Taking these results together, we propose a “weighted Goldilocks”scenario for HIV-1 GP incorporation, wherein combined mechanisms of GP enrichment and exclusion buffer virion infectivity over a broad range of local GP concentrations. These results provide new insights into the HIV-1 virion assembly pathway relevant to the anticipated efficacy of PRF-targeted antiviral strategies. IMPORTANCE HIV-1 infectivity requires incorporation of the Gag-Pol (GP) precursor polyprotein into virions during the process of virus particle assembly. Mechanisms dictating GP incorporation into assembling virions are poorly defined, with GP levels in virions traditionally thought to solely reflect relative levels of Gag and GP expressed in cells, dictated by the frequency of a 21 programmed ribosomal frameshifting (PRF) event that occurs in gag-pol mRNAs. Herein, we provide experimental support for a “weighted Goldilocks”scenario for GP incorporation, wherein the virus exploits both random and nonrandom mechanisms to buffer infectivity over a wide range of GP expression levels. These mechanistic data are relevant to ongoing efforts to develop antiviral strategies targeting PRF frequency and/or HIV-1 virion maturation. KEYWORDS Gag, Gag-Pol, HIV, PRF, cis-acting RNA element, protease, reverse transcription, ribosomal frameshift, virion, virus assembly Retroviruses encode cis-acting RNA structural elements that regulate key stages of viral replication, including but not limited to transcription, splicing, RNA nuclear export, translation, RNA genome dimerization, and genome packaging (1–3). A wellstudied example is the human immunodeficiency virus type 1 (HIV-1) programmed Editor Viviana Simon, Icahn School of Medicine at Mount Sinai Copyright © 2022 American Society for Microbiology. All Rights Reserved. Address correspondence to Nathan M. Sherer, [email protected]. Received 11 August 2021 Accepted 30 September 2021 Accepted manuscript posted online 13 October 2021 Published January 2022 Volume 96 Issue 1 e01349-21 Journal of Virology jvi.asm.org 1 VIRUS-CELL INTERACTIONS 12 January 2022 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. ribosomal frameshift (PRF) regulatory element that controls the synthesis of Gag and Gag-Pol (GP) virion proteins from a single viral unspliced gag-pol mRNA (4–10). Gag forms the largest percentage of the HIV-1 virion and is expressed as an ;55-kDa precursor polyprotein (Pr55) cleaved into the subunits matrix (MA; p17), capsid (CA; p24), nucleocapsid (NC; p7), and late domain (p6) and two spacer peptides (SP1 and SP2) (11, 12). GP is larger (Pr160) and consists of identical MA, CA, SP1, and NC subunit domains fused to a linker protein (p6*) upstream of subunits encoding the viral enzymes protease (PR), reverse transcriptase (RT), and integrase (IN) (13). Gag expression is sufficient to generate virus-like particles even in the absence of all other viral proteins. However, GP incorporation into virions is essential to virion infectivity because it delivers PR, which mediates cleavage of Gag and GP during capsid maturation, RT, which reverse transcribes the viral RNA genome to form double-stranded DNA (dsDNA) following capsid delivery into target cells, and IN, which integrates the dsDNA proviral genome intermediate into host cell chromatin. GP incorporation levels need to be tightly controlled, based on prior studies showing that GP overexpression negatively impacts capsid maturation steps (14–17) and the stability of packaged RNA genome dimers (14). With the exception of spumaviruses, which express Gag and Pol from independent mRNAs, all other known retroviruses use translational recoding of a single gag-pol transcript to generate Gag and GP, employing either frameshifting (FS) or codon readthrough mechanisms (18). For HIV-1, the PRF element regulates FS frequency through the activities of two proximal cis-acting regulatory sequences: a conserved heptanucleotide “slippery”sequence (UUUUUUA) (SS) located upstream of a strong (DG= 221.8 kcal/mol) 11-bp RNA stem-loop positioned 164 bases prior to the gag stop codon (8, 19). A consensus model posits that ribosome stalling at the stem-loop leads to 21 FS events at the SS ;5 to 10% of the time, so that Gag and GP are synthesized at an approximate ratio of 20:1 (Gag to GP) (4, 9, 20). Increasing the local thermodynamic stability of the PRF stem-loop enhances FS frequency both in vitro (19) and in cells (21), and we showed previously that stem-loop modifications increasing FS frequency as little as 2-fold can yield reductions in viral infectivity of .80% (21). Accordingly, the PRF element may represent a viable target for antiviral intervention. Indeed, cell-permeant small molecules designed to bind the stem-loop and increase FS frequency have been shown to reduce viral infectivity in cell culture (22). The incorporation of Gag and GP into virus particles is traditionally viewed as a stochastic process, wherein the ratio of GP to Gag found in virions roughly equals that found in cells, with GP recruited to virions through random associations with Gag and the viral RNA scaffold (21, 23, 24). To better understand how altering PRF frequency affects virion infectivity, here we studied the assembly characteristics of mutant HIV-1 viruses engineered to either increase or abolish frameshifting. Using these viruses, we demonstrated that GP incorporation levels are, in fact, governed by nonstochastic mechanisms, with GP being moderately enriched in virions relative to cells and, more strikingly, much more efficiently incorporated into virions when cogenerated with Gag in cis (i.e., from the same gag-pol mRNA) than in trans (i.e., when Gag and GP originate from separate gag and GP mRNAs). Unexpectedly, we also discovered that virions impose an ;2-fold saturation ceiling on GP incorporation when GP is delivered in trans, a feature that helps the virus to preserve low-level infectivity even when cytoplasmic concentrations of GP are exceptionally high. RESULTS Increasing PRF stem-loop stability enhances GP synthesis and incorporation into virions. Because our previous work showed that increasing FS frequency results in significant decreases to virion infectivity (21), the initial goal of this study was to more precisely define the levels of PRF and virion GP incorporation that would be needed to abrogate HIV-1 replication in the context of an antiviral strategy (Fig. 1 and 2). To this end, we focused on a subset of FS mutants at either end of the frameshifting spectrum: M1, which we had previously shown to exhibit increased FS frequency due Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 2 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. to stronger local base-pairing interactions at the base of the PRF stem-loop, and 2SS, a mutant that encodes two U-to-C mutations within the slippery sequence 59to the PRF stem-loop, thereby abolishing frameshifting entirely (Fig. 1A) (21). To establish baseline levels of FS frequency and GP incorporation into virions, green fluorescent protein (GFP) reporter viruses bearing wild-type (WT), M1, and 2SS frameshift sites were transfected into HEK293T cells treated with the protease inhibitor saquinavir, and pelleted virions and lysates were harvested at 48 h posttransfection. Saquinavir prevents Gag and GP proteolytic cleavage, allowing direct measurements of precursor levels using quantitative immunoblotting (Fig. 1B). FS frequency and GP incorporation frequency were measured as GP/Gag ratios relative to WT virus for cells (Fig. 1C, orange bars) or virions (Fig. 1C, blue bars), respectively. The WT FS frequency was 6.8% (61.7; n= 3) (Fig. 1C, orange bars), similar to prior studies (4, 9, 20), while virion GP incorporation frequency was 22.5% (62.4; n= 3) (Fig. 1C, blue bars), indicating that GP/Gag ratios were enriched 3.6-fold in WT virions relative to cells (Fig. 1C, WT; compare orange and blue bars). In comparison, M1 exhibited a markedly higher FS FIG 1 Increasing PRF element stem-loop stability results in an increase in GP production and enriched levels of GP associated with virions. (A) Representation of the wild-type (WT) HIV-1 gag-pol mRNA frameshift (FS) site secondary structure and that of PRF mutants –SS and M1. M1 was engineered to exhibit elevated stem-loop stability, with DG Local being the predicted free energy of the first 3 bp of the WT and M1 stem-loops. (B) WT, M1, and 2SS Gag and GP expression and incorporation into virus particles. HEK293T cells generating WT or the indicated PRF element mutant viruses were cultured in the presence of the protease inhibitor saquinavir (10 m M) to prevent Gag and GP processing. Cell lysates and virions were harvested at 48 h. Gag and GP were detected by Western blotting using anti-p24 Gag primary antiserum and infrared-labeled secondary antibodies. HSP90 was detected as a loading control. (C) FS frequency was defined as the ratio of cell-associated GP to Gag (orange bars). GP incorporation frequency into virions was defined as the ratio of virion-associated GP to Gag (blue bars). Fold changes in GP/Gag ratios for the indicated conditions are indicated by black lines, with comparisons derived from three independently performed biological replicates. Error bars represent the standard deviations of the means. *,P,0.05, **,P,0.001, and ***,P,0.0001. Pvalues were derived using Student’s two-tailed ttest for comparisons as indicated in the figure, except for 2SS Pvalues, which were derived from comparisons of FS frequency and GP incorporation levels to the WT values. HIV-1 Gag-Pol Incorporation Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 3 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. frequency of 22% relative to WT (64.35, n= 3) (Fig. 1C, orange bars), which corresponded to virion GP incorporation levels of 34.5% (63.71; n= 3) (Fig. 1C, blue bars). Accordingly, M1 virus exhibited a 3.2-fold-greater frameshift frequency than WT (Fig. 1C, compare M1 and WT orange bars), although M1 virions exhibited only a 1.6-fold enrichment of GP incorporation frequency (Fig. 1C, M1, compare orange and blue bars). As anticipated, the FS mutant 2SS produced GP-deficient virus particles (Fig. 1B and C). FIG 2 Virus complementation reveals a nonlinear relationship between GP expression and viral infectivity at suboptimal levels of GP. (A) Infectivity of virions produced by WT, M1, and 2SS reporter viruses. Viral GFP expression was quantified and normalized to that of WT virus (set to 100%). (B) Schematic of viral 2-color complementation assay wherein WT or PRF mutant GFP reporter viruses were coexpressed in cells generating a Rev 2 HIV-1 RFP reporter virus encoding a WT PRF element. “FSE”refers to the RNA frameshift regulatory element. (C) Summary of infectious yields of PRF mutant viruses produced alone or coproduced with WT RFP reporter virus in HEK239T cells expressed at a 1:1 ratio. Pseudotyped virus particles were assayed by infecting HEK293T cells (an example is shown) prior to measuring per-well fluorescence intensity relative to the WT control. (D) Data from panel C shown in graphical format. Error bars represent standard deviations of the means derived from three independent biological replicates. (E) Predicted cellular GP/Gag ratios plotted against cumulative relative infectivity, with measurements derived from panels A and D. The dashed green line indicates that a GP/Gag ratio of 0.5 yields 90% overall (GFP plus RFP) infectivity for the 2SS1WT condition, close to that of WT virus alone. In contrast, the dashed red line indicates a that a GP/Gag ratio of more than 2-fold yields less infectivity (52%) for the M11WT condition than WT. Comparisons were derived from three independently performed biological replicates. *,P,0.05; **,P,0.001; ***,P,0.0001; n.s., nonsignificant (for comparisons of M1 and 2SS to the corresponding WT using Student’s two-tailed ttest [A and D]). Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 4 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. A“weighted Goldilocks”scenario: HIV-1 infectivity is more tolerant of subphysiological levels of GP than when GP is in excess. To better define the relationship between cellular GP expression levels and viral infectivity, we generated WT, M1, and 2SS GFP reporter viruses pseudotyped using vesicular stomatitis virus G protein (VSV-G) and used the supernatants to infect HEK293T target cells (Fig. 2A). Relative to WT, we observed significantly lower infectivity (;5-fold compared to WT) based on reporter gene (GFP) expression for M1 (18% 60.88%; n= 3) (Fig. 2A), consistent with our prior study (21). We note that the M1 PRF mutations caused a small number of amino acid changes in Gag and GP (see details in reference 21 and Materials and Methods). However, these changes were in regions of the proteins (Gag p1 and GP p6*) previously shown to accommodate changes without affecting Gag or GP assembly function (21, 25–27). As expected, 2SS virions, which lacked GP due to the frameshiftblocking 2SS mutation, were not infectious (Fig. 2A). We next tested the effects of modulating cellular GP/Gag ratios by coexpressing WT, M1, or 2SS GFP virus genomes at a 1:1 ratio with WT PRF reporter virus expressing red fluorescent protein (RFP) instead of GFP (Fig. 2; schematic depiction of virus constructs is in Fig. 2B). We hypothesized that WT RFP virus would improve the infectivity of both M1 and 2SS GFP viruses by either reducing (with M1) or increasing (with 2SS) the relative cell-associated GP/Gag ratio. In this experiment, the WT RFP virus was also mutated to inactivate the viral rev gene, needed to activate unspliced and partially spliced viral RNA nuclear export, so that it would be expressed only if coexpressed in the same cell with a complementing GFP virus genome supplying Rev in trans (28). The VSV-G-pseudotyped virions resulting from these cotransfections were used to infect HEK293T cells, which were fixed at 48 h postinfection (hpi), and GFP, RFP, or both combined were measured to assess relative levels of infectivity (Fig. 2C and D). As anticipated, coexpressing M1 GFP and WT RFP virus genomes (M11WT) yielded higher cumulative infectivity (51.7% 62.8%, n= 3) than M1 alone (Fig. 2B to D), which was consistent with a cellular GP/Gag ratio of ;2-fold higher being needed to achieve an ;50% drop to infectivity (Fig. 2E, red dashed line). Interestingly, when infectivity yields from independent expression of the mutant M1 GFP and WT RFP viral genomes were compared to the coexpression results, M1 (GFP) infectivity was only moderately improved by coexpressing the WT viral genome (;18% [Fig. 2A, M1] to 35.2% 6 9.86%; n= 3 [Fig. 2D, M1, green bar]), and WT (RFP) infectivity was only moderately decreased (to 68.1% 614.32%; n= 3 [Fig. 2D, WT, middle red bar]). We interpreted this result as indicating that while excess GP generated by M1 is deleterious to both viruses, it had a bigger net negative effect on M1 genomes potentially due to its operating in cis (addressed further in Fig. 3 and 4). Also as expected, 1:1 coexpression of 2SS GFP virus genomes with WT RFP virus genomes improved 2SS virus infectivity. Remarkably, however, this rescue was nearly complete (90.2% 61.33%; n= 3), despite the predicted GP/Gag ratio of only 50% relative to the WT-alone control (Fig. 2C and D). When coexpressed, both the 2SS (GFP) and WT (RFP) genomes exhibited relatively high levels of infectivity (83.4% 620.4% for 2SS and 96.9% 618.1% for WT, respectively; n= 3) (Fig. 2C and D). This result demonstrated that GP is efficiently recruited to virions packaging 2SS genomes in trans even when intracellular levels of GP are relatively low. Using these data, we plotted predicted cellular GP/Gag ratios relative to cumulative infectivity from Fig. 2A and D in Fig. 2E, illustrating a nonlinear “weighted Goldilocks” scenario for cellular GP levels wherein “too little”GP (e.g., a predicted 50% level of GP/ Gag in cells compared to WT GP/Gag levels set to 100%) (Fig. 2E, green dashed lines) is well tolerated by the virus, while “too much”GP (e.g., an ;2-fold GP/Gag increase; Fig. 2E, red dashed lines) is more detrimental (2SS1WT compared to M11WT conditions [Fig. 2E]). Suboptimal effects of trans-delivered GP on infectivity suggest a cis preference for GP incorporation into virions. We next sought to test our “weighted Goldilocks” model by more carefully controlling levels of GP expressed in cells using a Gag-Pol- only (GP Only ) RFP reporter virus, wherein we abolished frameshifting by placing the pol HIV-1 Gag-Pol Incorporation Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 5 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. FIG 3 Suboptimal activity of GP supplied in trans suggests a cis preference for GP incorporation into virions. (A) Schematic of GP Only HIV-1 RFP reporter virus and altered slippery sequence that places pol in the 0 reading frame. “FSRE”refers to the RNA frameshift regulatory element. (B) Western blot analysis of Gag and GP expression confirmed that the GP Only RFP virus generated GP and not Gag, and at higher levels than GP derived from WT transcripts. Total Gag plus GP protein expression levels were similar for WT and GP Only transcripts. Note that GP expression alone did not produce virus particles. Hairlines indicate sites where bands from a single immunoblot were spliced together to improve data presentation, but with no further modifications. (C) Effects of GP on viral infectivity and Gag processing when coexpressed with WT, 2SS, or M1 viruses. HEK293T cells were transfected with plasmids encoding WT, –SS, or M1 GFP reporter viruses (1,500 ng input plasmid) in the presence or absence of increasing amounts of GP Only RFP reporter virus plasmid (25, 50, 100, 150, 200, and 300 ng). Viral infectivity was determined as for Fig. 2, with values shown normalized to WT virus production, for three independently performed biological replicates. Both GFP (green) and RFP (red) output is shown for each condition, with error bars representing the standard deviations of the means for both GFP and RFP infectivity, normalized to WT. Cell lysates and virions were also probed for p24 Gag by Western blotting as described for (Continued on next page) Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 6 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. coding region directly into the 0 reading frame (Fig. 3A). As expected, the GP Only virus yielded exclusive production of GP (Fig. 3B) and, interestingly, did not produce virus particles when expressed alone, potentially reflecting GP’s large size relative to Gag and its lacking the p6 Gag late domain necessary to recruit components of the cellular endosomal sorting complex required for transport (ESCRT) machinery, which mediates virus particle release (Fig. 3B) (29–32). We coexpressed the GP Only virusatincreasinglevelswithWT,M1,and2SS GFP viruses, with relative infectivity measured as described for Fig. 2 (Fig. 3C and D; Table 1). As expected, increasing levels of GP expressed in trans resulted in a dose-dependent decrease in WT GFP infectivity, and coexpression with the GP Only virus markedly improved the infectivity of 2SS GFP virus, which confirmed GP functionality (Fig. 3C). Unexpectedly, expressing increasing amounts of GP Only virus with M1 virus did not lead to any further decrease in M1 infectivity; that remained in the range of 20 to 30% of WT even at what we estimated would be extraordinarily high (.4-fold relative to WT [Table 1]) predicted cellular GP/Gag ratios (Fig. 3C and G). Anti-p24 Gag immunoblot confirmed that these effects were not attributable to the GP Only virus affecting the efficiency of virus particle assembly, considering that virion-associated p24 Gag levels were similar for M1 and WT virions across the full range of GP expression levels (Fig. 3C). Further, virion p24 Gag levels correlated well only with infectivity for 2SS virus coexpressed with low levels of GP, as would be expected due to GP Only virus being able to complement the 2SS virus’s lack of protease activity (Fig. 3C; correlation analysis is in Fig. 3D). Accordingly, we could explain this result only by hypothesizing that HIV-1 FIG 3 Legend (Continued) Fig. 1B. Hairlines indicate sites where bands from a single immunoblot were spliced together to improve data presentation, but with no further modifications. (D) Virion p24 Gag levels were quantified from the experiment reported in panel C and plotted against the corresponding total relative infectivity measurements (GFP and RFP) for each coexpression scenario. Pearson correlation coefficients were determined for each condition. (E to G) Plots depicting expected infectivity (dashed blue lines) based on expected per-transcript GP/Gag ratios (derived as shown in Table 1) and the predictive model in Fig. 2E, relative to actual observed infectivity (orange lines; measured in panel C) for WT, 2SS, and M1 coexpression with GP Only , respectively. Error bars represent the standard deviations of the means for the three biological replicates. FIG 4 Protease inhibitor treatment confirms cis preference and reveals a strong upper limit to trans-mediated delivery of Gag-Pol into virions. (A) HEK293T cells cultured in the presence of 10 m M saquinavir were transfected to express WT, M1, or 2SS viruses (1,500 ng plasmid) in the absence or presence of increasing levels of GP Only virus (25, 100, or 500 ng plasmid). Cell lysates and virions were harvested at 48 h and probed for Gag and GP levels by quantitative Western blotting as for Fig. 1B. All values were normalized to the WT- only condition (black dashed line). The apparent limit of trans GP incorporation is indicated by the red dashed line. Hairlines indicate sites where bands from a single immunoblot were spliced together to improve data presentation, but with no further modifications. (B) Bar graph showing the fold change in GP incorporation efficiencies calculated from GP band intensities for virions divided by GP associated with cells, from three independent biological replicates, showing greater incorporation of GP when made in cis by WT and M1 viruses. Error bars represent the standard deviations of the means. *,P,0.05; **,P,0.001; ***,P,0.0001 (for comparisons to WT using Student’s two-tailed ttest). HIV-1 Gag-Pol Incorporation Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 7 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. virion infectivity is partially buffered against the effects of trans-delivered GP, perhaps by limiting GP incorporation levels in virions. Consistent with this hypothesis, GP Only coexpressed with WT or 2SS virus in trans also exhibited less-than-expected effects on either loss (WT) or gain (2SS) of virion infectivity based on predicted GP/Gag ratios (Fig. 3C, E, and F; predicted ratios are given in Table 1). Protease inhibitor treatment confirms a cis preference for GP incorporation into virions and reveals an upper limit to trans-delivered GP. To more directly test for a cis preference, we measured the levels of cisversus trans-mediated GP incorporated into virions in the absence of proteolytic cleavage, directly quantifying Gag and GP precursor levels in cells and virions under saquinavir treatment after coexpressing WT, M1, or 2SS with increasing amounts of GP Only virus (Fig. 4A). Remarkably, GP/Gag ratios in virions for any coexpression condition never exceeded an ;2-fold virion incorporation upper limit, suggesting a ceiling for GP incorporation where only a limited amount of trans-delivered GP can be incorporated into assembling virions before saturation (Fig. 4A, compare lane 4 to lane 1), always lower than the cis-mediated level of GP incorporation achieved by M1 even in the absence of any coexpressed GP (Fig. 4A, compare lane 5 to lane 4). Moreover, increasing GP Only expression had little or no effect on GP levels in M1 virions (Fig. 4A, lanes 5 to 8), thus likely explaining why M1 viruses did not lose infectivity when GP was overexpressed (Fig. 3C and G). Interestingly, we noted that particularly high levels of GP Only expression caused some trans-mediated repression of Gag synthesis in cells (e.g., in Fig. 4A, compare Pr55 Gag lane 4 to lane 1 for cell lysates). However, these effects would not be anticipated to account for any differences in GP/Gag ratios in virions. That HIV-1 exhibits a trans GP incorporation ceiling was most clearly illustrated when increasing levels of GP Only virus were expressed with 2SS virus, wherein GP levels could TABLE 1 Summary of predicted and observed infectivity measurements for the GP titration experiment reported in Fig. 3 Plasmid(s) Amt (ng) Relative expected in-cell GP/Gag ratio a Infectivity (% GFP) Predicted b Observed c WT 1,500 1.00 100 100.0 WT:GP Only 1,500:25 1.22 92.5 94.6 1,500:50 1.44 83 85.5 1,500:100 1.86 63 75.4 1,500:150 2.25 47.7 67.9 1,500:200 2.62 35.5 63.4 1,500:300 3.29 16 43.2 2SS 1,500 0.00 0 3.1 2SS:GP Only 1,500:25 0.24 46 10.2 1,500:50 0.47 87 28.9 1,500:100 0.92 101 56.4 1,500:150 1.34 87.5 77.2 1,500:200 1.74 69 80.8 1,500:300 2.48 39.5 88.3 M1 1,500 3.24 18 20.5 M1:GP Only 1,500:25 3.42 12 29.5 1,500:50 3.60 7 28.1 1,500:100 3.95 0 33.2 1,500:150 4.28 0 31.5 1,500:200 4.59 0 24.3 1,500:300 5.15 0 20.7 a Calculated based on the ratios of viral constructs expressed and per transcript frameshift frequency ratios measured from Fig. 1. b Predicted from complementation-based modeling in Fig. 2E, utilizing calculated expected GP/Gag ratios. GFP viruses (WT, 2SS, or M1) were expressed from plasmids cotransfected with increasing amounts of GP Only virus and/or empty vector control plasmid to a total DNA concentration of 1,800 ng. c Measured from Fig. 3C. All values were normalized to the WT-alone condition. Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 8 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. never achieve those observed for M1 virions, even when GP was expressed in marked excess (Fig. 4A; compare lanes 10, 11, and 12 to lane 5; the red dotted line indicates the apparent trans upper limit). Comparing virion GP levels to in-cell GP levels under cis versus trans conditions further supported the notion that GP is much more efficiently incorporated into virions when expressed in cis than in trans (Fig. 4B; in particular, compare WT and M1 without GP Only conditions to 2SS with GP Only coexpression). Taken together, this analysis reinforced (i) that efficient GP enrichment into virions is highly favored under cis conditions relative to trans and (ii) that HIV-1 is capable of preventing the incorporation of trans-delivered GP to virions should GP be expressed at extraordinarily high levels. Excessive cis-mediated GP incorporation into virions causes premature Gag/GP cleavage and loss of Pol subunits RT and IN from virions. The observation that M1 virus maintained ;20% infectivity even in the presence of a marked excess of GP prompted us to attempt to better define the mechanistic basis for the M1 infectivity defect in the first place. We had previously shown that M1 and other PRF mutant viruses exhibiting elevated FS frequency cause changes to Gag cleavage efficiency reflected in a decrease in virion-associated Pr55/p24 ratios, consistent with excessive protease activity (21). To evaluate the impact of excess GP on M1 virion genesis over time, we compared WT and M1 virus Gag/GP virion production over 48 h using antip24 Gag immunoblotting. We observed an ;2-fold decrease in M1 Gag Pr55/p24 ratios relative to WT in harvested virions even at the earliest time of virion detection (24 h posttransfection), consistent with the idea that M1’s relatively high levels of GP cause premature Gag proteolytic processing (Fig. 5A, compare the quantification of Pr55/p24 at 24 h [lanes 4 and 5] and 48 h [lanes 7 and 8] in the virion blot). To subsequently evaluate the impact of premature cleavage on the status of crucial Pol products, we also probed cells and virions to detect RT and IN at the 48-h time point using antisera specific for either protein, with virions prepared in the presence or absence of saquinavir (Fig. 5B and D). Remarkably, this experiment revealed that despite elevated (;1.4-fold) levels of GP polyprotein incorporation (Fig. 5C and E, gray bars), M1 virions contained smaller amounts of RT and IN (;10% less) than WT virions when generated in the presence of an active protease (Fig. 5B and D, compare lanes 3 and 1; quantified in Fig. 5C and E, blue and orange bars). This net loss of GP products (IN and RT) in M1 virions (Fig. 5B to E) might most easily be explained by a dropout of a subset of IN and RT products occurring due to premature or aberrant GP cleavage events, occurring either during or after the process of virion assembly. Taken together, these data suggested that Gag and GP cleavage events resulting from excess GP in M1 virus may account for at least some of the loss of infectivity observed for the M1 mutant (Fig. 2A). A GP incorporation ceiling may limit defects to reverse transcription. Considering that IN and RT were lost from M1 virions and because high levels of GP were previously shown to affect RNA dimer stability (14), we subsequently measured levels of viral RNA associated with M1 virions as well as the capacity of these virions to complete reverse transcription using quantitative real-time PCR (qRT-PCR) (Fig. 6). We observed no differences in the abundance of unspliced viral RNA in association with M1 virions compared to WT, in the presence or absence of saquinavir, indicating that M1’s infectivity defects are unlikely to reflect a defect in net viral RNA genome packaging (Fig. 6A). In contrast, assessment of RT products in infected target cells revealed significant decreases to the levels of early, late, and two-long-terminal-repeat (2LTR) circle DNA RT products, indicating that M1 virions are highly defective in the process of reverse transcription (Fig. 6B). As expected, no RT products were observed for FS mutant 2SS, which did not express GP. We were surprised, however, to detect a moderate but reproducible ;50% decrease in the efficiency of viral RNA packaging by the 2SS virus (Fig. 6A, 2SS alone [black and gray bars]). We also sought to better understand the loss of infectivity we had observed for WT virus in the presence of elevated levels of trans-delivered GP (Fig. 3), measuring RNA packaging and RT efficiency for WT, M1, or 2SS viruses coexpressed with GP Only virus HIV-1 Gag-Pol Incorporation Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 9 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. transcripts produced from transfections with a WT HIV-1 genome. For comparisons with three or more groups, a one-way analysis of variance (ANOVA) was performed using Microsoft Excel. If this determined that a statistically significant difference existed within the group (P,0.05), a further post hoc test was done using Tukey’s honestly significant difference test (HSD) in Excel (66, 67). If only two groups were compared, Student’sttest in Excel was used. ANOVA results and relevant Tukey’s HSD and ttest comparisons are shown in the figures, unless Pwas .0.05 for the ANOVA, in which case only the ANOVA results are shown. Analysis of reverse transcription products. Cells (1 10 6 ) were infected with VSV-G pseudotyped VLPs. At 24 h postinfection, total DNA was harvested using the DNeasy kit from Qiagen. Quantitative real-time PCR was performed using the SsoFast probe kit (Bio-Rad). For early RT products, we used primers as previously described (68): ert2f (GTGCCCGTCTGTTGTGTGAC), ert2r (GGCGCCACTGCTAGAG ATTT), and ert2 probe (CTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGG). For late RT and 2LTR, we used primers that were described previously (69) but modified as necessary for analyzing the NL4-3 strain as follows: HIV-1 late forward MH531 (TGTGTGCCCGTCTGTTGTGT), rev MH532v (GAGTCCTGCGTCGAG AGATC), late RT probe (CAGTGGCGCCCGAACAGGGA), HIV-1 2LTR Fwd primer (AACTAGGGAACCCA CTGCTTAAG), HIV-1 2LTR Rev primer (TCCACAGATCAAGGATATCTTGTC), and HIV-1 2LTR probe (ACAC TACTTTGAGCACTCAAGGCAAGCTTT). A standard curve was derived using a gene block (Integrated DNA Technologies) containing the amplicon to determine the absolute number of molecules present, and total reverse transcription products in each sample were calculated and compared to infection with WT HIV-1 genomes. p24 Gag Western blots were used to ensure infection with equivalent numbers of virions. Statistical analyses were performed as described above for analysis of viral RNA packaging. ACKNOWLEDGMENTS The following reagents were obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: HIV-1 p24 hybridoma (183-H12-5C) from Bruce Chesebro (62), HIV-1 IN monoclonal antibody (2C11) from Dag E. Helland (catalog no. 7374) (63), and saquinavir. This research was supported by NIH grants R01AI110221 (N.M.S.), P01CA022332 (N.M.S., P.A.), R35GM118131 (S.E.B.), and T32GM008349 (B.E.B.); NSF graduate research fellowships DGE1747503 (B.E.B.) and DGE-1256269 (J.T.B.); a Shaw Scientist Award from the Greater Milwaukee Foundation (N.M.S.); and student fellowships from the University of Wisconsin-Madison (J.R.K.) and Wisconsin Alumni Research Foundation (J.T.B.). REFERENCES 1. Watts JM, Dang KK, Gorelick RJ, Leonard CW, Bess JW, Jr, Swanstrom R, Burch CL, Weeks KM. 2009. Architecture and secondary structure of an entire HIV-1 RNA genome. Nature 460:711–716. https://doi.org/10.1038/ nature08237. 2. D'Souza V, Summers MF. 2005. How retroviruses select their genomes. Nat Rev Microbiol 3:643–655. https://doi.org/10.1038/nrmicro1210. 3. Kuzembayeva M, Dilley K, Sardo L, Hu WS. 2014. Life of psi: how fulllength HIV-1 RNAs become packaged genomes in the viral particles. Virology 454-455:362–370. https://doi.org/10.1016/j.virol.2014.01.019. 4. Jacks T, Power MD, Masiarz FR, Luciw PA, Barr PJ, Varmus HE. 1988. Characterization of ribosomal frameshifting in HIV-1 gag-pol expression. Nature 331:280–283. https://doi.org/10.1038/331280a0. 5. Parkin NT, Chamorro M, Varmus HE. 1992. Human immunodeficiency virus type 1 gag-pol frameshifting is dependent on downstream mRNA secondary structure: demonstration by expression in vivo. J Virol 66: 5147–5151. https://doi.org/10.1128/JVI.66.8.5147-5151.1992. 6. Baril M, Dulude D, Gendron K, Lemay G, Brakier-Gingras L. 2003. Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M. RNA 9:1246–1253. https://doi.org/10.1261/rna.5113603. 7. Staple DW, Butcher SE. 2003. Solution structure of the HIV-1 frameshift inducing stem-loop RNA. Nucleic Acids Res 31:4326–4331. https://doi .org/10.1093/nar/gkg654. 8. Staple DW, Butcher SE. 2005. Solution structure and thermodynamic investigation of the HIV-1 frameshift inducing element. J Mol Biol 349: 1011–1023. https://doi.org/10.1016/j.jmb.2005.03.038. 9. Brierley I, Dos Ramos FJ. 2006. Programmed ribosomal frameshifting in HIV-1 and the SARS-CoV. Virus Res 119:29–42. https://doi.org/10.1016/j .virusres.2005.10.008. 10. Brakier-Gingras L, Charbonneau J, Butcher SE. 2012. Targeting frameshifting in the human immunodeficiency virus. Expert Opin Ther Targets 16: 249–258. https://doi.org/10.1517/14728222.2012.665879. 11. Freed EO. 2015. HIV-1 assembly, release and maturation. Nat Rev Microbiol 13:484–496. https://doi.org/10.1038/nrmicro3490. 12. Sundquist WI, Krausslich HG. 2012. HIV-1 assembly, budding, and maturation. Cold Spring Harb Perspect Med 2:a006924. https://doi.org/10.1101/ cshperspect.a006924. 13. Frankel AD, Young JA. 1998. HIV-1: fifteen proteins and an RNA. Annu Rev Biochem 67:1–25. https://doi.org/10.1146/annurev.biochem.67.1.1. 14. Shehu-Xhilaga M, Crowe SM, Mak J. 2001. Maintenance of the Gag/Gag- Pol ratio is important for human immunodeficiency virus type 1 RNA dimerization and viral infectivity. J Virol 75:1834–1841. https://doi.org/10 .1128/JVI.75.4.1834-1841.2001. 15. Gan X, Gould SJ. 2012. HIV Pol inhibits HIV budding and mediates the severe budding defect of Gag-Pol. PLoS One 7:e29421. https://doi.org/10 .1371/journal.pone.0029421. 16. Haraguchi H, Sudo S, Noda T, Momose F, Kawaoka Y, Morikawa Y. 2010. Intracellular localization of human immunodeficiency virus type 1 Gag and GagPol products and virus particle release: relationship with the Gag-to-GagPol ratio. Microbiol Immunol 54:734–746. https://doi.org/10 .1111/j.1348-0421.2010.00276.x. 17. Yu FH, Huang KJ, Wang CT. 2020. HIV-1 mutant assembly, processing and infectivity expresses Pol independent of Gag. Viruses 12:54. https://doi .org/10.3390/v12010054. 18. Hill M, Tachedjian G, Mak J. 2005. The packaging and maturation of the HIV-1 Pol proteins. Curr HIV Res 3:73–85. https://doi.org/10.2174/1570 162052772942. 19. Mouzakis KD, Lang AL, Vander Meulen KA, Easterday PD, Butcher SE. 2013. HIV-1 frameshift efficiency is primarily determined by the stability of base pairs positioned at the mRNA entrance channel of the ribosome. Nucleic Acids Res 41:1901–1913. https://doi.org/10.1093/nar/gks1254. 20. Korniy N, Goyal A, Hoffmann M, Samatova E, Peske F, Pohlmann S, Rodnina MV. 2019. Modulation of HIV-1 Gag/Gag-Pol frameshifting by tRNA abundance. Nucleic Acids Res 47:5210–5222. https://doi.org/10 .1093/nar/gkz202. Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 16 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. 21. Garcia-Miranda P, Becker JT, Benner BE, Blume A, Sherer NM, Butcher SE. 2016. Stability of HIV frameshift site RNA correlates with frameshift efficiency and decreased virus infectivity. J Virol 90:6906–6917. https://doi .org/10.1128/JVI.00149-16. 22. Hilimire TA, Bennett RP, Stewart RA, Garcia-Miranda P, Blume A, Becker J, Sherer N, Helms ED, Butcher SE, Smith HC, Miller BL. 2016. N-Methylation as a strategy for enhancing the affinity and selectivity of RNA-binding peptides: application to the HIV-1 frameshift-stimulating RNA. ACS Chem Biol 11:88–94. https://doi.org/10.1021/acschembio.5b00682. 23. Khorchid A, Halwani R, Wainberg MA, Kleiman L. 2002. Role of RNA in facilitating Gag/Gag-Pol interaction. J Virol 76:4131–4137. https://doi.org/ 10.1128/jvi.76.8.4131-4137.2002. 24. Huang Y, Khorchid A, Wang J, Parniak MA, Darlix JL, Wainberg MA, Kleiman L. 1997. Effect of mutations in the nucleocapsid protein (NCp7) upon Pr160(gag-pol) and tRNA(Lys) incorporation into human immunodeficiency virus type 1. J Virol 71:4378–4384. https://doi.org/10.1128/JVI .71.6.4378-4384.1997. 25. Hill MK, Shehu-Xhilaga M, Crowe SM, Mak J. 2002. Proline residues within spacer peptide p1 are important for human immunodeficiency virus type 1 infectivity, protein processing, and genomic RNA dimer stability. J Virol 76:11245–11253. https://doi.org/10.1128/jvi.76.22.11245-11253.2002. 26. de Marco A, Heuser AM, Glass B, Krausslich HG, Muller B, Briggs JA. 2012. Role of the SP2 domain and its proteolytic cleavage in HIV-1 structural maturation and infectivity. J Virol 86:13708–13716. https://doi.org/10 .1128/JVI.01704-12. 27. Leiherer A, Ludwig C, Wagner R. 2009. Uncoupling human immunodeficiency virus type 1 Gag and Pol reading frames: role of the transframe protein p6*in viral replication. J Virol 83:7210–7220. https://doi.org/10 .1128/JVI.02603-08. 28. Henderson BR, Percipalle P. 1997. Interactions between HIV Rev and nuclear import and export factors: the Rev nuclear localisation signal mediates specific binding to human importin-beta. J Mol Biol 274:693–707. https://doi.org/10.1006/jmbi.1997.1420. 29. Mergener K, Facke M, Welker R, Brinkmann V, Gelderblom HR, Krausslich HG. 1992. Analysis of HIV particle formation using transient expression of subviral constructs in mammalian cells. Virology 186:25–39. https://doi .org/10.1016/0042-6822(92)90058-w. 30. Garrus JE, von Schwedler UK, Pornillos OW, Morham SG, Zavitz KH, Wang HE, Wettstein DA, Stray KM, Cote M, Rich RL, Myszka DG, Sundquist WI. 2001. Tsg101 and the vacuolar protein sorting pathway are essential for HIV-1 budding. Cell 107:55–65. https://doi.org/10.1016/s0092-8674(01)00506-2. 31. Demirov DG, Ono A, Orenstein JM, Freed EO. 2002. Overexpression of the N-terminal domain of TSG101 inhibits HIV-1 budding by blocking late domain function. Proc Natl Acad Sci U S A 99:955–960. https://doi.org/10 .1073/pnas.032511899. 32. Demirov DG, Orenstein JM, Freed EO. 2002. The late domain of human immunodeficiency virus type 1 p6 promotes virus release in a cell type-dependent manner. J Virol 76:105–117. https://doi.org/10.1128/jvi.76.1.105-117.2002. 33. Hill MK, Hooker CW, Harrich D, Crowe SM, Mak J. 2001. Gag-Pol supplied in trans is efficiently packaged and supports viral function in human immunodeficiency virus type 1. J Virol 75:6835–6840. https://doi.org/10 .1128/JVI.75.15.6835-6840.2001. 34. Shehu-Xhilaga M, Lee JY, Campbell S, Marshall JA, Crowe SM, Mak J. 2002. Overexpression and incorporation of GagPol precursor does not impede packaging of HIV-1 tRNA(Lys3) but promotes intracellular budding of viruslike particles. J Biomed Sci 9:697–705. https://doi.org/10.1007/BF02254998. 35. Smith AJ, Srinivasakumar N, Hammarskjold ML, Rekosh D. 1993. Requirements for incorporation of Pr160gag-pol from human immunodeficiency virus type 1 into virus-like particles. J Virol 67:2266–2275. https://doi.org/ 10.1128/JVI.67.4.2266-2275.1993. 36. Huang M, Martin MA. 1997. Incorporation of Pr160(gag-pol) into virus particles requires the presence of both the major homology region and adjacent C-terminal capsid sequences within the Gag-Pol polyprotein. J Virol 71:4472–4478. https://doi.org/10.1128/JVI.71.6.4472-4478.1997. 37. Wills JW, Craven RC. 1991. Form, function, and use of retroviral gag proteins. AIDS 5:639–654. https://doi.org/10.1097/00002030-199106000-00002. 38. Takagi S, Momose F, Morikawa Y. 2017. FRET analysis of HIV-1 Gag and Gag- Pol interactions. FEBS Open Bio 7:1815–1825. https://doi.org/10.1002/2211 -5463.12328. 39. Kutluay SB, Bieniasz PD. 2010. Analysis of the initiating events in HIV-1 particle assembly and genome packaging. PLoS Pathog 6:e1001200. https://doi.org/10.1371/journal.ppat.1001200. 40. Hendrix J, Baumgartel V, Schrimpf W, Ivanchenko S, Digman MA, Gratton E, Krausslich HG, Muller B, Lamb DC. 2015. Live-cell observation of cytosolic HIV-1 assembly onset reveals RNA-interacting Gag oligomers. J Cell Biol 210:629–646. https://doi.org/10.1083/jcb.201504006. 41. Barajas BC, Tanaka M, Robinson BA, Phuong DJ, Chutiraka K, Reed JC, Lingappa JR. 2018. Identifying the assembly intermediate in which Gag first associates with unspliced HIV-1 RNA suggests a novel model for HIV- 1 RNA packaging. PLoS Pathog 14:e1006977. https://doi.org/10.1371/ journal.ppat.1006977. 42. Reed JC, Molter B, Geary CD, McNevin J, McElrath J, Giri S, Klein KC, Lingappa JR. 2012. HIV-1 Gag co-opts a cellular complex containing DDX6, a helicase that facilitates capsid assembly. J Cell Biol 198:439–456. https://doi.org/10.1083/jcb.201111012. 43. Lingappa JR, Reed JC, Tanaka M, Chutiraka K, Robinson BA. 2014. How HIV-1 Gag assembles in cells: putting together pieces of the puzzle. Virus Res 193:89–107. https://doi.org/10.1016/j.virusres.2014.07.001. 44. Dooher JE, Schneider BL, Reed JC, Lingappa JR. 2007. Host ABCE1 is at plasma membrane HIV assembly sites and its dissociation from Gag is linked to subsequent events of virus production. Traffic 8:195–211. https://doi.org/10.1111/j.1600-0854.2006.00524.x. 45. Deng Y, Hammond JA, Pauszek R, Ozog S, Chai I, Rabuck-Gibbons J, Lamichhane R, Henderson SC, Millar DP, Torbett BE, Williamson JR. 2021. Discrimination between functional and non-functional cellular Gag complexes involved in HIV-1 assembly. J Mol Biol 433:166842. https://doi.org/ 10.1016/j.jmb.2021.166842. 46. Lyon K, Aguilera LU, Morisaki T, Munsky B, Stasevich TJ. 2019. Live-cell single RNA imaging reveals bursts of translational frameshifting. Mol Cell 75: 172–183.E9. https://doi.org/10.1016/j.molcel.2019.05.002. 47. Chen J, Liu Y, Wu B, Nikolaitchik OA, Mohan PR, Chen J, Pathak VK, Hu WS. 2020. Visualizing the translation and packaging of HIV-1 full-length RNA. Proc Natl Acad Sci U S A 117:6145–6155. https://doi.org/10.1073/pnas .1917590117. 48. Pocock GM, Zimdars LL, Yuan M, Eliceiri KW, Ahlquist P, Sherer NM. 2017. Diverse activities of viral cis-acting RNA regulatory elements revealed using multicolor, long-term, single-cell imaging. Mol Biol Cell 28:476–487. https://doi.org/10.1091/mbc.E16-08-0612. 49. Pocock GM, Becker JT, Swanson CM, Ahlquist P, Sherer NM. 2016. HIV-1 and M-PMV RNA nuclear export elements program viral genomes for distinct cytoplasmic trafficking behaviors. PLoS Pathog 12:e1005565. https://doi.org/10.1371/journal.ppat.1005565. 50. Behrens RT, Aligeti M, Pocock GM, Higgins CA, Sherer NM. 2017. Nuclear export signal masking regulates HIV-1 Rev trafficking and viral RNA nuclear export. J Virol 91:e02107-16. https://doi.org/10.1128/JVI.02107-16. 51. Jouvenet N, Simon SM, Bieniasz PD. 2009. Imaging the interaction of HIV- 1 genomes and Gag during assembly of individual viral particles. Proc Natl Acad Sci U S A 106:19114–19119. https://doi.org/10.1073/pnas .0907364106. 52. Becker JT, Sherer NM. 2017. Subcellular localization of HIV-1 gag-pol mRNAs regulates sites of virion assembly. J Virol 91:e02315-16. https://doi .org/10.1128/JVI.02315-16. 53. Haraguchi H, Noda T, Kawaoka Y, Morikawa Y. 2012. A large extension to HIV-1 Gag, like Pol, has negative impacts on virion assembly. PLoS One 7: e47828. https://doi.org/10.1371/journal.pone.0047828. 54. Karacostas V, Wolffe EJ, Nagashima K, Gonda MA, Moss B. 1993. Overexpression of the HIV-1 gag-pol polyprotein results in intracellular activation of HIV- 1 protease and inhibition of assembly and budding of virus-like particles. Virology 193:661–671. https://doi.org/10.1006/viro.1993.1174. 55. Park J, Morrow CD. 1992. The nonmyristylated Pr160gag-pol polyprotein of human immunodeficiency virus type 1 interacts with Pr55gag and is incorporated into viruslike particles. J Virol 66:6304–6313. https://doi.org/ 10.1128/JVI.66.11.6304-6313.1992. 56. Yu FH, Chou TA, Liao WH, Huang KJ, Wang CT. 2015. Gag-Pol transframe domain p6*is essential for HIV-1 protease-mediated virus maturation. PLoS One 10:e0127974. https://doi.org/10.1371/journal.pone.0127974. 57. Krausslich HG. 1991. Human immunodeficiency virus proteinase dimer as component of the viral polyprotein prevents particle assembly and viral infectivity. Proc Natl Acad Sci U S A 88:3213–3217. https://doi.org/10 .1073/pnas.88.8.3213. 58. Bendjennat M, Saffarian S. 2016. The race against protease activation defines the role of ESCRTs in HIV budding. PLoS Pathog 12:e1005657. https://doi.org/10.1371/journal.ppat.1005657. 59. Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Martin MA. 1986. Production of acquired immunodeficiency syndrome-associ- ated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J Virol 59:284–291. https://doi.org/10.1128/JVI.59.2 .284-291.1986. HIV-1 Gag-Pol Incorporation Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 17 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235. 60. Aligeti M, Behrens RT, Pocock GM, Schindelin J, Dietz C, Eliceiri KW, Swanson CM, Malim MH, Ahlquist P, Sherer NM. 2014. Cooperativity among Rev-associated nuclear export signals regulates HIV-1 gene expression and is a determinant of virus species tropism. J Virol 88:14207–14221. https://doi .org/10.1128/JVI.01897-14. 61. Vella S, Floridia M. 1998. Saquinavir. Clinical pharmacology and efficacy. Clin Pharmacokinet 34:189–201. https://doi.org/10.2165/00003088-199834030 -00002. 62. Chesebro B, Wehrly K, Nishio J, Perryman S. 1992. Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T- cell-tropic isolates: definition of critical amino acids involved in cell tropism. J Virol 66:6547–6554. https://doi.org/10.1128/JVI.66.11.6547 -6554.1992. 63.NilsenBM,HauganIR,BergK,OlsenL,BrownPO,HellandDE.1996. Monoclonal antibodies against human immunodeficiency virus type 1 integrase: epitope mapping and differential effects on integrase activities in vitro. J Virol 70:1580–1587. https://doi.org/10.1128/JVI.70.3 .1580-1587.1996. 64. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an opensource platform for biological-image analysis. Nat Methods 9:676–682. https://doi.org/10.1038/nmeth.2019. 65. Shan L, Rabi SA, Laird GM, Eisele EE, Zhang H, Margolick JB, Siliciano RF. 2013. A novel PCR assay for quantification of HIV-1 RNA. J Virol 87: 6521–6525. https://doi.org/10.1128/JVI.00006-13. 66. Yandell BS. 1997. Practical data analysis for designed experiments. Chapman & Hall, London, United Kingdom. 67. Bruce JW, Bracken M, Evans E, Sherer N, Ahlquist P. 2021. ZBTB2 represses HIV-1 transcription and is regulated by HIV-1 Vpr and cellular DNA damage responses. PLoS Pathog 17:e1009364. https://doi.org/10.1371/journal.ppat.1009364. 68. Munk C, Brandt SM, Lucero G, Landau NR. 2002. A dominant block to HIV- 1 replication at reverse transcription in simian cells. Proc Natl Acad Sci U S A 99:13843–13848. https://doi.org/10.1073/pnas.212400099. 69. Butler SL, Hansen MS, Bushman FD. 2001. A quantitative assay for HIV DNA integration in vivo. Nat Med 7:631–634. https://doi.org/10.1038/87979. Benner et al. Journal of Virology January 2022 Volume 96 Issue 1 e01349-21 jvi.asm.org 18 Downloaded from https://journals.asm.org/journal/jvi on 13 November 2023 by 150.214.182.235.