Regulation of TIA-1 Condensates: Zn2+ and RGG Motifs Promote Nucleic Acid Driven LLPS and Inhibit Irreversible Aggregation

Regula ion o TIA-1 Condensa es: Zn 2+ and RGG Mo i s P omo e Nucleic Acid D i en LLPS and Inhibi I e e sible Agg ega ion Danella L. Wes 1 † , Fionna E. Loughlin 1 † , F ancisco Ri e o-Rod íguez 2 , Na een Vankada i 1 , Alejand o Velázquez-C uz 2 , Lau a Co ales-Gue e o 2 , I ene Díaz-Mo eno 2 * and Jacqueline A. Wilce 1 * 1 Monash Biomedicine Disco e y Ins i u e and Depa men o Biochemis y and Molecula Biology, Monash Uni e si y, Clay on, VIC, Aus alia, 2 Ins i u e o Chemical Resea ch, Uni e si y o Se ille—CSIC, Se ille, Spain S ess g anules a e non-memb ane bound RNA-p o ein g anules essen ial o su i al du ing acu e cellula s ess. TIA-1 is a key p o ein in he o ma ion o s ess g anules ha unde goes liquid-liquid phase sepa a ion by associa ion wi h specific RNAs and p o ein- p o ein in e ac ions. Howe e , he undamen al p ope ies o he TIA-1 p o ein ha enable phase-sepa a ion also ende TIA-1 suscep ible o he o ma ion o i e e sible fib illa agg ega es. Despi e his, wi hin physiological s ess g anules, TIA-1 is no p esen as fib ils, poin ing o addi ional ac o s wi hin he cell ha p e en TIA-1 agg ega ion. He e we show ha he e o ypic in e ac ions wi h s ess g anule co- ac o s Zn 2+ and RGG- ich egions om FUS each ac oge he wi h nucleic acid o induce he liquid-liquid phase sepa a ion o TIA-1. In con as , hese co- ac o s do no enhance nucleic acid induced fib il o ma ion o TIA-1, bu a he obus ly inhibi he p ocess. NMR i a ion expe imen s e ealed specific in e ac ions be ween Zn 2+ and H94 and H96 in RRM2 o TIA-1. S ikingly, his in e ac ion p omo es mul ime iza ion o TIA-1 independen ly o he p ion-like domain. Thus, h ough di e en molecula mechanisms, hese s ess g anule co- ac o s p omo e TIA-1 liquid-liquid phase sepa a ion and supp ess fib illa agg ega es, po en ially con ibu ing o he dynamic na u e o s ess g anules and he cellula p o ec ion ha hey p o ide. Keywo ds: TIA1, RNA binding p o ein, liquid-liquid phase sepa a ion, p ion-like domain, RRM, amyloid fib il, zinc, RGG mo i INTRODUCTION S ess g anules p o ec he cell du ing imes o acu e s ess by seques e ing mRNAs in dynamic RNA- p o ein compa men s whe e hey a e p o ec ed om deg ada ion (Riggs e al., 2020). Fo ma ion o s ess g anules occu s h ough a summa ion o mul i alen p o ein and RNA in e ac ions esul ing in de-mixing om he cy osol h ough he physical p ocess o liquid-liquid phase sepa a ion (LLPS) (Ho mann e al., 2021). The g anules o m wi h a dense co e and a liquid-like shell, and emain in a dynamic assembled s a e o se e al hou s un il disassembly occu s (Wheele e al., 2016). Abe an s ess g anule dynamics is associa ed wi h neu odegene a i e diseases, including amyo ophic la e al scle osis (ALS), on o- empo al loba degene a ion (FTLD) as well as auopa hies (Albe i and Do mann, 2019;Wolozin and I ano , 2019;Albe i and Hyman, 2021). Specifically, delayed disassembly and educed dynamics Edi ed by: Tomohi o Yamazaki, Osaka Uni e si y, Japan Re iewed by: Masa o Ka o, Uni e si y o Texas Sou hwes e n Medical Cen e , Uni ed S a es Joseph B. Rayman, Columbia Uni e si y, Uni ed S a es *Co espondence: I ene Díaz-Mo eno [email p o ec ed] Jacqueline A. Wilce [email p o ec ed]u † These au ho s sha e fi s au ho ship Special y sec ion: This a icle was submi ed o RNA Ne wo ks and Biology, a sec ion o he jou nal F on ie s in Molecula Biosciences Recei ed: 03 June 2022 Accep ed: 24 June 2022 Published: 14 July 2022 Ci a ion: Wes DL, Loughlin FE, Ri e o-Rod íguez F, Vankada i N, Velázquez-C uz A, Co ales-Gue e o L, Díaz-Mo eno I and Wilce JA (2022) Regula ion o TIA- 1 Condensa es: Zn 2+ and RGG Mo i s P omo e Nucleic Acid D i en LLPS and Inhibi I e e sible Agg ega ion. F on . Mol. Biosci. 9:960806. doi: 10.3389/ molb.2022.960806 F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608061 ORIGINAL RESEARCH published: 14 July 2022 doi: 10.3389/ molb.2022.960806 wi hin s ess g anules is widely hypo hesized o acili a e he agg ega ion o s ess g anule-associa ed p o eins, esul ing in pa hologic inclusions ha a e a hallma k o hese neu odegene a i e diseases (Zhang e al., 2019). TIA-1 is a cha ac e is ic s ess g anule p o ein ha binds mRNA and con ibu es o s ess g anule o ma ion ia i s C- e minal P ion-like domain (P LD) (Gilks e al., 2004). The N- e minus o TIA-1 comp ises h ee RRM domains, o which RRM2 and 3 (“RRM2,3”) coope a i ely bind a ge RNA wi h high a fini y (Dembe e al., 1996;C uz-Galla do e al., 2014; Wa is e al., 2017). In i o s udies o TIA-1 iden ified i s in insic abili y o unde go LLPS ei he alone (Mackenzie e al., 2017)o as enhanced by mul i-si e a ge nucleic acid (Loughlin e al., 2021). These same s udies also showed ha , o e ime, TIA-1 p og esses o o m i e e sible ß-shee ich agg ega es and ha his is also enhanced in he p esence o a ge nucleic acid. Thus, he sel - associa ing p ope ies ha unde lie TIA-1 unc ion also p edispose i o i e e sible agg ega ion, po en ially unde lying disease. In ac , mu a ions in TIA-1 associa ed wi h Welande dis al myopa hy (WDM) and ALS con e a g ea e p opensi y o agg ega ion and delayed s ess g anule disassembly, consis en wi h his mechanism o disease (Mackenzie e al., 2017). Howe e , ex ensi e amyloid agg ega es o TIA-1 a e no a dis inc i e ea u e o s ess g anules in heal hy cells, sugges ing ha in e ac ions p e en ing agg ega ion o TIA-1 p o ein exis wi hin he cell. He ein we in es iga e he e ec o s ess g anule co- ac o s on LLPS and fib il o ma ion o TIA-1 in i o. S ess g anules a e made up o hund eds o p o eins and co- ac o s, a subse o which specifically con ibu e o he assembly and main enance o he liquid s a e (Jain e al., 2016;Taube e al., 2020). Zn 2+ has been epo ed o be a second messenge , enhancing he o ma ion o TIA-1 posi i e s ess g anules (Rayman e al., 2018). The elease o in acellula Zn 2+ was obse ed in cells and issues exposed o a seni e ea men , consis en wi h Zn 2+ playing a ole in s ess g anule o ma ion in esponse o oxida i e s ess. When Zn 2+ was made una ailable in i o by chela ion, he o ma ion o TIA-1 posi i e s ess g anules was educed (Rayman e al., 2018;Ca ascoso e al., 2019). S udies o pu ified TIA-1 p o ein showed Zn 2+ dependen mul ime iza ion using a Fö s e esonance ene gy ans e (FRET) coinciding wi h o ma ion o LLPS wi hou ex ensi e ß-shee o ma ion (Rayman e al., 2018). This s udy hus sugges ed ha a di ec in e ac ion be ween Zn 2+ and TIA-1, and subsequen change in mul ime iza ion leading o LLPS, could influence s ess g anule o ma ion. This aises ques ions o how Zn 2+ di e en ially a ec s TIA-1 LLPS s fib illa agg ega ion, and he molecula basis o he Zn 2+ -TIA- 1 in e ac ion. In he cu en s udy, he e o e, we analysed he e ec o Zn 2+ on LLPS and fib illa agg ega ion o TIA-1, he nucleic acid-induced TIA-1 condensa es and also in es iga ed he molecula basis o he Zn 2+ :TIA-1 in e ac ion. S ess g anules a e pa icula ly en iched wi h RNA-binding p o eins wi h low complexi y egions, including P LDs and also ano he ype o in insically diso de ed egion (IDR) ich in A g- Gly-Gly epea s (RGG) (Chong e al., 2018;Youn e al., 2019). RGG-con aining p o eins include he co e s ess g anule p o ein G3BP1/2, in which he RGG egion media es an RNA induced swi ch o ins iga e condensa ion (Guillen-Boixe e al., 2020; Sande s e al., 2020;Yang e al., 2020), and he FUS p o ein, ha is ec ui ed o s ess g anules by i s RGG-zinc finge domain in disease (Ben mann e al., 2012). I has also been shown ha he A g- ich epea pep ides de i ed om pa hogenic C9o 72 expansions associa e wi h s ess g anules, a ec ing hei dynamics (Boeynaems e al., 2017). While well known o hei abili y o in e ac di ec ly wi h RNA, RGG- ich IDRs can also in e ac wi h P LDs, enhancing LLPS (Kau e al., 2021). Mul i alen ansien in e ac ions be ween he P LD and RGG IDRs o FUS enhance phase sepa a ion (Qama e al., 2018;Wang e al., 2018). Fu he mo e, ensuing condensa es can co- ec ui o he RNA-binding p o eins, including TIA-1, po en ially also ia in e molecula he e o ypic RGG:P LD in e ac ions (Qama e al., 2018;Wang e al., 2018). Thus, in e ac ions be ween P LD and RGG- ich IDRs a e likely o undamen al impo ance in s ess g anule biology and disease. We ha e hence examined he in e ac ions o he na i e RGG- ich RNA-binding domain o FUS (FUS-RBD) wi h TIA-1 as a model o he e ec o he e o ypic in e ac ions in p o ein-RNA condensa es. The cu en s udy in es iga es he way in which s ess g anule p o eins and co- ac o s influence LLPS and fib illa agg ega ion o TIA-1. We epo he impac s o Zn 2+ and FUS-RBD on TIA-1 in he absence and p esence o nucleic acid. Ou in es iga ion u ilises in i o assays o TIA-1 LLPS and fib illa agg ega e o ma ion as p e iously used o p obe he e ec o nucleic acid (Loughlin e al., 2021) as well as NMR spec oscopy and si e di ec ed mu agenesis o u he iden i y Zn 2+ binding si es. These expe imen s e ealed ha he me al ion Zn 2+ no only enhances LLPS o TIA-1 alone, bu also u he enhances nucleic acid-induced TIA-1 LLPS. NMR spec oscopy and mu a ional s udies defined a zinc binding si e on RRM2 leading o he iden ifica ion o H94 and H96 as Zn 2+ ligands. Su p isingly, Zn 2+ was ound o induce mul ime iza ion o he isola ed TIA-1 RRM2,3 domains e en in he absence o he P LD, po en ially eflec ing an addi ional mode o TIA-1 sel - in e ac ion ia Zn 2+ liga ion. Zn 2+ -enhanced LLPS o ull leng h TIA-1, howe e , did no esul in fib illa agg ega e o ma ion o TIA-1 and Zn 2+ s ikingly inhibi ed nucleic acid- induced fib illa agg ega ion o TIA-1 e en a sub-s oichiome ic le els. FUS-RBD also u he enhanced nucleic acid-induced LLPS o TIA-1, bu e ec i ely inhibi ed fib illa agg ega ion, p esumably h ough a di ec compe i ion be ween P LD:P LD and P LD:RGG in e ac ions. Toge he , his s udy showcases wo ypes o he e o ypic in e ac ion o TIA-1 ha p omo e LLPS, bu supp ess he agg ega ion capaci y o TIA-1 in i o, po en ially con ibu ing o he main enance o he e e sible and dynamic s a e o TIA-1 wi hin s ess g anules. MATERIALS AND METHODS Cloning o TIA-1 RRM2,3 His Mu an s To cons uc he plasmid o exp ession o TIA-1 RRM2,3 (93- 274), pGEX-4T-2 (GE Heal hca e) was modified o bea a 6xHis ag and a h ombin clea age si e. TIA-1 RRM2,3 was inse ed di ec ly a e he h ombin si e using oligonucleo ides TIA-1 F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608062 Wes e al. Regula ion o TIA-1 Condensa es RRM2,3-Fo (GCGTGGATCCCCAGGAATTCCCAATCATTT CCATGTCTTTGTTGGTG) and TIA-1 RRM2,3- e (CAG TCACGATGCGGCCGCTTATTTGCCCCAATAGCATTTCAC AAC). To cons uc he plasmid TIA-1 RRM2,3 bea ing mu a ions H94A, H96 A and H94A H96A, si e-di ec ed mu agenesis by in e se PCR (Liu and Naismi h, 2008) was pe o med using he oligonucleo ide pai s: TIA-1 RRM2,3-H94A-Fo : CCAATgc TTCCATGTCTTTG TTGGTGATCTCAGCCCAG TIA-1 RRM2,3-H94A-Re : ATGGAAagcATTGGGAATTCC TGGGGATCCACG TIA-1 RRM2,3-H96A-Fo : TTTCgc GTCTTTGTTGGTGA TCTCAGCCCAG TIA-1 RRM2,3-H96A-Re : AAAGACagcGAAATGATTGGG AATTCCTGGGGATCCACG TIA-1 RRM2,3-H94A H96A-Fo : CCAATgc TTCgcTGTCT TTGTTGGTGATCTCAGCCCAG TIA-1 RRM2,3-H94A H96A-Re : AAAGACagcGAAagcATT GGGAATTCCTGGGGATCCACGCGG Full-Leng h TIA-1 P o ein P epa a ion TIA-1 p o ein sho iso o m (P31483-2) was exp essed om plasmid pETM11 as a 6xHis- agged p o ein in BL21 pLysS E. coli cells and pu ified as p e iously epo ed (Loughlin e al., 2021). In b ie , his in ol ed ini ial pu ifica ion using Co-TALON me al a fini y esin (Taka a), ollowed by clea age o he 6xHis- ag by using TEV p o ease and i s emo al using Ni- NTA esin. The final pu ifica ion was by size exclusion ch oma og aphy in a bu e es ablished o main ain TIA-1 solubili y (20 mM sodium phospha e, 60 mM KCl, 0.5 M a ginine-HCl, 1 mM MgCl 2 , 2 mM DTT, 0.5 mM EDTA, pH 7.0). Aliquo s we e concen a ed o a maximum o 100 μM, fil e ed and s o ed a −80°C in size exclusion bu e . TIA-1 p o ein used in Zn 2+ expe imen s was p epa ed in he same manne , wi h he excep ion ha EDTA was no included in he final size exclusion s ep. The A 280/260 a io o each p epa a ion was <0.65 AU and p o ein was quan ified using a heo e ical mola ex inc ion coe ficien o 80,330 M −1 cm −1 . TIA-1 RRM1 and RRM2,3 P epa a ion GST-TIA-1 RRM1 (amino acids 1-81; in plasmid pGEX-4T-2) and 6xHis-TIA-1 RRM2,3 (amino acids 93-27; in plasmid pET x-1a) a ian s (Wa is e al., 2017) we e p oduced in E. coli BL21 (DE3) cells g own a 37°C oanOD 600 o 0.6–0.8. LB medium was used i p o eins we e in ended o u bidi y measu emen s, whe eas 15 N-labelled TIA-1 cons uc s o NMR i a ions we e p oduced in M9 minimal medium wi h 15 NH 4 Cl as a ni ogen sou ce. Exp ession was induced by he addi ion o 1 mM IPTG and cul u es we e incuba ed a 30°C o 16–18 h. Cell pelle s we e esuspended in lysis bu e (20 mM po assium phospha e, 500 mM KCl, pH 7.4) wi h 20 μg/ml DNase I, 1 mM phenylme hanesul onyl fluo ide (PMSF) and 100 μg/ml lysozyme. Cells we e dis up ed by sonica ion (cycles o 30 s a 40% o ampli ude, 60 s o es , 6 min o al ime, on ice), and cell deb is was emo ed by cen i uga ion a 28,000 × g (4°C o 45 min). The supe na an om GST-TIA-1 RRM1 was loaded on o a 5 ml P ofini y GST column (BioRad) and elu ed in a single-s ep wi h lysis bu e con aining 20 mM GSH in a NGC Ch oma og aphy Sys em Ques 10 (BioRad). The supe na an om 6xHis-TIA- 1 RRM2,3 WT o i s mu an a ian s was loaded on o a Ni- NTA ma ix (The moFishe ), p e iously equilib a ed wi h lysis bu e con aining 5 mM imidazole, and incuba ed o 1h a 4 °C. Recombinan p o eins we e elu ed using a non- con inuous imidazole g adien and pu i y was u he checked by SDS-PAGE. The GST- and 6xHis- ag we e emo ed by o e nigh incuba ion (4°C) o he p o ein wi h 2.5 U/mg o h ombin p o ease (Cy i a). Clea ed TIA-1 cons uc s we e hen isola ed wi h Ni-NTA esin ( o RRM2,3) o a wo-s ep ch oma og aphy wi h EN ich SEC 650 (BioRad) and P ofini y GST columns ( o RRM1). Pu ified p o eins we e dialyzed wice agains 5 L o ei he HEPES bu e (20 mM HEPES, 50 mM NaCl, pH 6.9) o ci a e bu e (20 mM ci a e, 50 mM NaCl, pH 5.5) a 4°C o e nigh . Fo comple e disulphide bond educ ion, bu e ed TCEP was added o dialyzed p o eins up o a concen a ion o 1 o 5 mM o u bidi y assays and NMR i a ions, espec i ely. Then, samples we e concen a ed using Amicon Ul a-15 cen i ugal fil e s (Me ck-Millipo e). P o eins we e quan ified by spec opho ome y a 280 nm using ex inc ion coe ficien s o 8,480 M −1 cm −1 o TIA-1 RRM1 and 30,940 M −1 cm −1 o TIA-1 RRM2,3. FUS-RBD P o ein P epa a ion Two cons uc s o FUS we e exp essed and pu ified as pe Loughlin e al. (Loughlin e al., 2019). FUS-RBD (amino acids 242-526) comp ising FUS RGG1-RRM-RGG2-ZnF- RGG3 domains was p oduced om pET24b consis ing o a N- e minal GB1 solubili y ag ollowed by a 6xHis- ag. FUS- RBD-ΔRGG1/3 (amino acids 269-454) was p oduced om pET28a consis ing o a N- e minal 6xHis ag. Each cons uc was exp essed in EcoliBL21 Rose a2 cells g own a 37°C, ollowed by p o ein exp ession induc ion wi h 0.5 mM IPTG and o e nigh exp ession a a educed empe a u e o 25°C. Cell pelle s we e esuspended in lysis bu e (50 mM T is-HCl, 1 M NaCl, 0.5% T i on-X, 5 mM imidazole, 0.5 mM ß-me cap oe hanol, pH 8.0) and lysed by sonica ion. Lysa e was cla ified a 48,000 × g o 30 min, loaded on o Ni-NTA beads, washed wi h 20 and 40 mM imidazole in wash bu e (50mM T is-HCl, 1M NaCl, 0.5mM ß-me cap oe hanol, pH 8.0) and elu ed wi h 200 mM imidazole in wash bu e . Fo FUS-RBD sho , he 6xHis- ag was clea ed wi h TEV p o ease in 50 mM T is-HCl, 1 M NaCl, 10 mM imidazole, 0.5 mM ß-me cap oe hanol, pH 8.0, and emo ed wi h Ni- NTA beads. P o eins we e dialysed in o s o age bu e (50 mM T is-HCl, 1 M NaCl, 20 mM imidazole, 0.5 mM ß- me cap oe hanol, pH 8), concen a ed o 0.4 mM and s o ed a −80°C. P o eins we e quan ified using ex inc ion coe ficien s o 36,883 M −1 cm −1 o GB1-6xHis-FUS-RBD usion and 20,970 M −1 cm −1 o FUS-RBD-ΔRGG1/3. Oligonucleo ides Syn he ic single s anded DNA oligonucleo ides con aining h ee o fi e TC- ich TIA-1 binding si es we e syn hesized and HPLC F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608063 Wes e al. Regula ion o TIA-1 Condensa es pu ified comme cially (IDT, Aus alia) and quan ified using mola ex inc ion coe ficien s supplied by IDT. TC3 (34 n ): TTTTTACTCCAATTTTTACTCCAATTTTTA CTCC TC5 (58 n ): TTTTTACTCCAATTTTTACTCCAATTTTTA CTCCAATTTTTACTCCAATTTTTACTCC Tu bidi y Measu emen s Tu bidi y measu emen s o ull leng h TIA-1 we e used o measu e he ela i e amoun s o LLPS unde se condi ions. Measu emen s we e aken wi hin 20 min o ins iga ing LLPS, a ime ame in which we do no obse e agg ega ion ei he by mic oscopy o ThT fluo escence. TIA-1 p o ein in size exclusion bu e was dilu ed ei he alone, o in he p esence o nucleic acids in agg ega ion bu e . In gene al, TIA-1 p o ein was dilu ed o 2.5 μM in he p esence o 0.5 μM oligonucleo ides unless o he wise s a ed. Final agg ega ion bu e was20mMHEPES,50mMNaCl,pH7.2,including esidual 15 mM a ginine-HCl. As con ols, nucleic acid o ZnCl 2 alone we e dilu ed in agg ega ion bu e . T iplica e samples o 150 µL we e se -up a oom empe a u e and incuba ed o 10 min a 25°C in 96-well clea bo om non- binding black pla es (G eine ), hen analysed a 385 nm using a CLARIOs a pla e eade (BMG Lab ech). Assays included 3 eplica es wi h e o ba s ep esen ing S.D. Tu bidi y measu emen s o TIA-1 RRM2,3 WT, H94A, H96A and H94A H96A we e pe o med a a final concen a ion o 20 μM in ei he HEPES bu e (20 mM HEPES, 50 mM NaCl, pH 6.9) o ci a e bu e (20 mM ci a e, 50 mM NaCl, pH 5.5). Each cons uc was measu ed a 25°C e e y min o 30 min a e he addi ion o ZnCl 2 o TPEN a he indica ed a ios. Independen samples o 100 µL we e p epa ed a oom empe a u e and measu ed a 385 nm in a 96-well pla e wi h a Va ioskan LUX mic owell pla e eade (The moFishe ). G aphs ep esen he a e age o he las 10 alues o u bidi y measu emen s, a e signal s abiliza ion. Assays included 3 eplica es wi h e o ba s ep esen ing S.D. Boxplo s we e gene a ed using R e sion 4.0.5 (h p://www. -p ojec .o g). DIC Mic oscopy Samples o ull leng h TIA-1 wi h o wi hou ZnCl 2 o oligonucleo ides we e p epa ed esh as pe samples used in u bidi y measu emen s and imaged wi hin 20 min o mixing unless o he wise s a ed. A 10 μL-aliquo o each sample was spo ed on o a glass mic oscope slide wi h double sided ape and co e ed wi h 0.17 mm HP glass co e slip (Zeiss). Solu ions we e imaged a oom empe a u e wi h di e en ial in e e ence con as (DIC) on an In e ed Olympus IX81 x 2UCB mic oscope (Olympus, Tokyo, Japan) wi h a 60 × objec i e. Images we e p ocessed using FIJI (Schindelin e al., 2012). Thiofla in T Assay Thiofla in-T (ThT) fluo escence assays we e used o moni o ThT posi i e agg ega e o ma ion o ull leng h TIA-1 alone and in he p esence o nucleic acids. Samples we e p epa ed as pe u bidi y assays in agg ega ion bu e . A e u bidi y measu emen s, a 1 mM ThT s ock solu ion was dilu ed o a final concen a ion o 5 μM and equilib a ed o 30 o C o se e al minu es p io o measu emen s commencing. Samples we e hen agi a ed h ough o bi al shaking a 500 .p.m. and 30°Co e 12–16 h, and ThT fluo escence was moni o ed wi h an exci a ion wa eleng h o 425 nm andanemissionwa eleng ho 485nm,usingaCLARIOs a pla e eade (BMG Lab ech). Measu emen s we e baseline co ec ed using ThT fluo escence o agg ega ion bu e /ThT alone. Assays included 3 eplica es wi h e o ba s ep esen ing S.D. T ansmission Elec on Mic oscopy To analye he mo phology o he agg ega es p esen a he endpoin o he ThT assay, samples we e imaged by T ansmission Elec on Mic oscopy (TEM). A 5 µL o endpoin sample was applied o he su ace o glow-discha ged con inues ca bon g ids and s ained wi h 2% u anyl ace a e solu ion. The excess s ain was emo ed using fil e pape and g ids we e ai - d ied. All samples we e imaged on an FEI Tecnai F2 F20 TWIN elec on mic oscope wi h a Ga an 4k x 4k CCD, unde a wo king ol age o 200 kV a he Ramacio i Cen e o C yo-Elec on Mic oscopy o Monash Uni e si y. NMR Measu emen s Nuclea Magne ic Resonance (NMR) i a ions in ol ing TIA- 1 cons uc s we e eco ded and moni o ed a 25°Cby1D 1 H and 2D [ 1 H- 15 N] He e onuclea Single Quan um Co ela ion (HSQC) spec a in a B uke A ance-III 700 and 500 MHz equipped wi h a 5 mm TCI c yop obe. Samples we e dialyzed in 20 mM ci a e, 50 mM NaCl, 5 mM TCEP, pH 5.5, o 20 mM HEPES, 50 mM NaCl, 5 mM TCEP, pH 6.9, o NMR i a ions. 5% D 2 O was added o all samples o adjus he lock signal o he NMR spec ome e . Samples we e p epa ed a 200 o 300 μM o TIA-1 RRM1 and TIA-1 RRM2,3, espec i ely, in a final olume o 350 μL. Samples we e loaded in o Shigemi ubes (Shigemi Inc.). Da a we e acqui ed and p ocessed using TopSpin 3.5pL7 so wa e (B uke ). Linewid h b oadening and chemical-shi pe u ba ion analysis we e pe o med using NMRFAM- SPARKY so wa e dis ibu ion (Na ional Magne ic Resonance Facili y, Madison). The NMR assignmen o TIA-1 RRM1 and TIA-1 RRM2,3 was al eady a ailable (Biological Magne ic Resonance Bank [BMRB] accession numbe s 34144 and 19,735, espec i ely) (Wang e al., 2014; Sonn ag e al., 2017). Chemical-shi pe u ba ions (Δδ AVG ) we e calcula ed as p e iously desc ibed (Ri e o-Rod íguez e al., 2021). CD Spec opola ime y Ci cula Dich oism (CD) spec a we e eco ded in he a -UV ange (195–250 nm) a 20°C on a Jasco J-815 CD spec opola ime e equipped wi h a Pel ie empe a u e con ol sys em. 10 µM o each TIA-1 RRM2,3 cons uc in phospha e bu e (10 mM sodium phospha e, 1 mM TCEP, pH 6.9) was measu ed in a 1 mm qua z cu e e. The final spec a we e an a e age o 20 scans. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608064 Wes e al. Regula ion o TIA-1 Condensa es RESULTS Zn 2+ Enhances LLPS o TIA-1, Especially in he P esence o Nucleic Acid To explo e he e ec o Zn 2+ on TIA-1 LLPS and po en ial subsequen agg ega ion, we fi s assessed he e ec o Zn 2+ on he LLPS o TIA-1 p o ein in he absence o nucleic acid. In his s udy, pu ified monome ic TIA-1 p o ein was p epa ed in he p esence o 500 mM a ginine, hen dilu ed in o a low sal bu e o a concen a ion jus below i s sa u a ion (Csa ), a which TIA-1 shows minimal LLPS (Loughlin e al., 2021). The e ec o ZnCl 2 on he LLPS o TIA-1 p o ein was analysed by DIC mic oscopy and quan ified using u bidi y (abso bance a 385 nm). TIA-1 p o ein alone a 2.5 μM showed minimal LLPS when imaged by DIC (Figu e 1A). Addi ion o 0.1–50 μM ZnCl 2 esul ed in he appea ance o sphe ical d ople s ha escala ed in numbe on inc easing Zn 2+ concen a ion, demons a ing ZnCl 2 enhanced LLPS o TIA-1 (Figu e 1A). The u bidi y o TIA-1 also inc eased in he p esence o ZnCl 2 in a concen a ion-dependen manne om 0.2 o 0.8, eflec ing inc eased LLPS (Figu e 1B). Taken oge he , hese esul s show ha ZnCl 2 alone enhances LLPS o TIA-1, in ag eemen wi h p e ious s udies o TIA-1 usion p o ein (Rayman e al., 2018). Ou p e ious wo k showed ha nucleic acid ha bou ing mul iple binding si es enhances LLPS o TIA-1, lowe ing he concen a ion a which he p o ein spon aneously phase sepa a es (Loughlin e al., 2021). To de e mine whe he nucleic acid and Zn 2+ enhance LLPS o TIA-1 coope a i ely o ac in a compe i i e manne , we analysed he e ec o ZnCl 2 on ssDNA-induced LLPS o TIA-1. TIA-1 (a 2.5 μM) in he p esence o ssDNA ha bou ing fi e TIA-1 binding si es (“TC5”) was assessed o LLPS using DIC mic oscopy and quan ified by u bidi y. DIC showed he p esence o LLPS d ople s (~2–5μm in diame e ) ha we e sligh ly la ge han hose ins iga ed only by ZnCl 2 and ga e ise o u bidi y measu emen s o ~0.3 (Figu es 1A,C). Addi ion o 0.1 μM ZnCl 2 had minimal e ec on he u bidi y o TIA-1:ssDNA; howe e , 1–10 μM ZnCl 2 enhanced he numbe o d ople s and inc eased u bidi y o 0.4-0.75, showing ha Zn 2+ and ssDNA oge he enhance LLPS o TIA-1. Addi ion o 50 μM ZnCl 2 esul ed in a FIGURE 1 | Zinc enhances LLPS o TIA-1 and TIA-1:ssDNA in a concen a ion dependan manne . (A) DIC mic oscopy o 2.5 μM TIA-1 (uppe ) and 0.5 μM ssDNA TC5 + 2.5 μM TIA-1 (lowe ) in he p esence o 0–50 μM ZnCl 2 .(B) Tu bidi y (A 385 nm )o 2.5μM TIA-1 + 0–50 μM ZnCl 2 .(C) Tu bidi y o 2.5 μM TIA-1 + 0.5 μM ssDNA TC5 + 0–50 μM ZnCl 2 and (D) Tu bidi y o 0–50 μM ZnCl 2 alone. Condi ions: 20 mM HEPES, 50 mM NaCl, 12 mM A ginine, pH 7.2, a 25°C and wi hin 20 min o incuba ion. 4 eplica es. E o ba s ep esen S.D. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608065 Wes e al. Regula ion o TIA-1 Condensa es FIGURE 2 | Zn2+ specifically binds o TIA-1 RRM2,3 and media es p o ein mul ime iza ion. (A) De ailed iew o ep esen a i e amide esonances o unpe u bed (le panel), ß-shee (middle panel)o Zn 2+ binding si e (le panel) TIA-1 RRM2,3 esidues om he supe imposed [ 1 H- 15 N] HSQC spec a o 15 N-labeled TIA-1 RRM2,3 cons uc ei he ee (blue) o upon incuba ion wi h ZnCl 2 ( ed) o ZnCl 2 + TPEN (da k g een). Whole iews o 2D NMR spec a a e included in Supplemen a y Figu es S2A,E.(B) Map o 1 H-linewid hs on he TIA-1 RRM2,3 ibbon upon addi ion o an equimola a io o ZnCl 2 . Residues wi h 1 H line b oadening la ge han he a e age (µ) plus wo s anda d de ia ions (σ) a e colo ed using a whi e- o-blue scale. P olines and unassigned esidues a e colo ed in g ey. TIA-1 PDB ID: 2MJN (Wang e al., 2014). Condi ions: 20 mM HEPES, 50 mM NaCl, 5 mM TCEP, pH 6.9, a 25°C and upon 30 min incuba ion wi h ZnCl 2 o ZnCl 2 +TPEN. (C) Compa ison o u bidi y (A 385 nm ) p oduced by TIA-1 RRM2,3 WT and di e en His- o-Ala mu an s a inc easing concen a ions o ZnCl 2 . All measu emen s we e pe o med by using TIA-1 cons uc s a 20 µM concen a ion. Condi ions: 20 mM HEPES, 50 mM NaCl, 1 mM TCEP, pH 6.9, a 25°C and wi hin 30 min incuba ion unde shaking. 3 eplica es. E o ba s ep esen S.D. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608066 Wes e al. Regula ion o TIA-1 Condensa es u he inc ease in u bidi y o ~1.0, and DIC showed he p esence o a la ge numbe o smalle d ople s, sugges ing ha a hese concen a ions Zn 2+ -induced TIA-1 LLPS domina es he phase sepa a ion o hese samples. I was also confi med ha ZnCl 2 alone did no gi e ise o sample u bidi y (Figu e 1D). These esul s show ha Zn 2+ u he enhances nucleic acid- induced LLPS o TIA-1. Zn 2+ In e ac s Specifically Wi h TIA-1 RRM2 Residues In o de o explo e he molecula basis o Zn 2+ -induced LLPS o TIA-1, NMR 1 H- 15 N-HSQC i a ion expe imen s we e unde aken o RRM1 (amino acids 1-81) and RRM2,3 (amino acids 93-274) domains. ZnCl 2 was i a ed in o 15 N-labelled RRM1 o RRM2,3 a 200 and 300 μM, espec i ely, a pH 6.9. Addi ion o Zn 2+ in o ei he sample esul ed in some u bidi y obse ed by eye, sugges ing a dec ease in solubili y a hese concen a ions. The RRM1 amide esonances showed no significan changes in ei he chemical-shi pe u ba ions o linewid hs; he e o e, no specificZn 2+ binding si e was iden ified (Supplemen a y Figu e S1). In con as , when Zn 2+ was added o a sample o RRM2,3, he a e age b oadening was enhanced om 25.5 ± 4.8 Hz ( ee TIA-1 RRM2,3) o 37.4 ± 18.3 Hz (Zn 2+ :p o ein a io o 1:1), indica i e o mul ime iza ion o TIA-1 (Supplemen a y Figu e S2). Fu he mo e, ou analysis also e ealed a subse o amide esonances unde going specific line b oadening (>250 Hz). In e es ingly, some o he a ec ed esidues—namely N93 (ß 1 ), F95 (ß 1 ), H96 (ß 1 ), V97 (ß 1 ), S122 (ß 2 ), A124 (ß 2 ) and F143 (ß 3 )—a e posi ioned in a clus e adjacen o and including RRM2 ß-shee esidues o he canonical RNA binding si e (Figu es 2A,B and Supplemen a y Figu e S2A). Mo eo e , o he esidues a RRM2 α 2 -helix (K146 and D148) and hose loca ed a a flexible RRM2 loop and he in e domain linke (M130 and A171, espec i ely) we e also subs an ially b oadened (>250 Hz; Figu es 2A,B). Mode a e, bu s ill significan , b oadening (>mean + 2σHz) was also obse ed o esonances H94 (ß 1 ), F98 (ß 1 ), V99 (ß 1 ), I111 (α 1 ), R125 (ß 2 ), S135 (ß 3 ), S142 (ß 3 ), A149 (α 2 ), N151 (α 2 ) and A152 (α 2 )in RRM2 (Figu es 2A,B,Supplemen a y Figu e S2). Se e al esidues om he linke and RRM3 also b oadened abo e he h eshold, bu no o he ex en o ha obse ed in RRM2. Rema kably, bo h subs an ial line b oadening o RRM2 in RRM2,3 and sample u bidi y we e ully e e sible upon addi ion o he Zn 2+ -chela o TPEN (a e age linewid h o 26 ± 4 Hz), which confi ms ha hese e ec s a e unequi ocally induced by Zn 2+ (Figu e 2A,Supplemen a y Figu es S2E,G). I was also confi med ha TPEN alone had no e ec on TIA-1 RRM2,3 esonances (Supplemen a y Figu es S2F,G). Toge he , hese esul s sugges ha Zn 2+ media es he mul ime iza ion o TIA-1 RRM2,3 domains independen ly o he P LD a high p o ein concen a ion (300 µM). F om hese da a, H94 and H96 in RRM2 s and ou as po en ial Zn 2+ ligands o TIA-1 as his idine esidues a e o en in ol ed in Zn 2+ coo dina ion (Kocyla e al., 2021). Based on his p emise, he NMR i a ion was epea ed unde lowe pH condi ions a which his idine esidues could no in e ac wi h Zn 2+ due o p o ona ion (C uz- Galla do e al., 2013;C uz-Galla do e al., 2015). Ti a ing TIA-1 RRM2,3 wi h Zn 2+ a pH 5.5 esul ed in nei he enhanced line b oadening no isible u bidi y, consis en wi h he lack o his idine coo dina ion o Zn 2+ in TIA-1 RRM2,3 (Supplemen a y Figu es S2B–D). I should be no ed ha Zn 2+ addi ion o a solu ion o TIA-1 RRM1 a pH 5.5 also did no p oduce any isible u bidi y and he linewid h o he signals emained unal e ed (Supplemen a y Figu es S1B–D). Thus, his idines in RRM1, ha occu a posi ions 54, 56 and 58, could also ansien ly coo dina e Zn 2+ , bu wi hou o ming s able complexes. Al oge he , NMR i a ions iden ified TIA-1 RRM2 H94 and H96 esidues as po en ial candida es o specificZn 2+ binding, possibly media ing he o ma ion o Zn 2+ -induced mul ime s unde lying he obse ed solu ion u bidi y o TIA-1 RRM2,3. To es his hypo hesis we fi s quan ified he e ec o Zn 2+ i a ionin o20µMTIA-1RRM2,3onsolu ion u bidi y—as measu ed by abso bance a 385 nm. Inc easing he Zn 2+ enhanced he u bidi y o RRM2,3 in a concen a ion dependen manne (Supplemen a y Figu e S3A). Fu he mo e, unde hese condi ions, he supp essing e ec s o TPEN and pH 5.5 in educing TIA-1 RRM2,3 u bidi y we e also obse ed, as p e iously seen in he mo e concen a ed TIA-1 RRM2,3 NMR solu ions (Supplemen a y Figu es S3B,C). Thus, in o de o confi m he oleo H94andH96inZn 2+ -induced mul ime iza ion, TIA-1 RRM2,3 mu an s we e designed so ha one o bo h his idine esidues we e subs i u ed by alanine. The co ec p o ein olding was confi med using CD spec opola ime y, e ealing he same seconda y s uc u e con en o TIA-1 RRM2,3 wild ype and mu an s (Supplemen a y Figu e S4). While addi ion o Zn 2+ o a a ioo 8:1inc eased he u bidi yo TIA-1RRM2,3(20µM), minimal o negligible e ec s we e obse ed o H94A, H96A o H94A H96A mu an s (Figu e 2C). This finding sugges s a s uc u al ole o Zn 2+ in specifically coo dina ing H94/H96 esidues in RRM2, unde lying Zn 2+ -induced mul ime iza ion o TIA-1 RRMs. Zn 2+ Supp esses Nucleic Acid Induced TIA-1 Fib illa Agg ega ion Whils LLPS o TIA-1 con ibu es o s ess g anule o ma ion, abe an LLPS o disease-associa ed TIA-1 a ian s and enhanced p opensi y o o m fib illa agg ega es a e associa ed wi h impai ed s ess g anule dynamics acili a ing pa hological inclusions linked o ALS (Mackenzie e al., 2017;Zhang e al., 2019). Thus, we nex p obed he e ec o Zn 2+ on fib illa agg ega ion o TIA-1 o e ime, in and ou o he p esence o nucleic acid, as moni o ed by Thiofla in T (ThT) fluo escence and TEM. A concen a ions a which TIA-1 shows minimal LLPS (2.5 μM), no significan TIA-1 agg ega ion was de ec ed (Supplemen a y Figu e S5A). Addi ion o 10 μMZnCl 2 , ha obus ly induces LLPS o TIA-1, did no enhance agg ega ion o TIA-1 and e en appea ed o show a sligh supp ession o ThT fluo escence (Figu e 3A). TEM measu emen s did no de ec any fib illa agg ega ion (Figu e 3B), showing ha Zn 2+ -induced LLPS o TIA-1 does no p oduce fib illa agg ega es. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608067 Wes e al. Regula ion o TIA-1 Condensa es We hen unde ook he same expe imen in he p esence o he TC- ich dsDNA ha bou ing 5 TIA-1 binding si es (“TC5”), ha enhances TIA-1 LLPS and fib il o ma ion (Loughlin e al., 2021). As p e iously obse ed, addi ion o TC5 o TIA-1 (2.5 μM) esul ed in fib illa agg ega ion as de ec ed by ThT fluo escence o e ime, and fib ils as obse ed by TEM (Figu es 3C,D). To es he e ec o Zn 2+ on nucleic acid-induced fib iliza ion o TIA-1, we moni o ed agg ega ion o TIA-1 in he p esence o TC5 and 10 μMZnCl 2 . No enhancemen in ThT fluo escence was obse ed o e ime and TEM o final samples did no show nume ous fib ils, bu small agg ega es wi h po en ial oligome ic species (Figu es 3E,F). In e es ingly, we also obse ed inhibi ion o ThT fluo escence a subs oichiome ic concen a ions o ZnCl 2 (Supplemen a y Figu e 5B). These esul s sugges ha he p esence o Zn 2+ impedes fib iliza ion o TIA-1, main aining i wi hin a e e sible LLPS s a e. RGG-Rich RBD o FUS Enhances Nucleic Acid Induced TIA-1 LLPS and P e en s Ma u a ion o I e e sible Agg ega es As pa o ou s udy o s ess g anule co- ac o s, we also analysed he e ec s o he RGG- ich RNA-binding domain (RBD) o FUS—as a ep esen a i e RGG- ich p o ein and po en ial molecula modula o o TIA-1 LLPS. FUS localises o s ess g anules ia i s RGG- ich in insically diso de ed egion RGG3 (Ben mann e al., 2012). Mo eo e , in i o TIA-1 p o ein pa i ions in o phase sepa a ed FUS p o ein media ed in pa by he RGG ich RBD (Wang e al., 2018). In e es ingly, al hough RGG IDPs can d i e homo ypic LLPS, unlike P LD- media ed LLPS, hey do no eadily ma u e in o i e e sible fib illa agg ega es (Gui e al., 2019). Thus, in e ac ions o RGG in insically diso de ed egions may also influence TIA-1 LLPS and po en ial fib illa agg ega ion. We he e o e es ed he e ec o RGG- ich RBD o FUS on TIA-1 LLPS and agg ega ion, by DIC and u bidi y measu emen s, bo h alone and in he p esence o nucleic acids. FUS-RBD (amino acids 242-526) comp ising RGG1-RRM-RGG2-ZnF-RGG3 (Figu e 4A) was pu ified in high sal o homogenei y, ee om RNA con amina ion. TIA-1 and FUS-RBD dilu ed o 2.5 µM in agg ega ion bu e showed minimal LLPS in DIC mic oscopy, wi h no appa en inc ease upon hei addi ion (Figu e 4B), and only a e y small inc ease in u bidi y was obse ed upon hei addi ion (Figu e 4C). Toge he , his sugges s ha FUS-RBD does no g ea ly enhance LLPS o TIA-1 a hese concen a ions. Nex , we es ed he e ec o FUS-RBD on TIA-1 LLPS in he p esence o a ssDNA comp ising h ee andem TIA-1 binding si es (“TC3”). The addi ion o sub-s oichiome ic amoun s o TC3 o TIA-1 d ama ically enhanced LLPS, as measu ed by inc eased solu ion u bidi y (Figu e 4C) and by d ople s obse ed by DIC FIGURE 3 | Zinc inhibi s fib illa agg ega ion o TIA-1. Thiofla in T (ThT) fluo escence assay moni o ing he o ma ion o ThT posi i e agg ega es ( op) and TEM o final samples (bo om)(A,B) 2.5 μM TIA-1, 10 μM ZnCl 2 (C,D) 2.5 μM TIA-1, 0.5 μM ssDNA TC5 (E,F) 2.5 μM TIA-1, 0.5 μM ssDNA TC5, 10 μM ZnCl 2 . Condi ions: 20 mM HEPES, 50 mM NaCl, 15 mM A ginine, pH 7.2, a 30°C wi h shaking. 3 eplica es. E o s ep esen S.D. Scale ba ep esen s 200 nm. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608068 Wes e al. Regula ion o TIA-1 Condensa es ha we e s able o e 2 h (Figu e 4D). Addi ion o equimola FUS- RBD o TIA-1 and TC3 u he enhanced LLPS, esul ing in g ea ly inc eased u bidi y and subs an ially la ge LLPS d ople s (Figu es 4C,D). Unlike he s able TIA-1:TC3 samples, TIA-1:TC3:FUS-RBD condensa es used oge he o e 2 h. To es whe he hese changes we e due o RGG egions o FUS, a sho e sion o FUS RBD (amino acids 269-454) wi hou RGG1 o RGG3 egions (FUS-RBD- ΔRGG1/3) was mixed wi h TIA-1:TC3. On addi ion o FUS-RBD- ΔRGG1/3, no change in u bidi y o appea ance o LLPS was obse ed, wi h d ople s appea ing ela i ely s able o e a 2 h ime pe iod (Figu es 4C,D). Al hough TC3 was designed wi h TIA-1 binding si es, addi ion o TC3 ssDNA o FUS-RBD esul ed in inc eased u bidi y, wi h a small inc ease in he numbe o LLPS d ople s (Figu es 4C,E). In con as , he addi ion o TC3 o FUS- RBD-ΔRGG1/3 did no inc ease u bidi y o d ople o ma ion (Figu es 4C,E). In o de o check whe he FUS-RBD could be o ming p omiscuous in e ac ions by displacing TIA-1 om he TC3 ssDNA, we de e mined i s di ec binding a fini y o a TC DNA sequence in compa ison o ha o TIA-1 RRM2,3. This showed ha he FUS-RBD a fini y (K d =30nM)wassignifican ly lowe han ha o TIA-1 RRM2,3 (K d =2nM)(Supplemen a y Figu e S6)andis unlikely o displace TIA-1 unde he condi ions o he LLPS assay. These esul s show ha he addi ion o an RGG- ich p o ein can modula e he nucleic acid-induced LLPS o TIA-1, po en ially ia in e ac ions wi h RRM-bound nucleic acid and/o wi h TIA-1 P LD. Following he obse a ion o changes in LLPS o TIA-1: TC3 condensa es, we nex examined he fib il o ma ion capaci y o TIA-1 in he p esence o RGG- ich FUS-RBD as moni o ed by ThT fluo escence and TEM. Whe eas 2.5 µM TIA- 1 showed minimal agg ega ion wi h only a small inc ease in ThT fluo escence a e ~8 h, TC3 ssDNA e ficien ly enhanced ThT fluo escence o e ime, esul ing in amyloid-like fib ils, as obse ed unde TEM (Figu es 5A,B). In con as , he addi ion o FUS-RBD o TIA-1:TC3 esul ed in a d ama ic educ ion in ThT fluo escence, sugges ing a subs an ial dec ease in fib il o ma ion, confi med by TEM imaging (Figu es 5C,D). In e es ingly, he small inc ease in ThT fluo escence o TIA-1 alone is also inhibi ed in he p esence o FUS-RBD (Figu e 5C). FIGURE 4 | FUS-RBD enhances nucleic acid induced LLPS o TIA-1. (A) Domain s uc u es o TIA-1 (wi h P LD sequence alongside highligh ing Q, N and Y amino acids) and FUS cons uc s: FUS-RBD and FUS-RBD-ΔRGG1/3 cons uc s (wi h RGG sequences shown unde nea h highligh ing R, F and Y amino acids). (B) DIC mic oscopy o 2.5 μM TIA-1; 0.5 μM ssDNA TC3; 2.5 μM FUS-RBD-RGG; 2.5 μM FUS-RBD-sho a oom empe a u e (C) Tu bidi y assay o 2.5 μM TIA-1; 0.5 μM ssDNA TC3; 2.5 μM FUS-RBD-RGG; 2.5 μM FUS-RBD-sho . 20 min incuba ion a 25°C. 3 eplica es. E o ba s ep esen S.D. (D) DIC mic oscopy o 2.5 μM TIA-1 combined wi h 0.5 μM ssDNA TC3 alone o wi h 2.5 μM FUS-RBD-RGG o 2.5 μM FUS-RBD-sho a 30 and 120 min incuba ion a oom empe a u e. (E) 0.5 μM ssDNA TC3 alone o wi h 2.5 μM FUS-RBD-RGG o 2.5 μM FUS-RBD-sho . Scale ba s depic 10 μm. Condi ions: 20 mM HEPES, 50 mM NaCl, 12 mM a ginine, pH 7.2, a 25°C. F on ie s in Molecula Biosciences | www. on ie sin.o g July 2022 | Volume 9 | A icle 9608069 Wes e al. Regula ion o TIA-1 Condensa es