Full text
Con iden ial: o pee e iew only
Role o Low-Le el Quinolone Resis ance in Gene a ing
Tole ance in Esche ichia coli unde The apeu ic
Concen a ions o Cip o loxacin
Jou nal:
Jou nal o An imic obial Chemo he apy
Manusc ip ID
JAC-2019-2038.R1
Manusc ip Type:
O iginal A icle
Da e Submi ed by he
Au ho :
n/a
Comple e Lis o Au ho s:
O iz Padilla, Mi iam; Uni e si y o Se ille, Mic obiology
Diaz-Diaz, Sa a; Uni e sidad de Se illa Facul ad de Medicina
Machuca, Jesús; Uni e si a y Hospi al Vi gen Maca ena, Mic obiology
Tejada-Gonzalez, An onio; Uni e si y o Se ille
Recacha, Es he ; Uni e si y o Se ille, Mic obiology
Docobo-Pé ez, Fe nando; Uni e sidad de Se illa Facul ad de Medicina,
Mic obiologia; Ins i u o de Biomedicina de Se illa,
Pascual He nández, Ál a o
Rod iguez Ma inez, Jose Manuel; Uni . Se illa, Mic obiology
Keywo ds:
Quinolones, Tole ance, Pe sis ence, Low-le el esis ance, SOS esponse
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
1JAC-2019-2038_R1
2Role o Low-Le el Quinolone Resis ance in Gene a ing
3Tole ance in Esche ichia coli unde The apeu ic Concen a ions
4o Cip o loxacin
5
6M. O iz-Padilla1,2,3,4, S. Diaz-Diaz1,2,3,4, J. Machuca1,2,3,4, A. Tejada-
7Gonzalez2, E. Recacha1,3,4, F. Docobo-Pé ez2,3,4, A. Pascual1,2,3,4, J.M.
8Rod íguez-Ma ínez2,3,4,*
91Unidad Clínica de En e medades In ecciosas, Mic obiología y Medicina
10 P e en i a, Hospi al Uni e si a io Vi gen Maca ena, Se ille, Spain.; 2Depa amen o
11 de Mic obiología, Facul ad de Medicina, Uni e sidad de Se illa, Se illa, Spain;
12 3Red Española de In es igación en Pa ología In ecciosa (REIPI), Ins i u o de Salud
13 Ca los III, Mad id, Spain; 4Ins i u o de Biomedicina de Se illa IBIS, Hospi al
14 Uni e si a io Vi gen Maca ena/CSIC/Depa amen o de Mic obiología, Uni e sidad
15 de Se illa, Se ille, Spain
16
17 Running i le: Role o Low-Le el Quinolone Resis ance in Tole ance Gene a ion
18 Equal con ibu ion
19 * Co esponding au ho : Mailing add ess: Depa men o Mic obiology; Uni e si y o
20 Se ille. A da Sanchez Pizjuan s/n. 41009 Spain.
21 Phone: +34 954 55 28 63. Fax: +34 954 37 74 13; E-mail: [email p o ec ed]
22 Wo ds: Abs ac leng h 250; Tex leng h 3218
23 Tables/Figu es/Supplemen a y da a/Re e ences numbe : 1/5/2/40
24
25
26
Page 1 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
27
28 ABSTRACT
29
30 Backg ound/Objec i es: Tole ance (including pe sis ence) and esis ance
31 esul in inc eased su i al unde an ibio ic p essu e. We e alua ed he in e play
32 be ween esis ance and ole ance o cip o loxacin unde he apeu ic and killing
33 condi ions o de e mine he con ibu ion o low-le el quinolone esis ance (LLQR)
34 mechanisms o ole ance. We also de e mined how he in e ac ion be ween
35 esis ance (LLQR pheno ypes) and ole ance was modi ied unde SOS esponse
36 supp ession.
37 Me hods: Twel e isogenic E. coli s ains ha bo ing quinolone esis ance
38 mechanisms combined wi h SOS esponse de iciency and six clinical E. coli
39 isola es (LLQR o non-LLQR) we e e alua ed. Su i al ( ole ance o pe sis ence)
40 assays we e used o measu e su i ing bac e ia a e a sho pe iod (up o 4
41 hou s) o bac e icidal an ibio ic ea men unde he apeu ic and killing
42 concen a ions o cip o loxacin (1 mg/L, he EUCAST/CLSI b eakpoin ; and
43 2.5 mg/L, Cmax).
44 Resul s: QRDR subs i u ions (S83L in Gy A alone o combined wi h S80R in
45 Pa C) signi ican ly inc eased he ac ion o ole an bac e ia (2-4 log10 c u/mL)
46 a e exposu e o cip o loxacin a clinically ele an concen a ions. Impac on
47 ole an bac e ia due o SOS esponse supp ession (including pe sis ence
48 media ed by he isB gene) was e e ed by LLQR mechanisms a he apeu ic
49 concen a ions. Fu he mo e, no educ ion in he ac ion o ole an bac e ia due
50 o SOS esponse supp ession was obse ed when S83L in Gy A plus S80R in
51 Pa C we e combined.
Page 2 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
52 Conclusions: Tole ance and quinolone esis ance mu a ions in e ac
53 syne gis ically, gi ing LLQR mechanisms an addi ional ole in allowing bac e ial
54 su i al and e asion o he apeu ic an imic obial condi ions by a combina ion o
55 he wo s a egies. A clinically ele an concen a ions, LLQR mechanisms e e
56 u he impac o SOS esponse supp ession in educing bac e ial ole ance.
57
Page 3 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
58 In oduc ion
59 An imic obial ole ance is de ined as he capaci y o p olong he du a ion o
60 ea men ha bac e ia can sus ain, o example, by emaining do man .
61 Do mancy ( ole ance) p o ec s bac e ia om he le hal e ec s o many ypes o
62 an ibio ics like be a-lac ams and quinolones whose mechanism o ac ion equi es
63 g ow h, as long as hey emain do man . A ela ed phenomenon called
64 pe sis ence is he abili y o a subpopula ion o suscep ible bac e ia o su i e
65 le hal doses o an ibio ics, esul ing in a biphasic killing cu e. 1–4 Bo h ole ance
66 and pe sis ence a e ansien and non-he edi a y pheno ypes, unlike esis ance,
67 which is he esul o gene ic modi ica ion. 4–8 Bo h gene ic and pheno ypic
68 a iabili y can ha e impo an consequences o bac e ial su i al in an ibio ic
69 ea men .
70 Resis ance is he inhe i ed abili y o mic oo ganisms o g ow in he p esence o
71 an ibio ics, ega dless o du a ion o ea men . Resis ance is achie ed by
72 di e en mechanisms such as modi ica ion o he d ug a ge o e lux pumps, and
73 is quan i ied by MIC o an ibio ic equi ed o p e en g ow h. 8–10
74 Bo h ole ance (including pe sis ence) and esis ance esul in inc eased su i al
75 unde an ibio ic p essu e. The in e ac ion be ween esis ance and ole ance has
76 no been comple ely analyzed.
77 One o he mos equen ly p esc ibed b oad-spec um an ibio ics a e he
78 luo oquinolones (FQs), which a ge DNA gy ase and opoisome ase IV. These
79 essen ial enzymes egula e genomic DNA supe coiling du ing eplica ion and
80 ansc ip ion. 9,11,12 FQs p e en liga ion eac ions o gy ase and opoisome ase
81 esul ing in double-s and b eaks. En e obac e ales like Esche ichia coli a e
Page 4 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
82 among he mos common causes o communi y-acqui ed and nosocomial
83 in ec ions. FQs a e used as empi ical and di ec ed he apy in in ec ions caused
84 by E. coli. 13 FQ esis ance in bo h human and e e ina y isola es o
85 En e obac e ales has inc eased no ably. 14,15 The mechanisms o luo oquinolone
86 esis ance mainly in ol e ch omosomal mu a ions in genes encoding quinolone
87 a ge s ( ype II opoisome ases), bu also educed pe meabili y o e lux pump
88 o e exp ession. 9,11,12 Plasmid-media ed quinolone esis ance (PMQR)
89 mechanisms a e also epidemiologically ele an . 9 Bo h ch omosomal and
90 plasmid-media ed mechanisms on hei own con e low-le el quinolone
91 esis ance (LLQR) p oducing a clinically suscep ible pheno ype, so ha mul iple
92 mechanisms mus be combined o achie e clinical esis ance. The in e play
93 be ween LLQR pheno ypes and ole ance a clinically ele an concen a ions o
94 quinolones has no been explo ed.
95 Quinolone he apy can acili a e adap i e esis ance mu a ions and he
96 acquisi ion o esis ance genes by p omo ing he ac i a ion o RecA (ini ia ing he
97 SOS esponse in ol ing he DNA epai and mu agenesis pa hways). 16–20 The
98 SOS esponse is induced a e RecA ac i a ion, which igge s sel -clea age o
99 he LexA ep esso . Apa om ha , RecA is a mul i unc ional p o ein in ol ed in
100 DNA epai , ecombina ion and ho izon al gene ans e . 16,21 In e es ingly, he
101 SOS esponse is an ac i e and inducible mechanism o pe sis e o ma ion
102 (media ed by he isB gene). 6 SOS-induced pe sis ence is a mechanism ha cells
103 can use o coun e ac DNA damage and p omo e su i al in he p esence o
104 luo oquinolones. The bac e ial s ess- esponse pep ide TisB in E. coli dissipa es
105 he ansmemb ane po en ial in such a way ha he deple ion o ATP le els
106 induces he o ma ion o do man pe sis e cells. 22 I has been epo ed ha his
Page 5 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
107 su i al mechanism could be impo an o in luencing he ou come o an ibio ic
108 he apy in i o. 2,3,6,7 Supp ession o he SOS esponse has ecen ly been
109 e ealed as a he apeu ic s a egy o po en ia ing bac e icidal an ibio ics such as
110 quinolones agains bo h suscep ible and esis an E. coli, leading o hei
111 esensi iza ion. 17,18,20,23–25 Howe e , he impac o SOS esponse supp ession on
112 ole ance (and pe sis ence) a es in bac e ia wi h LLQR pheno ypes a clinically
113 ele an concen a ions o quinolones is unknown.
114 In his s udy, we examine he in e play be ween ole ance and esis ance unde
115 he apeu ic condi ions using cip o loxacin (1 mg/L, he EUCAST/CLSI
116 b eakpoin s o esis ance, and 2.5 mg/L, he Cmax o his d ug) 26–28 and
117 measu ing he abundance o su i ing bac e ia a e bac e icidal an ibio ic
118 ea men . The p ima y ques ion was o de e mine how LLQR gene ic
119 mechanisms con ibu e o ole ance unde hese condi ions. Fo his goal, bo h
120 isogenic LLQR mu an s and clinical LLQR isola es we e es ed. Ou second goal
121 was o de e mine whe he in e ac ions be ween esis ance (LLQR pheno ypes)
122 and ole ance mechanisms we e modi ied unde condi ions o SOS esponse
123 supp ession in o de o alida e he impac o his s a egy o educe ole ance
124 (and pe sis ence) a es in bac e ia wi h LLQR pheno ypes a clinically ele an
125 concen a ions o quinolones.
126
Page 6 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
127 Ma e ials and me hods
128 S ains, g ow h condi ions and an imic obial agen s
129 Twel e isogenic E. coli s ains (based on wild- ype E. coli ATCC 25922
130 and E. coli MG1655) we e used ha bo ing ch omosomally-media ed quinolone
131 esis ance mechanisms combined wi h ecA dele ion and/o lexA eplacemen by
132 lexA1. 17 Th ee clinical isola es o E. coli ully suscep ible o cip o loxacin and
133 h ee clinical isola es o E. coli wi h LLQR (ha bo ing plasmid-media ed quinolone
134 esis ance mechanisms) o cip o loxacin we e also e alua ed 29 (see Table 1).
135 Liquid o solid LB (Lu ia-Be ani) medium and Muelle -Hin on b o h (MHB)
136 we e used. S ains we e g own a 37ºC. Cip o loxacin was used o he a ious
137 assays (Sigma-Ald ich, Mad id, Spain). Kanamycin (Sigma-Ald ich, Mad id,
138 Spain) a 30 mg/L, chlo amphenicol (Sigma-Ald ich, Mad id, Spain) a 25 mg/L
139 and ampicillin (Sigma-Ald ich, Mad id, Spain) a 50 mg/L we e used o plasmid
140 main enance. Exp ession o cip o loxacin-induced GFP in o he kanamycin-
141 esis an pMS ecA-g p and pMS isB-g p ec o s was used o de ec ecA (SOS
142 induc ion) and isB p omo e ac i i y, espec i ely (see Table S1). 17,30
143 Suscep ibili y es ing
144 MICs we e de e mined in iplica e o each bac e ial s ain, using wo
145 di e en echniques, b o h mic odilu ion and he g adien s ip assay echnique,
146 ollowing CLSI e e ence me hods. 28 Clinical ca ego ies we e es ablished
147 acco ding o CLSI and EUCAST b eakpoin s. 26,28
148
Page 7 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
149 In i o e olu ion o E. coli s ain MG1655 and whole genome sequencing
150 cha ac e iza ion
151 E. coli s ain MG1655 was g adually exposed o e i e days o inc easing
152 concen a ions o cip o loxacin ( om 1/4xMIC o 4xMIC) in se ial subcul u es.
153 S able inc eased MICs we e con i med, and se e al mu an s ob ained a 4xMIC
154 we e sequenced by WGS. In b ie , genomic DNA was ex ac ed om e ol ed
155 mu an s and pa en al s ain and sequenced using MiSeq (Illumina, San Diego,
156 CA, USA). Raw eads we e quali y il e ed and assembled in o con igs using he
157 CLC genomics wo kbench 9.5.2. (CLC bio, QIAGEN, Mad id, Spain) and he
158 de aul se ings o he so wa e. An a e age co e age o 50x was obse ed.
159 Con igs we e anno a ed using RAST 2.0 (h p:// as .nmpd .o g/ as .cgi). SNP
160 analysis, and mu a ion/ a ian de ec ion was ca ied ou on a CLC genomics
161 wo kbench 9.5.2, using E. coli MG1655 (Genbank accession: U00096.2) as he
162 e e ence. BLASTn/p® (Na ional Cen e o Bio echnology In o ma ion,
163 Be hesda, MD, USA) was used o con i m he sequences. A e his analysis, i
164 was con i med ha he E. coli MG2 s ain ha bou ed only he S83L subs i u ion
165 as he molecula mechanism o cip o loxacin esis ance.
166
167 isAB oxin-an i oxin sys em inac i a ion
168 Dis up ion o he isAB sys em was ca ied ou using a modi ied e sion o
169 he me hod desc ibed by Da senko and Wanne (see Table S1 o de ails). 31
170
171
Page 8 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
299 Wi h espec o he isB gene, we also analyzed i s p esence in a collec ion
300 o 35 E. coli clinical isola es om he Uni e si y Hospi al Vi gen Maca ena 29 and
301 ound ha his gene was absen in 46% o isola es. This obse a ion suppo s
302 ha mul iple genes can be implica ed in pe sis ence phenomena.
Page 15 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
303 Discussion
304 Tole ance (including he pe sis ence pheno ype) and esis ance a e wo
305 di e en ways used by bac e ia o e ade an ibio ic ea men . 8,32 Sepa a ely,
306 ole ance and esis ance ha e been shown o al e he e icacy o an imic obials,
307 2,7,9,11 bu he in e play be ween he wo ypes o mechanism, as well as he
308 con ibu ion o low-le el mechanisms o he abundance o ole an bac e ia unde
309 he apeu ic concen a ions o an imic obial agen s, ha e no been analyzed in
310 de ail.
311 Le in-Reisman e al. e y ecen ly e alua ed he epis a ic ela ionship
312 be ween an ibio ic ole ance, pe sis ence, and esis ance mu a ions wi h an E.
313 coli and be a-lac am (ampicillin) ea men model 3 ha used concen a ions
314 abo e he MPC (Mu an P e en ion Concen a ion, he concen a ion equi ed o
315 p e en g ow h o esis an mu an s e ol ed by a single mu a ion). 26,33 They
316 ound ha in e ac ion be ween esis ance and ole ance mu a ions was
317 syne gis ic in s ains e ol ed unde in e mi en an ibio ic ea men . The da a
318 suppo ha ole ance leads o esis ance, and esis ance inc eases he
319 abundance o ole an bac e ia. 2,3,7,34 This in o ma ion could be impo an o he
320 design o mo e po en ea men s. In his con ex , i would be impo an o
321 unde s and how his in e ac ion occu s unde he apeu ic concen a ions o
322 an imic obial agen s.
323 In ou s udy, ou in e es was o e alua e he in e play be ween ole ance
324 and esis ance unde he apeu ic and killing condi ions o cip o loxacin (1 mg/L,
325 he EUCAST/CLSI b eakpoin o esis ance, and 2.5 mg/L, he Cmax o his
326 d ug) 26–28 by measu ing he abundance o su i ing bac e ia o e a sho pe iod
Page 16 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
327 (up o 4 hou s). A hese he apeu ic concen a ions, we ound ha LLQR
328 mechanisms (media ed by ype II opoisome ase modi ica ions and PMQR
329 mechanisms) inc eased ole ance (and pe sis ence) agains cip o loxacin, bo h
330 in isogenic LLQR E. coli mu an s and clinical LLQR E. coli isola es (Figu e 1 and
331 Figu e 2). Ou da a suppo he gene al idea ha ole ance and esis ance
332 mu a ions in e ac syne gis ically and ha he wo s a egies combined p o ide
333 bac e ia wi h an oppo uni y o e ade he apeu ic an imic obial condi ions. 3,7,8
334 In e es ingly, o he low-le el esis ance mechanisms such as e lux sys ems (like
335 Ac AB-TolC) ha e been shown o ac i ely con ibu e o ole ance (pe sis ence)
336 o ma ion, indica ing ha exp ession o hese ypes o sys em ac s as a posi i e
337 de ense agains an ibio ics du ing do mancy, and sugges ing ha e lux inhibi o s
338 could be conside ed o comba d ug ole ance. 35 I would be in e es ing o
339 alida e hese esul s using hollow ibe o animal models.
340 SOS esponse plays an impo an ole in adap a ion and acqui ed bac e ial
341 esis ance o an ibio ics and has been p oposed as an a ac i e s a egy o
342 inc easing bac e ial suscep ibili y and an ibio ic le hali y and o comba ing he
343 eme gence o esis ance. 17,18 In e es ingly, he SOS esponse has been linked
344 o ole ance pheno ypes. 5 DNA damage p oduced by quinolones also ac i a es
345 a ne wo k o SOS-dependen genes, he esul o which is he p oduc ion o
346 a ious epai p o eins o oxin-an i oxin sys ems (such as isAB genes) leading
347 o he o ma ion o ole an (pe sis e ) cells. 6 Induced ole ance as a side e ec
348 o an ibio ic ea men is an e ec i e bac e ial su i al s a egy and could
349 con ibu e o ecalci an in ec ions. 2,4,7,8 Apa om ha , low-le el esis ance
350 pheno ypes such as LLQR (which can be exposed o sub-le hal le els o
351 an ibio ics du ing an imic obial ea men ), pose a signi ican h ea o he
Page 17 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
352 de elopmen o clinical esis ance. 9,36–39 In he p esen s udy, we also
353 de e mined whe he he in e ac ion be ween esis ance (LLQR pheno ypes) and
354 ole ance (including pe sis ence) mechanisms was modi ied unde condi ions o
355 supp ession o SOS esponse, in o de o alida e he impac o his s a egy on
356 educing ole ance a es in bac e ia wi h LLQR pheno ypes a clinically ele an
357 concen a ions o quinolones. We obse ed ha LLQR mechanisms abo u he
358 educ ions in ole an bac e ia due o supp ession o he SOS esponse a
359 clinically ele an concen a ions, 26,27 which con as s wi h obse a ions in ully
360 suscep ible wild- ype E. coli s ains. 5,6 This e ec was mo e ob ious due o he
361 accumula ion o wo modi ica ions in ype II opoisome ases (S83L in Gy A and
362 S80R in Pa C). RecA and LexA ha e been p oposed as he apeu ic a ge s o
363 pe u b SOS induc ion (Figu e 3 and Figu e 4), 17,18,20,23 playing RecA an
364 addi ional ole in o he s impo an p ocesses like homologous ecombina ion o
365 ho izon al gene ans e . 16,21 Ou da a sugges ha a ge ing ei he RecA o LexA
366 would no ha e a bene icial impac agains ole an (pe sis e ) pheno ypes in low-
367 le el esis ance pheno ypes unde clinically ele an concen a ions o
368 quinolones.
369 In o e all e ms, his s udy shows ha ole ance and esis ance mu a ions
370 in e ac syne gis ically and ha he wo s a egies combined gi es bac e ia he
371 oppo uni y o e ade he apeu ic an imic obial condi ions, wi h low-le el
372 esis ance mechanisms playing an ex a ole in enabling bac e ial su i al. SOS
373 esponse supp ession is an in e es ing s a egy o educing ole ance and
374 abundance in he absence o LLQR mechanisms; un o una ely om a
375 he apeu ic poin o iew, he p esence o LLQR mechanisms abo s his
376 app oach a clinically ele an concen a ions.
Page 18 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
377 Funding
378 This s udy was unded by he Ins i u o de Salud Ca los III, Minis e io de
379 Economía y Compe i i idad—co- inanced by Eu opean De elopmen Regional
380 Fund ‘A way o achie e Eu ope’ ERDF, Spanish Ne wo k o Resea ch in
381 In ec ious Diseases [REIPI RD12/0015 and RD16/0016].
382 Suppo ed by Plan Nacional de I+D+i 2013‐2016 and Ins i u o de Salud
383 Ca los III, Subdi ección Gene al de Redes y Cen os de In es igación
384 Coope a i a, Minis e io de Economía, Indus ia y Compe i i idad, Spanish
385 Ne wo k o Resea ch in In ec ious Diseases (PI14/00940, PI17/01501,
386 RD16/0016/0001 and REIPI RD16/0016/0009) ‐ co- inanced by Eu opean
387 De elopmen Regional Fund “A way o achie e Eu ope”, Ope a i e P og amme
388 In elligen G ow h 2014‐2020.
389 The unde s had no ole in he design, collec ion o da a, analysis and
390 w i ing o he manusc ip o he decision o publish.
391
392
393 T anspa ency decla a ions
394
395 None o decla e.
396
397
398
399
Page 19 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
400 Re e ences
401 1. Balaban NQ, Me in J, Chai R e al. Bac e ial pe sis ence as a pheno ypic
402 swi ch. Science 2004; 305: 1622–5.
403 2. Le in-Reisman I, Ronin I, Ge en O e al. An ibio ic ole ance acili a es he
404 e olu ion o esis ance. Science 2017; 355: 826–30.
405 3. Le in-Reisman I, B aune A, Ronin I e al. Epis asis be ween an ibio ic
406 ole ance, pe sis ence, and esis ance mu a ions. P oc Na l Acad Sci 2019; 116:
407 14734–9.
408 4. Lewis K, Shan Y. Why ole ance in i es esis ance. Science 2017; 355: 796.
409 5. Dö T, Lewis K, Vulić M. SOS esponse induces pe sis ence o
410 luo oquinolones in Esche ichia coli. PLoS Gene 2009; 5: e1000760.
411 6. Dö T, Vulić M, Lewis K. Cip o loxacin causes pe sis e o ma ion by inducing
412 he TisB oxin in Esche ichia coli. PLoS Biol 2010; 8: e1000317.
413 7. Balaban NQ, Helaine S, Lewis K e al. De ini ions and guidelines o esea ch
414 on an ibio ic pe sis ence. Na Re Mic obiol 2019; 17: 441–8.
415 8. B aune A, F idman O, Ge en O e al. Dis inguishing be ween esis ance,
416 ole ance and pe sis ence o an ibio ic ea men . Na Re Mic obiol 2016; 14:
417 320–30.
418 9. Rod íguez-Ma ínez JM, Machuca J, Cano ME e al. Plasmid-media ed
419 quinolone esis ance: Two decades on. D ug Resis Upda 2016; 29: 13–29.
420 10. Blai JMA, Webbe MA, Baylay AJ e al. Molecula mechanisms o an ibio ic
421 esis ance. Na Re Mic obiol 2015; 13: 42–51.
Page 20 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
422 11. Hoope DC, Jacoby GA. Mechanisms o d ug esis ance: quinolone
423 esis ance. Ann N Y Acad Sci 2015; 1354: 12–31.
424 12. Jacoby G, S ahile i z J, Hoope D. Plasmid-media ed quinolone esis ance.
425 Mic obiol Spec 2014; 2: 997–1003.
426 13. Vila J, Sáez-López E, Johnson JR e al. Esche ichia coli: an old iend wi h
427 new idings. FEMS Mic obiol Re 2016; 40: 437-63.
428 14. Roca I, Ako a M, Baque o F e al. The global h ea o an imic obial
429 esis ance: science o in e en ion. New mic obes new In ec 2015; 6: 22–9.
430 15. Laxmina ayan R, Duse A, Wa al C e al. An ibio ic esis ance- he need o
431 global solu ions. Lance In ec Dis 2013; 13: 1057–98.
432 16. Baha oglu Z, Mazel D. SOS, he o midable s a egy o bac e ia agains
433 agg essions. FEMS Mic obiol Re 2014; 38: 1126–45.
434 17. Recacha E, Machuca J, Díaz de Alba P e al. Quinolone Resis ance
435 Re e sion by Ta ge ing he SOS Response. MBio 2017; 8: pi: e00971-17.
436 18. Recacha E, Machuca J, Díaz-Díaz S e al. Supp ession o he SOS esponse
437 modi ies spa io empo al e olu ion, pos -an ibio ic e ec , bac e ial i ness and
438 bio ilm o ma ion in quinolone- esis an Esche ichia coli. J An imic ob Chemo he
439 2019; 74: 66-73.
440 19. Blazquez J, Couce A, Rod iguez-Bel an J e al. An imic obials as p omo e s
441 o gene ic a ia ion. Cu Opin Mic obiol 2012; 15: 561–9.
442 20. Culyba MJ, Mo CY, Kohli RM. Ta ge s o Comba ing he E olu ion o
443 Acqui ed An ibio ic Resis ance. Biochemis y 2015; 54: 3573–82.
Page 21 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
444 21. Blázquez J, Rod íguez-Bel án J, Ma ic I. An ibio ic-Induced Gene ic
445 Va ia ion: How I A ises and How I Can Be P e en ed. Annu Re Mic obiol 2018;
446 72: 209–30.
447 22. S einb eche T, P ock S, Reiche J e al. Pep ide-Lipid In e ac ions o he
448 S ess-Response Pep ide TisB Tha Induces Bac e ial Pe sis ence. Biophys J
449 2012; 103: 1460–9.
450 23. Mo CY, Manning SA, Roggiani M e al. Sys ema ically Al e ing Bac e ial SOS
451 Ac i i y unde S ess Re eals The apeu ic S a egies o Po en ia ing An ibio ics.
452 mSphe e 2016; 1: pii: e00163-16.
453 24. Alam MK, Alhhazmi A, DeCo eau JF e al. RecA Inhibi o s Po en ia e
454 An ibio ic Ac i i y and Block E olu ion o An ibio ic Resis ance. Cell Chem Biol
455 2016; 23: 381–91.
456 25. Lu TK, Collins JJ. Enginee ed bac e iophage a ge ing gene ne wo ks as
457 adju an s o an ibio ic he apy. P oc Na l Acad Sci U S A 2009; 106: 4629–34.
458 26. Eu opean Commi ee on An imic obial Suscep ibili y Tes ing. 2018. Clinical
459 b eakpoin s and epidemiological cu -o alues. h p://www.eucas
460 .o g/clinical_b eakpoin s/.
461 27. Benne JE, Dolin R, Blase MJ. 2015. Mandell, Douglas, and Benne ’s
462 p inciples and p ac ice o in ec ious diseases, 8 h ed, p427. Else ie Saunde s,
463 Philadelphia, PA.
464 28. CLSI. Pe o mance S anda ds o An imic obial Suscep ibili y Tes ing-:
465 Twen y-nine h Edi ion: M100-S28. 2018.
Page 22 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
466 29. Rod íguez-Ma ínez JM, López-Ce e o L, Díaz-de-Alba P e al. Assessmen
467 o a pheno ypic algo i hm o de ec plasmid-media ed quinolone esis ance in
468 En e obac e iaceae. J An imic ob Chemo he 2016; 71: 845–7.
469 30. Zasla e A, B en A, Ronen M e al. A comp ehensi e lib a y o luo escen
470 ansc ip ional epo e s o Esche ichia coli. Na Me hods 2006; 3: 623–8.
471 31. Da senko KA, Wanne BL. One-s ep inac i a ion o ch omosomal genes in
472 Esche ichia coli K-12 using PCR p oduc s. P oc Na l Acad Sci U S A 2000; 97:
473 6640–5.
474 32. Lewis K. Pe sis e cells, do mancy and in ec ious disease. Na Re Mic obiol
475 2007; 5: 48–56.
476 33. D lica K, Zhao X. Mu an Selec ion Window Hypo hesis Upda ed. Clin In ec
477 Dis 2007; 44: 681–8.
478 34. Windels EM, Michiels JE, Van den Be gh B e al. An ibio ics: Comba ing
479 Tole ance To S op Resis ance Eps ein S, Rubin EJ, eds. MBio 2019; 10: pii:
480 e02095-19.
481 35. Pu Y, Zhao Z, Li Y e al. Enhanced E lux Ac i i y Facili a es D ug Tole ance
482 in Do man Bac e ial Cells. Mol Cell 2016; 62: 284–94.
483 36. Domínguez-He e a J, Velasco C, Docobo-Pé ez F e al. Impac o qn A1,
484 qn B1 and qn S1 on he e icacy o cip o loxacin and le o loxacin in an
485 expe imen al pneumonia model caused by Esche ichia coli wi h o wi hou he
486 Gy A mu a ion Se 83Leu. J An imic ob Chemo he 2013; 68: 1609–15.
487 37. Machuca J, B iales A, Lab ado G e al. In e play be ween plasmid-media ed
Page 23 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
488 and ch omosomal-media ed luo oquinolone esis ance and bac e ial i ness in
489 Esche ichia coli. J An imic ob Chemo he 2014; 69: 3203-15.
490 38. Machuca J, B iales A, Diaz-de-Alba P e al E ec o he e lux pump QepA2
491 combined wi h ch omosomally media ed mechanisms on quinolone esis ance
492 and bac e ial i ness in Esche ichia coli. J An imic ob Chemo he 2015; 70: 2524-
493 7.
494 39. Rod iguez-Ma inez JM, Diaz de Alba P, B iales A e al. Con ibu ion o
495 OqxAB e lux pumps o quinolone esis ance in ex ended-spec um-be a-
496 lac amase-p oducing Klebsiella pneumoniae. J An imic ob Chemo he 2013; 68:
497 68–73.
498 40. Rod iguez-Ma inez JM, Velasco C, Pascual A e al. Co ela ion o quinolone
499 esis ance le els and di e ences in basal and quinolone-induced exp ession om
500 h ee qn A-con aining plasmids. Clin Mic obiol In ec 2006; 12: 440–5.
501
502
Page 24 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
573 Figu e 4
574
MG1655
(1mg/L)
MG1655 isB
(1mg/L)
MG2
(1mg/L)
MG2 isB
(1mg/L)
0
2
4
6
8
Log10 c u/mL
Pe sis e s cells a 1 mg/L a e 3 hou s
*
ns
Page 31 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
575 Figu e 5
576
ecA
isB
0
1
2
3
4
5
Induc ion a e 4 hou s
E alua ed Genes
Fold induc ion
E. coli ATCC (WT) EC02 (LLQR)
EC04 (LLQR)
*
*
*
*
Page 32 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
577 Figu e S1
578
51 (LLQR) s 111S (WT)
Time (hou s)
01234
0
2
4
6
8
10
Log10 (c u/mL)
2 (LLQR) s 112S (WT)
Time (hou s)
Log10 (c u/mL)
01234
0
2
4
6
8
10
100 (LLQR) s 105S (WT)
Time (hou s)
Log10 (c u/mL)
01234
0
2
4
6
8
10
NT LLQR CIP1 LLQR CIP2.5 LLQR
NT WT pheno ype CIP1 WT pheno ype CIP2.5 WT pheno ype
Page 33 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
579 Table 1. Geno ypes and cip o loxacin suscep ibili y (by E es ) o isogenic s ains.
580
S aina
gy A1
gy A2
pa C
ma R
qn
SOS
esponse
MICb
CC
(CLSI/EUCAST)c
Sou ce o
e e ence
ATCCd
-
-
-
-
-
WTe
0.008
S/S
Lab collec ion
ATCC ecA
-
-
-
-
-
ecA
<0.002
S/S
17
ATCClexA1
-
-
-
-
-
lexA1
0.004
S/S
17
EC02
S83L
-
-
-
-
WT
0.25
S/S
17
EC02 ecA
S83L
-
-
-
-
ecA
0.03
S/S
17
EC04
S83L
-
S80R
-
-
WT
0.5
I/ATU
17
EC04 ecA
S83L
-
S80R
-
-
ecA
0.125
S/S
17
EC04lexA1
S83L
-
S80R
-
-
lexA1
0.5
I/ATU
17
MG1655d
-
-
-
-
-
WT
0.03
S/S
Lab collec ion
MG1655 isAB
-
-
-
-
-
isAB
0.03
S/S
This s udy
MG2
S83L
-
-
-
-
WT
0.25
S/S
This s udy
MG2 isAB
S83L
-
-
-
-
isAB
0.25
S/S
This s udy
105S
-
-
-
-
-
WT
0.008
S/S
29
Page 34 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
111S
-
-
-
-
-
WT
0.016
S/S
29
112S
-
-
-
-
-
WT
0.008
S/S
29
2
-
-
-
-
qn S1
WT
0.5
I/ATU
29
51
-
-
-
-
qn B4
WT
0.25
S/S
29
100
-
-
-
-
qn B4
WT
0.125
S/S
29
581
582 a Geno ype. S ains a e isogenic o E. coli ATCC 25922 and ca y only ch omosomal modi ica ions and/o SOS dys unc ion [ ecA dele ion o non-p o eolizable LexA
583 a ian (LexA1)]. Resis ance-associa ed mu a ions loca ed in he Gy A and Pa C p o eins a e de ined as esis ance mechanisms ha al e he a ge si e.
584 b MIC (mg/L) o cip o loxacin by E es .
585 c CC (CLSI/EUCAST) e e s o clinical ca ego ies acco ding o CLSI o EUCAST b eakpoin s 26,28.
586 d ATCC means E. coli ATCC 25922 and MG1655 means E. coli MG1655
587 e Wild- ype
588 S, suscep ible; I, in e media e suscep ibili y; R, esis an ; ATU, A ea o Technical Unce ain y
589
590
Page 35 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
591 Table S1. Oligonucleo ides and plasmids used in his s udy.
592
P ime o plasmid
Sequencea
Use in his s udy
Sou ce o
e e ence
P ime Inac i a ion o isAB genes
H1- isAB-P1
5´- AGCGGAAAGGTACGTCAGCTGGCAGTGCTCCTGAACCACAGGAGACGCGT-GTGTAGGCTGGAGCTGCTTC -3´
isAB inac i a ion
This s udy
H2- isAB-P2
5´- ATATAAAAGGGGAGCGGTTTCCCGCTCCCCTTTGGTGCGACTTGAATCTG-ATGGGAATTAGCCATGGTCC -3´
isAB inac i a ion
This s udy
P e-H1- isAB
5’ – TACGTGTTCCGCGCAGAACGCG-3’
isAB inac i a ion es ing
This s udy
Pos -H2- isAB
5’ – CCAGGAATGGGGAATTGTTTAGC -3’
isAB inac i a ion es ing
This s udy
isB-Fw
5’ – ATGAACCTGGTGGATATCGCCA-3’
isB in e nal ampli ica ion
This s udy
isB-R
5’ – TTACTTCAGGTATTTCAGAACA-3’
isB in e nal ampli ica ion
This s udy
K1
5´ -CAGTCATAGCCGAATAGCCT-3´
Ch omosomal
inac i a ion
31
K2
5´ -CGGTGCCCTGAATGAACTGC-3´
Ch omosomal
inac i a ion
31
K
5´-CGGCCACAGTCGATGAATCC-3´
Ch omosomal
inac i a ion
31
isB-g p epo e p omo e usion
P e-P isB-Xhol
5´-ccgCTCGAGcggTACGTGTTCCGCGCAGAACGCG-3´
isB-g p epo e
p omo e usion
This s udy
Page 36 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
P isB-R -BamH1
5´-cgcGGATCCgcgACGCGTCTCCTGTGGTTCAGGAG-3´
isB-g p epo e
p omo e usion
This s udy
gy A-1
5´-AAATCTGCCCGTGTCGTTGGT-3
QRDR Gy A sequencing
40
gy A-2
5´-GCCATACCTACGGCGATACC-3
QRDR Gy A sequencing
40
Ec-pcA
5´-GCGAACGATTTCGGATCG-3
QRDR Pa C sequencing
40
Ec-pcB
5´-CTGAATGCCAGCGCCAAATT-3
QRDR Pa C sequencing
40
Plasmids
pKD4
Ch omosomal
inac i a ion
31
pKOBEG
Ch omosomal
inac i a ion/ helpe
ec o
31
pCP20
Ch omosomal
inac i a ion/ esolu ion
ec o
31
pMS201
low copy, GFP epo e
ec o ( ep-pSC101 KmR
g p)
pMS ecA-g p
ecA-g p epo e
p omo e usion
30
pMS isB-g p
isB-g p epo e
p omo e usion
This s udy
593
594 aUnde lined nucleo ides co espond o he BamHI and XhoI si e used o cloning.
595
Page 37 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
Page 38 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
Page 39 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy
Con iden ial: o pee e iew only
Page 40 o 45
Jou nal o An imic obial Chemo he apy: unde e iew
Jou nal o An imic obial Chemo he apy