Role of low-level quinolone resistance in generating tolerance in Escherichia coli under therapeutic concentrations of ciprofloxacin

Confidential: for peer review only Role of Low-Level Quinolone Resistance in Generating Tolerance in Escherichia coli under Therapeutic Concentrations of Ciprofloxacin Journal: Journal of Antimicrobial Chemotherapy Manuscript ID JAC-2019-2038.R1 Manuscript Type: Original Article Date Submitted by the Author: n/a Complete List of Authors: Ortiz Padilla, Miriam; University of Seville, Microbiology Diaz-Diaz, Sara; Universidad de Sevilla Facultad de Medicina Machuca, Jesús; Universitary Hospital Virgen Macarena, Microbiology Tejada-Gonzalez, Antonio; University of Seville Recacha, Esther; University of Seville, Microbiology Docobo-Pérez, Fernando; Universidad de Sevilla Facultad de Medicina, Microbiologia; Instituto de Biomedicina de Sevilla, Pascual Hernández, Álvaro Rodriguez Martinez, Jose Manuel; Univ. Sevilla, Microbiology Keywords: Quinolones, Tolerance, Persistence, Low-level resistance, SOS response Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 1JAC-2019-2038_R1 2Role of Low-Level Quinolone Resistance in Generating 3Tolerance in Escherichia coli under Therapeutic Concentrations 4of Ciprofloxacin 5 6M. Ortiz-Padilla1,2,3,4, S. Diaz-Diaz1,2,3,4, J. Machuca1,2,3,4, A. Tejada- 7Gonzalez2, E. Recacha1,3,4, F. Docobo-Pérez2,3,4, A. Pascual1,2,3,4, J.M. 8Rodríguez-Martínez2,3,4,* 91Unidad Clínica de Enfermedades Infecciosas, Microbiología y Medicina 10 Preventiva, Hospital Universitario Virgen Macarena, Seville, Spain.; 2Departamento 11 de Microbiología, Facultad de Medicina, Universidad de Sevilla, Sevilla, Spain; 12 3Red Española de Investigación en Patología Infecciosa (REIPI), Instituto de Salud 13 Carlos III, Madrid, Spain; 4Instituto de Biomedicina de Sevilla IBIS, Hospital 14 Universitario Virgen Macarena/CSIC/Departamento de Microbiología, Universidad 15 de Sevilla, Seville, Spain 16 17 Running title: Role of Low-Level Quinolone Resistance in Tolerance Generation 18  Equal contribution 19 * Corresponding author: Mailing address: Department of Microbiology; University of 20 Seville. Avda Sanchez Pizjuan s/n. 41009 Spain. 21 Phone: +34 954 55 28 63. Fax: +34 954 37 74 13; E-mail: [email protected] 22 Words: Abstract length 250; Text length 3218 23 Tables/Figures/Supplementary data/References number: 1/5/2/40 24 25 26 Page 1 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 27 28 ABSTRACT 29 30 Background/Objectives: Tolerance (including persistence) and resistance 31 result in increased survival under antibiotic pressure. We evaluated the interplay 32 between resistance and tolerance to ciprofloxacin under therapeutic and killing 33 conditions to determine the contribution of low-level quinolone resistance (LLQR) 34 mechanisms to tolerance. We also determined how the interaction between 35 resistance (LLQR phenotypes) and tolerance was modified under SOS response 36 suppression. 37 Methods: Twelve isogenic E. coli strains harboring quinolone resistance 38 mechanisms combined with SOS response deficiency and six clinical E. coli 39 isolates (LLQR or non-LLQR) were evaluated. Survival (tolerance or persistence) 40 assays were used to measure surviving bacteria after a short period (up to 4 41 hours) of bactericidal antibiotic treatment under therapeutic and killing 42 concentrations of ciprofloxacin (1 mg/L, the EUCAST/CLSI breakpoint; and 43 2.5 mg/L, Cmax). 44 Results: QRDR substitutions (S83L in GyrA alone or combined with S80R in 45 ParC) significantly increased the fraction of tolerant bacteria (2-4 log10 cfu/mL) 46 after exposure to ciprofloxacin at clinically relevant concentrations. Impact on 47 tolerant bacteria due to SOS response suppression (including persistence 48 mediated by the tisB gene) was reverted by LLQR mechanisms at therapeutic 49 concentrations. Furthermore, no reduction in the fraction of tolerant bacteria due 50 to SOS response suppression was observed when S83L in GyrA plus S80R in 51 ParC were combined. Page 2 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 52 Conclusions: Tolerance and quinolone resistance mutations interact 53 synergistically, giving LLQR mechanisms an additional role in allowing bacterial 54 survival and evasion of therapeutic antimicrobial conditions by a combination of 55 the two strategies. At clinically relevant concentrations, LLQR mechanisms revert 56 further impact of SOS response suppression in reducing bacterial tolerance. 57 Page 3 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 58 Introduction 59 Antimicrobial tolerance is defined as the capacity to prolong the duration of 60 treatment that bacteria can sustain, for example, by remaining dormant. 61 Dormancy (tolerance) protects bacteria from the lethal effects of many types of 62 antibiotics like beta-lactams and quinolones whose mechanism of action requires 63 growth, as long as they remain dormant. A related phenomenon called 64 persistence is the ability of a subpopulation of susceptible bacteria to survive 65 lethal doses of antibiotics, resulting in a biphasic killing curve. 1–4 Both tolerance 66 and persistence are transient and non-hereditary phenotypes, unlike resistance, 67 which is the result of genetic modification. 4–8 Both genetic and phenotypic 68 variability can have important consequences for bacterial survival in antibiotic 69 treatment. 70 Resistance is the inherited ability of microorganisms to grow in the presence of 71 antibiotics, regardless of duration of treatment. Resistance is achieved by 72 different mechanisms such as modification of the drug target or efflux pumps, and 73 is quantified by MIC of antibiotic required to prevent growth. 8–10 74 Both tolerance (including persistence) and resistance result in increased survival 75 under antibiotic pressure. The interaction between resistance and tolerance has 76 not been completely analyzed. 77 One of the most frequently prescribed broad-spectrum antibiotics are the 78 fluoroquinolones (FQs), which target DNA gyrase and topoisomerase IV. These 79 essential enzymes regulate genomic DNA supercoiling during replication and 80 transcription. 9,11,12 FQs prevent ligation reactions of gyrase and topoisomerase 81 resulting in double-strand breaks. Enterobacterales like Escherichia coli are Page 4 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 82 among the most common causes of community-acquired and nosocomial 83 infections. FQs are used as empirical and directed therapy in infections caused 84 by E. coli. 13 FQ resistance in both human and veterinary isolates of 85 Enterobacterales has increased notably. 14,15 The mechanisms of fluoroquinolone 86 resistance mainly involve chromosomal mutations in genes encoding quinolone 87 targets (type II topoisomerases), but also reduced permeability or efflux pump 88 overexpression. 9,11,12 Plasmid-mediated quinolone resistance (PMQR) 89 mechanisms are also epidemiologically relevant. 9 Both chromosomal and 90 plasmid-mediated mechanisms on their own confer low-level quinolone 91 resistance (LLQR) producing a clinically susceptible phenotype, so that multiple 92 mechanisms must be combined to achieve clinical resistance. The interplay 93 between LLQR phenotypes and tolerance at clinically relevant concentrations of 94 quinolones has not been explored. 95 Quinolone therapy can facilitate adaptive resistance mutations and the 96 acquisition of resistance genes by promoting the activation of RecA (initiating the 97 SOS response involving the DNA repair and mutagenesis pathways). 16–20 The 98 SOS response is induced after RecA activation, which triggers self-cleavage of 99 the LexA repressor. Apart from that, RecA is a multifunctional protein involved in 100 DNA repair, recombination and horizontal gene transfer. 16,21 Interestingly, the 101 SOS response is an active and inducible mechanism of persister formation 102 (mediated by the tisB gene). 6 SOS-induced persistence is a mechanism that cells 103 can use to counteract DNA damage and promote survival in the presence of 104 fluoroquinolones. The bacterial stress-response peptide TisB in E. coli dissipates 105 the transmembrane potential in such a way that the depletion of ATP levels 106 induces the formation of dormant persister cells. 22 It has been reported that this Page 5 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 107 survival mechanism could be important for influencing the outcome of antibiotic 108 therapy in vivo. 2,3,6,7 Suppression of the SOS response has recently been 109 revealed as a therapeutic strategy for potentiating bactericidal antibiotics such as 110 quinolones against both susceptible and resistant E. coli, leading to their 111 resensitization. 17,18,20,23–25 However, the impact of SOS response suppression on 112 tolerance (and persistence) rates in bacteria with LLQR phenotypes at clinically 113 relevant concentrations of quinolones is unknown. 114 In this study, we examine the interplay between tolerance and resistance under 115 therapeutic conditions using ciprofloxacin (1 mg/L, the EUCAST/CLSI 116 breakpoints for resistance, and 2.5 mg/L, the Cmax for this drug) 26–28 and 117 measuring the abundance of surviving bacteria after bactericidal antibiotic 118 treatment. The primary question was to determine how LLQR genetic 119 mechanisms contribute to tolerance under these conditions. For this goal, both 120 isogenic LLQR mutants and clinical LLQR isolates were tested. Our second goal 121 was to determine whether interactions between resistance (LLQR phenotypes) 122 and tolerance mechanisms were modified under conditions of SOS response 123 suppression in order to validate the impact of this strategy to reduce tolerance 124 (and persistence) rates in bacteria with LLQR phenotypes at clinically relevant 125 concentrations of quinolones. 126 Page 6 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 127 Materials and methods 128 Strains, growth conditions and antimicrobial agents 129 Twelve isogenic E. coli strains (based on wild-type E. coli ATCC 25922 130 and E. coli MG1655) were used harboring chromosomally-mediated quinolone 131 resistance mechanisms combined with recA deletion and/or lexA replacement by 132 lexA1. 17 Three clinical isolates of E. coli fully susceptible to ciprofloxacin and 133 three clinical isolates of E. coli with LLQR (harboring plasmid-mediated quinolone 134 resistance mechanisms) to ciprofloxacin were also evaluated 29 (see Table 1). 135 Liquid or solid LB (Luria-Bertani) medium and Mueller-Hinton broth (MHB) 136 were used. Strains were grown at 37ºC. Ciprofloxacin was used for the various 137 assays (Sigma-Aldrich, Madrid, Spain). Kanamycin (Sigma-Aldrich, Madrid, 138 Spain) at 30 mg/L, chloramphenicol (Sigma-Aldrich, Madrid, Spain) at 25 mg/L 139 and ampicillin (Sigma-Aldrich, Madrid, Spain) at 50 mg/L were used for plasmid 140 maintenance. Expression of ciprofloxacin-induced GFP into the kanamycin- 141 resistant pMSrecA-gfp and pMStisB-gfp vectors was used to detect recA (SOS 142 induction) and tisB promoter activity, respectively (see Table S1). 17,30 143 Susceptibility testing 144 MICs were determined in triplicate for each bacterial strain, using two 145 different techniques, broth microdilution and the gradient strip assay technique, 146 following CLSI reference methods. 28 Clinical categories were established 147 according to CLSI and EUCAST breakpoints. 26,28 148 Page 7 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 149 In vitro evolution of E. coli strain MG1655 and whole genome sequencing 150 characterization 151 E. coli strain MG1655 was gradually exposed over five days to increasing 152 concentrations of ciprofloxacin (from 1/4xMIC to 4xMIC) in serial subcultures. 153 Stable increased MICs were confirmed, and several mutants obtained at 4xMIC 154 were sequenced by WGS. In brief, genomic DNA was extracted from evolved 155 mutants and parental strain and sequenced using MiSeq (Illumina, San Diego, 156 CA, USA). Raw reads were quality filtered and assembled into contigs using the 157 CLC genomics workbench 9.5.2. (CLC bio, QIAGEN, Madrid, Spain) and the 158 default settings of the software. An average coverage of 50x was observed. 159 Contigs were annotated using RAST 2.0 (http://rast.nmpdr.org/rast.cgi). SNP 160 analysis, and mutation/variant detection was carried out on a CLC genomics 161 workbench 9.5.2, using E. coli MG1655 (Genbank accession: U00096.2) as the 162 reference. BLASTn/p® (National Center for Biotechnology Information, 163 Bethesda, MD, USA) was used to confirm the sequences. After this analysis, it 164 was confirmed that the E. coli MG2 strain harboured only the S83L substitution 165 as the molecular mechanism of ciprofloxacin resistance. 166 167 tisAB toxin-antitoxin system inactivation 168 Disruption of the tisAB system was carried out using a modified version of 169 the method described by Datsenko and Wanner (see Table S1 for details). 31 170 171 Page 8 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 299 With respect to the tisB gene, we also analyzed its presence in a collection 300 of 35 E. coli clinical isolates from the University Hospital Virgen Macarena 29 and 301 found that this gene was absent in 46% of isolates. This observation supports 302 that multiple genes can be implicated in persistence phenomena. Page 15 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 303 Discussion 304 Tolerance (including the persistence phenotype) and resistance are two 305 different ways used by bacteria to evade antibiotic treatment. 8,32 Separately, 306 tolerance and resistance have been shown to alter the efficacy of antimicrobials, 307 2,7,9,11 but the interplay between the two types of mechanism, as well as the 308 contribution of low-level mechanisms to the abundance of tolerant bacteria under 309 therapeutic concentrations of antimicrobial agents, have not been analyzed in 310 detail. 311 Levin-Reisman et al. very recently evaluated the epistatic relationship 312 between antibiotic tolerance, persistence, and resistance mutations with an E. 313 coli and beta-lactam (ampicillin) treatment model 3 that used concentrations 314 above the MPC (Mutant Prevention Concentration, the concentration required to 315 prevent growth of resistant mutants evolved by a single mutation). 26,33 They 316 found that interaction between resistance and tolerance mutations was 317 synergistic in strains evolved under intermittent antibiotic treatment. The data 318 support that tolerance leads to resistance, and resistance increases the 319 abundance of tolerant bacteria. 2,3,7,34 This information could be important for the 320 design of more potent treatments. In this context, it would be important to 321 understand how this interaction occurs under therapeutic concentrations of 322 antimicrobial agents. 323 In our study, our interest was to evaluate the interplay between tolerance 324 and resistance under therapeutic and killing conditions of ciprofloxacin (1 mg/L, 325 the EUCAST/CLSI breakpoint for resistance, and 2.5 mg/L, the Cmax for this 326 drug) 26–28 by measuring the abundance of surviving bacteria over a short period Page 16 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 327 (up to 4 hours). At these therapeutic concentrations, we found that LLQR 328 mechanisms (mediated by type II topoisomerase modifications and PMQR 329 mechanisms) increased tolerance (and persistence) against ciprofloxacin, both 330 in isogenic LLQR E. coli mutants and clinical LLQR E. coli isolates (Figure 1 and 331 Figure 2). Our data support the general idea that tolerance and resistance 332 mutations interact synergistically and that the two strategies combined provide 333 bacteria with an opportunity to evade therapeutic antimicrobial conditions. 3,7,8 334 Interestingly, other low-level resistance mechanisms such as efflux systems (like 335 AcrAB-TolC) have been shown to actively contribute to tolerance (persistence) 336 formation, indicating that expression of these types of system acts as a positive 337 defense against antibiotics during dormancy, and suggesting that efflux inhibitors 338 could be considered to combat drug tolerance. 35 It would be interesting to 339 validate these results using hollow fiber or animal models. 340 SOS response plays an important role in adaptation and acquired bacterial 341 resistance to antibiotics and has been proposed as an attractive strategy for 342 increasing bacterial susceptibility and antibiotic lethality and for combating the 343 emergence of resistance. 17,18 Interestingly, the SOS response has been linked 344 to tolerance phenotypes. 5 DNA damage produced by quinolones also activates 345 a network of SOS-dependent genes, the result of which is the production of 346 various repair proteins or toxin-antitoxin systems (such as tisAB genes) leading 347 to the formation of tolerant (persister) cells. 6 Induced tolerance as a side effect 348 of antibiotic treatment is an effective bacterial survival strategy and could 349 contribute to recalcitrant infections. 2,4,7,8 Apart from that, low-level resistance 350 phenotypes such as LLQR (which can be exposed to sub-lethal levels of 351 antibiotics during antimicrobial treatment), pose a significant threat to the Page 17 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 352 development of clinical resistance. 9,36–39 In the present study, we also 353 determined whether the interaction between resistance (LLQR phenotypes) and 354 tolerance (including persistence) mechanisms was modified under conditions of 355 suppression of SOS response, in order to validate the impact of this strategy on 356 reducing tolerance rates in bacteria with LLQR phenotypes at clinically relevant 357 concentrations of quinolones. We observed that LLQR mechanisms abort further 358 reductions in tolerant bacteria due to suppression of the SOS response at 359 clinically relevant concentrations, 26,27 which contrasts with observations in fully 360 susceptible wild-type E. coli strains. 5,6 This effect was more obvious due to the 361 accumulation of two modifications in type II topoisomerases (S83L in GyrA and 362 S80R in ParC). RecA and LexA have been proposed as therapeutic targets to 363 perturb SOS induction (Figure 3 and Figure 4), 17,18,20,23 playing RecA an 364 additional role in others important processes like homologous recombination or 365 horizontal gene transfer. 16,21 Our data suggest that targeting either RecA or LexA 366 would not have a beneficial impact against tolerant (persister) phenotypes in low- 367 level resistance phenotypes under clinically relevant concentrations of 368 quinolones. 369 In overall terms, this study shows that tolerance and resistance mutations 370 interact synergistically and that the two strategies combined gives bacteria the 371 opportunity to evade therapeutic antimicrobial conditions, with low-level 372 resistance mechanisms playing an extra role in enabling bacterial survival. SOS 373 response suppression is an interesting strategy for reducing tolerance and 374 abundance in the absence of LLQR mechanisms; unfortunately from a 375 therapeutic point of view, the presence of LLQR mechanisms aborts this 376 approach at clinically relevant concentrations. Page 18 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 377 Funding 378 This study was funded by the Instituto de Salud Carlos III, Ministerio de 379 Economía y Competitividad—co-financed by European Development Regional 380 Fund ‘A way to achieve Europe’ ERDF, Spanish Network for Research in 381 Infectious Diseases [REIPI RD12/0015 and RD16/0016]. 382 Supported by Plan Nacional de I+D+i 2013‐2016 and Instituto de Salud 383 Carlos III, Subdirección General de Redes y Centros de Investigación 384 Cooperativa, Ministerio de Economía, Industria y Competitividad, Spanish 385 Network for Research in Infectious Diseases (PI14/00940, PI17/01501, 386 RD16/0016/0001 and REIPI RD16/0016/0009) ‐ co-financed by European 387 Development Regional Fund “A way to achieve Europe”, Operative Programme 388 Intelligent Growth 2014‐2020. 389 The funders had no role in the design, collection of data, analysis and 390 writing of the manuscript or the decision to publish. 391 392 393 Transparency declarations 394 395 None to declare. 396 397 398 399 Page 19 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 400 References 401 1. Balaban NQ, Merrin J, Chait R et al. Bacterial persistence as a phenotypic 402 switch. Science 2004; 305: 1622–5. 403 2. Levin-Reisman I, Ronin I, Gefen O et al. Antibiotic tolerance facilitates the 404 evolution of resistance. Science 2017; 355: 826–30. 405 3. Levin-Reisman I, Brauner A, Ronin I et al. Epistasis between antibiotic 406 tolerance, persistence, and resistance mutations. Proc Natl Acad Sci 2019; 116: 407 14734–9. 408 4. Lewis K, Shan Y. Why tolerance invites resistance. Science 2017; 355: 796. 409 5. Dörr T, Lewis K, Vulić M. SOS response induces persistence to 410 fluoroquinolones in Escherichia coli. PLoS Genet 2009; 5: e1000760. 411 6. Dörr T, Vulić M, Lewis K. Ciprofloxacin causes persister formation by inducing 412 the TisB toxin in Escherichia coli. PLoS Biol 2010; 8: e1000317. 413 7. Balaban NQ, Helaine S, Lewis K et al. Definitions and guidelines for research 414 on antibiotic persistence. Nat Rev Microbiol 2019; 17: 441–8. 415 8. Brauner A, Fridman O, Gefen O et al. Distinguishing between resistance, 416 tolerance and persistence to antibiotic treatment. Nat Rev Microbiol 2016; 14: 417 320–30. 418 9. Rodríguez-Martínez JM, Machuca J, Cano ME et al. Plasmid-mediated 419 quinolone resistance: Two decades on. Drug Resist Updat 2016; 29: 13–29. 420 10. Blair JMA, Webber MA, Baylay AJ et al. Molecular mechanisms of antibiotic 421 resistance. Nat Rev Microbiol 2015; 13: 42–51. Page 20 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 422 11. Hooper DC, Jacoby GA. Mechanisms of drug resistance: quinolone 423 resistance. Ann N Y Acad Sci 2015; 1354: 12–31. 424 12. Jacoby G, Strahilevitz J, Hooper D. Plasmid-mediated quinolone resistance. 425 Microbiol Spectr 2014; 2: 997–1003. 426 13. Vila J, Sáez-López E, Johnson JR et al. Escherichia coli: an old friend with 427 new tidings. FEMS Microbiol Rev 2016; 40: 437-63. 428 14. Roca I, Akova M, Baquero F et al. The global threat of antimicrobial 429 resistance: science for intervention. New microbes new Infect 2015; 6: 22–9. 430 15. Laxminarayan R, Duse A, Wattal C et al. Antibiotic resistance-the need for 431 global solutions. Lancet Infect Dis 2013; 13: 1057–98. 432 16. Baharoglu Z, Mazel D. SOS, the formidable strategy of bacteria against 433 aggressions. FEMS Microbiol Rev 2014; 38: 1126–45. 434 17. Recacha E, Machuca J, Díaz de Alba P et al. Quinolone Resistance 435 Reversion by Targeting the SOS Response. MBio 2017; 8: pi: e00971-17. 436 18. Recacha E, Machuca J, Díaz-Díaz S et al. Suppression of the SOS response 437 modifies spatiotemporal evolution, post-antibiotic effect, bacterial fitness and 438 biofilm formation in quinolone-resistant Escherichia coli. J Antimicrob Chemother 439 2019; 74: 66-73. 440 19. Blazquez J, Couce A, Rodriguez-Beltran J et al. Antimicrobials as promoters 441 of genetic variation. Curr Opin Microbiol 2012; 15: 561–9. 442 20. Culyba MJ, Mo CY, Kohli RM. Targets for Combating the Evolution of 443 Acquired Antibiotic Resistance. Biochemistry 2015; 54: 3573–82. Page 21 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 444 21. Blázquez J, Rodríguez-Beltrán J, Matic I. Antibiotic-Induced Genetic 445 Variation: How It Arises and How It Can Be Prevented. Annu Rev Microbiol 2018; 446 72: 209–30. 447 22. Steinbrecher T, Prock S, Reichert J et al. Peptide-Lipid Interactions of the 448 Stress-Response Peptide TisB That Induces Bacterial Persistence. Biophys J 449 2012; 103: 1460–9. 450 23. Mo CY, Manning SA, Roggiani M et al. Systematically Altering Bacterial SOS 451 Activity under Stress Reveals Therapeutic Strategies for Potentiating Antibiotics. 452 mSphere 2016; 1: pii: e00163-16. 453 24. Alam MK, Alhhazmi A, DeCoteau JF et al. RecA Inhibitors Potentiate 454 Antibiotic Activity and Block Evolution of Antibiotic Resistance. Cell Chem Biol 455 2016; 23: 381–91. 456 25. Lu TK, Collins JJ. Engineered bacteriophage targeting gene networks as 457 adjuvants for antibiotic therapy. Proc Natl Acad Sci U S A 2009; 106: 4629–34. 458 26. European Committee on Antimicrobial Susceptibility Testing. 2018. Clinical 459 breakpoints and epidemiological cut-off values. http://www.eucast 460 .org/clinical_breakpoints/. 461 27. Bennett JE, Dolin R, Blaser MJ. 2015. Mandell, Douglas, and Bennett’s 462 principles and practice of infectious diseases, 8th ed, p427. Elsevier Saunders, 463 Philadelphia, PA. 464 28. CLSI. Performance Standards for Antimicrobial Susceptibility Testing-: 465 Twenty-nineth Edition: M100-S28. 2018. Page 22 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 466 29. Rodríguez-Martínez JM, López-Cerero L, Díaz-de-Alba P et al. Assessment 467 of a phenotypic algorithm to detect plasmid-mediated quinolone resistance in 468 Enterobacteriaceae. J Antimicrob Chemother 2016; 71: 845–7. 469 30. Zaslaver A, Bren A, Ronen M et al. A comprehensive library of fluorescent 470 transcriptional reporters for Escherichia coli. Nat Methods 2006; 3: 623–8. 471 31. Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes in 472 Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 2000; 97: 473 6640–5. 474 32. Lewis K. Persister cells, dormancy and infectious disease. Nat Rev Microbiol 475 2007; 5: 48–56. 476 33. Drlica K, Zhao X. Mutant Selection Window Hypothesis Updated. Clin Infect 477 Dis 2007; 44: 681–8. 478 34. Windels EM, Michiels JE, Van den Bergh B et al. Antibiotics: Combatting 479 Tolerance To Stop Resistance Epstein S, Rubin EJ, eds. MBio 2019; 10: pii: 480 e02095-19. 481 35. Pu Y, Zhao Z, Li Y et al. Enhanced Efflux Activity Facilitates Drug Tolerance 482 in Dormant Bacterial Cells. Mol Cell 2016; 62: 284–94. 483 36. Domínguez-Herrera J, Velasco C, Docobo-Pérez F et al. Impact of qnrA1, 484 qnrB1 and qnrS1 on the efficacy of ciprofloxacin and levofloxacin in an 485 experimental pneumonia model caused by Escherichia coli with or without the 486 GyrA mutation Ser83Leu. J Antimicrob Chemother 2013; 68: 1609–15. 487 37. Machuca J, Briales A, Labrador G et al. Interplay between plasmid-mediated Page 23 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 488 and chromosomal-mediated fluoroquinolone resistance and bacterial fitness in 489 Escherichia coli. J Antimicrob Chemother 2014; 69: 3203-15. 490 38. Machuca J, Briales A, Diaz-de-Alba P et al Effect of the efflux pump QepA2 491 combined with chromosomally mediated mechanisms on quinolone resistance 492 and bacterial fitness in Escherichia coli. J Antimicrob Chemother 2015; 70: 2524- 493 7. 494 39. Rodriguez-Martinez JM, Diaz de Alba P, Briales A et al. Contribution of 495 OqxAB efflux pumps to quinolone resistance in extended-spectrum-beta- 496 lactamase-producing Klebsiella pneumoniae. J Antimicrob Chemother 2013; 68: 497 68–73. 498 40. Rodriguez-Martinez JM, Velasco C, Pascual A et al. Correlation of quinolone 499 resistance levels and differences in basal and quinolone-induced expression from 500 three qnrA-containing plasmids. Clin Microbiol Infect 2006; 12: 440–5. 501 502 Page 24 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 573 Figure 4 574 MG1655 (1mg/L) MG1655tisB (1mg/L) MG2 (1mg/L) MG2tisB (1mg/L) 0 2 4 6 8 Log10 cfu/mL Persisters cells at 1 mg/L after 3 hours * ns Page 31 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 575 Figure 5 576 recA tisB 0 1 2 3 4 5 Induction after 4 hours Evaluated Genes Fold induction E. coli ATCC (WT) EC02 (LLQR) EC04 (LLQR) * * * * Page 32 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 577 Figure S1 578 51 (LLQR) vs 111S (WT) Time (hours) 01234 0 2 4 6 8 10 Log10 (cfu/mL) 2 (LLQR) vs 112S (WT) Time (hours) Log10 (cfu/mL) 01234 0 2 4 6 8 10 100 (LLQR) vs 105S (WT) Time (hours) Log10 (cfu/mL) 01234 0 2 4 6 8 10 NT LLQR CIP1 LLQR CIP2.5 LLQR NT WT phenotype CIP1 WT phenotype CIP2.5 WT phenotype Page 33 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 579 Table 1. Genotypes and ciprofloxacin susceptibility (by Etest) of isogenic strains. 580 Straina gyrA1 gyrA2 parC marR qnr SOS response MICb CC (CLSI/EUCAST)c Source or reference ATCCd - - - - - WTe 0.008 S/S Lab collection ATCCrecA - - - - - recA <0.002 S/S 17 ATCClexA1 - - - - - lexA1 0.004 S/S 17 EC02 S83L - - - - WT 0.25 S/S 17 EC02recA S83L - - - - recA 0.03 S/S 17 EC04 S83L - S80R - - WT 0.5 I/ATU 17 EC04recA S83L - S80R - - recA 0.125 S/S 17 EC04lexA1 S83L - S80R - - lexA1 0.5 I/ATU 17 MG1655d - - - - - WT 0.03 S/S Lab collection MG1655tisAB - - - - - tisAB 0.03 S/S This study MG2 S83L - - - - WT 0.25 S/S This study MG2tisAB S83L - - - - tisAB 0.25 S/S This study 105S - - - - - WT 0.008 S/S 29 Page 34 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 111S - - - - - WTf 0.016 S/S 29 112S - - - - - WTf 0.008 S/S 29 2 - - - - qnrS1 WT 0.5 I/ATU 29 51 - - - - qnrB4 WT 0.25 S/S 29 100 - - - - qnrB4 WT 0.125 S/S 29 581 582 a Genotype. Strains are isogenic to E. coli ATCC 25922 and carry only chromosomal modifications and/or SOS dysfunction [recA deletion or non-proteolizable LexA 583 variant (LexA1)]. Resistance-associated mutations located in the GyrA and ParC proteins are defined as resistance mechanisms that alter the target site. 584 b MIC (mg/L) of ciprofloxacin by Etest. 585 c CC (CLSI/EUCAST) refers to clinical categories according to CLSI or EUCAST breakpoints 26,28. 586 d ATCC means E. coli ATCC 25922 and MG1655 means E. coli MG1655 587 e Wild-type 588 S, susceptible; I, intermediate susceptibility; R, resistant; ATU, Area of Technical Uncertainty 589 590 Page 35 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only 591 Table S1. Oligonucleotides and plasmids used in this study. 592 Primer or plasmid Sequencea Use in this study Source or reference Primer Inactivation of tisAB genes H1-tisAB-P1 5´- AGCGGAAAGGTACGTCAGCTGGCAGTGCTCCTGAACCACAGGAGACGCGT-GTGTAGGCTGGAGCTGCTTC -3´ tisAB inactivation This study H2-tisAB-P2 5´- ATATAAAAGGGGAGCGGTTTCCCGCTCCCCTTTGGTGCGACTTGAATCTG-ATGGGAATTAGCCATGGTCC -3´ tisAB inactivation This study Pre-H1-tisAB 5’ – TACGTGTTCCGCGCAGAACGCG-3’ tisAB inactivation testing This study Post-H2-tisAB 5’ – CCAGGAATGGGGAATTGTTTAGC -3’ tisAB inactivation testing This study tisB-Fw 5’ – ATGAACCTGGTGGATATCGCCA-3’ tisB internal amplification This study tisB-Rv 5’ – TTACTTCAGGTATTTCAGAACA-3’ tisB internal amplification This study K1 5´ -CAGTCATAGCCGAATAGCCT-3´ Chromosomal inactivation 31 K2 5´ -CGGTGCCCTGAATGAACTGC-3´ Chromosomal inactivation 31 Kt 5´-CGGCCACAGTCGATGAATCC-3´ Chromosomal inactivation 31 tisB-gfp reporter promoter fusion Pre-PtisB-Xhol 5´-ccgCTCGAGcggTACGTGTTCCGCGCAGAACGCG-3´ tisB-gfp reporter promoter fusion This study Page 36 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only PtisB-Rv-BamH1 5´-cgcGGATCCgcgACGCGTCTCCTGTGGTTCAGGAG-3´ tisB-gfp reporter promoter fusion This study gyrA-1 5´-AAATCTGCCCGTGTCGTTGGT-3 QRDR GyrA sequencing 40 gyrA-2 5´-GCCATACCTACGGCGATACC-3 QRDR GyrA sequencing 40 Ec-pcA 5´-GCGAACGATTTCGGATCG-3 QRDR ParC sequencing 40 Ec-pcB 5´-CTGAATGCCAGCGCCAAATT-3 QRDR ParC sequencing 40 Plasmids pKD4 Chromosomal inactivation 31 pKOBEG Chromosomal inactivation/ helper vector 31 pCP20 Chromosomal inactivation/ resolution vector 31 pMS201 low copy, GFP reporter vector (rep-pSC101 KmR gfp) pMSrecA-gfp recA-gfp reporter promoter fusion 30 pMStisB-gfp tisB-gfp reporter promoter fusion This study 593 594 aUnderlined nucleotides correspond to the BamHI and XhoI site used for cloning. 595 Page 37 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only Page 38 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only Page 39 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy Confidential: for peer review only Page 40 of 45 Journal of Antimicrobial Chemotherapy: under review Journal of Antimicrobial Chemotherapy