Full text
Resea ch
Compa a i e genomics o ci ic-acid-p oducing
Aspe gillus nige ATCC 1015 e sus enzyme-p oducing
CBS 513.88
Mikael R. Ande sen,
1
Ma ga i a P. Salaza ,
1,19
Pe e J. Schaap,
2
Pe e J.I. an de Vonde oo ,
3
Da id Culley,
4
Je e Thykae ,
1
Jens C. F is ad,
1
K is ian F. Nielsen,
1
Richa d Albang,
5
Kaj Albe mann,
5
Randy M. Be ka,
6
Ge ha d H. B aus,
7
Susanna A. B aus-S omeye ,
7
Luis M. Co ochano,
8
Ziyu Dai,
4
Pie W.M. an Dijck,
9
Ge ald Ho mann,
10
Linda L. Lasu e,
4
Jon K. Magnuson,
4
Hildega d Menke,
3
Ma in Meije ,
11
Susan L. Meije ,
1
Jakob B. Nielsen,
1
Michael L. Nielsen,
1
Albe J.J. an Ooyen,
3
He man J. Pel,
3
La s Poulsen,
1
Rob A. Samson,
11
Hein S am,
3
Ad ian Tsang,
12
Johannes M. an den B ink,
13
Alex A kins,
14
And ea Ae s,
14
Ha is Shapi o,
14
Jasmyn Pangilinan,
14
Asa Salamo ,
14
Yigong Lou,
14
E ika Lindquis ,
14
Susan Lucas,
14
Jane G imwood,
15
Igo V. G igo ie ,
14
Ch is ian P. Kubicek,
16
Diego Ma inez,
17,18
Noe¨l N.M.E. an Peij,
3
Johannes A. Roubos,
3
Jens Nielsen,
1,19
and Sco E. Bake
4,20
1–18
[Au ho a ilia ions appea a he end o he pape .]
The ilamen ous ungus Aspe gillus nige exhibi s g ea di e si y in i s pheno ype. I is ound globally, bo h as ma ine and
e es ial s ains, p oduces bo h o ganic acids and hyd oly ic enzymes in high amoun s, and some isola es exhibi
pa hogenici y. Al hough he genome o an indus ial enzyme-p oducing A. nige s ain (CBS 513.88) has al eady been
sequenced, he e sa ili y and di e si y o his species compel addi ional explo a ion. We he e o e unde ook whole-
genome sequencing o he acidogenic A. nige wild- ype s ain (ATCC 1015) and p oduced a genome sequence o e y high
quali y. Only 15 gaps a e p esen in he sequence, and hal he elome ic egions ha e been elucida ed. Mo eo e , sequence
in o ma ion om ATCC 1015 was used o imp o e he genome sequence o CBS 513.88. Ch omosome-le el compa isons
unco e ed se e al genome ea angemen s, dele ions, a clea case o s ain-speci ic ho izon al gene ans e , and iden i-
ica ion o 0.8 Mb o no el sequence. Single nucleo ide polymo phisms pe kilobase (SNPs/kb) be ween he wo s ains
we e ound o be excep ionally high (a e age: 7.8, maximum: 160 SNPs/kb). High a ia ion wi hin he species was con-
i med wi h exo-me aboli e p o iling and phylogene ics. De ailed lis s o alleles we e gene a ed, and geno ypic di e ences
we e obse ed o accumula e in me abolic pa hways essen ial o acid p oduc ion and p o ein syn hesis. A ansc ip ome
analysis suppo ed up- egula ion o genes associa ed wi h biosyn hesis o amino acids ha a e abundan in glucoamylase
A, RNA-syn hases, and p o ein anspo e s in he p o ein p oducing CBS 513.88 s ain. Ou esul s and da a se s om
his in eg a i e sys ems biology analysis esul ed in a snapsho o ungal e olu ion and will suppo u he op imiza ion o
cell ac o ies based on ilamen ous ungi.
[Supplemen al ma e ial is a ailable o his a icle. The A. nige ATCC 1015 whole genome sequence has been submi ed o
GenBank (h p://www.ncbi.nlm.nih.go /genbank/) unde accession no. ACJE00000000. The sequence da a om he
phylogeny s udy ha e been submi ed o GenBank unde accession nos. GU296686–GU296739. The mic oa ay da a
om his s udy ha e been submi ed o he NCBI Gene Exp ession Omnibus (GEO) (h p://www.ncbi.nlm.nih.go /geo/)
unde se ies accession no. GSE10983. The dsmM_ANIGERa_coll511030F lib a y and pla o m in o ma ion ha e been
submi ed o GEO unde accession no. GPL6758.]
The sap o ophic ilamen ous ungus Aspe gillus nige is ound
globally and exhibi s a g ea di e si y in i s pheno ype. A. nige has
become one o he majo wo kho ses in indus ial bio echnology,
being e y e icien in p oducing bo h polysaccha ide-deg ading
enzymes (pa icula ly amylases, pec inases, and xylanases) o o -
ganic acids (mainly ci ic acid) in high amoun s. I also has a long
his o y o sa e use (Schus e e al. 2002; an Dijck e al. 2003; an
19
P esen add ess: Sys ems Biology, Depa men o Chemical and
Biological Enginee ing, Chalme s Uni e si y o Technology, SE-41296
Go
¨ ebo g, Sweden.
20
Co esponding au ho .
E-mail sco .b[email p o ec ed]; ax (509) 372-4732.
A icle published online be o e p in . A icle, supplemen al ma e ial, and pub-
lica ion da e a e a h p://www.genome.o g/cgi/doi/10.1101/g .112169.110.
F eely a ailable online h ough he Genome Resea ch Open Access op ion.
21:885–897 Ó2011 by Cold Sp ing Ha bo Labo a o y P ess; ISSN 1088-9051/11; www.genome.o g Genome Resea ch 885
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
Dijck 2008). Comme cial impo ance is illus a ed by a wo ld
ma ke o indus ial enzymes o nea ly US$ 5 billion in 2009, o
which ilamen ous ungi accoun o oughly hal o he p o-
duc ion (Lube ozzi and Keasling 2008), and a global ci ic acid
p oduc ion o 9 310
6
me ic ons in 2000 (Ka a a and Kubicek
2003).
In 2007, he genome sequence o A. nige s ain CBS 513.88,
used o indus ial enzyme p oduc ion, was published (Pel e al.
2007). This s ain was de i ed om A. nige NRRL 3122, a s ain
de eloped o glucoamylase A p oduc ion by classical mu agenesis
and sc eening me hods ( an Lanen and Smi h 1968). This wo k
ini ia ed a numbe o new genome-based in es iga ions (Sun e al.
2007; Ande sen e al. 2008ab; Ma ens-Uzuno a and Schaap 2008;
Yuan e al. 2008ab) bu did no e eal di e ences be ween ci ic-
acid-p oducing and enzyme-p oducing A. nige s ains (Cullen
2007).
In his s udy, we p esen he nea ly comple e genome se-
quence o he ci ic-acid-p oducing A. nige wild- ype s ain ATCC
1015 and compa e i o he genome sequence o he enzyme-
p oducing s ain CBS 513.88. The gene ic di e si y o hese wo A.
nige s ains was de e mined by applying sys ems biology ools as
well as new bioin o ma ics me hods o examine mul i-le el di -
e ences ha dis inguish he wild- ype ci ic-acid-p oducing s ain
om he mu agenized glucoamylase A–p oducing s ain.
Resul s
Gene al genome s a is ics
The 34.85-Mb genome sequence o A. nige ATCC 1015 was gen-
e a ed using a sho gun app oach and hen u he imp o ed o
a high-quali y assembly o 24 inished con igs sepa a ed by 15 gaps
(including eigh om cen ome ic egions). Genome s a is ics a e
summa ized in Table 1, wi h de ails in Supplemen al Tex 1. The
ull sequence and anno a ions a e a ailable om he Join Genome
Ins i u e (JGI) Genome Po al (h p://genome.jgi-ps .o g/Aspni5)
and om NCBI (accession numbe ACJE00000000).
The genome sequence o A. nige CBS 513.88 (Pel e al. 2007)
was imp o ed using he ATCC 1015 sequence o close 186 con ig
gaps and modi y he gene models associa ed wi h hese gaps (Table 1;
Supplemen al Table 1). The upda ed A. nige CBS 513.88 genome se-
quence is accessible h ough EMBL (accession numbe s AM269948–
AM270415).
We no e a la ge di e ence (2882) in he numbe o called
genes in he wo s ains (Table 1). A ho ough analysis indica es an
o e p edic ion o genes in CBS 513.88 and an unde p edic ion o
genes in ATCC 1015, and 396/510 unique genes in CBS 513.88/
ATCC 1015 (Supplemen al Tex 2; Supplemen al Fig. 1; o de ails,
see Supplemen al Tables 2–9). Fo u he alida ion o he ab-
sence/p esence o indi idual p o eins, we ha e pe o med gDNA
hyb idiza ions, which can be consul ed o e e ence (Supple-
men al Table 16).
Unique genes in bo h s ains sugges ho izon al gene ans e
o be a cause o he amylase hype -p oduce pheno ype
Fo he genes unique o he amylase-p oducing s ain CBS 513.88
(Supplemen al Table 6), he mos no able genes a e wo alpha-
amylases ha a e iden ical o he Aspe gillus o yzae alpha-amylase,
a possible cause o he amylase hype -p oduce pheno ype. We
discuss his in de ail below (Fig. 2). Fu he mo e, we ind h ee
possible polyke ide syn hases, which sugges s a unique seconda y
me aboli e p o ile o his s ain.
Examining he genes ound only in ATCC 1015 (Supple-
men al Table 6) does no poin o any ob ious cause o ci ic acid
hype -p oduc ion, bu ou possible polyke ide syn hases and
a pu a i e NRPS a e ound o be unique o ATCC 1015, sugges ing
his s ain has unique seconda y me aboli es as well. Mul iple e -
ec s o his ype a e, indeed, seen o bo h s ains in analyses below
(Fig. 1; Supplemen al Fig. 10; Table 2).
Syn eny mapping shows 0.5 Mb o ch omosomal
ea angemen s and a whole-a m in e sion
The genomes o he wo s ains a e la gely syn enic (Fig. 1). Fo
example, he 1429 p o ein-encoding genes o CBS 513.88 supe -
con ig An01 ha ha e p edic ed coun e pa s in ATCC 1015 a e,
wi h one excep ion, all mapped o ch omosome 2b. A simila ex-
ample is seen o all bu one o 1486 p o ein-encoding genes on
supe con ig An02. Bo h excep ions encode pu a i e Tan1-like ans-
posases. No wi hs anding, a numbe o signi ican di e ences in
genome con igu a ion exis (Fig. 1). Mo e han 0.5 Mb o addi ional
genome sequence in ATCC 1015 esides in ou la ge egions on
ch omosomes (Ch ) II, III, and V (Fig. 1). The lanking sequences o
h ee o hese addi ional elemen s in ATCC 1015 a e syn enic o
con inuous sequences in CBS 513.88 and a e hus ue di e ences in
genome con igu a ion (Supplemen al Fig. 2; Supplemen al Table 2;
o de ails on Ch III, see nex sec ion). The ou h egion on he le
a m o Ch V in ATCC 1015 could no be e i ied due o a con ig gap
o CBS 513.88. The con ig gap in he igh a m o Ch V in he ge-
nome sequence o ATCC 1015 is spanned by con inuous sequence
in CBS 513.88, con aining 15 p edic ed genes. An o e iew o he
genes ound in he gaps unique o ATCC 1015 can be ound in
Supplemen al Table 2.
O he s iking di e ences include
a la ge in e sion in Ch VIII and he in-
e sion and ansloca ion o a la ge ag-
men be ween he le a ms o Ch III and
Ch VII (Supplemen al Fig. 3). Bo h we e
con i med wi h PCR spanning he b eak-
poin s (da a no shown).
Finally, he p esence o elome e se-
quences in genome da a con i ms an in-
e sion o he comple e igh a m o Ch VI.
Two ex a alpha-amylase-encoding
genes likely ob ained h ough HGT
An unma ched egion iden i ied o he
le a m o Ch III (Fig. 1) spans 72.5 kb o
Table 1. Gene al genome s a is ics o A. nige ATCC 1015 and A. nige CBS 513.88
A. nige ATCC
1015 ( his s udy)
A. nige CBS 513.88
a
(Pel e al. 2007)
A. nige CBS 513.88
b
( his s udy)
Gene models 11,200 14,165 14,082
Genome size (Mb) 34.85 33.93 34.02
P o ein leng h (amino acids) 484.3 439.9 442.5
Exons pe gene 3.1 3.6 3.6
Exon leng h (bp) 480.8 370.0 371.6
In on leng h (bp) 93.8 97.2 96.9
Excep genome sizes and he numbe o gene models, all alues a e a e ages.
a
The genome assembly published by Pel e al. (2007).
b
Genome assembly o A. nige CBS 513.88 a e gap closu e using sequence in o ma ion om ATCC
1015.
886 Genome Resea ch
www.genome.o g
Ande sen e al.
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
unique sequence in ATCC 1015. Rema kably, o CBS 513.88,
a unique 85.3-kb sequence is ound a his loca ion (Fig. 2A). Gene
anno a ion may be ound in Supplemen al Table 10. To con i m
he ac ual absence o he egion in he ch omosome o ATCC 1015,
we pe o med gDNA hyb idiza ions, which did indeed suppo his
inding (Supplemen al Fig. 4).
App oxima ely 12 kb o his egion sha es >99.8% sequence
iden i y a DNA le el wi h genomic DNA om A. o yzae RIB40
(Fig. 2B). The comple e 85-kb agmen including he 12-kb alpha-
amylase egion also appea s o be in ol ed in a ecen duplica ion
ecombina ion e en o Ch VII, (Fig. 2C). Thus, he CBS 513.88
genome ha bo s wo addi ional alpha-amylase-encoding genes
ha a e o hologs o he alpha-amylase-encoding genes
(AO090023000944, AO090120000196) o A. o yzae RIB40. These
indings sugges ha CBS 513.88 and he pa en al s ain NRRL
3122 (da a no shown) acqui ed hese duplica e alpha-amylase
genes (An12g06930, An05g02100) h ough ho izon al gene
ans e (HGT). The occu ence o HGT in Aspe gilli would u he
be suppo ed by he p esence o alpha-amylase-encoding genes in
o he black Aspe gilli ha display >99% nucleo ide iden i y o hose
o A. o yzae RIB40 and he A. nige CBS 513.88 alpha-amylases
(Ko man e al. 1990; Shibuya e al. 1992). The o igin o he
Figu e 1. Syn eny map o he con igs o A. nige ATCC 1015 o he supe con igs o A. nige CBS 513.88. The colo ing o he ch omosomes shows
syn enic egions in A. nige CBS 513.88. A abic nume als show he numbe o he supe con ig in A. nige CBS 513.88. G ay a eas show egions no ound in
he CBS 513.88 genome sequence (Pel e al. 2007). (Filled black ci cles) P oposed loca ions o cen ome ic egions. Sequenced elome es a e ma ked wi h
a T. Ze oes ma k he i s base o he con igs. A black line unde nea h a sec ion o he ch omosomes deno es in e ed sequence. Black his og ams show
SNPs pe kilobase (numbe o single nucleo ide polymo phisms/kilobase) be ween he sequences o he wo s ains (y-axis: 0–160 SNPs/kb). Gaps
be ween con igs and cen ome es a e no o scale. The alignmen demons a es almos comple e syn eny be ween he wo s ains, wi h he excep ion o
a c oss-o e e en be ween he le a ms o ch omosomes III and VII. An o e iew o he genes ound in he gaps unique o ATCC 1015 can be ound in
Supplemen al Table 2.
Aspe gillus nige s ain e olu ion
Genome Resea ch 887
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
emaining pa o he unma ched egion emains unclea . No sig-
ni ican simila i y was obse ed a he DNA le el, and only a ew o
he encoded p o eins show simila i y wi h o he p o eins p esen
in he NR p o ein da abase.
The e is also e idence ha his HGT may ha e occu ed by
he ac ion o ansposases. The 12-kb HGT egion is lanked by
202-bp in e ed, pe ec , e minal epea s (ITR) (Fig. 2A,B). Fu -
he mo e, his HGT egion ha bo s ano he gene, An12g07000,
ha is iden ical o he A. o yzae npA ansposase gene. In-
e es ingly, in he A. o yzae RIB40genome, hesame12-kb ag-
men has been duplica ed wice and is p esen on mul iple
ch omosomes, bu only one pe ec copy o he ITRs is e ained
(Fig. 2C).
T ansposon p esence is s ain-speci ic
T ansposon-like sequences we e iden i ied in bo h genomes and
quan i ied (Supplemen al Table 11). This compa ison pinpoin s
a ema kable di e ence in he p esence and amoun o ansposon-
ela ed sequences in ATCC 1015 and CBS 513.88 bo h o class I
and o class II ansposons: Only 16 sequences we e iden i ied in
ATCC 1015, bu 55 we e de ec ed in CBS 513.88. Whe eas he
ATCC 1015 genome con ains no class I supe amily copia and
a single copy o class II supe amily Fo 1/pogo, hese sequences a e
much mo e abundan in CBS 513.88, whe e 15 class I copia, and
13 class II Fo 1/pogo a e ound.
SNP analysis e eals high mu a ion a es
and hype a iable egions
We ound 8 616 SNPs/kb (a e age 6s anda d de ia ion) and
a maximum o 163 SNPs/kb single-nucleo ide polymo phisms
(SNPs) be ween A. nige s ains ATCC 1015 and CBS 513.88 (Sup-
plemen al Table 12). This alue is much highe han he maximum
o 9 SNPs/kb ound by Cuomo e al. (2007) in a SNP analysis o
wo Fusa ium g aminea um s ains. A compa ison o he A. nige
ATCC 1015 genome sequence o ha o A. nige ATCC 9029
e ealed ma kedly less a ia ion be ween he wo (2 65 SNPs/kb)
(Supplemen al Fig. 5), indica ing a la ge genomic a ia ion in he
A. nige g oup bu li le be ween ATCC 1015 and 9029. These
polymo phisms a e no uni o mly dis ibu ed bu clus e in hype -
a iable egions (Fig. 1). This is suppo ed by a gDNA hyb idiza ion
s udy, which con i ms he p esence o dis inc hype a iable egions
(Supplemen al Fig. 4).
Gene compa isons e eal indus ially ele an
s ain di e ences
To iden i y s ain-de ining sys emic e ec s o he genome a ia-
ion, esul s om he Imp in gene syn eny analysis (see Supple-
men al Table 5; Me hods) we e used o addi ional genome-scale
in es iga ion.
GO e m o e - ep esen a ion analysis was pe o med on gene
g oups wi h dis inc common p ope ies ( o G oup o e iew, see
Supplemen al Table 5; o de ails, see Supplemen al Table 13). Mos
in e es ing is he obse a ion ha 37 p o eins in ol ed in an-
sc ip ional egula ion a e non unc ional in CBS 513.88 due o
ameshi s o s op codons. This sugges s a less s ingen egula ion
o CBS 513.88 ela i e o ATCC 1015. A compa a i e shake- lask
s udy o he wo s ains also sugges s mu a ions in egula o y ele-
men s as ni ogen sou ce u iliza ion is impai ed in he CBS 513.88
s ain (da a no shown). While he ni ogen ca abolism egula o
A eA was o iginally hough o be mu a ed in CBS 513.88 (Pel e al.
2007), a esequencing o a eA showed he ORFs o be iden ical.
To de ec po en ial di e ences in he me abolism o he wo
s ains, we compa ed all genes encoding p o eins ha display
di e ences a he amino acid le el be ween he wo s ains on he
me abolic ne wo k o A. nige (Ande sen e al. (2008a) and mapped
hem o me abolic pa hways (Supplemen al Fig. 6). Mu a ions
we e ound in he pa hways o biosyn hesis o p oline, aspa a e,
aspa agine, yp ophan, and his idine, which may be ele an o
p o ein p oduc ion. Also, mu a ions we e ound in he plasma
memb ane-bound ATPase, in he enzymes o he GABA shun , o
he TCA cycle, and in componen s o all s eps o he elec on
anspo chain, which could be ele an o he p oduc ion o
ci ic acid.
Phylogene ic analysis con i ms high a iabili y be ween
genome sequences
To place he compa ison o A. nige ATCC 1015 and CBS 513.88
in o he la ge con ex o he Aspe gillus sec ion Nig i, a ia ion in
he wo s ains was analyzed by phylogene ic analysis o a pa o
he be a- ubulin sequence o a numbe o A. nige s ains and o he
black Aspe gilli (Fig. 3A). To u he explo e he genome a iabili y
ac oss he A. nige species, we iden i ied ou 1-kb egions om
Ch II, Ch IV, Ch VI, and Ch VIII ha we e iden ical in he ATCC
1015 and ATCC 9029 s ains bu had ;20 SNPs/kb ela i e o he
genome sequenceo CBS 513.88. These egions we e PCR-sequenced
in se en A. nige s ains including he CBS 513.88 p ogeni o , NRRL
Table 2. Exo-me abolomic p o iling o 11 A. nige s ains based on HPLC-DAD-FLD and HPLC-DAD-HRMS ( his s udy)
Seconda y me aboli es Re e ence
NRRL
3122
CBS
513.88
a
CBS
126.49
ATCC
1015
a
ATCC
9029
a
CBS
554.65
NRRL
328
NRRL
350
NRRL
511
NRRL
1278
NRRL
2270
Au aspe one B Tanaka e al. 1966 • • • • • • •••••
Fumonisin B
2
F is ad e al. 2007b • • • • • •••••
Funalenone Inokoshi e al. 1999 • • • • •••••
Ko anin Bu
¨chi e al. 1971 • • • • •••••
Nig agillin Isogai e al. 1975 ••
Och a oxin A Aba ca e al. 1994 •• •
O landin Cu le e al. 1979 • • • • •••••
O he naph ho-g-py ones • • • • •••••
Py anonig in A Hio e al. 2004 • • • • • • •••••
Tensidol B Fukada e al. 2006 • • • • • • •••••
The e e ence column ela es o he elucida ion o he compound s uc u e.
a
Genome-sequenced s ains.
Ande sen e al.
888 Genome Resea ch
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
3122, and he A. nige neo ype s ain, CBS 554.65 (Kozakiewicz
e al. 1992) o o m a phylogene ic ee wi h high a ia ion (Fig.
3B). Fo p e iously sequenced s ains, he esequencing esul s
we e iden ical o he p e iously de e mined genomic sequence,
he eby excluding ha he genomic a ia ion is an a i ac o low-
ideli y sequencing.
All A. nige s ains ha e an iden ical sequence o be a- ubulin
and o m a s ongly suppo ed e minal clade oge he wi h As-
pe gillus awamo i (Fig. 3A). The o he axonomically di e en spe-
cies a e phylogene ically dis inc om his g oup, which is in ac-
co dance wi h he se ial classi ica ion o F is ad e al. (2007a). The
la e clus e ing based on he selec ed egions (Fig. 3B) was able o
Figu e 2. Ho izon al gene ans e o alpha-amylase genes om A. o yzae o A. nige CBS 513.88. (A) Unma ched egion iden i ied o he le a m o
ch omosome III spanning 65 kb o ATCC 1015 encoding 30 p edic ed genes and 85 kb o CBS 513.88 encoding 24 p edic ed genes. The unma ched
egion is lanked on one side by a small local in e sion o h ee p edic ed genes (in g een). (B) The 12.4-kb HGT egion is pa o an iden ical 12.7-kb egion
p esen in A. o yzae RIB40 supe con igs SC113 and SC023. In A. nige CBS 513.88, he ans e ed egion is enclosed by a 203-bp in e ed epea ( ed
a ow). An12g07000 (blue) is a pu a i e ansposase and iden ical o he A. o yzae ansposon Ao 1 npA gene. Simila ly, he A. nige CBS 513.88 alpha-
amylase encoding gene An12g06930 (o ange) is iden ical o A. o yzae anno a ed genes AO090120000196 (SC113) and AO090023000944 (SC023). (C)
P oposed duplica ion– ecombina ion e en be ween supe con ig 12 and supe con ig 05 o he 12-kb HGT egion. B eakpoin s a e indica ed wi h do ed
lines. The agmen encoding alpha-amylase An05g02200 is iden ical o An12g06930 (o ange). The b eakpoin s a e lanked wi h addi ional copies o he
203-bp epea egion ( ed a ow). The egion encoding genes An12g06940 o An12g06970 is iden ical o he egion encoding An05g02210 o
An05g02130. The downs eam b eakpoin occu ed in he p edic ed gene coding egion o An12g06970, he eby dele ing he o iginal s a codon and
ups eam egion.
Aspe gillus nige s ain e olu ion
Genome Resea ch 889
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
sepa a e he A. nige s ains in o h ee g oups. S ain CBS 513.88
and i s p ogeni o NRRL 3122 we e iden ical o he egions, in-
dica ing limi ed SNP in oduc ion due o classical s ain imp o e-
men , and hus con i ms high a ia ion in he A. nige g oup.
Exo-me abolomic p o iling desc ibes h ee dis inc g oups
o A. nige
To u he compa e he wo sequenced s ains on a sys em-wide,
bu nongenomic le el, o each o he and o o he membe s o he
A. nige species g oup, exo-me abolomic p o iles o he wo s ains
we e compa ed o nine o he s ains, including he CBS 513.88
p ogeni o s ain, NRRL 3122; he widely used labo a o y s ain
ATCC 9029; and he A. nige neo ype, CBS 554.65 (Table 2). This
ga e h ee dis inc clades, which ollow he clus e ing o Figu e 3B,
bu does no con o m o he phylogene ic dis ances calcula ed.
S ain CBS 513.88 and i s p ogeni o s ain had e y simila sec-
onda y me aboli e p o iles. These wo s ains di e ed om he
o he s ains analyzed. S ain ATCC 1015 had a p o ile simila o
se en o he s ains, al hough he e we e some quan i a i e di -
e ences. S ain CBS 126.49 had a unique p o ile.
In he case o och a oxin A, i is in e es ing ha in ATCC 1015
and ATCC 9029, a emnan o he PKS gene (An15g07920) o he
pu a i e och a oxin clus e in A. nige CBS 513.88 (Pel e al. 2007)
was iden i ied, which could be ela ed o a 21-kb dele ion in bo h
s ains (Supplemen al Fig. 7). We ha e no ed ha a pu a i e NRPS
is ound in one o he unique ch omosome egions ound in ATCC
1015 (Fig. 1), which may accoun o some o he di e ence
(Supplemen al Table 2).
T ansc ip ome analysis o A. nige ATCC 1015 and CBS 513.88
g owing on glucose
To e alua e he e ec o he di e ences in genome sequence on he
physiology o he wo s ains, ba ch cul i a ions in bio eac o s and
a compa a i e ansc ip ome analysis we e pe o med. S ains
ATCC 1015 and CBS 513.88 we e g own unde he same condi-
ions in ba ch cul u es in a glucose-based minimal medium. The
GlaA-p oducing s ain CBS 513.88 p oduced >1.2 g/L GlaA mo e
han ATCC 1015, while p oducing ;1 g/L biomass less. O he
measu ed cha ac e is ics we e simila o he wo s ains (Table 3).
S a is ical analysis showed 4784 signi ican ly (adj. p<0.05) di -
e en ially exp essed genes, wi h an almos equal numbe o genes
up- egula ed in ei he s ain (2431 in CBS 513.88 s. 2353 o
ATCC 1015).
Examining he di e en ial exp ession in he con ex o me -
abolic pa hways (Supplemen al Fig. 8), only he al e na i e oxi-
da i e pa hway has uni o mly highe exp ession in ATCC 1015,
while a subs an ial subse o me abolism was up- egula ed in CBS
513.88, including glycolysis and he TCA cycle. As he speci ic
g ow h a es o he s ains a e simila , we sugges ha his ex a
ac i i y o cen al me abolism p o ides p ecu so s o he highe
p oduc i i y o glucoamylase. We also ind inc eased exp ession
o genes in ol ed in amino acid me abolism, especially he en-
i e biosyn he ic pa hways o h eonine, se ine, and yp ophan.
Figu e 3. (A) Phylogene ic ela ionship o se e al black Aspe gilli based on pa ial sequencing o be a- ubulin. The ee was oo ed o Aspe gillus aculea us
CBS 172.66. (B) Phylogene ic ela ionship o se en s ains o A. nige based on sequencing o 1-kb a iable egions om ou ch omosomes. The ee was
oo ed o he sequence ob ained om Aspe gillus ca bona ius IMI 388653. Clades based on he exo-me abolomic g oupings o Table 2 a e shown. Fo bo h
ees, boo s ap alues abo e 80% o he 1000 pe o med ei e a ions a e shown.
Table 3. S a is ics o ba ch cul i a ions o A. nige ATCC 1015 and
A. nige CBS 513.88
ATCC 1015 CBS 513.88
mRNA (h) 24.5 61.2 40.2 64.2
Biomass (g/L) 5.0 60.1 4.0 60.5
m
max
(h
1
) 0.17 60.01 0.15 60.01
Glucose (g/L) 10.0 60.6 9.5 60.4
Glyce ol (g/L) 0.09 60.02 0.27 60.03
Y
xs
(Cmol/Cmol)
a
0.67 60.03 0.55 60.03
GlaA (g/L)
b
0.24 60.08 1.57 60.23
Ci ic acid (g/L) 0.10 60.12 0.14 60.03
Fe men a ions we e pe o med in biological iplica es o each s ain.
Values a e p esen ed as a e age 6s anda d de ia ion. m
max
and Y
xs
a e
gene al s a is ics o he e men a ions, while he emaining alues a e
speci ic o he ime o sampling o ansc ip ion analysis (see mRNA ow).
GlaA is glucoamylase A.
a
Biomass was con e ed o Cmol using 24.9 g o biomass/Cmol (Nielsen
e al. 2003).
b
One uni o glucoamylase can be assumed o co espond o 25 mgo
p o ein (PESL p o ein assay; Boeh inge Mannheim).
Ande sen e al.
890 Genome Resea ch
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
In iguingly, analysis o he amino acid composi ion o he glu-
coamylase A p o ein (Supplemen al Fig. 9) e ealed ha GlaA is
a ypical in ha i has a highe con en o speci ically yp ophan,
h eonine, and se ine han 90% o he p edic ed genes o CBS
513.88. Fo all h ee amino acids, he con en is almos wice as
high as he a e age in he composi ion o o al p o ein (Ch is ias
e al. 1975).
We ini ially hough ha his was due o a ameshi mu a-
ion iden i ied in he gene o he gene al amino acid– egula ing
ansc ip ion ac o (c oss-pa hway con ol p o ein) CpcA (Sup-
plemen al Table 5), bu esequencing o his gene showed his
ameshi o be a sequencing e o . The p esence o wo sense
mu a ions was con i med and is cu en ly being in es iga ed.
To u he suppo ha he inc eased p oduc ion o GlaA is
signi ican enough o a ec amino acid biosyn hesis, we used
a genome-scale me abolic model o A. nige (Ande sen e al. 2008a)
o model he wo s ains unde he g ow h condi ions used (Table
3). The compu ed luxes (Supplemen al Table 14) show ha o all
h ee amino acids, he luxes h ough he biosyn he ic pa hways
mus be a leas wice as high in CBS 513.88 compa ed o ATCC
1015 o suppo he inc eased GlaA p oduc ion, hus co espond-
ing well wi h he ansc ip ome esul s.
Fo a b oade analysis o ends e ealed by he ansc ip ome
p o iles, a GO e m o e - ep esen a ion analysis was conduc ed
on he genes signi ican ly up- egula ed in ei he s ain (Supple-
men al Table 15). The analysis con i med ha ai s ele an o
p o ein p oduc ion—such as amino acid biosyn hesis and RNA
aminoacyla ion—appea o be highly signi ican o CBS 513.88.
Fo ATCC 1015, GO biological unc ions o elec on anspo (adj.
p=2.7 310
5
), ca bohyd a e anspo (adj. p=6.8 310
3
), and
o ganic acid anspo (adj. p=0.035) we e signi ican .
An examina ion o exp ession o indi idual genes showed
ha glaA had signi ican ly inc eased exp ession in CBS 513.88 (adj.
p=84 310
6
), bu he old change (3.2) was lowe han he in-
c ease in enzyme ac i i y (six old) (Table 3). In e es ingly, all iden-
i ied RNA-aminoacyl syn hases we e ound o be wo old o six old
up- egula ed in CBS 513.88.
Mapping o gene exp ession o he genome iden i ies
seconda y me aboli e clus e ac i i ies and unde pins
he whole-a m in e sion in ch omosome VI
To examine di e ences in gene exp ession be ween he wo s ains
ela i e o ch omosome posi ions, he log
2
- a ios o he gene ex-
p ession indices om he ansc ip ome analysis we e mapped o
he syn eny diag ams o Figu e 1 (Supplemen al Fig. 10).
The analysis o his mapping iden i ied a numbe o ea-
u es. Fi s , six egions no ound in CBS 513.88 con ain genes
wi h uni o mly highe exp ession in ATCC 1015, suppo ing he
absence o hese egions in CBS 513.88. Second, wo ac i e sec-
onda y me aboli e clus e s we e iden i ied on Ch VIII (con ains
a polyke ide syn hase [ID: 211885] ha is unique o ATCC 1015)
and Ch I (NRPS clus e , ound in bo h s ains [NRPS ID: 43555/
An09g00520], bu appea s only o be ac i e in CBS 513.88). Thi d,
he in e sion o he en i e igh a m o Ch VI (Fig. 1) is u he
suppo ed. The elome ic posi ion e ec , which de ines de-
c eased exp ession in he icini y o elome es, has been de-
sc ibed o Saccha omyces ce e isiae (Go schling e al. 1990). Thus,
i an a m has been in e ed, educed exp ession should be ound
a opposi e ends in ATCC 1015 and CBS 513.88. This is indeed
e lec ed in he log
2
- a io on he igh a m o Ch VI (Supplemen al
Fig. 10).
Discussion
In his s udy, we p o ide and compa e he genomes o wo s ains
o A. nige . These wo s ains ha e di e en pheno ypes: one, he
p edecesso o e icien enzyme-p oducing s ains ha ing un-
de gone some le el o mu agenesis and selec ion, and he o he
a wild- ype pa en s ain o high ci ic-acid-p oducing s ains. This
makes he compa ison in e es ing bo h in e ms o genomic e-
sea ch and indus ial applica ions. We ha e suppo ed he con-
clusions o ou compa ison wi h u he expe imen s, allowing us
o p opose new hypo heses and conclusions wi hin h ee main
a eas: (1) gene ic di e si y o he A. nige g oup, (2) ho izon al gene
ans e in ungi, and (3) ungal bio echnology (discussed sepa-
a ely below).
The di e si y o he wo s ains was explo ed h ough a mul i-
le el compa ison (DNA, ch omosome, gene, and p o ein) be ween
bo h genome a chi ec u es and was suppo ed by mul iple ypes o
expe imen al wo k. In e es ingly, we obse e a ema kable simi-
la i y a he le el o ch omosome, gene o de , and gene iden i y,
bu also no able di e si y was de ec ed and u he explo ed,
namely, dis inc egions wi h high le els o SNPs, a 0.8-Mb di -
e ence in genome size, se e al la ge inse ion/dele ions o up o
200 kb, di e en ansposon popula ions, a majo ansloca ion/
in e sion, he in e sion o an en i e ch omosomal a m, and a la ge
se o unique genes in bo h species (see poin s 1–5 below):
1. Abou 400–500 unique genes we e iden i ied o each s ain,
mos o which a e e enly dis ibu ed o e he ch omosomes.
This indica es s ain e olu ion by a high equency o loss
and/o up ake o gene agmen s. In e es ingly, he opposi e is
seen in wo s ains o he pa hogenic Aspe gillus umiga us,
whe e 80% o he s ain-speci ic genes (143 and 218, espec-
i ely) a e ound in a ew, la ge isola e-speci ic genomic islands
(Fedo o a e al. 2008). Thus, his in a-species inc eased e-
quency o ans e /loss o gene ic elemen s so a seems o be
speci ic o he A. nige g oup. Mo e genome sequences may
p o e i o be p esen in o he Aspe gilli as well.
2. The whole-a m in e sion on Ch VI is a ema kable e en . O e
he cha ac e ized Aspe gilli sequenced genomes, mos desc ibed
in e sions we e isola ed as mu an s, wi h a b eakpoin in
a gene, leading o a pheno ype. Pel e al. (2007) epo ed high
syn eny be ween he cen ome ic pa s o he a ms o A. nige
CBS 513.88 and Aspe gillus nidulans FGSC A4. E en so, in his
case, i is suppo ed by he genome sequence, he p esence o
elome ic sequences, and a de ec able elome ic posi ioning
e ec . F om Figu e 2 in Galagan e al. 2005, i is also clea ha
cen ome ic in e sions mus ha e occu ed in he genealogy o
he common ances o o A. nidulans,A. o yzae, and A. umiga us.
3. The la ge ansloca ion/in e sion e en o Ch III and Ch VII
explains he disc epancies in ch omosome size epo ed by Pel
e al. (2007) be ween s ain N400 (Ve does e al. 1994) and
calcula ed sizes o Ch III and Ch VII o CBS 513.88. This ac
and ha he b eakpoin s a e wi hin wo o he wise in ac genes
indica e ha he e en occu ed a e he b anching o s ains
N400 and NRRL 3122, possibly in he mu agenesis o he p e-
decesso o CBS 513.88.
4. The p esence and unc ionali y o ansposons a e quali a i ely
and quan i a i ely less complex in he genome o ATCC 1015
han in CBS 513.88 (Supplemen al Table 11). Such a di e en
dis ibu ion o ansposons be ween s ains has been obse ed
be o e (B aumann e al. 2008) and was desc ibed o be inducible
by mu agenesis and o he s ess-induced condi ions (S and and
Aspe gillus nige s ain e olu ion
Genome Resea ch 891
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
McDonald 1985). Howe e , he numbe and scale o di e ences
make a ecen mu agenesis p og am unlikely o be he basis o
he mul iple HGT e en s. Fu he mo e, he de ec ion o epea
sequences in a numbe o DNA egions was accompanied by
s ain-speci ic di e ences. The e o e, we sugges ha he
ansposon popula ions ha e played a signi ican ole in s ain
e olu ion.
5. Finally, he phylogene ic analysis (Fig. 3B) con i ms he high
gene ic a ia ion desc ibed o wo s ains o be gene al wi hin
he A. nige g oup and no he esul o ei he CBS 513.88 o
ATCC 1015 being a ypical. This is again suppo ed by he exo-
me abolomic p o iles o he 11 examined A. nige s ains (Table
2). While he g ouping o he exo-me aboli es does no accu-
a ely e lec he cladog ams in Figu e 3, we see his as con i -
ma ion o he high gene ic a ia ion in he A. nige g oup, as he
p oduc ion o a gi en exo-me aboli e may be changed by
a single genomic e en . Thus, we belie e ha he di e si y o
he wo genome-sequenced s ains is common o he A. nige
g oup, which seems o ha e highly dynamic genomes.
The p esence/absence o HGT in ungi has caused a lo o discus-
sion (Galagan e al. 2005; Keeling and Palme 2008; Khaldi and
Wol e 2008; Khaldi e al. 2008). In his s udy, we ha e shown HGT
o be a mos likely o igin o wo alpha-amylase genes in CBS 513.88
ha migh ha e been ans e ed o A. nige om ano he species,
possibly A. o yzae. The HGT mus ha e occu ed be o e he sepa-
a ion o CBS 513.88 and ATCC 1015. The amylase genes a e no
ound in he ATCC 1015 s ain (also suppo ed by gDNA hyb id-
iza ion), bu hey a e in CBS 513.88 lanked by a ansposon,
which is ound bo h in A. o yzae RIB40 and in a unca ed o m in
ATCC 1015. Wi h he e idence o HGT in o Aspe gillus cla a us
om a Magnapo he- ela ed dono , p esen ed by Khaldi e al.
(2008), HGT is now iden i ied in wo sepa a e cases wi h dis an ly
ela ed species and may hus be seen as a gene al phenomenon in
ilamen ous ungi.
The ini ial eason o compa ing he wo s ains has been o
gain insigh in he gene ic basis o he wo indus ially ele an
pheno ypes. In ci ic-acid-p oducing ATCC 1015, we a e in igued
o see highe exp ession o elemen s om he elec on anspo ,
ca bohyd a e anspo , and o ganic acid anspo . These ac o s
a e known o be in ol ed in ob aining high ci ic acid yields.
Highe exp ession le els e en hough ci ic acid p oduc ion is no
no ably highe (see discussion below) sugges s ha hese ai s may
ha e been con ibu ing ac o s o he o iginal selec ion o ATCC
1015 o ci ic acid p oduc ion. Fo he GlaA-p oducing s ain (CBS
513.88), we obse e sys emic changes: Mu a ions in egula o y
genes (e.g., cpcA), highe exp ession o glaA i sel , and up- egula ion
o all iden i ied RNA-syn hases may all con ibu e o a mo e e i-
cien enzyme p oduce . We also p esen he hypo hesis ha in-
c eased p oduc ion o he amino acids se ine, h eonine, and yp-
ophan may be equi ed o e icien GlaA p oduc ion, as hese a e
o e - ep esen ed in GlaA.
While we ha e iden i ied mul iple possible con ibu o s o
he e icien amylase p oduc ion o CBS 513.88, we ha e only seen
a ew ac o s associa ed wi h ci ic acid p oduc ion. We p opose
mul iple easons o his: (1) CBS 513.88 was selec ed o inc eased
GlaA p oduc ion, while ATCC 1015 is a wild- ype s ain wi h only
modes ci ic acid p oduc ion (compa ed o cu en yields). (2) The
medium used o he ansc ip ome analysis is no op imized o
ci ic acid p oduc ion, as his would no gi e he dispe sed g ow h
necessa y o ep esen a i e sampling (Ka a a and Kubicek 2003).
(3) P o ein syn hesis is a complex p ocess, wi h mo e ac o s in-
ol ed han in he p oduc ion and sec e ion o a simple o ganic
acid. Since mo e han 6000 genes di e a he amino acid le el
be ween he wo s ains, i would be unlikely no o ind many
di e ences in ol ed in p o ein p oduc ion. Fo his eason, we
ha e pu ou emphasis on genes ound in mul iple ypes o anal-
yses, e ec s in en i e pa hways, and ai s (GO) ha a e ound o be
s a is ically o e - ep esen ed, which allows o obus conclusions.
In conclusion, ou esul s es ablish a i m compa a i e geno-
mics ounda ion on which o build and es hypo heses ega ding
enzyme p oduc ion, o ganic acid p oduc ion, and di e si y wi hin
a ‘‘species g oup.’’
Me hods
ATCC 1015 genome assembly
The sequence eads we e de i ed om ou whole-genome sho -
gun (WGS) lib a ies: one wi h an inse size o 2–3 kb, wo wi h an
inse size o 6–8 kb, and one wi h an inse size o 35–40 kb. The
eads we e sc eened o ec o using c oss_ma ch and hen im-
med o ec o sequence and quali y (J Chapman, N Pu nam, I Ho,
and D Rokhsa , unpubl.). Reads sho e han 100 bases a e im-
ming we e excluded. The inal da a se included: 28,551 o 2–3-kb
eads, con aining 21.5 Mb o sequence; 160,479 o 6–8-kb eads,
con aining 123 Mb o sequence; and 38,651 o 35–40-kb eads,
con aining 23.8 Mb o sequence.
The da a we e assembled using elease 2.7 o Jazz, a WGS as-
semble de eloped a he JGI (Apa icio e al. 2002; J Chapman,
N Pu nam, I Ho, and D Rokhsa , unpubl.). The genome size and se-
quence dep h we e ini ially es ima ed o be 36 Mb and 8.0, e-
spec i ely. A e emo al o sho (<1 kb) and edundan sca olds
(<5 kb wi h 80% o mo e o he leng h ma ching a sca old >5 kb),
he assembly included 43.7 Mb o sca old sequence wi h 8.2 Mb
(18.9%) o gaps in 350 sca olds, wi h hal o he sca old sequence
con ained in he eigh la ges sca olds o 1.81 Mb o longe . The
sequence dep h de i ed om he assembly was 7.88 60.05. To
es ima e he comple eness o he assembly, a se o 50,001 ESTs was
BLAT-aligned o he unassembled immed eads, as well as he
assembly i sel . Fo y- h ee housand h ee hund ed and wen y-
h ee ESTs (86.6%) we e >80% co e ed by he unassembled da a;
43,978 (88.0%) we e >50% co e ed; and 44,206 (88.4%) we e >20%
co e ed. By way o compa ison, 48,798 ESTs (97.6%) showed hi s
o he assembly. O ien a ion o he ch omosome a ms was based
on eigh a ailable elome e sequences, he supe con ig o ien a ion
p oposed by Pel e al. (2007), and esea ch on linkage g oups in
A. nige (Bos e al. 1989; Debe se al.1989, 1990a,b; Swa e al. 1992;
Ve does e al. 1994).
ATCC 1015 genome inishing
To pe o m genome imp o emen on A. nige ATCC 1015, ini ial
ead layou s om he whole-genome sho gun assembly we e
con e ed in o he ph ed/ph ap/consed pipeline (Go don e al.
1998). Following manual inspec ion o he assembled sequences,
inishing was pe o med by esequencing plasmid subclones and
by walking on plasmid subclones o osmids using cus om p ime s.
All inishing eac ions we e pe o med wi h 4:1 BigDye o dGTP
BigDye e mina o chemis y (Applied Biosys ems). Repea s in he
sequence we e esol ed by ansposon-hopping 8-kb plasmid
clones. Fosmid clones we e sho gun sequenced and inished o ill
la ge gaps, esol e la ge epea s, o o esol e ch omosome dupli-
ca ions and ex end in o ch omosome elome e egions.
The esul ing 24 inished sca olds we e o ien a ed whe e
possible in o ch omosome s uc u es using compa isons o Pel e al.
(2007) and elome e posi ions. The imp o ed genome consis s o
Ande sen e al.
892 Genome Resea ch
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om
34,853,277 bp wi h an es ima ed e o a e o less han 1 e o in
100,000 bp.
ATCC 1015 au oma ic anno a ion
Gene models in he genome o A. nige we e p edic ed using Fgenesh
(Salamo and Solo ye 2000), Fgenesh+(Salamo and Solo ye
2000), and Genewise (Bi ney and Du bin 2000) in eg a ed in o he
JGI anno a ion pipeline. Fgenesh was ained on a se o mo e han
2000 pu a i e ull-leng h ansc ip s de i ed om clus e ed A. nige
ESTs and eliable homology-based gene models o show 81% sen-
si i i y and 81% speci ici y o p edic ions on a es se . Homology-
based gene p edic o s we e seeded wi h BLASTX alignmen s o
p o eins om he NCBI non edundan se o p o eins. Thi y-one
housand i e hund ed and se en y-eigh A. nige ESTs we e se-
quenced using Sange echnology and we e ei he di ec ly mapped
o genomic sequence when he ESTs included pu a i e ull-leng h
(FL) genes o used o ex end p edic ed gene models in o FL genes
by adding 59and/o 39UTRs. In addi ion, 386,515 ESTs wi h an
a e age leng h o 104 n we e sequenced wi h 454 Li e Sciences
(Roche) GS20 sequence s and used in alida ion o p edic ed gene
models. Since mul iple gene models we e gene a ed o each locus,
a single ep esen a i e model was chosen based on homology and
EST suppo and used o u he analysis.
All p edic ed gene models we e unc ionally anno a ed by
sequence simila i y o anno a ed genes om he NCBI non-
edundan se and o he specialized da abases (such as KEGG)
(Kanehisa e al. 2002, 2004) using BLAST and ha dwa e accele a ed
double-a ine Smi h-Wa e man alignmen s (h p://www. imelogic.
com). Func ional and s uc u al domains we e p edic ed in p o ein
sequences using he In e P o so wa e (Zdobno and Apweile
2001). All genes we e also anno a ed acco ding o Gene On ology
(Ashbu ne e al. 2000; Ha is e al. 2004), euka yo ic o hologous
g oups (KOGs) (Koonin e al. 2004), and KEGG me abolic pa hways
(Kanehisa e al. 2004).
ATCC 1015 sequence a ailabili y
A. nige assemblies, anno a ions, and analyzes a e a ailable
h ough he in e ac i e JGI Genome Po al a h p://genome.jgi-
ps .o g/Aspni5/Aspni51.home.h ml. Genome assemblies oge he
wi h p edic ed gene models and anno a ions we e also deposi ed a
NCBI unde he p ojec accession numbe ACJE00000000.
S ains
The ollowing A. nige s ains we e used o expe imen s (de-
posi ion numbe s in di e en collec ions a e gi en as well): CBS
513.88 =FGSC A1513 =IBT 29270, ATCC 1015 =IBT 28639 =NCTC
3858a =NRRL 1278 =NRRL 350 =NRRL 511 =NRRL 328 =Thom
167 =CBS 113.46 =ATCC 10582 =IMI 031821 =LSBH Ac4 =Thom
3528.7, NRRL 3 =IBT 28539 =MUCL 30480 =DSM 2466 =CECT
2088 =VTT D-85240 =NRRL 566 =WB3 =ATCC 9029 =N400 =
CBS 120.49 =IMI 041876, NRRL 326 =IBT 27876 =WB 326 =CBS
554.65 =ATCC 16888 =IHEM 3415 =IMI 050566 =Thom 2766 =
JCM 10254 =IFO 33023 (ex annin-gallic acid e men a ion;
A. nige neo ype) (Kozakiewicz e al. 1992) NRRL 328 =IBT 27878 =
NRRL 350 =IBT 27877 =CBS 113.46, NRRL 337 =CBS 126.48 =
ATCC 10254 =DSM 734 =IFO 6428 =IMI 015954 =WB 337, NRRL
363 =IBT 3617 =IBT 5764 =CBS 126.49 =ATCC 10698 =IFO 6648,
NRRL 511 =IBT 27875, NRRL 1278 =IBT 27872, NRRL 2270 =IBT
26391 =ATCC 11414 =VTT D-77050 =IMI 075353 =A60 =S.M.
ma in A-1-233 =Wisconsin 72-4, de i ed om ATCC 1015, and
NRRL 3122 =IBT 23538 =ATCC 22343 =CBS 115989 ( his s ain is
a wild- ype p ogeni o o CBS 513.88). S ain his o ies o ATCC
1015, ATCC 9029, and NRRL 3122 a e e iewed by Bake (2006).
Exo-me aboli e p o iling
A. nige s ains we e inocula ed on Czapek yeas au olysa e (CYA),
yeas ex ac suc ose (YES) aga , and CYA wi h 5% NaCl aga (CYAS
aga ). Fo medium composi ion, see F is ad and Samson (2004). All
s ains we e h ee-poin inocula ed on hese media and incuba ed
a 25°C in da kness o a week, a e which i e plugs (6 mm di-
ame e ) along a diame e o a ungal colony we e cu ou and
ex ac ed (Smedsgaa d 1997). The ex ac s we e analyzed by HPLC-
DAD luo escence (F is ad and Th ane 1987; Smedsgaa d 1997)
and by HPLC-HR-MS (Nielsen and Smedsgaa d 2003; F is ad e al.
2007b). The seconda y me aboli es we e iden i ied by compa ison
wi h au hen ic s anda ds ( umonisin B
2
, och a oxin A, nig agillin,
ko anin, and o landin) and by UV spec a and high- esolu ion
mass spec a using elec osp ay ioniza ion.
CBS 513.88 gap closu e
The nea -comple e ATCC 1015 genome sequence was used o
e i y con ig o de and o ien a ion and o es ima e gap sequence
leng h be ween con igs in CBS 513.88. Gap- lanking PCR p ime s
(20-me s) gi ing ise o PCR p oduc s wi h a minimal o e lap o
100 bp we e au oma ically designed wi h p ime -3 (Rozen and
Skale sky 2000) using cus om sc ip s. PCR p oduc s o expec ed
size we e pu i ied using a QIAquick PCR Pu i ica ion Ki (QIAGEN)
and sequenced by Baseclea . The upda ed sequence o A. nige CBS
513.88 is a ailable om EMBL (h p://www.ebi.ac.uk/embl/) un-
de accession nos. AM269948–AM270415.
Sequencing o a iable egions
Regions we e ampli ied using s anda d PCR echniques wi h he
ou ollowing p ime pai s ( he name desc ibes ch omosome
numbe and di ec ion): (1) Ch 02-Fwd: 59-GGACACTGCTTGATG
TGATG-39, Ch 02-Re : 59-GAGAGACGTACGAAAGGTTG-39; (2)
Ch 04-Fwd: 59-CGATCTGCGACCAGGA-39, Ch 04-Re : 59-CATAA
CGGATTCGTCGCTG-39; (3) Ch 06-Fwd: 59-CTTGAAGGCGTTGA
GGTC-39,Ch 06-Re :59-GCGAGTATGTGGCTAACATC-39; (4) Ch 08-
Fwd: 59-GGTATGTCACATTCCRTCCA-39, Ch 08-Re : 59-GCTTGC
AGTGAGCAAGGA-39. The sequences on Ch II, Ch VI, and Ch VIII
o e lap wi h p edic ed genes. The PCR p oduc s we e pu i ied us-
ing a QIAquick PCR Pu i ica ion Ki (QIAGEN) and sequenced by
Agencou Bioscience Co po a ion (GenBank accession numbe
GU296708–GU296739).
Sequencing o be a- ubulin
Ampli ica ion o pa o he be a- ubulin gene was pe o med using
he p ime s B 2a (GGTAACCAAATCGGTGCTGCTTTC) and B 2b
(ACCCTCAGTGTAGTGACCCTTGGC) (Glass and Donaldson 1995).
Bo h s ands o he PCR agmen s we e sequenced wi h he ABI
P ism Big DyeTM Te mina o .3.0 Ready Reac ion Cycle sequenc-
ing ki . Samples we e analyzed on an ABI PRISM 3700 Gene ic An-
alyze , and con igs we e assembled using he o wa d and e e se
sequences wi h he p og am SeqMan om he Lase Gene package
(GenBank accession numbe s GU296686–GU296707).
Calcula ion o phylogene ic ee
Sequences we e aligned using Clus alX and immed o he i s
common base a bo h ends be o e making he inal alignmen . Fo
he ee o Figu e 3B, ou immed sequences we e joined o
each s ain be o e making he inal alignmen . T ee calcula ions
we e pe o med using T eeCon ( an de Pee and de Wach e
1994). Dis ances we e es ima ed using he Jukes and Can o algo-
i hm aking inse ions and dele ions in o accoun . Topology was
Aspe gillus nige s ain e olu ion
Genome Resea ch 893
www.genome.o g
Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om