Comparative genomics of citric-acid-producing Aspergillus niger ATCC 1015 versus enzyme-producing CBS 513.88

Resea ch Compa a i e genomics o ci ic-acid-p oducing Aspe gillus nige ATCC 1015 e sus enzyme-p oducing CBS 513.88 Mikael R. Ande sen, 1 Ma ga i a P. Salaza , 1,19 Pe e J. Schaap, 2 Pe e J.I. an de Vonde oo , 3 Da id Culley, 4 Je e Thykae , 1 Jens C. F is ad, 1 K is ian F. Nielsen, 1 Richa d Albang, 5 Kaj Albe mann, 5 Randy M. Be ka, 6 Ge ha d H. B aus, 7 Susanna A. B aus-S omeye , 7 Luis M. Co ochano, 8 Ziyu Dai, 4 Pie W.M. an Dijck, 9 Ge ald Ho mann, 10 Linda L. Lasu e, 4 Jon K. Magnuson, 4 Hildega d Menke, 3 Ma in Meije , 11 Susan L. Meije , 1 Jakob B. Nielsen, 1 Michael L. Nielsen, 1 Albe J.J. an Ooyen, 3 He man J. Pel, 3 La s Poulsen, 1 Rob A. Samson, 11 Hein S am, 3 Ad ian Tsang, 12 Johannes M. an den B ink, 13 Alex A kins, 14 And ea Ae s, 14 Ha is Shapi o, 14 Jasmyn Pangilinan, 14 Asa Salamo , 14 Yigong Lou, 14 E ika Lindquis , 14 Susan Lucas, 14 Jane G imwood, 15 Igo V. G igo ie , 14 Ch is ian P. Kubicek, 16 Diego Ma inez, 17,18 Noe¨l N.M.E. an Peij, 3 Johannes A. Roubos, 3 Jens Nielsen, 1,19 and Sco E. Bake 4,20 1–18 [Au ho a ilia ions appea a he end o he pape .] The ilamen ous ungus Aspe gillus nige exhibi s g ea di e si y in i s pheno ype. I is ound globally, bo h as ma ine and e es ial s ains, p oduces bo h o ganic acids and hyd oly ic enzymes in high amoun s, and some isola es exhibi pa hogenici y. Al hough he genome o an indus ial enzyme-p oducing A. nige s ain (CBS 513.88) has al eady been sequenced, he e sa ili y and di e si y o his species compel addi ional explo a ion. We he e o e unde ook whole- genome sequencing o he acidogenic A. nige wild- ype s ain (ATCC 1015) and p oduced a genome sequence o e y high quali y. Only 15 gaps a e p esen in he sequence, and hal he elome ic egions ha e been elucida ed. Mo eo e , sequence in o ma ion om ATCC 1015 was used o imp o e he genome sequence o CBS 513.88. Ch omosome-le el compa isons unco e ed se e al genome ea angemen s, dele ions, a clea case o s ain-speci ic ho izon al gene ans e , and iden i- ica ion o 0.8 Mb o no el sequence. Single nucleo ide polymo phisms pe kilobase (SNPs/kb) be ween he wo s ains we e ound o be excep ionally high (a e age: 7.8, maximum: 160 SNPs/kb). High a ia ion wi hin he species was con- i med wi h exo-me aboli e p o iling and phylogene ics. De ailed lis s o alleles we e gene a ed, and geno ypic di e ences we e obse ed o accumula e in me abolic pa hways essen ial o acid p oduc ion and p o ein syn hesis. A ansc ip ome analysis suppo ed up- egula ion o genes associa ed wi h biosyn hesis o amino acids ha a e abundan in glucoamylase A, RNA-syn hases, and p o ein anspo e s in he p o ein p oducing CBS 513.88 s ain. Ou esul s and da a se s om his in eg a i e sys ems biology analysis esul ed in a snapsho o ungal e olu ion and will suppo u he op imiza ion o cell ac o ies based on ilamen ous ungi. [Supplemen al ma e ial is a ailable o his a icle. The A. nige ATCC 1015 whole genome sequence has been submi ed o GenBank (h p://www.ncbi.nlm.nih.go /genbank/) unde accession no. ACJE00000000. The sequence da a om he phylogeny s udy ha e been submi ed o GenBank unde accession nos. GU296686–GU296739. The mic oa ay da a om his s udy ha e been submi ed o he NCBI Gene Exp ession Omnibus (GEO) (h p://www.ncbi.nlm.nih.go /geo/) unde se ies accession no. GSE10983. The dsmM_ANIGERa_coll511030F lib a y and pla o m in o ma ion ha e been submi ed o GEO unde accession no. GPL6758.] The sap o ophic ilamen ous ungus Aspe gillus nige is ound globally and exhibi s a g ea di e si y in i s pheno ype. A. nige has become one o he majo wo kho ses in indus ial bio echnology, being e y e icien in p oducing bo h polysaccha ide-deg ading enzymes (pa icula ly amylases, pec inases, and xylanases) o o - ganic acids (mainly ci ic acid) in high amoun s. I also has a long his o y o sa e use (Schus e e al. 2002; an Dijck e al. 2003; an 19 P esen add ess: Sys ems Biology, Depa men o Chemical and Biological Enginee ing, Chalme s Uni e si y o Technology, SE-41296 Go ¨ ebo g, Sweden. 20 Co esponding au ho . E-mail sco .b[email p o ec ed]; ax (509) 372-4732. A icle published online be o e p in . A icle, supplemen al ma e ial, and pub- lica ion da e a e a h p://www.genome.o g/cgi/doi/10.1101/g .112169.110. F eely a ailable online h ough he Genome Resea ch Open Access op ion. 21:885–897 Ó2011 by Cold Sp ing Ha bo Labo a o y P ess; ISSN 1088-9051/11; www.genome.o g Genome Resea ch 885 www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om Dijck 2008). Comme cial impo ance is illus a ed by a wo ld ma ke o indus ial enzymes o nea ly US$ 5 billion in 2009, o which ilamen ous ungi accoun o oughly hal o he p o- duc ion (Lube ozzi and Keasling 2008), and a global ci ic acid p oduc ion o 9 310 6 me ic ons in 2000 (Ka a a and Kubicek 2003). In 2007, he genome sequence o A. nige s ain CBS 513.88, used o indus ial enzyme p oduc ion, was published (Pel e al. 2007). This s ain was de i ed om A. nige NRRL 3122, a s ain de eloped o glucoamylase A p oduc ion by classical mu agenesis and sc eening me hods ( an Lanen and Smi h 1968). This wo k ini ia ed a numbe o new genome-based in es iga ions (Sun e al. 2007; Ande sen e al. 2008ab; Ma ens-Uzuno a and Schaap 2008; Yuan e al. 2008ab) bu did no e eal di e ences be ween ci ic- acid-p oducing and enzyme-p oducing A. nige s ains (Cullen 2007). In his s udy, we p esen he nea ly comple e genome se- quence o he ci ic-acid-p oducing A. nige wild- ype s ain ATCC 1015 and compa e i o he genome sequence o he enzyme- p oducing s ain CBS 513.88. The gene ic di e si y o hese wo A. nige s ains was de e mined by applying sys ems biology ools as well as new bioin o ma ics me hods o examine mul i-le el di - e ences ha dis inguish he wild- ype ci ic-acid-p oducing s ain om he mu agenized glucoamylase A–p oducing s ain. Resul s Gene al genome s a is ics The 34.85-Mb genome sequence o A. nige ATCC 1015 was gen- e a ed using a sho gun app oach and hen u he imp o ed o a high-quali y assembly o 24 inished con igs sepa a ed by 15 gaps (including eigh om cen ome ic egions). Genome s a is ics a e summa ized in Table 1, wi h de ails in Supplemen al Tex 1. The ull sequence and anno a ions a e a ailable om he Join Genome Ins i u e (JGI) Genome Po al (h p://genome.jgi-ps .o g/Aspni5) and om NCBI (accession numbe ACJE00000000). The genome sequence o A. nige CBS 513.88 (Pel e al. 2007) was imp o ed using he ATCC 1015 sequence o close 186 con ig gaps and modi y he gene models associa ed wi h hese gaps (Table 1; Supplemen al Table 1). The upda ed A. nige CBS 513.88 genome se- quence is accessible h ough EMBL (accession numbe s AM269948– AM270415). We no e a la ge di e ence (2882) in he numbe o called genes in he wo s ains (Table 1). A ho ough analysis indica es an o e p edic ion o genes in CBS 513.88 and an unde p edic ion o genes in ATCC 1015, and 396/510 unique genes in CBS 513.88/ ATCC 1015 (Supplemen al Tex 2; Supplemen al Fig. 1; o de ails, see Supplemen al Tables 2–9). Fo u he alida ion o he ab- sence/p esence o indi idual p o eins, we ha e pe o med gDNA hyb idiza ions, which can be consul ed o e e ence (Supple- men al Table 16). Unique genes in bo h s ains sugges ho izon al gene ans e o be a cause o he amylase hype -p oduce pheno ype Fo he genes unique o he amylase-p oducing s ain CBS 513.88 (Supplemen al Table 6), he mos no able genes a e wo alpha- amylases ha a e iden ical o he Aspe gillus o yzae alpha-amylase, a possible cause o he amylase hype -p oduce pheno ype. We discuss his in de ail below (Fig. 2). Fu he mo e, we ind h ee possible polyke ide syn hases, which sugges s a unique seconda y me aboli e p o ile o his s ain. Examining he genes ound only in ATCC 1015 (Supple- men al Table 6) does no poin o any ob ious cause o ci ic acid hype -p oduc ion, bu ou possible polyke ide syn hases and a pu a i e NRPS a e ound o be unique o ATCC 1015, sugges ing his s ain has unique seconda y me aboli es as well. Mul iple e - ec s o his ype a e, indeed, seen o bo h s ains in analyses below (Fig. 1; Supplemen al Fig. 10; Table 2). Syn eny mapping shows 0.5 Mb o ch omosomal ea angemen s and a whole-a m in e sion The genomes o he wo s ains a e la gely syn enic (Fig. 1). Fo example, he 1429 p o ein-encoding genes o CBS 513.88 supe - con ig An01 ha ha e p edic ed coun e pa s in ATCC 1015 a e, wi h one excep ion, all mapped o ch omosome 2b. A simila ex- ample is seen o all bu one o 1486 p o ein-encoding genes on supe con ig An02. Bo h excep ions encode pu a i e Tan1-like ans- posases. No wi hs anding, a numbe o signi ican di e ences in genome con igu a ion exis (Fig. 1). Mo e han 0.5 Mb o addi ional genome sequence in ATCC 1015 esides in ou la ge egions on ch omosomes (Ch ) II, III, and V (Fig. 1). The lanking sequences o h ee o hese addi ional elemen s in ATCC 1015 a e syn enic o con inuous sequences in CBS 513.88 and a e hus ue di e ences in genome con igu a ion (Supplemen al Fig. 2; Supplemen al Table 2; o de ails on Ch III, see nex sec ion). The ou h egion on he le a m o Ch V in ATCC 1015 could no be e i ied due o a con ig gap o CBS 513.88. The con ig gap in he igh a m o Ch V in he ge- nome sequence o ATCC 1015 is spanned by con inuous sequence in CBS 513.88, con aining 15 p edic ed genes. An o e iew o he genes ound in he gaps unique o ATCC 1015 can be ound in Supplemen al Table 2. O he s iking di e ences include a la ge in e sion in Ch VIII and he in- e sion and ansloca ion o a la ge ag- men be ween he le a ms o Ch III and Ch VII (Supplemen al Fig. 3). Bo h we e con i med wi h PCR spanning he b eak- poin s (da a no shown). Finally, he p esence o elome e se- quences in genome da a con i ms an in- e sion o he comple e igh a m o Ch VI. Two ex a alpha-amylase-encoding genes likely ob ained h ough HGT An unma ched egion iden i ied o he le a m o Ch III (Fig. 1) spans 72.5 kb o Table 1. Gene al genome s a is ics o A. nige ATCC 1015 and A. nige CBS 513.88 A. nige ATCC 1015 ( his s udy) A. nige CBS 513.88 a (Pel e al. 2007) A. nige CBS 513.88 b ( his s udy) Gene models 11,200 14,165 14,082 Genome size (Mb) 34.85 33.93 34.02 P o ein leng h (amino acids) 484.3 439.9 442.5 Exons pe gene 3.1 3.6 3.6 Exon leng h (bp) 480.8 370.0 371.6 In on leng h (bp) 93.8 97.2 96.9 Excep genome sizes and he numbe o gene models, all alues a e a e ages. a The genome assembly published by Pel e al. (2007). b Genome assembly o A. nige CBS 513.88 a e gap closu e using sequence in o ma ion om ATCC 1015. 886 Genome Resea ch www.genome.o g Ande sen e al. Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om unique sequence in ATCC 1015. Rema kably, o CBS 513.88, a unique 85.3-kb sequence is ound a his loca ion (Fig. 2A). Gene anno a ion may be ound in Supplemen al Table 10. To con i m he ac ual absence o he egion in he ch omosome o ATCC 1015, we pe o med gDNA hyb idiza ions, which did indeed suppo his inding (Supplemen al Fig. 4). App oxima ely 12 kb o his egion sha es >99.8% sequence iden i y a DNA le el wi h genomic DNA om A. o yzae RIB40 (Fig. 2B). The comple e 85-kb agmen including he 12-kb alpha- amylase egion also appea s o be in ol ed in a ecen duplica ion ecombina ion e en o Ch VII, (Fig. 2C). Thus, he CBS 513.88 genome ha bo s wo addi ional alpha-amylase-encoding genes ha a e o hologs o he alpha-amylase-encoding genes (AO090023000944, AO090120000196) o A. o yzae RIB40. These indings sugges ha CBS 513.88 and he pa en al s ain NRRL 3122 (da a no shown) acqui ed hese duplica e alpha-amylase genes (An12g06930, An05g02100) h ough ho izon al gene ans e (HGT). The occu ence o HGT in Aspe gilli would u he be suppo ed by he p esence o alpha-amylase-encoding genes in o he black Aspe gilli ha display >99% nucleo ide iden i y o hose o A. o yzae RIB40 and he A. nige CBS 513.88 alpha-amylases (Ko man e al. 1990; Shibuya e al. 1992). The o igin o he Figu e 1. Syn eny map o he con igs o A. nige ATCC 1015 o he supe con igs o A. nige CBS 513.88. The colo ing o he ch omosomes shows syn enic egions in A. nige CBS 513.88. A abic nume als show he numbe o he supe con ig in A. nige CBS 513.88. G ay a eas show egions no ound in he CBS 513.88 genome sequence (Pel e al. 2007). (Filled black ci cles) P oposed loca ions o cen ome ic egions. Sequenced elome es a e ma ked wi h a T. Ze oes ma k he i s base o he con igs. A black line unde nea h a sec ion o he ch omosomes deno es in e ed sequence. Black his og ams show SNPs pe kilobase (numbe o single nucleo ide polymo phisms/kilobase) be ween he sequences o he wo s ains (y-axis: 0–160 SNPs/kb). Gaps be ween con igs and cen ome es a e no o scale. The alignmen demons a es almos comple e syn eny be ween he wo s ains, wi h he excep ion o a c oss-o e e en be ween he le a ms o ch omosomes III and VII. An o e iew o he genes ound in he gaps unique o ATCC 1015 can be ound in Supplemen al Table 2. Aspe gillus nige s ain e olu ion Genome Resea ch 887 www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om emaining pa o he unma ched egion emains unclea . No sig- ni ican simila i y was obse ed a he DNA le el, and only a ew o he encoded p o eins show simila i y wi h o he p o eins p esen in he NR p o ein da abase. The e is also e idence ha his HGT may ha e occu ed by he ac ion o ansposases. The 12-kb HGT egion is lanked by 202-bp in e ed, pe ec , e minal epea s (ITR) (Fig. 2A,B). Fu - he mo e, his HGT egion ha bo s ano he gene, An12g07000, ha is iden ical o he A. o yzae npA ansposase gene. In- e es ingly, in he A. o yzae RIB40genome, hesame12-kb ag- men has been duplica ed wice and is p esen on mul iple ch omosomes, bu only one pe ec copy o he ITRs is e ained (Fig. 2C). T ansposon p esence is s ain-speci ic T ansposon-like sequences we e iden i ied in bo h genomes and quan i ied (Supplemen al Table 11). This compa ison pinpoin s a ema kable di e ence in he p esence and amoun o ansposon- ela ed sequences in ATCC 1015 and CBS 513.88 bo h o class I and o class II ansposons: Only 16 sequences we e iden i ied in ATCC 1015, bu 55 we e de ec ed in CBS 513.88. Whe eas he ATCC 1015 genome con ains no class I supe amily copia and a single copy o class II supe amily Fo 1/pogo, hese sequences a e much mo e abundan in CBS 513.88, whe e 15 class I copia, and 13 class II Fo 1/pogo a e ound. SNP analysis e eals high mu a ion a es and hype a iable egions We ound 8 616 SNPs/kb (a e age 6s anda d de ia ion) and a maximum o 163 SNPs/kb single-nucleo ide polymo phisms (SNPs) be ween A. nige s ains ATCC 1015 and CBS 513.88 (Sup- plemen al Table 12). This alue is much highe han he maximum o 9 SNPs/kb ound by Cuomo e al. (2007) in a SNP analysis o wo Fusa ium g aminea um s ains. A compa ison o he A. nige ATCC 1015 genome sequence o ha o A. nige ATCC 9029 e ealed ma kedly less a ia ion be ween he wo (2 65 SNPs/kb) (Supplemen al Fig. 5), indica ing a la ge genomic a ia ion in he A. nige g oup bu li le be ween ATCC 1015 and 9029. These polymo phisms a e no uni o mly dis ibu ed bu clus e in hype - a iable egions (Fig. 1). This is suppo ed by a gDNA hyb idiza ion s udy, which con i ms he p esence o dis inc hype a iable egions (Supplemen al Fig. 4). Gene compa isons e eal indus ially ele an s ain di e ences To iden i y s ain-de ining sys emic e ec s o he genome a ia- ion, esul s om he Imp in gene syn eny analysis (see Supple- men al Table 5; Me hods) we e used o addi ional genome-scale in es iga ion. GO e m o e - ep esen a ion analysis was pe o med on gene g oups wi h dis inc common p ope ies ( o G oup o e iew, see Supplemen al Table 5; o de ails, see Supplemen al Table 13). Mos in e es ing is he obse a ion ha 37 p o eins in ol ed in an- sc ip ional egula ion a e non unc ional in CBS 513.88 due o ameshi s o s op codons. This sugges s a less s ingen egula ion o CBS 513.88 ela i e o ATCC 1015. A compa a i e shake- lask s udy o he wo s ains also sugges s mu a ions in egula o y ele- men s as ni ogen sou ce u iliza ion is impai ed in he CBS 513.88 s ain (da a no shown). While he ni ogen ca abolism egula o A eA was o iginally hough o be mu a ed in CBS 513.88 (Pel e al. 2007), a esequencing o a eA showed he ORFs o be iden ical. To de ec po en ial di e ences in he me abolism o he wo s ains, we compa ed all genes encoding p o eins ha display di e ences a he amino acid le el be ween he wo s ains on he me abolic ne wo k o A. nige (Ande sen e al. (2008a) and mapped hem o me abolic pa hways (Supplemen al Fig. 6). Mu a ions we e ound in he pa hways o biosyn hesis o p oline, aspa a e, aspa agine, yp ophan, and his idine, which may be ele an o p o ein p oduc ion. Also, mu a ions we e ound in he plasma memb ane-bound ATPase, in he enzymes o he GABA shun , o he TCA cycle, and in componen s o all s eps o he elec on anspo chain, which could be ele an o he p oduc ion o ci ic acid. Phylogene ic analysis con i ms high a iabili y be ween genome sequences To place he compa ison o A. nige ATCC 1015 and CBS 513.88 in o he la ge con ex o he Aspe gillus sec ion Nig i, a ia ion in he wo s ains was analyzed by phylogene ic analysis o a pa o he be a- ubulin sequence o a numbe o A. nige s ains and o he black Aspe gilli (Fig. 3A). To u he explo e he genome a iabili y ac oss he A. nige species, we iden i ied ou 1-kb egions om Ch II, Ch IV, Ch VI, and Ch VIII ha we e iden ical in he ATCC 1015 and ATCC 9029 s ains bu had ;20 SNPs/kb ela i e o he genome sequenceo CBS 513.88. These egions we e PCR-sequenced in se en A. nige s ains including he CBS 513.88 p ogeni o , NRRL Table 2. Exo-me abolomic p o iling o 11 A. nige s ains based on HPLC-DAD-FLD and HPLC-DAD-HRMS ( his s udy) Seconda y me aboli es Re e ence NRRL 3122 CBS 513.88 a CBS 126.49 ATCC 1015 a ATCC 9029 a CBS 554.65 NRRL 328 NRRL 350 NRRL 511 NRRL 1278 NRRL 2270 Au aspe one B Tanaka e al. 1966 • • • • • • ••••• Fumonisin B 2 F is ad e al. 2007b • • • • • ••••• Funalenone Inokoshi e al. 1999 • • • • ••••• Ko anin Bu ¨chi e al. 1971 • • • • ••••• Nig agillin Isogai e al. 1975 •• Och a oxin A Aba ca e al. 1994 •• • O landin Cu le e al. 1979 • • • • ••••• O he naph ho-g-py ones • • • • ••••• Py anonig in A Hio e al. 2004 • • • • • • ••••• Tensidol B Fukada e al. 2006 • • • • • • ••••• The e e ence column ela es o he elucida ion o he compound s uc u e. a Genome-sequenced s ains. Ande sen e al. 888 Genome Resea ch www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om 3122, and he A. nige neo ype s ain, CBS 554.65 (Kozakiewicz e al. 1992) o o m a phylogene ic ee wi h high a ia ion (Fig. 3B). Fo p e iously sequenced s ains, he esequencing esul s we e iden ical o he p e iously de e mined genomic sequence, he eby excluding ha he genomic a ia ion is an a i ac o low- ideli y sequencing. All A. nige s ains ha e an iden ical sequence o be a- ubulin and o m a s ongly suppo ed e minal clade oge he wi h As- pe gillus awamo i (Fig. 3A). The o he axonomically di e en spe- cies a e phylogene ically dis inc om his g oup, which is in ac- co dance wi h he se ial classi ica ion o F is ad e al. (2007a). The la e clus e ing based on he selec ed egions (Fig. 3B) was able o Figu e 2. Ho izon al gene ans e o alpha-amylase genes om A. o yzae o A. nige CBS 513.88. (A) Unma ched egion iden i ied o he le a m o ch omosome III spanning 65 kb o ATCC 1015 encoding 30 p edic ed genes and 85 kb o CBS 513.88 encoding 24 p edic ed genes. The unma ched egion is lanked on one side by a small local in e sion o h ee p edic ed genes (in g een). (B) The 12.4-kb HGT egion is pa o an iden ical 12.7-kb egion p esen in A. o yzae RIB40 supe con igs SC113 and SC023. In A. nige CBS 513.88, he ans e ed egion is enclosed by a 203-bp in e ed epea ( ed a ow). An12g07000 (blue) is a pu a i e ansposase and iden ical o he A. o yzae ansposon Ao 1 npA gene. Simila ly, he A. nige CBS 513.88 alpha- amylase encoding gene An12g06930 (o ange) is iden ical o A. o yzae anno a ed genes AO090120000196 (SC113) and AO090023000944 (SC023). (C) P oposed duplica ion– ecombina ion e en be ween supe con ig 12 and supe con ig 05 o he 12-kb HGT egion. B eakpoin s a e indica ed wi h do ed lines. The agmen encoding alpha-amylase An05g02200 is iden ical o An12g06930 (o ange). The b eakpoin s a e lanked wi h addi ional copies o he 203-bp epea egion ( ed a ow). The egion encoding genes An12g06940 o An12g06970 is iden ical o he egion encoding An05g02210 o An05g02130. The downs eam b eakpoin occu ed in he p edic ed gene coding egion o An12g06970, he eby dele ing he o iginal s a codon and ups eam egion. Aspe gillus nige s ain e olu ion Genome Resea ch 889 www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om sepa a e he A. nige s ains in o h ee g oups. S ain CBS 513.88 and i s p ogeni o NRRL 3122 we e iden ical o he egions, in- dica ing limi ed SNP in oduc ion due o classical s ain imp o e- men , and hus con i ms high a ia ion in he A. nige g oup. Exo-me abolomic p o iling desc ibes h ee dis inc g oups o A. nige To u he compa e he wo sequenced s ains on a sys em-wide, bu nongenomic le el, o each o he and o o he membe s o he A. nige species g oup, exo-me abolomic p o iles o he wo s ains we e compa ed o nine o he s ains, including he CBS 513.88 p ogeni o s ain, NRRL 3122; he widely used labo a o y s ain ATCC 9029; and he A. nige neo ype, CBS 554.65 (Table 2). This ga e h ee dis inc clades, which ollow he clus e ing o Figu e 3B, bu does no con o m o he phylogene ic dis ances calcula ed. S ain CBS 513.88 and i s p ogeni o s ain had e y simila sec- onda y me aboli e p o iles. These wo s ains di e ed om he o he s ains analyzed. S ain ATCC 1015 had a p o ile simila o se en o he s ains, al hough he e we e some quan i a i e di - e ences. S ain CBS 126.49 had a unique p o ile. In he case o och a oxin A, i is in e es ing ha in ATCC 1015 and ATCC 9029, a emnan o he PKS gene (An15g07920) o he pu a i e och a oxin clus e in A. nige CBS 513.88 (Pel e al. 2007) was iden i ied, which could be ela ed o a 21-kb dele ion in bo h s ains (Supplemen al Fig. 7). We ha e no ed ha a pu a i e NRPS is ound in one o he unique ch omosome egions ound in ATCC 1015 (Fig. 1), which may accoun o some o he di e ence (Supplemen al Table 2). T ansc ip ome analysis o A. nige ATCC 1015 and CBS 513.88 g owing on glucose To e alua e he e ec o he di e ences in genome sequence on he physiology o he wo s ains, ba ch cul i a ions in bio eac o s and a compa a i e ansc ip ome analysis we e pe o med. S ains ATCC 1015 and CBS 513.88 we e g own unde he same condi- ions in ba ch cul u es in a glucose-based minimal medium. The GlaA-p oducing s ain CBS 513.88 p oduced >1.2 g/L GlaA mo e han ATCC 1015, while p oducing ;1 g/L biomass less. O he measu ed cha ac e is ics we e simila o he wo s ains (Table 3). S a is ical analysis showed 4784 signi ican ly (adj. p<0.05) di - e en ially exp essed genes, wi h an almos equal numbe o genes up- egula ed in ei he s ain (2431 in CBS 513.88 s. 2353 o ATCC 1015). Examining he di e en ial exp ession in he con ex o me - abolic pa hways (Supplemen al Fig. 8), only he al e na i e oxi- da i e pa hway has uni o mly highe exp ession in ATCC 1015, while a subs an ial subse o me abolism was up- egula ed in CBS 513.88, including glycolysis and he TCA cycle. As he speci ic g ow h a es o he s ains a e simila , we sugges ha his ex a ac i i y o cen al me abolism p o ides p ecu so s o he highe p oduc i i y o glucoamylase. We also ind inc eased exp ession o genes in ol ed in amino acid me abolism, especially he en- i e biosyn he ic pa hways o h eonine, se ine, and yp ophan. Figu e 3. (A) Phylogene ic ela ionship o se e al black Aspe gilli based on pa ial sequencing o be a- ubulin. The ee was oo ed o Aspe gillus aculea us CBS 172.66. (B) Phylogene ic ela ionship o se en s ains o A. nige based on sequencing o 1-kb a iable egions om ou ch omosomes. The ee was oo ed o he sequence ob ained om Aspe gillus ca bona ius IMI 388653. Clades based on he exo-me abolomic g oupings o Table 2 a e shown. Fo bo h ees, boo s ap alues abo e 80% o he 1000 pe o med ei e a ions a e shown. Table 3. S a is ics o ba ch cul i a ions o A. nige ATCC 1015 and A. nige CBS 513.88 ATCC 1015 CBS 513.88 mRNA (h) 24.5 61.2 40.2 64.2 Biomass (g/L) 5.0 60.1 4.0 60.5 m max (h 1 ) 0.17 60.01 0.15 60.01 Glucose (g/L) 10.0 60.6 9.5 60.4 Glyce ol (g/L) 0.09 60.02 0.27 60.03 Y xs (Cmol/Cmol) a 0.67 60.03 0.55 60.03 GlaA (g/L) b 0.24 60.08 1.57 60.23 Ci ic acid (g/L) 0.10 60.12 0.14 60.03 Fe men a ions we e pe o med in biological iplica es o each s ain. Values a e p esen ed as a e age 6s anda d de ia ion. m max and Y xs a e gene al s a is ics o he e men a ions, while he emaining alues a e speci ic o he ime o sampling o ansc ip ion analysis (see mRNA ow). GlaA is glucoamylase A. a Biomass was con e ed o Cmol using 24.9 g o biomass/Cmol (Nielsen e al. 2003). b One uni o glucoamylase can be assumed o co espond o 25 mgo p o ein (PESL p o ein assay; Boeh inge Mannheim). Ande sen e al. 890 Genome Resea ch www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om In iguingly, analysis o he amino acid composi ion o he glu- coamylase A p o ein (Supplemen al Fig. 9) e ealed ha GlaA is a ypical in ha i has a highe con en o speci ically yp ophan, h eonine, and se ine han 90% o he p edic ed genes o CBS 513.88. Fo all h ee amino acids, he con en is almos wice as high as he a e age in he composi ion o o al p o ein (Ch is ias e al. 1975). We ini ially hough ha his was due o a ameshi mu a- ion iden i ied in he gene o he gene al amino acid– egula ing ansc ip ion ac o (c oss-pa hway con ol p o ein) CpcA (Sup- plemen al Table 5), bu esequencing o his gene showed his ameshi o be a sequencing e o . The p esence o wo sense mu a ions was con i med and is cu en ly being in es iga ed. To u he suppo ha he inc eased p oduc ion o GlaA is signi ican enough o a ec amino acid biosyn hesis, we used a genome-scale me abolic model o A. nige (Ande sen e al. 2008a) o model he wo s ains unde he g ow h condi ions used (Table 3). The compu ed luxes (Supplemen al Table 14) show ha o all h ee amino acids, he luxes h ough he biosyn he ic pa hways mus be a leas wice as high in CBS 513.88 compa ed o ATCC 1015 o suppo he inc eased GlaA p oduc ion, hus co espond- ing well wi h he ansc ip ome esul s. Fo a b oade analysis o ends e ealed by he ansc ip ome p o iles, a GO e m o e - ep esen a ion analysis was conduc ed on he genes signi ican ly up- egula ed in ei he s ain (Supple- men al Table 15). The analysis con i med ha ai s ele an o p o ein p oduc ion—such as amino acid biosyn hesis and RNA aminoacyla ion—appea o be highly signi ican o CBS 513.88. Fo ATCC 1015, GO biological unc ions o elec on anspo (adj. p=2.7 310 5 ), ca bohyd a e anspo (adj. p=6.8 310 3 ), and o ganic acid anspo (adj. p=0.035) we e signi ican . An examina ion o exp ession o indi idual genes showed ha glaA had signi ican ly inc eased exp ession in CBS 513.88 (adj. p=84 310 6 ), bu he old change (3.2) was lowe han he in- c ease in enzyme ac i i y (six old) (Table 3). In e es ingly, all iden- i ied RNA-aminoacyl syn hases we e ound o be wo old o six old up- egula ed in CBS 513.88. Mapping o gene exp ession o he genome iden i ies seconda y me aboli e clus e ac i i ies and unde pins he whole-a m in e sion in ch omosome VI To examine di e ences in gene exp ession be ween he wo s ains ela i e o ch omosome posi ions, he log 2 - a ios o he gene ex- p ession indices om he ansc ip ome analysis we e mapped o he syn eny diag ams o Figu e 1 (Supplemen al Fig. 10). The analysis o his mapping iden i ied a numbe o ea- u es. Fi s , six egions no ound in CBS 513.88 con ain genes wi h uni o mly highe exp ession in ATCC 1015, suppo ing he absence o hese egions in CBS 513.88. Second, wo ac i e sec- onda y me aboli e clus e s we e iden i ied on Ch VIII (con ains a polyke ide syn hase [ID: 211885] ha is unique o ATCC 1015) and Ch I (NRPS clus e , ound in bo h s ains [NRPS ID: 43555/ An09g00520], bu appea s only o be ac i e in CBS 513.88). Thi d, he in e sion o he en i e igh a m o Ch VI (Fig. 1) is u he suppo ed. The elome ic posi ion e ec , which de ines de- c eased exp ession in he icini y o elome es, has been de- sc ibed o Saccha omyces ce e isiae (Go schling e al. 1990). Thus, i an a m has been in e ed, educed exp ession should be ound a opposi e ends in ATCC 1015 and CBS 513.88. This is indeed e lec ed in he log 2 - a io on he igh a m o Ch VI (Supplemen al Fig. 10). Discussion In his s udy, we p o ide and compa e he genomes o wo s ains o A. nige . These wo s ains ha e di e en pheno ypes: one, he p edecesso o e icien enzyme-p oducing s ains ha ing un- de gone some le el o mu agenesis and selec ion, and he o he a wild- ype pa en s ain o high ci ic-acid-p oducing s ains. This makes he compa ison in e es ing bo h in e ms o genomic e- sea ch and indus ial applica ions. We ha e suppo ed he con- clusions o ou compa ison wi h u he expe imen s, allowing us o p opose new hypo heses and conclusions wi hin h ee main a eas: (1) gene ic di e si y o he A. nige g oup, (2) ho izon al gene ans e in ungi, and (3) ungal bio echnology (discussed sepa- a ely below). The di e si y o he wo s ains was explo ed h ough a mul i- le el compa ison (DNA, ch omosome, gene, and p o ein) be ween bo h genome a chi ec u es and was suppo ed by mul iple ypes o expe imen al wo k. In e es ingly, we obse e a ema kable simi- la i y a he le el o ch omosome, gene o de , and gene iden i y, bu also no able di e si y was de ec ed and u he explo ed, namely, dis inc egions wi h high le els o SNPs, a 0.8-Mb di - e ence in genome size, se e al la ge inse ion/dele ions o up o 200 kb, di e en ansposon popula ions, a majo ansloca ion/ in e sion, he in e sion o an en i e ch omosomal a m, and a la ge se o unique genes in bo h species (see poin s 1–5 below): 1. Abou 400–500 unique genes we e iden i ied o each s ain, mos o which a e e enly dis ibu ed o e he ch omosomes. This indica es s ain e olu ion by a high equency o loss and/o up ake o gene agmen s. In e es ingly, he opposi e is seen in wo s ains o he pa hogenic Aspe gillus umiga us, whe e 80% o he s ain-speci ic genes (143 and 218, espec- i ely) a e ound in a ew, la ge isola e-speci ic genomic islands (Fedo o a e al. 2008). Thus, his in a-species inc eased e- quency o ans e /loss o gene ic elemen s so a seems o be speci ic o he A. nige g oup. Mo e genome sequences may p o e i o be p esen in o he Aspe gilli as well. 2. The whole-a m in e sion on Ch VI is a ema kable e en . O e he cha ac e ized Aspe gilli sequenced genomes, mos desc ibed in e sions we e isola ed as mu an s, wi h a b eakpoin in a gene, leading o a pheno ype. Pel e al. (2007) epo ed high syn eny be ween he cen ome ic pa s o he a ms o A. nige CBS 513.88 and Aspe gillus nidulans FGSC A4. E en so, in his case, i is suppo ed by he genome sequence, he p esence o elome ic sequences, and a de ec able elome ic posi ioning e ec . F om Figu e 2 in Galagan e al. 2005, i is also clea ha cen ome ic in e sions mus ha e occu ed in he genealogy o he common ances o o A. nidulans,A. o yzae, and A. umiga us. 3. The la ge ansloca ion/in e sion e en o Ch III and Ch VII explains he disc epancies in ch omosome size epo ed by Pel e al. (2007) be ween s ain N400 (Ve does e al. 1994) and calcula ed sizes o Ch III and Ch VII o CBS 513.88. This ac and ha he b eakpoin s a e wi hin wo o he wise in ac genes indica e ha he e en occu ed a e he b anching o s ains N400 and NRRL 3122, possibly in he mu agenesis o he p e- decesso o CBS 513.88. 4. The p esence and unc ionali y o ansposons a e quali a i ely and quan i a i ely less complex in he genome o ATCC 1015 han in CBS 513.88 (Supplemen al Table 11). Such a di e en dis ibu ion o ansposons be ween s ains has been obse ed be o e (B aumann e al. 2008) and was desc ibed o be inducible by mu agenesis and o he s ess-induced condi ions (S and and Aspe gillus nige s ain e olu ion Genome Resea ch 891 www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om McDonald 1985). Howe e , he numbe and scale o di e ences make a ecen mu agenesis p og am unlikely o be he basis o he mul iple HGT e en s. Fu he mo e, he de ec ion o epea sequences in a numbe o DNA egions was accompanied by s ain-speci ic di e ences. The e o e, we sugges ha he ansposon popula ions ha e played a signi ican ole in s ain e olu ion. 5. Finally, he phylogene ic analysis (Fig. 3B) con i ms he high gene ic a ia ion desc ibed o wo s ains o be gene al wi hin he A. nige g oup and no he esul o ei he CBS 513.88 o ATCC 1015 being a ypical. This is again suppo ed by he exo- me abolomic p o iles o he 11 examined A. nige s ains (Table 2). While he g ouping o he exo-me aboli es does no accu- a ely e lec he cladog ams in Figu e 3, we see his as con i - ma ion o he high gene ic a ia ion in he A. nige g oup, as he p oduc ion o a gi en exo-me aboli e may be changed by a single genomic e en . Thus, we belie e ha he di e si y o he wo genome-sequenced s ains is common o he A. nige g oup, which seems o ha e highly dynamic genomes. The p esence/absence o HGT in ungi has caused a lo o discus- sion (Galagan e al. 2005; Keeling and Palme 2008; Khaldi and Wol e 2008; Khaldi e al. 2008). In his s udy, we ha e shown HGT o be a mos likely o igin o wo alpha-amylase genes in CBS 513.88 ha migh ha e been ans e ed o A. nige om ano he species, possibly A. o yzae. The HGT mus ha e occu ed be o e he sepa- a ion o CBS 513.88 and ATCC 1015. The amylase genes a e no ound in he ATCC 1015 s ain (also suppo ed by gDNA hyb id- iza ion), bu hey a e in CBS 513.88 lanked by a ansposon, which is ound bo h in A. o yzae RIB40 and in a unca ed o m in ATCC 1015. Wi h he e idence o HGT in o Aspe gillus cla a us om a Magnapo he- ela ed dono , p esen ed by Khaldi e al. (2008), HGT is now iden i ied in wo sepa a e cases wi h dis an ly ela ed species and may hus be seen as a gene al phenomenon in ilamen ous ungi. The ini ial eason o compa ing he wo s ains has been o gain insigh in he gene ic basis o he wo indus ially ele an pheno ypes. In ci ic-acid-p oducing ATCC 1015, we a e in igued o see highe exp ession o elemen s om he elec on anspo , ca bohyd a e anspo , and o ganic acid anspo . These ac o s a e known o be in ol ed in ob aining high ci ic acid yields. Highe exp ession le els e en hough ci ic acid p oduc ion is no no ably highe (see discussion below) sugges s ha hese ai s may ha e been con ibu ing ac o s o he o iginal selec ion o ATCC 1015 o ci ic acid p oduc ion. Fo he GlaA-p oducing s ain (CBS 513.88), we obse e sys emic changes: Mu a ions in egula o y genes (e.g., cpcA), highe exp ession o glaA i sel , and up- egula ion o all iden i ied RNA-syn hases may all con ibu e o a mo e e i- cien enzyme p oduce . We also p esen he hypo hesis ha in- c eased p oduc ion o he amino acids se ine, h eonine, and yp- ophan may be equi ed o e icien GlaA p oduc ion, as hese a e o e - ep esen ed in GlaA. While we ha e iden i ied mul iple possible con ibu o s o he e icien amylase p oduc ion o CBS 513.88, we ha e only seen a ew ac o s associa ed wi h ci ic acid p oduc ion. We p opose mul iple easons o his: (1) CBS 513.88 was selec ed o inc eased GlaA p oduc ion, while ATCC 1015 is a wild- ype s ain wi h only modes ci ic acid p oduc ion (compa ed o cu en yields). (2) The medium used o he ansc ip ome analysis is no op imized o ci ic acid p oduc ion, as his would no gi e he dispe sed g ow h necessa y o ep esen a i e sampling (Ka a a and Kubicek 2003). (3) P o ein syn hesis is a complex p ocess, wi h mo e ac o s in- ol ed han in he p oduc ion and sec e ion o a simple o ganic acid. Since mo e han 6000 genes di e a he amino acid le el be ween he wo s ains, i would be unlikely no o ind many di e ences in ol ed in p o ein p oduc ion. Fo his eason, we ha e pu ou emphasis on genes ound in mul iple ypes o anal- yses, e ec s in en i e pa hways, and ai s (GO) ha a e ound o be s a is ically o e - ep esen ed, which allows o obus conclusions. In conclusion, ou esul s es ablish a i m compa a i e geno- mics ounda ion on which o build and es hypo heses ega ding enzyme p oduc ion, o ganic acid p oduc ion, and di e si y wi hin a ‘‘species g oup.’’ Me hods ATCC 1015 genome assembly The sequence eads we e de i ed om ou whole-genome sho - gun (WGS) lib a ies: one wi h an inse size o 2–3 kb, wo wi h an inse size o 6–8 kb, and one wi h an inse size o 35–40 kb. The eads we e sc eened o ec o using c oss_ma ch and hen im- med o ec o sequence and quali y (J Chapman, N Pu nam, I Ho, and D Rokhsa , unpubl.). Reads sho e han 100 bases a e im- ming we e excluded. The inal da a se included: 28,551 o 2–3-kb eads, con aining 21.5 Mb o sequence; 160,479 o 6–8-kb eads, con aining 123 Mb o sequence; and 38,651 o 35–40-kb eads, con aining 23.8 Mb o sequence. The da a we e assembled using elease 2.7 o Jazz, a WGS as- semble de eloped a he JGI (Apa icio e al. 2002; J Chapman, N Pu nam, I Ho, and D Rokhsa , unpubl.). The genome size and se- quence dep h we e ini ially es ima ed o be 36 Mb and 8.0, e- spec i ely. A e emo al o sho (<1 kb) and edundan sca olds (<5 kb wi h 80% o mo e o he leng h ma ching a sca old >5 kb), he assembly included 43.7 Mb o sca old sequence wi h 8.2 Mb (18.9%) o gaps in 350 sca olds, wi h hal o he sca old sequence con ained in he eigh la ges sca olds o 1.81 Mb o longe . The sequence dep h de i ed om he assembly was 7.88 60.05. To es ima e he comple eness o he assembly, a se o 50,001 ESTs was BLAT-aligned o he unassembled immed eads, as well as he assembly i sel . Fo y- h ee housand h ee hund ed and wen y- h ee ESTs (86.6%) we e >80% co e ed by he unassembled da a; 43,978 (88.0%) we e >50% co e ed; and 44,206 (88.4%) we e >20% co e ed. By way o compa ison, 48,798 ESTs (97.6%) showed hi s o he assembly. O ien a ion o he ch omosome a ms was based on eigh a ailable elome e sequences, he supe con ig o ien a ion p oposed by Pel e al. (2007), and esea ch on linkage g oups in A. nige (Bos e al. 1989; Debe se al.1989, 1990a,b; Swa e al. 1992; Ve does e al. 1994). ATCC 1015 genome inishing To pe o m genome imp o emen on A. nige ATCC 1015, ini ial ead layou s om he whole-genome sho gun assembly we e con e ed in o he ph ed/ph ap/consed pipeline (Go don e al. 1998). Following manual inspec ion o he assembled sequences, inishing was pe o med by esequencing plasmid subclones and by walking on plasmid subclones o osmids using cus om p ime s. All inishing eac ions we e pe o med wi h 4:1 BigDye o dGTP BigDye e mina o chemis y (Applied Biosys ems). Repea s in he sequence we e esol ed by ansposon-hopping 8-kb plasmid clones. Fosmid clones we e sho gun sequenced and inished o ill la ge gaps, esol e la ge epea s, o o esol e ch omosome dupli- ca ions and ex end in o ch omosome elome e egions. The esul ing 24 inished sca olds we e o ien a ed whe e possible in o ch omosome s uc u es using compa isons o Pel e al. (2007) and elome e posi ions. The imp o ed genome consis s o Ande sen e al. 892 Genome Resea ch www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om 34,853,277 bp wi h an es ima ed e o a e o less han 1 e o in 100,000 bp. ATCC 1015 au oma ic anno a ion Gene models in he genome o A. nige we e p edic ed using Fgenesh (Salamo and Solo ye 2000), Fgenesh+(Salamo and Solo ye 2000), and Genewise (Bi ney and Du bin 2000) in eg a ed in o he JGI anno a ion pipeline. Fgenesh was ained on a se o mo e han 2000 pu a i e ull-leng h ansc ip s de i ed om clus e ed A. nige ESTs and eliable homology-based gene models o show 81% sen- si i i y and 81% speci ici y o p edic ions on a es se . Homology- based gene p edic o s we e seeded wi h BLASTX alignmen s o p o eins om he NCBI non edundan se o p o eins. Thi y-one housand i e hund ed and se en y-eigh A. nige ESTs we e se- quenced using Sange echnology and we e ei he di ec ly mapped o genomic sequence when he ESTs included pu a i e ull-leng h (FL) genes o used o ex end p edic ed gene models in o FL genes by adding 59and/o 39UTRs. In addi ion, 386,515 ESTs wi h an a e age leng h o 104 n we e sequenced wi h 454 Li e Sciences (Roche) GS20 sequence s and used in alida ion o p edic ed gene models. Since mul iple gene models we e gene a ed o each locus, a single ep esen a i e model was chosen based on homology and EST suppo and used o u he analysis. All p edic ed gene models we e unc ionally anno a ed by sequence simila i y o anno a ed genes om he NCBI non- edundan se and o he specialized da abases (such as KEGG) (Kanehisa e al. 2002, 2004) using BLAST and ha dwa e accele a ed double-a ine Smi h-Wa e man alignmen s (h p://www. imelogic. com). Func ional and s uc u al domains we e p edic ed in p o ein sequences using he In e P o so wa e (Zdobno and Apweile 2001). All genes we e also anno a ed acco ding o Gene On ology (Ashbu ne e al. 2000; Ha is e al. 2004), euka yo ic o hologous g oups (KOGs) (Koonin e al. 2004), and KEGG me abolic pa hways (Kanehisa e al. 2004). ATCC 1015 sequence a ailabili y A. nige assemblies, anno a ions, and analyzes a e a ailable h ough he in e ac i e JGI Genome Po al a h p://genome.jgi- ps .o g/Aspni5/Aspni51.home.h ml. Genome assemblies oge he wi h p edic ed gene models and anno a ions we e also deposi ed a NCBI unde he p ojec accession numbe ACJE00000000. S ains The ollowing A. nige s ains we e used o expe imen s (de- posi ion numbe s in di e en collec ions a e gi en as well): CBS 513.88 =FGSC A1513 =IBT 29270, ATCC 1015 =IBT 28639 =NCTC 3858a =NRRL 1278 =NRRL 350 =NRRL 511 =NRRL 328 =Thom 167 =CBS 113.46 =ATCC 10582 =IMI 031821 =LSBH Ac4 =Thom 3528.7, NRRL 3 =IBT 28539 =MUCL 30480 =DSM 2466 =CECT 2088 =VTT D-85240 =NRRL 566 =WB3 =ATCC 9029 =N400 = CBS 120.49 =IMI 041876, NRRL 326 =IBT 27876 =WB 326 =CBS 554.65 =ATCC 16888 =IHEM 3415 =IMI 050566 =Thom 2766 = JCM 10254 =IFO 33023 (ex annin-gallic acid e men a ion; A. nige neo ype) (Kozakiewicz e al. 1992) NRRL 328 =IBT 27878 = NRRL 350 =IBT 27877 =CBS 113.46, NRRL 337 =CBS 126.48 = ATCC 10254 =DSM 734 =IFO 6428 =IMI 015954 =WB 337, NRRL 363 =IBT 3617 =IBT 5764 =CBS 126.49 =ATCC 10698 =IFO 6648, NRRL 511 =IBT 27875, NRRL 1278 =IBT 27872, NRRL 2270 =IBT 26391 =ATCC 11414 =VTT D-77050 =IMI 075353 =A60 =S.M. ma in A-1-233 =Wisconsin 72-4, de i ed om ATCC 1015, and NRRL 3122 =IBT 23538 =ATCC 22343 =CBS 115989 ( his s ain is a wild- ype p ogeni o o CBS 513.88). S ain his o ies o ATCC 1015, ATCC 9029, and NRRL 3122 a e e iewed by Bake (2006). Exo-me aboli e p o iling A. nige s ains we e inocula ed on Czapek yeas au olysa e (CYA), yeas ex ac suc ose (YES) aga , and CYA wi h 5% NaCl aga (CYAS aga ). Fo medium composi ion, see F is ad and Samson (2004). All s ains we e h ee-poin inocula ed on hese media and incuba ed a 25°C in da kness o a week, a e which i e plugs (6 mm di- ame e ) along a diame e o a ungal colony we e cu ou and ex ac ed (Smedsgaa d 1997). The ex ac s we e analyzed by HPLC- DAD luo escence (F is ad and Th ane 1987; Smedsgaa d 1997) and by HPLC-HR-MS (Nielsen and Smedsgaa d 2003; F is ad e al. 2007b). The seconda y me aboli es we e iden i ied by compa ison wi h au hen ic s anda ds ( umonisin B 2 , och a oxin A, nig agillin, ko anin, and o landin) and by UV spec a and high- esolu ion mass spec a using elec osp ay ioniza ion. CBS 513.88 gap closu e The nea -comple e ATCC 1015 genome sequence was used o e i y con ig o de and o ien a ion and o es ima e gap sequence leng h be ween con igs in CBS 513.88. Gap- lanking PCR p ime s (20-me s) gi ing ise o PCR p oduc s wi h a minimal o e lap o 100 bp we e au oma ically designed wi h p ime -3 (Rozen and Skale sky 2000) using cus om sc ip s. PCR p oduc s o expec ed size we e pu i ied using a QIAquick PCR Pu i ica ion Ki (QIAGEN) and sequenced by Baseclea . The upda ed sequence o A. nige CBS 513.88 is a ailable om EMBL (h p://www.ebi.ac.uk/embl/) un- de accession nos. AM269948–AM270415. Sequencing o a iable egions Regions we e ampli ied using s anda d PCR echniques wi h he ou ollowing p ime pai s ( he name desc ibes ch omosome numbe and di ec ion): (1) Ch 02-Fwd: 59-GGACACTGCTTGATG TGATG-39, Ch 02-Re : 59-GAGAGACGTACGAAAGGTTG-39; (2) Ch 04-Fwd: 59-CGATCTGCGACCAGGA-39, Ch 04-Re : 59-CATAA CGGATTCGTCGCTG-39; (3) Ch 06-Fwd: 59-CTTGAAGGCGTTGA GGTC-39,Ch 06-Re :59-GCGAGTATGTGGCTAACATC-39; (4) Ch 08- Fwd: 59-GGTATGTCACATTCCRTCCA-39, Ch 08-Re : 59-GCTTGC AGTGAGCAAGGA-39. The sequences on Ch II, Ch VI, and Ch VIII o e lap wi h p edic ed genes. The PCR p oduc s we e pu i ied us- ing a QIAquick PCR Pu i ica ion Ki (QIAGEN) and sequenced by Agencou Bioscience Co po a ion (GenBank accession numbe GU296708–GU296739). Sequencing o be a- ubulin Ampli ica ion o pa o he be a- ubulin gene was pe o med using he p ime s B 2a (GGTAACCAAATCGGTGCTGCTTTC) and B 2b (ACCCTCAGTGTAGTGACCCTTGGC) (Glass and Donaldson 1995). Bo h s ands o he PCR agmen s we e sequenced wi h he ABI P ism Big DyeTM Te mina o .3.0 Ready Reac ion Cycle sequenc- ing ki . Samples we e analyzed on an ABI PRISM 3700 Gene ic An- alyze , and con igs we e assembled using he o wa d and e e se sequences wi h he p og am SeqMan om he Lase Gene package (GenBank accession numbe s GU296686–GU296707). Calcula ion o phylogene ic ee Sequences we e aligned using Clus alX and immed o he i s common base a bo h ends be o e making he inal alignmen . Fo he ee o Figu e 3B, ou immed sequences we e joined o each s ain be o e making he inal alignmen . T ee calcula ions we e pe o med using T eeCon ( an de Pee and de Wach e 1994). Dis ances we e es ima ed using he Jukes and Can o algo- i hm aking inse ions and dele ions in o accoun . Topology was Aspe gillus nige s ain e olu ion Genome Resea ch 893 www.genome.o g Cold Sp ing Ha bo Labo a o y P ess on Ap il 26, 2016 - Published by genome.cshlp.o gDownloaded om