Determinig the Specific Status of the Iberian Sturgeons by Means Genetic Analyses of Old Specimens

Ad ances in Bioscience and Bio echnology, 2010, 1, 171-179 ABB doi:10.4236/abb.2010.13024 Published Online Augus 2010 (h p://www.SciRP.o g/jou nal/abb/) Published Online June 2010 in SciRes. h p://www.sci p.o g/jou nal/abb De e mining he speci ic s a us o he Ibe ian s u geons by means gene ic analyses o old specimens F ancisca Robles1*, Belén Cano-Roldán1, Ca melo Ruiz Rejón1, Luís Ja ie Ma ínez-González2, Ma ía Jesús Ál a ez-Cube o2, José An onio Lo en e2, José An onio Riquelme Can al3, Ped o Aguayo de Hoyos4, Ja ie Ca asco Rus4, Miguel Co és Sánchez5, Ma ía Dolo es Simón Vallejo6, Manuel Ruiz Rejón1, Robe o de la He án1 1Depa amen o de Gené ica, Facul ad de Ciencias, Uni e sidad de G anada, G anada, Spain; 2Cen o P ize , Uni e sidad de G anada, Jun a de Andalucía de Genómica e In es igación Oncológica, Cen o de In es igación Biomédica, A . del Conocimien o s/n, A milla, G anada, Spain; 3Conseje ía de Cul u a, Jun a de Andalucía, Se illa, Spain; 4Depa amen o de P ehis o ia y A queología. Facul ad de Filoso ía y Le as, Uni e sidad de G anada, G anada, Spain; 5Faculdade de Ciências Humanas e Sociais, Uni e sidade do Alga e, Fa o, Po ugal; 6Fundación Cue a de Ne ja, Malaga, Spain. Email: obles@ug .es Recei ed 5 Ap il 2010; e ised 22 Ap il 2010; accep ed 11 May 2010. ABSTRACT To cla i y he species s a us o s u geon om i e s o he Ibe ian Peninsula, eigh molecula ma ke s (4 nuclea and 4 mi ochond ial) ha e been analysed in di e en specimens om his o ical museum samples and p ehis o ic samples om a chaeological si es. These analyses indica e ha one o hese specimens (UGP cap u ed in he Guadalqui i Ri e in he 19 h cen u y) is A. s u io, based on all he eigh molecula ma ke s, ou o hem used om he i s ime in his s udy. In p e ious analyses based on 5 gene ic ma k- e s, ou g oup assigned wo specimens cap u ed in his i e in he 1970-80s (EBD8173 and EBD8401) o he species A. nacca ii, sugges ing he p esence o his species in he Ibe ian Peninsula. In his wo k, his conclusion is d awn a e success ully ob aining a mi ochond ial ma ke in a e y old scu e om a p e- his o ic si e (Acinipo, abou 1500 BC, om he Gua- dalqui i Ri e basin). On he o he hand, in he specimen EBD8174 cap u ed in he Guadalqui i in 1975, we ha e ob ained wo new mi ochond ial ma ke s con i ming ha i can be conside ed A. s u- io o all he mi ochond ial ma ke s, bu nuclea ones iden i y i as A. nacca ii. Finally, wo e y old samples (Ne ja E-VI and Ne ja N/62-63) we e no success ully cha ac e ized by any molecula ma ke s. Some aspec s and consequences o ou esul s a e discussed, such as he o igin o he “mosaic” speci- men EBD8174 and, abo e all, he na i e s a us o A. nacca ii in his o ic and p ehis o ic imes in he sou he n Ibe ian Peninsula. Keywo ds: Ibe ian S u geons; A. nacca ii; A. s u io; Ancien DNA; Gene ic Iden i ica ion; Molecula Ma ke s 1. INTRODUCTION The iden i ica ion o s u geon species inhabi ing a ce ain geog aphical egion has in e es no only om he basic scien i ic s andpoin bu also o he conse - a ion and eco e y o his g oup o ancien ish so impo an om he e olu iona y as well as he eco- nomic pe spec i e [1]. Thus, he speci ic s a us o he Ibe ian Peninsula s u geons is a deba able ma e be- cause, bea ing in mind ha hey a e cu en ly almos ex inc , i becomes necessa y o analyse old museum specimens and e en a chaeological emains. In his sense, du ing he second hal o he 20 h cen u y, i was adi ionally conside ed ha in he seas and sou he n i e s o Wes e n Eu ope and, mo e con- c e ely, in he sou he n Ibe ian Peninsula, he e was only one s u geon species, Acipense s u io (Linnaeus 1758). Howe e , om end o las cen u y, he idea a ose ha un il ecen ly a leas wo species could ha e coexis ed. In ac , based on mo phologic and mainly gene ic s udies (including mi ochond ial and nuclea ma ke s) o old museum specimens o s u geons om his egion, i has been shown [2-4] ha , in addi ion o specimens belonging o A. s u io, i is possible o ind specimens belonging o ano he species, A. nacca ii (Bonapa e 1836). This si ua ion had been p e iously p oposed by di e en au ho s who his o ically, al- hough o go en, ci ed A. nacca ii in he Ibe ian Pen- F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 172 insula [5-13]. All hese esul s would indica e ha , in ecen his o ical imes, his la e species (A. nacca ii), un il now conside ed only endemic o he Ad ia ic e- gion, would also ha e li ed in i e s o he Ibe ian Peninsula. Howe e , hese esul s ha e been ques ioned pa ly by o he s udies, which ha e no p o ided da a o in- dica e he p esence o he species A. nacca ii in his egion [14-16]. Finally, ecen ly Ludwig e al. [17] s udying he mi ochond ial egion con ol in i e scu es o s u geons om a chaeological loca ions o his o ical imes in he Ibe ian Peninsula, ha e ecen ly ound only mi ochond ial haplo ypes o A. s u io. The e o e, i becomes necessa y o con inue del ing in o he analysis o his issue. In his wo k, ou g oup, which has con ibu ed o opening his new ision o he dis ibu ion o s u geons in Sou he n Eu ope (i.e. he coexis ence o A.nacca ii wi h A. s u io), analyses and discusses he a emp s o ob ain eigh molecula ma ke s (mi ochond ial and nuclea ) in se en old specimens o his o ic and p e- his o ic imes in sou he n Spain. These molecula ma ke s a e compa ed in se e al s u geon species. Thus, he esul s p e iously epo ed by ou g oup ha e been co obo a ed in ou his o ical specimens. In addi ion, we ha e ied o cla i y he speci ic s a us o h ee new s u geon samples om a chaeological si es. Emphasis is placed mainly on he posi i e esul s o one o hese samples, in a scu e o a e y old specimen da ing om 1500 BC, which again e i ies he p es- ence o he species A. nacca ii in his egion. 2. MATERIALS AND METHODS 2.1. Samples In his wo k, DNA was ex ac ed om se en old s u - geon specimens om he sou he n Ibe ian Peninsula. Fou o he specimens analysed had been cap u ed in he Guadalqui i Ri e , EBD8173, EBD8401, EBD8174 and UGP. Th ee o hem (labelled EBD), cap u ed in he 1970-80s, a e conse ed in he Biological S a ion o Doñana (Spain). The samples EBD8173 and EBD8401 a e p ese ed in e hanol, whe eas he EBD8174 is a d y skin. The ou h sample (labelled UGP) is a skin con- se ed in he Depa men o Biology Animal o he Uni- e si y o G anada and was also cap u ed in he Gua- dalqui i Ri e (19 h cen u y). Addi ionally, h ee p ehis o ic samples a e analysed o i s ime. One o hem co esponds o a scu e om 1500 BC which was ound in he Acinipo a chaeological deposi (Ronda, Malaga, Spain) (Figu e 1). The a chae- ological deposi o Ronda la Vieja (called Acinipo, he name o he Roman ci y buil on his si e; [18]) is loca ed in he dep ession o Ronda, 20 km om he ci y. The si e Figu e 1. Scu e da ed in 1500 BC ound in he a chaeological deposi o Acinipo (Ronda, Malaga, Spain). is si ua ed on a la ge limes one pla eau, which p o ides a s a egic iew o he su ounding e i o y and p o ides communica ion wi h o he a eas, including he coun y- side o he Guadalqui i Ri e . The bony sample o s u geon analysed co esponds o he a chaeological phase Acinipo III [19], p io o he Phoenician coloniza- ion a ound he second hal o he II millennium B.C. Al hough i is di icul o assign i s o igin o he Gua- dalqui i Ri e , he da es and he zone whe e i has been ound would indica e i s o igin om his i e . Finally, an a emp was made o ex ac DNA and ampli y he di e en molecula ma ke s om wo e y old scu es o s u geons ound a ano he p ehis o ic deposi (Ca e o Ne ja, Malaga, Spain). The Ca e o Ne ja has a long ich hyoa chaeological eco d o he exca a ions made basically in he oom o he Ves íbulo [20] on he s a um VII (abou 12,000 yea s old). This le el is co ela ed wi h Magdalenian occupa ion in he ca e [21]. 2.2. DNA Ex ac ion The ex ac ion and pu i ica ion o DNA was ca ied ou using ancien DNA echniques and acco ding o he p o- ocol desc ibed in Ma ínez-Espín e al. [22]. The i s s ep consis ed o cleaning he issue samples in a poly- me hac yla e (PMMA) box. A minia u e D emel d ill was used o elimina e any pollu ing agen s adhe ing o he su ace. Then, he issue samples we e pul e ized in liquid ni ogen using a F eeze Mill. A e pul e iza ion, F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 173 he powde ed sample was ans e ed o a s e ile 15 ml conical polyp opylene ube. To imp o e DNA eco e y, in olde samples ( he scu e om Acinipo and he wo scu es om Ne ja), we made some changes in he p o ocols. Fo hese h ee samples, a p o ocol was adap ed o demine aliza ion o skele al emains equen ly used in mommies and his o ical iden- i ica ion [23,24]. To minimize he possibili y o con- amina ion by con empo a y DNA o ex aneous sou ces, hese samples we e ex ac ed in he minimal-human- emains labo a o y, whe e an animal sample had ne e be o e been ex ac ed. He e, possible con amina ion was elimina ed om he old samples. Only one specimen was cleaned and p ocessed a he same ime and a nega- i e con ol was included wi h he analysis o each specimen. A e adding demine aliza ion bu e , he samples we e incuba ed on an o bi al shake a 56ºC o 20-30 h. The ubes we e angled du ing agi a ion o en- su e ho ough mixing. A he beginning o he ex ac ion, we i s added 50 µl o p o einase K (20 mg/ml) and 25 µl again 18 h la e . The ex ac s we e pu i ied using s e - ile wa e washes in Mic ocon YM-30 Millipo e cen- i ugal il e uni s; in he o he samples, Mic ocon YM-100 was used. As a inal poin , he concen a o was disca ded, and 200 µl o he pu i ied DNA we e ob ained. In his case, many inhibi o s we e also ob ained owing o he ac ha issue is adso bed in o a mine al ma ix, a e he dea h o he animal. The ollowing s ep was he pu i ica ion wi h he GENECLEAN® (BIO 101) o An- cien DNA Ki (using he ecommended p o ocol). To gua an ee he absence o inhibi o , he Quan i ile ® ki o 7500 Real-Time PCR (Applied Biosys ems) was used. The In e nal Posi i e Con ol de ec o s indica ed he absence o PCR inhibi o in all samples. 2.3. Ampli ica ion, Cloning, and Sequencing o Molecula Ma ke s Fo each specimen an e o was made o cha ac e ize he ollowing gene ic ma ke s: 1) ou nuclea ma ke s co esponding o wo sa elli e-DNA amilies: he amily HindIII [25] and he amily Ps I [26]; non- ansc ibed sequences o 5S ibosomal gene (NTS) [27] and 230 base pai s om nuclea DNA lanking he mic osa elli e Aox-23 [28]. 2) ou mi ochond ial ma ke s co espond- ing o wo agmen s o he cy och ome b gene o 212 bp and 265 bp, espec i ely [29,30], one agmen o 210 bp co esponding o he mi ochond ial egion con ol, d-loop, [30], and one agmen o he 12S ibosomal gene o 139 bp [16]. In each case, he PCR eac ions we e ca ied ou wi h he ampli ica ion condi ions de- sc ibed in each o he e e ences. Each ma ke was cloned using he ec o TOPO TA (TOPO TA Cloning® ki PCR® 2.1) and we e used o ans o m he cells DH5α o E. coli, acco ding o he supplie ecommenda ions (In i ogen Ca lsbad, CA, USA). Recombinan plasmids we e sequenced on bo h s ands using Big Dye Te mina o Cycle Sequencing Ki (Applied Biosys ems) and T7 and M13 p ime s in an ABI P ims 3100-A an Gene ic Analyze DNA Se- quence (Applied Biosys ems). 2.4. Sequence Analysis Mul iples alignmen s o sequences ob ained om he samples and e e ence sequences om GenBank da a- base we e pe o med using Clus alX so wa e [31]. Phylogene ic and molecula e olu iona y analyses we e conduc ed using MEGA e sion 4 [32]. Sequence di e - gences we e calcula ed acco ding o he Jukes-Can o me hod and dis ance ees p oduced by UPGMA [33] and he neighbou -joining me hod [34]. 3. RESULTS AND DISCUSSION The (Table 1) p esen s a summa y o all he se en s u - geon specimens om Ibe ian Peninsula analysed o di e en molecula ma ke s. This able includes he da a ob ained in his new s udy, comple ed wi h he da a om p e ious analyses made by us. The specimen UGP (Table 1) had p e iously been analysed o ou ma ke s (HindIII and Ps I sa elli e DNA amily, 212-bp cy och ome b and 12S mi ochon- d ial gene) and ca alogued as A. s u io [4]. Conside ing nuclea ma ke s, Ga ido-Ramos e al. [4] analysed his specimen o he HindIII sa elli e DNA amily, showing he lack o his epe i i e sequence in i s genome (i s absence is cha ac e is ic o he species A. s u io; [35]) In he same s udy, hese esea che s showed ha he se- quences co esponding o Ps I sa elli e DNA amily analysed o his specimen UGP we e g ouped, in a phylogene ic ee, oge he wi h he sequences o A. s u- io. Now, nine clones ha e been sequenced o non- an- sc ibed sequences o he 5S ibosomal nuclea genes (NTS), and hei sequences we e aligned wi h NTS i- bosomal genes om o he s u geon species (Figu e 2). Cha ac e is ic posi ions o A. s u io and A. oxy inchus a e p esen in he sequences isola ed om UGP. Thus, in a phylogene ic ee based in gene ics dis ances, all se- quences belonging o his sample we e g ouped oge he wi h he NTS sequences o A. s u io (Figu e 2). Addi ionally, a new nuclea ma ke Aox23 locus [28] was ampli ied in his specimen. The sequence ound, when compa ed wi h sequences o A. s u io and A. oxy- inchus aken om GenBank, p o ed simila o hose o A. s u io (da a no shown). F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 174 Table 1. Summa y o s u geon specimens analysed. ?--------? P o incial A chaeological Museum o Malaga, Spain Ca e o Ne ja (Malaga, Spain) Ne ja N/62-63 36/VII Caja 25 ?--------? P o incial A chaeological Museum o Malaga, Spain Ca e o Ne ja (Malaga, Spain) Ne ja E- VI 1963 A.nacca ii * FN256368 -------? Municipal A chaeological Museum o Ronda, Malaga, Spain A chaeological Deposi o Ronda la Vieja (Ronda, Malaga, Spain) Acinipo A.nacca ii (nuclea ) A.s u io (mi ochond ial) AJ543479 * FN256386 * FN256395 AJ543486- 5 AJ543474 o AJ543478 3 AJ543460 o AJ543462 AJ543463 A.s u io Doñana Biological S a ion, Se ille, Spain (s u ed) Guadalqui i i e , Alcalá del Río. Se ille, Spain (1975) EBD8174 A.nacca iiAJ543482 --AJ543485- 6 AJ543466 o AJ543471 6 AJ543452 o AJ543457 2 AJ543464, AJ543465 A.s u io Doñana Biological S a ion, Se ille, Spain (e hanol) Guadalqui i i e , Co ia del Río, Se ille, Spain (1981) EBD8401 A.nacca iiAJ543480--AJ543488- 2 AJ543472, AJ543473 4 AJ543450, AJ543451, AJ543458, AJ543459 Z50744 A.s u io Doñana Biological S a ion, Se ille, Spain (e hanol) Guadalqui i i e , Alcalá del Río. Se ille, Spain (1974) EBD8173 A.s u ioFN256367 * FN256381 * FN256392 FN256388 9* FN256399 o FN256407 9* FN256408 o FN256416 6 FN256417 o FN256422 npA.s u io Museum o he Animal Biology Depa men . Facul ad de Ciencias. Uni o G anada, Spain (s u ed) Guadalqui i i e (nine een h cen u y) UGP Molecula s a us 12S mi ochond ial gene d-loop 265-bp Cy b 212-bp Cy b Aox23NTSPs IHindIII T adi ional Classi ica ion Sampling loca ion (p ese a ion) P o enance (yea o ca ch) Specimen Molecula ma ke s, Numbe o sequences analysed and Accession Numbe ?--------? P o incial A chaeological Museum o Malaga, Spain Ca e o Ne ja (Malaga, Spain) Ne ja N/62-63 36/VII Caja 25 ?--------? P o incial A chaeological Museum o Malaga, Spain Ca e o Ne ja (Malaga, Spain) Ne ja E- VI 1963 A.nacca ii * FN256368 -------? Municipal A chaeological Museum o Ronda, Malaga, Spain A chaeological Deposi o Ronda la Vieja (Ronda, Malaga, Spain) Acinipo A.nacca ii (nuclea ) A.s u io (mi ochond ial) AJ543479 * FN256386 * FN256395 AJ543486- 5 AJ543474 o AJ543478 3 AJ543460 o AJ543462 AJ543463 A.s u io Doñana Biological S a ion, Se ille, Spain (s u ed) Guadalqui i i e , Alcalá del Río. Se ille, Spain (1975) EBD8174 A.nacca iiAJ543482 --AJ543485- 6 AJ543466 o AJ543471 6 AJ543452 o AJ543457 2 AJ543464, AJ543465 A.s u io Doñana Biological S a ion, Se ille, Spain (e hanol) Guadalqui i i e , Co ia del Río, Se ille, Spain (1981) EBD8401 A.nacca iiAJ543480--AJ543488- 2 AJ543472, AJ543473 4 AJ543450, AJ543451, AJ543458, AJ543459 Z50744 A.s u io Doñana Biological S a ion, Se ille, Spain (e hanol) Guadalqui i i e , Alcalá del Río. Se ille, Spain (1974) EBD8173 A.s u ioFN256367 * FN256381 * FN256392 FN256388 9* FN256399 o FN256407 9* FN256408 o FN256416 6 FN256417 o FN256422 npA.s u io Museum o he Animal Biology Depa men . Facul ad de Ciencias. Uni o G anada, Spain (s u ed) Guadalqui i i e (nine een h cen u y) UGP Molecula s a us 12S mi ochond ial gene d-loop 265-bp Cy b 212-bp Cy b Aox23NTSPs IHindIII T adi ional Classi ica ion Sampling loca ion (p ese a ion) P o enance (yea o ca ch) Specimen Molecula ma ke s, Numbe o sequences analysed and Accession Numbe Lis o s u geon specimens analysed, hei cu en speci ic s a us and he esul s o he ma ke s analysed in each specimen and he numbe o uni s sequenced (wi h hei accession numbe ) o each nuclea epe i i e ma ke o he numbe o mi ochond ial clones sequenced o each mi ochond ial ma ke . np: no p esen ; na: no ampli ied; he as e isk (*) shows he sequences ound in his s udy; ques ion ma k (?) indica es unknown T adi ional Classi ica ion and/o Molecula s a us. Wi h espec o mi ochond ial ma ke s, Ga ido- Ramos e al. [4] analysed in his specimen he agmen s o he mi ochond ial DNA 212-bp cy och ome b and 12S gene and conside ed UGP as A. s u io. In he p esen wo k, wo new mi ochond ial ma ke s ha e been ampli- ied o his sample (265-bp cy och ome b and d-loop). I was ound ha all diagnos ic posi ions o hese ma ke s co espond o he species A. s u io (Figu es 3(a) and (b)). The e o e, he esul s o eigh nuclea and mi ochon- d ial ma ke s con i m he classi ica ion o his sample (UGP) as A. s u io. This a i ma ion is no su p ising i we bea in mind, as men ioned in he In oduc ion, ha he species A. s u io has been b oadly desc ibed in mos o i e s o he Ibe ian Peninsula. On he o he hand, p e ious molecula analyses ca - ied ou by ou g oup in h ee samples om he Biologi- cal S a ion o Doñana (Table 1), iden i ied wo o hem, EBD8173 and EBD8401, as A. nacca ii, based bo h on he mi ochond ial and on he nuclea ma ke s [2-4]. Thus, he samples EBD8173 and EBD8401 ha e he HindIII sa elli e DNA amily in hei genome. This sa el- li e DNA, as commen ed abo e, is absen in he A. s u io genome [2]. The p esence o his epe i i e sequence means ha hese wo samples canno be assigned o A. s u io, he only species ha had p e iously been conside ed o li e in he i e s o he Ibe ian Peninsula. Addi ional esul s using he ma ke s Ps I sa elli e DNA, non- ansc ibed sequences o 5S ibosomal gene (Figu e 2), 212-bp cy- och ome b and 12S mi ochond ial gene (Figu es 3(a) and 4) con i med ha EBD8173 and EBD8401 belong o A. nacca ii [3,4]. Howe e , he sample EBD8174 (Table 1) is a special specimen om he gene ic pe spec i e. Fo all he nu- clea ma ke s analysed o da e, his sample EBD8174 canno be assigned o A. s u io bu o A. nacca ii. The p esence o HindIII sa elli e DNA amily and he ac ha all he sequences co esponding o he nuclea ma ke s ( he HindIII i sel and sa elli e Ps I and NTS) a e no g ouped wi h A. s u io bu wi h A. nacca ii a e indica i e o his ac [3,4]. Howe e , p e ious mi o- chond ial DNA s udies using 212-bp cy och ome b and 12S mi ochond ial gene DNA ma ke s [3,15,16], con- clude ha , in his specimen, mi ochond ial DNA ma ke s a e simila o A. s u io. Thus, he esul s o nuclea and mi ochond ial DNA a e con adic o y in his specimen because, he nuclea F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 175 NAC RUT E B D 8174-11 E B D 8174-29 STE BAE GUE E B D 8173-13 HUS E B D 8173-19 E B D 8401-30B E B D 8401-60 TRA E B D 8174-45 E B D 8401-30A E B D 8174-32 E B D 8174-20 E B D 8401-71 E B D 8401-21 E B D 8401-42 UGP45 OXY UGP62A UGP68A STU UGP43 UGP42 UGP61A UGP67A UGP40 UGP44 68 27 73 38 34 20 60 57 28 35 96 41 99 74 30 61 39 72 54 69 0.000.020.040.060.08 Figu e 2. UPGMA ee based on NTS sequences o 5S ibo- somal nuclea genes. UPGMA ee based on NTS sequences and Juckes Can o dis ances calcula ed in MEGA 4. The ee shows he close ela ionships be ween he 9 NTS sequences om UGP (▲) specimen and NTS sequences o A. s u io (STU AJ550044) and A. oxy inchus (OXY AJ555397), and be ween he 13 NTS sequences om he h ee EBD specimens -EBD8173 (■), EBD8174 (●) and EBD8401 (♦)- and NTS sequences o A. nacca ii (NAC AJ550039) and o he s u geon species as A. ansmon anus (TRA AJ555360), A. bae ii (BAE AJ555351), A. gueldens aed ii (GUE AJ555353), A. s ella us (STE AJ555385), Huso huso (HUS AJ555358) and A. u henus (RUT AJ555393). The code name species and he accession numbe a e show in o pa en hesis. Numbe s indica e boo s ap suppo o each node (10000 eplica es). DNA ma ke s indica e i s assignmen o A. nacca ii bu mi ochond ial DNA ma ke s show iden i ies o A. s u io. To con i m his si ua ion, we analysed wo new mi o- chond ial ma ke s, 265-bp cy och ome b and d-loop (Figu es 3(a) and (b)). And he esul s coincided wi h p e ious ones, demons a ing ha his sample co e- sponds o A. s u io o all mi ochond ial ma ke s. In ac , in he mi ochond ial sequences analysed in his s udy (265-bp cy och ome b and d-loop), we ound posi ions ixed wi h hose o he species A. s u io. Thus, he specimen EBD8174 could be conside ed a “mosaic” s u geon: ha ing nuclea cha ac e is ics o A. nacca ii bu mi ochond ial ma ke s o A. s u io. Hy- b idiza ion o in og ession p ocesses be ween A. s u io and A. nacca ii could explain his phenomenon. In s u - geons, gene ic e idence o hyb idisa ion phenomena be ween sympa ic s u geon species has been shown o example in A e je [36], and mo e ecen ly be ween A. u henus and A. bae ii in he Danube Ri e [37]. Also, simila in og ession p ocesses ha e been de- sc ibed p e iously in he Ad ia ic egion (A. guelden- s aed ii in og essed in o he A. nacca ii) [38] and in he popula ion o he Bal ic Sea o A. s u io (A. oxy inchus in og essed in o he A. s u io; [39]). Finally, we ha e ied o cla i y he speci ic s a us o h ee samples om a chaeological si es (Table 1). Two o hese samples (abou 12,000 yea s old ound a an olde p ehis o ic se lemen , he Ca e o Ne ja) we e no success ully analysed. Un o una ely, none o he ma k- e s used could be cha ac e ized o hese samples. How- e e , we succeeded in ampli ying a agmen o he 12S mi ochond ial gene om he p ehis o ic scu e (Ronda, Malaga, o abou 3500 yea s o an iqui y) ound a he a chaeological si e o Acinipo (Table 1). These esul s a e en a i e because he i s samples we e e y old and i was di icul o ex ac enough quali y DNA o ampli y he molecula ma ke s. Howe e , in p e ious s udies some samples wi h simila an iqui y a Acinipo, ha e been used success ully in species iden i ica ion [17,40]. The 12S mi ochond ial gene ob ained om he Acinipo sample was compa ed wi h o he 12S sequences om di e en species o s u geons in he GeneBank da abase. The diagnos ic posi ions o his ma ke did no coincide wi h A. s u io, uling ou i s assignmen o his species (Figu e 4). In ac , all diagnos ic si es co- incided wi h A. nacca ii, al hough hey a e no exclusi e o his species, sha ing hem wi h o he s u geon species such as A. gueldens aed ii, A. bae ii, A. pe sicus and A. nudi en is wi h a dis ibu ion a away om he Ibe ian Peninsula. Thus, in a phylogene ic ee, based on gene ic dis ances, he sequence om he Acinipo scu e is g ouped wi h he sequences om A. nacca ii (Figu e 5). 4. CONCLUSIONS The nuclea and mi ochond ial ma ke s show ha he specimens EBD8173 and EBD8401 belong o he spe- cies A. nacca ii, and he sample UGP o A. s u io. The specimen EBD8174, using mi ochond ial ma ke s can be ca alogued as A. s u io, o as A. nacca ii acco ding o nuclea ma ke s. Hyb idiza ion o in og ession p oc- F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 176 esses be ween A. s u io and A. nacca ii, could explain his phenomenon, common in s u geons in hese species. On he o he hand, we we e able o analyse he 12S mi- ochond ial ma ke o he ACINIPO sample (3500 yea s old) demons a ing ha i belongs o species A. nacca ii. These analyses p o ide insigh s in o he exis ence o specimens belonging o A. nacca ii in he sou he n Ibe- ian Peninsula in his o ic (EBDs samples) and p ehis- o ic (ACINIPO) imes. Thus, ou analyses con i m old e e ences men ioning he p esence o A. nacca ii in he Ibe ian Peninsula [5-13]. The e o e, al hough A. nacca ii is cu en ly conside ed endemic o he Ad ia ic Sea, in he pas i could ha e had a b oade dis ibu ion a ea, ex ending o he Ibe ian Peninsula, including he Gua- STU CCTGTTTCTACACCAAACAGGATCAAACAACCCAACAGGACTAAACTCAGACGCAGACAAAGTAACATTCCACCCATATTTCTCTTATAAAGACTTATTCGGTTTTATCCTAAT 114 UGP .................................................................................................................. EBD8174 .................................................................................................................. NAC ...A....................................T................T..G..............G..C.....A..C......C....G..G........... OXY ...A...................................GT.G......................................................C........G....... PER ...A....................................T................T..G..............G..C.....A..C......C....G..G........... GUE ...A....................................T................T..G..............G..C.....A..C......C....G..G........... BAE ...A....................................T...................G..............G..C.....A..C...........A..A........... SIN T...G...............................................................................A..C......C.C.....A......T.... STE ...A..C.................................T.G................................G........A..C...........A..G........... STU ACTAATCGGACTCGCCTCTGTGGCACTATTCTCCCCCAACCTTTTAGGCGACCCAGACAACTTTACGCCTGCCAACCCCCTTGTCACACCCCCACACATCAAACCCGAATGATA 228 UGP .................................................................................................................. EBD8174 .................................................................................................................. NAC G...G........A....C..A....................CC.G.................C..A..C.................T..............G........... OXY GT...........A....C..A........T................................................................................... PER G...G........A....C..A....................CC.G.................C..A..C.................T..............G........... GUE G...G........A....C..A....................CC.G.................C..A..C.................T..............G........... BAE G...G........A....C..A........T...........CC.G.................C..A..C.................T..............G........... SIN G...G........A....C..A....................C..G....................A............................................... STE G...G........A....C..A..............T......C.G..T..............C..A..C.....T...........T..............G........... (a) STU TAAGATTCTACATTAAACTATTCTCTGACCACATG-T-------------------CTGACCC-----ATACCAATGTCTGCA--TACATTAAATTGTACA--TACATA-AACATACTATG 121 EBD8174 ................................................................................................................T........ UGP ......................................................................................................................... NAC .............................T.T.CCA....................-------.....-----.....T....TG.............TT.AG......AGG......... OXY ...........................G...T..CA.G....................CG..T......C........T.--...............CTT....G...G.G.....T.... PER .............................T.T.CCA....................-------.....-----.....T....TG.............TT.AG......AGG......... GUE .............................T.T.CCA....................-------.....-----.....T....TG.............TT.AG......AGG......... BRE ...............................T.CCAC...................-------.....-----G...CTCA..CA.............TT.AG......AG.......... BAE ...............................T.CCA....................-------.....-----....CT.A..TA.............TT.AG......AG....G..... HUS .................................CCA.GTTTAACCCACACCAATTT..AG..ACCATA-CTAT.....T.A..TA...........A.T..AG......AG....G..... RUT ...........................GTT.T.CCA.GTTTAATCCACATTAACTT..AGT.ACCATA-.CAT.....T...G.............A.TT.AG......AGG...G..... STE ...............................TGCTA.GTTTAATCCACATTAATTT..AG..ACCATA-ACAT....CT....CA...........A.TT.AG......AG....G..... TRA ...............................TGCTA.GTTTAATCCACATTAATTT..AG..ACCATA-CCAT....CTCA..AGC............TT.AG......AG....G..... FUL .............................-.T.CTA.GTTTAATCCACATTAATTT..AGT.ATCATA-C.T.....CTC.T.CA.............TT.AG......GG.......... MED ...............................T.CTA.GTTTAATCCACATTAATCT..AGT.ACCAT..CCAT.....T..T.AA...........ACCT...--T...GG.......... MIK ...............................T.CTA.GTTTAATCCACATTAATCT..AGT.ACCAT..CCAT.....T..T.AA.......G...ACCT...--T...AG.......... PLA .....................C............-A.GTTTAATCCACATTAATTT..AGT.ACCATAC.CAT-------..G.............A.TG.GG......AG....G..... STU TTTAATCCCCATTAATTTCTAGCCACCAAT---ACCAATGTTTACCTATAT-ATTAAATTATCTAAGTACATA-GACATACTATGTTTAATCCCCATTAATTTCTAGTCAACATA--TCA 241 EBD8174 ..............................A...........C............................................................................. UGP ........................................................................................................................ NAC ........A.............T.....TA.CC.T-.......G.A.G..C.........G.T..........A.G.................A................C......C.. OXY ......................T.....-...............TA....C......GCC..T.........G.A.............T...........C......C..CT.....A.. PER ........A...................TA.TC.T-.......G.A.G..C.........G.T..........A...................A.............C..C......... GUE ........A...................TA.CC.T-.......G.A.G..C.........G.T..........A.G.................A.............C..C......C.. BRE ........A...................TAACC.T-....C....AC...C.........G.T..........A...................A.............C..C....AC... BAE ........A.............T.....TA.CC.T-....C....A....C.........G.T..........A.....G.............A................C......C.. HUS .A......A.....G.............TA.CC.T-.........A....C...........TC.........A.....G......A......A.....G.......C..C......C.. RUT ........A......C......T.....TA.TC.T-.......G--CG..C...........T..........A.G...G.............A......C.........C......... STE ........A...................TA.AC.T-....C..G.AC...C...........T..........A.....G.............A.......................... TRA ........A...................TA.CC.T-....C.C..AAGC.C.........G.T..........A.....G.............A.............C..T......... FUL ........A.............T..T..TA..C.T.....C.CGTAC...C.........G.T..........G......T............A..........C.....CT.C..CA.. MED ........A.......C.....T.....TA.CC.T-.......GTAA...CC........G---.CC..T...G...................A.......C........C......C.. MIK ........A.......C.....T.....TA.CC.T-.......GTAA...C.....G....----CC..T...A...................A.......C........C......C.. PLA ........A.............T.....TACTC.T-.---------CG..C...........TG.GG......A.....G.............A.......................... (b) Figu e 3. (a) Alignmen o sequences o a 265-bp cy och ome b agmen . Mul iple alignmen o he sequences o a 265-bp cy o- ch ome-b agmen om UGP and EBD8174, espec i ely. They a e compa ed wi h he same mi ochond ial DNA egion om A. s u io (STU AJ245839), A. nacca ii (NAC AJ245834), A. oxy inchus (OXY AJ245838), A. pe sicus (PER AJ245835), A. guelden- s aed ii (GUE AJ245827), A. bae ii (BAE AJ245825), A. sinensis (SIN AJ252186), A. s ella us (STE AY846686). The g ey boxes show he diagnos ic si es used in he analysis. The p ime sequence is no used in he alignmen ; (b) Alignmen o pa ial d-loop se- quences. Mul iple alignmen o he sequences o he d-loop om EBD8174 and UGP, espec i ely. These a e compa ed wi h se- quences o he same mi ochond ial DNA egion om 15 di e en species o s u geon: A. s u io (STU AJ428274), A. nacca ii (NAC AJ275199), A. oxy inchus (OXY AJ249670), A. pe sicus (PER AJ275205), A. gueldens aed ii (GUE AJ249668), A. b e i os um (BRE AJ275194), A. bae ii (BAE AJ249660), H. huso (HUS AJ249675), A. u henus (RUT AJ249671), A. s ella us (STE AJ249672), A. ansmon anus (TRA AJ249674), A. ul escens (FUL AJ249661), A. medi os is (MED AJ275188), A. mikadoi (MIK AJ275189) and S. pla o ynchus (PLA AJ249676). The g ey boxes show he diagnos ic si es used in he analysis. The pa ial RNAP o sequences a e unde lined. The alignmen does no show he p ime sequence. F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 177 STU GGAAAGAAATGGGCTACATTTTCTGACACAGAAAACACACGAATAATACTGTGAAACCAGTGATTGAAGGTGGATTTAGCAGTAAAAAGAAAATAGAAA 99 UGP ................................................................................................... EBD8174 ................................................................................................... EBD1873 ...................................T..........C...............G.................................... EBD8401 ...................................T..........C...............G.................................... Acinipo ...................................T..........C...............G.................................... NAC ...................................T..........C...............G.................................... OXY ..........................T........T..........C..................................................G. GUE ...................................T..........C...............G.................................... BAE ...................................T..........C...............G.................................... PER ...................................T..........C...............G.................................... NUD ...................................T..........C...............G.................................... HUS ...................................T..........C...............G.......................G............ STE ...................................T..........C...............G.......................G............ RUT ...................................T..........C.................................................... FUL ..............................................C.................................................... BRE ...................................T..........C.................................................... TRA ...................................T..........C.................................................... SIN ...................................T..........C.................................................... SCH ...................................T..........C.................................................... DAU ...................................T..........C.................................................... MIK ...................................T..........C.................................................... MED ...................................T..........C.................................................... PLA ...................................T..........C.................................................... ALB ...................................T..........C.................................................... SUS ...................................T..........C.................................................... Figu e 4. Alignmen o sequences o 12S mi ochond ial gene om Acinipo. Mul iple alignmen o sequences o 12S mi ochond ial gene om Acinipo. These a e compa ed wi h he same mi ochond ial-DNA egion om he h ee EBD and UGP specimens, A. s u io (STU AJ549115), A. nacca ii ((NAC AJ549114) A. oxy inchus (OXY AF402894), A. gueldens aed ii (GUE FJ392605), A. bae ii (BAE AY544135), A. pe sicus (PER AY544139), A. nudi en is (NUD AY544138), H. huso (HUS AY544146), A. s ella us (STE AY544144), A. u henus (RUT AY544140), A. ul escens (FUL AF402885), A. b e i os um (BRE AF402886), A. ansmon anus (TRA AF402893), A. sinensis (SIN AY544143), A. sch enckii (SCH AY544142), H. dau icus (DAU AY544147), A. mikadoi (MIK AY544141), A. medi os is (MED AF125598), S. pla o ynchus (PLA AF402901), S. albus (ALB AY430247) and S. su kusii (SUS AF402900). The g ey boxes show he diagnos ic si es used in he analysis. The alignmen does no show he p ime sequence. NAC E B D 1873 Acinipo BAE GUE E B D 8401 PER NUD STE HUS PLA SCH DAU SUS MED MIK ALB RUT TRA BRE SIN FU L E B D 8174 STU UGP OXY P.o na ipinnis 68 65 65 38 50 72 56 0.02 Figu e 5. Neighbou -joining ee based on 12S mi ochond ial gene sequences. Neighbou -joining ee based on 12S mi o- chond ial gene sequences and Jukes-Can o dis ances calcu- la ed in MEGA 4. The ee shows he close ela ionships be- ween sequences om Acinipo (▼), EBD8173 and EBD8104 wi h A. nacca ii and be ween sequences om UGP and EBD8174 wi h A. s u io. Numbe s indica e he boo s ap sup- po o each node (10000 eplica es). Polyp e us. o na innis (Bichi NC001778) is used as ou g oup. dalqui i Ri e . Simila ly, A. s u io was dis ibu ed no so long ago h oughou Eu ope whe eas, a he p esen , only one popula ion exis s, in he Gi onde-Ga onne- Do dogne Ri e , F ance [41-44]. Fu he mo e, o p o- pose a b oad dis ibu ion a ea o A. nacca ii is consis- en wi h he gene al obse a ion ha mos s u geon spe- cies inhabi ed as a eas o con inen s and i e basins [45]. Thus, obse a ions based on molecula analyses, as we p esen in his pape , o he inding o an “Ame ican” species in Eu ope (i.e. he mo emen o A. oxy inchus in o Eu ope du ing he Li le Middle Ages [46,47]), e- qui e mo e s udies in o de o es ablish a mo e comple e ision o he dis ibu ion o di e en s u geon species in Wes e n Eu ope. 5. ACKNOWLEDGEMENTS This esea ch has been inanced by g an s o he Jun a de Andalucía, Conseje ía de Inno ación, Ciencia y Emp esa (P oyec o de In es iga- ción de Excelencia P07-CVI-03296) (F. Robles is a pos doc o al g an holde in his P ojec ). Ne ja Ca e was analysed in he P ojec “Re- isión, es udio y con ex ualización c onoes a ig á ica de los es os a queológicos p oceden es de las an iguas exca aciones del Pa ona o de la Cue a de Ne ja”, au ho ized by Conseje ía de Cul u a de la Jun a de Andalucía o one o he au ho s (MCS). We also hank ou colleague F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 178 D. Nesbi o e ising ou English ex . REFERENCES [1] Ca mona, R., Domezain, A., Ga cía-Gallego, M., He - mando, J.A., Rod íguez, F. and Ruiz-Rejón, M. (Ed.) (2009) Biology, Conse a ion and sus ainable de elop- men o s u geons, Fish & Fishe ies, Se ies 29, Sp inge . [2] Ga ido-Ramos, M.A., So igue , C., de la He án, R., Jamilena, M., Ruiz-Rejón, C., Domezain, A., He nando, J.A. and Ruiz-Rejón, M. (1997) Mo phome ic and ge- ne ic analysis as p oo o he exis ence o wo s u geon species in he Guadalqui i i e . Ma ine Biology, 129(1), 33-39. [3] De la He án, R., Ma ínez-Espín, E., Lo en e, J.A., Ruiz-Rejón, C., Ga ido-Ramos, M.A. and Ruiz-Rejón, M. (2004) Gene ic iden i ica ion o wes e n Medi e a- nean s u geons and i s implica ion o conse a ion. Con- se a ion Gene ics, 5(4), 545-551. [4] Ga ido-Ramos, M.A., Robles, F., de la He án, R., Ma ínez-Espín, E., Lo en e, J.A., Ruiz-Rejón, C. and Ruiz-Rejón, M. (2009) Analysis o mi ochond ial and nuclea DNA ma ke s in old museum s u geons yield in- sigh s abou he species exis ing in Wes e n Eu ope: A. s u io, A. nacca ii and A. oxy inchus. In: Ca mona, e al., Ed., Biology, Conse a ion and Sus ainable De elopmen o S u geons, Fish & Fishe ies, Se ies 29, Sp inge , 25- 49. [5] Capello, F.B. (1869) Ca alogo dos peixes do Po ugal que exis em do Museu de Lisboa. Jo nal de Sciencias Ma he- ma icas, Physicas, e Na u aes, 1(2), 131-193. [6] Capello, F.B. (1880) Ca alogo dos peixes do Po ugal. Mémoi es de l'Académie Royale des Sciences, Lisboa, 6, 1-78. [7] Osó io, B. (1894) D’algunas especies a jun a ao Ca alogo dos peixes do Po ugal de Capello. Jo nal de Sciencias Ma hema icas, Physicas, e Na u aes, 3(11), 186-188. [8] Nob e, A. (1931) Peixes das aguas doces de Po ugal. Bole im Minis é io da Ag icul u a, 13(2), 73-112. [9] Nob e, A. (1935) Fauna Ma inha de Po ugal. Ve e- b ados, Po o, 579. [10] Gonçal es, B.C. (1942) Colecçao ocenog á ica de D. Ca los I. Ca álogo dos Peixes. T a aux S a ion de Biolo- gie Ma ine de Lisbonne, 46, 1-108. [11] Helling, H. (1943) No o ca alogo dos Peixes do Po ugal em colecçao no Museu de Zoologia da Uni e sidade de Coimb a. Memó ias e Es udos do Museu Zoológico da Uni e sidade de Coimb a, 149, 1-110. [12] Albuque que, R.M. (1956) Peixes do Po ugal e ilhas adjacen es. Cha es pa a a sua de e minação. Po uga- liae Ac a Biológica, 5B, 195. [13] Baucho , M.L. (1987) Poissons osseux. In: Fische , W., Baucho , M.L. and Schneide , M., Eds., Fiches FAO d’iden i ica ion pou les besoins de la pêche ( e .1). Médi e anée e me Noi e. Zone de pêche 37, Com- mission des Communau és Eu opéennes and FAO, Rome, 2, 891-1421. [14] Rincón, P.A. (2000) Pu a i e mo phome ic e idence o he p esence o Acipense nacca ii Bonapa e, 1836 in Ibe ian i e s, o why on ogene ic allome y needs ade- qua e ea men . Bole ín Ins i u o Español de Oceano- g a ía, 16(1-4), 217-229. [15] Almodó a , A., Macho dom, A. and Suá ez, J. (2000) P elimina y esul s om cha ac e iza ion o he Ibe ian Peninsula s u geon based on analysis o he m DNA cy o- ch ome b. Symposium on Conse a ion o he A lan ic S u geon Acipense s u io. L., 1758 in Eu ope, Bole ín. Ins i u o Español de Oceanog a ía, 16(1-4), 17-27. [16] Gasen -Ramí ez, J.M., Godoy, J.A. and Jo dano, P. (2001) Iden i icación de es u iones p oceden es del Guadalqui i median e análisis de ADN en especimenes de museo. Publicaciones de la Conseje ía de medio Ambien e de la Jun a de Andalucía, 36, 44-49. [17] Ludwig, A., A nd , U., Debus, L., Roselló, E. and Mo ales, A. (2009) Ancien mi ochond ial DNA analyses o Ibe ian s u geons. Jou nal Applied Ich hyology, 25(1), 5-9. [18] Aguayo, P., Ca ile o, M., Ma ínez, G., A onso, J.A., Ga ido, O. and Radial, B. (1989) Exca aciones A - queológicas en el yacimien o de Ronda la Vieja (Acinipo). Campaña de 1988. Anua io A queológico de Andalucía 88/II, Conseje ía de Cul u a, Jun a de Anda- lucía, Se illa, 309-314. [19] Ca ile o, M., Aguayo, P., Ga ido, O. and Padial, B. (2002) Au óc onos y enicios en la Andalucía Medi e- ánea. en XVI Jo nadas de A queología enicio-púnica (Ei issa, 2001), T eballs del Museu A queològic d´ Ei issa i Fo men e a, Ibiza, 50, 69-125. [20] Simón Vallejo, M.D. (2003) Una secuencia con mucha p ehis o ia: la Cue a de Ne ja. Mainake, 25, 249-274. [21] Co és, M. (2004) Del Magdaleniense al Neolí ico en la cos a de Malaga. No edades y pe spec i as. Ac as Jo - nadas Temá icas Andaluzas de A queología, Sociedades ecolec o as y p ime os p oduc o es, Jun a de Andalucía, 109-122. [22] Ma ínez-Espín, E., Ma ínez-González, L.J., Ál a ez, J.C., Roby, R.K. and Lo en e, J.A. (2009) Fo ensic s a egies used o DNA ex ac ion o ancien and de- g aded museum s u geon specimens. In: Ca mona, e al., Ed., Biology, Conse a ion and Sus ainable De elopmen o S u geons, Fish & Fishe ies, Se ies 29, Sp inge , 85- 96. [23] Donoghue, H.D., Spigelman, M., G eenbla , C.L., Le -Mao , G., Ba -Gal, G.K., Ma heson, C., Ve non, K., Ne lich, A.G. and Zink, A.R. (2004) Tube culosis: F om p ehis o y o Robe Koch, as e ealed by ancien DNA. Lance In ec ious Diseases, 4(9), 584-592. [24] Hagelbe g, E. and Clegg, J.B. (1991) Isola ion and cha - ac e iza ion o DNA om a chaeological bone. P oceed- ings o he Royal Socie y B: Biological Sciences, 244 (1309), 45-50. [25] De la He án, R., Fon ana, F., Lan edi, M., Congiu, L., Leis, M., Rossi, R., Ruiz-Rejón, C., Ruiz-Rejón, M. and Ga ido-Ramos, M.A. (2001) Slow a es o e olu ion and sequence homogeniza ion in an ancien sa elli e DNA amily o s u geons. Molecula Biology and E olu ion, 18(3), 432-436. [26] Robles, F., De la He án, R., Ludwig, A., Ruiz-Rejón, C., Ruiz-Rejón, M. and Ga ido-Ramos, M.A. (2004) E olu- ion o ancien sa elli e DNAs in s u geon genomes. Gene, 338(1), 133-142. F. Robles e al. / Ad ances in Bioscience and Bio echnology 1 (2010) 171-179 Copy igh © 2010 SciRes. ABB 179 [27] Taglia ini, J., Willio , P., Congiu, L., Chicca, M., Lan- edi, M., Rossi, R. and Fon ana, F. (1999) Molecula cy ogene ic analysis o he ka yo ipe o he Eu opean A - lan ic s u geon, Acipense s u io. He edi y, 83(5), 520- 525. [28] King, T.L., Lubinski, B.A. and Spidle, A.P. (2001) Mi- c osa elli e DNA a ia ion in A lan ic s u geon (Acipen- se oxy inchus oxy inchus) and c oss-species ampli ica- ion in he Acipense idae. Conse a ion Gene ics, 2(2), 103-119. [29] Ludwig, A. and Ki schbaum, F. (1998) Compa ison o mi ochond ial DNA sequences be ween he Eu opean and he Ad ia ic s u geon. Jou nal o Fish Biology, 52(6), 1289-1291. [30] Ludwig, A., May, B., Debus, L. and Jenneckens, I. (2000) He e oplasmy in he m DNA con ol egion o s u geon (Acipense , Huso and Scaphi hynchus). Gene ics, 156(4), 1933-1947. [31] Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F. and Higgins, D.G. (1997) The Clus alX windows in- e ace: Flexible s a egies o mul iple sequence align- men aided by quali y analysis ools. Nucleic Acids Re- sea ch, 25(24), 4876-4882. [32] Tamu a, K., Dudley, J., Nei, M. and Kuma , S. (2007) MEGA4: Molecula E olu iona y Gene ics Analysis (MEGA) so wa e e sion 4.0. Molecula Biology and E olu ion, 24(8), 1596-1599. [33] Michene , D. and Sokal, R.R. (1957) A quan i a i e ap- p oach o a p oblem o classi ica ion. E olu ion, 11(2), 130-162. [34] Sai ou, N. and Nei, M. (1987) The neighbo -joining me hod: A new me hod o econs uc ing phylogene ic ees. Molecula Biology and E olu ion, 4(4), 406-425. [35] Fon ana, F., Taglia ini, J. and Congiu, L. (2001) S u geon gene ics and cy ogene ics: Recen ad ancemen s and pe spec i es. Gene ica, 111(1-3), 359-373. [36] A e je , V.A. (1997) Cy ogene ics o in e ploid hyb idi- za ion o s u geons. P oceedings o he 3 d In e na ional Symposium on S u geon, Piacenza, I aly, 277. [37] Ludwig, A., Lippold, S., Debus, L. and Reina z, R. (2009) Fi s e idence o hyb idiza ion be ween endan- ge ed s a le s (Acipense u henus) and exo ic Sibe ian s u geons (Acipense bae ii) in he Danube Ri e . Bio- logical In asions, 11, 753-760. [38] Ludwig, A., Congiu, L., Pi a, C., Fickel, J., Gessne , J., Fon ana, F., Pa a nello, T. and Zane, L. (2003) Noncon- co dan e olu iona y his o y o ma e nal and pa e nal lineages in Ad ia ic s u geon. Molecula Ecology, 12(12), 3253-3264. [39] Tiedemann, R., Moll, K., Paulus, K.B., Schee , M., Wil- lio , P., Ba el, R., Gessne , J. and Ki schbaum, F. (2007) A lan ic s u geons (Acipense s u io, Acipense oxy in- chus): Ame ican emales success ul in Eu ope. Na u - wissenscha en, 94(3), 213-217. [40] Pagès, M., Desse-Be se , N., Touga d, C., B osse, L., Hänni, C. and Be ebi, P. (2008) His o ical p esence o he s u geon Acipense s u io in he Rhône basin de e mined by he analysis o ancien DNA cy och ome b sequences. Conse a ion Gene ics, 10(1), 217-224. [41] Rocha d, E., Cas elnaud, G. and Lepage, M. (1990) S u - geons (Pisces: Acipense idae), h ea s and p ospec s. Jou nal o Fish Biology, 37(Suppl A), 123-132. [42] Lepage, M. and Rocha d, E. (1995) Th ea ened ishes o he wo ld: Acipense s u io Linnaeus, 1758 (Acipen- se idae). En i onmen al Biology o Fishes, 43(1), 28. [43] Willio , P., Rocha d, E., Cas elnaud, G., Rouaul , T., B un, R., Lepage, M. and Elie, P. (1997) Biological and eco- logical cha ac e is ics o Eu opean A lan ic s u geon, Acipense s u io, as ounda ions o a es o a ion p o- g amme in F ance. En i onmen al Biology o Fishes, 48 (1-4), 359-370. [44] Willio , P., A la i, G., Chebano , M., Gulyas, T., Kasimo , R., Ki schbaum, F., Pa iche, N., Pa lo skaya, L., Poli- ako a, L., Pou kazemi, M., Yu, K., Zhuang, P. and Zholdaso a, I.M. (2002) S a us and managemen o Eu asian s u geon: An o e iew. In e na ional Re iew o Hyd obiology, 87(5-6), 483-506. [45] Choudhu y, A. and. Dick, T.A. (1998) The his o ical biogeog aphy o s u geons (Os eich hyes: Acipense idae): A syn hesis o phylogene ics, palaeon ology and palaeo- geog aphy. Jou nal Biogeog aphy, 25(4), 623-640. [46] Ludwig, A., Debus, L., Lieck eld , D., Wi gin, I., Benecke, N., Jenneckens, I., Willio , P., Waldman, J.R. and Pi a, C. (2002) When he Ame ican sea s u geon Swam eas . Na u e, 419(6906), 447-448. [47] Ludwig, A., A nd , U., Lippold, S., Benecke, N., Debus, L., King T.L. and Ma sumu a, S. (2008) T acing he i s s eps o Ame ican s u geon pionee s in Eu ope. BMC E olu iona y Biology, 8(1), 221-252.