Generation of the human iPSC line ESi082-A from a patient with macular dystrophy associated to mutations in the CRB1 gene

Stem Cell Research 53 (2021) 102301 Available online 18 March 2021 1873-5061/© 2021 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/). Generation of the human iPSC line ESi082-A from a patient with macular dystrophy associated to mutations in the CRB1 gene Alberto Ca˜ nibano-Hern´ andez a , Lourdes Valdes-Sanchez a , Ana B. Garcia-Delgado a , Beatriz Ponte-Zú˜ niga b , Francisco J. Diaz-Corrales a , Berta de la Cerda a , * a Department of Regeneration and Cell Therapy, Andalusian Molecular Biology and Regenerative Medicine Centre (CABIMER), Avda. Americo Vespucio, 24, 41092 Seville, Spain b University Hospital Virgen Macarena, RETICS Oftared, Carlos III Institute of Health (Spain), Ministry of Health RD16/0008/0010, Seville, Spain ABSTRACT Retinal dystrophies associated to mutations in the CRB1 gene comprise a wide array of clinical presentations. A blood sample from a patient with a family history of CRB1-retinal dystrophy was used to prepare the iPSC line ESi082-A. The genotype of the donor, affected of a perifoveal-bilateral macular dystrophy includes one frameshift deletion and one hypomorphic allele. ESi082-A cell line has been characterized for pluripotency and will be used to prepare retinal cellular models to study the dysfunction leading to the disease. 1. Resource table Unique stem cell line identifier ESi082-A Alternative name(s) of stem cell line CRB1-MiPS4F1 Institution Andalusian Molecular Biology and Regenerative Medicine Centre (CABIMER), Seville, Spain. Contact information of distributor Berta de la Cerda [email protected] Type of cell line iPSC Origin Human Additional origin info Age: 56 Sex: Male Ethnicity: European descent Cell Source Peripheral blood mononucleated cells Clonality Clonal Method of reprogramming hOCT3/4, hSOX2, hc-MYC, and hKLF4 via nonintegrative Sendai virus Genetic Modification Yes Type of Modification Hereditary Associated disease Macular dystrophy Gene/locus CRB1/ Chr. 1: 197,268,204–197,478,455 Mutations: c.613_619del (p.Ile205Aspfs*13) LOVD#CRB1_000175 c.498_506del (p.Ile167_Gly169del) CinVar ID#96659 Method of modification N/A Name of transgene or resistance N/A (continued on next column) (continued) Inducible/constitutive system N/A Date archived/stock date 10. 20. 2020 Cell line repository/bank hpsreg.eu/cell-line/ESi082-A Ethical approval Cellular Reprogramming Board of Andalucía. Ethical Approval number: PR_01_2015 2. Resource utility Most CRB1-associated retinal dystrophies present as Leber congenital amaurosis or retinitis pigmentosa but the hypomorphic allele CRB1 c.613_619del has been associated to macular dystrophy. The iPSC line ESi082-A will be used to obtain retinal cellular models by differentiation, enabling the study of the mechanisms of disease leading to cellular degeneration. 3. Resource details Retinal dystrophies associated to CRB1 mutations cover a wide spectrum of clinical presentations and currently it is unclear which are the factors leading to the different degrees of disease (Khan et al., 2018; Quinn et al., 2017). Cellular modelling using patient-derived iPSCs is a promising tool to uncover the mechanisms of disease. A patient diagnosed with macular dystrophy associated to a composite homozygous genotype in the CRB1 gene was the donor of the biological sample to * Corresponding author. E-mail address: [email protected] (B. de la Cerda). Contents lists available at ScienceDirect Stem Cell Research journal homepage: www.elsevier.com/locate/scr https://doi.org/10.1016/j.scr.2021.102301 Received 27 January 2021; Received in revised form 16 February 2021; Accepted 14 March 2021 Stem Cell Research 53 (2021) 102301 2 obtain the ESi082-A iPSC line. Mononucleated cells collected from peripheral blood (PBMCs) were reprogrammed to iPSCs using the nonintegrative Sendai virus to transduce the reprogramming factors hOCT3/4, hc-MYC, hKLF4, and hSOX2. Identity of the cell line was confirmed by DNA fingerprinting, matching with the DNA of the original biological material (available with the authors). Moreover, DNA sequencing of ESi082-A compared to a normal control confirmed the presence of the two mutations in the CRB1 gene (Fig. 1A). CRB1/ c.613_619del mutation is the maternal allele, a mutation previously associated to Leber congenital amaurosis (http://databases.lovd.nl/sh ared/variants/CRB1), and CRB1/c.498_506del is the paternal allele, reported as pathogenic for macular dystrophy (Khan et al., 2018). The iPSC line was checked for normal 46, XY male karyotype (Fig. 1B) and for the typical stem cell morphology of compact flat colonies composed of cells with a high nuclear/cytosolic ratio (Fig. 1D). Clearance of viral capsid and ectopic reprogramming factors was apparent at passage 7, with no expression of these genes detected by RT-PCR (Fig. 1C). To characterize the pluripotency of cell line, expression of NANOG and OCT4 genes was quantified by RT-qPCR. ESi082-A iPSC line presented a high level of expression for both genes compared to PBMCs of the patient, used as a negative control (Fig. 1G). A complete panel of pluripotency markers was evaluated by immunofluorescence, demonstrating nuclear expression for OCT4, NANOG and SOX2, and surface expression for SSEA3, SSEA4 and TRA-1-81 (Fig. 1F; right panels depict a magnification of each left panel). Additionally, elevated enzymatic activity for alkaline phosphatase was also shown for the iPSC line (Fig. 1E). The Fig. 1. A. Ca˜ nibano-Hern´ andez et al. Stem Cell Research 53 (2021) 102301 3 ability of ESi082-A to generate the three germ layers was evaluated by inducing the formation of embryoid bodies in vitro and then confirming the expression of specific markers by immunofluorescence: endodermal α -fetoprotein (AFP), mesodermal smooth-muscle actin (SMA) and ectodermal PAX6 (Fig. 1H; right panels depict a magnification of each left panel). Characterization is summarized in Table 1. 4. Materials and methods 4.1. Mutation sequencing Genomic DNA from iPSCs was isolated using the QIAamp DNA Blood mini kit (Qiagen). Primers for amplification and Sanger sequencing of the genomic region flanking the mutation sites are described in Table 2. 4.2. Peripheral blood mononuclear cells (PBMCs) primary culture PBMCs were isolated from 4 mL of peripheral blood using Vacutainer CPT tubes (BD) and cultured in expansion medium (EM: QBSF-60 (Quality Biological) with 50 μ g/ml of ascorbic acid (Sigma-Aldrich); 50 ng/ml of SCF (Stemcell Technologies); 10 ng/ml IL-3 (Stemcell Technologies); 2 U/mL of EPO (Stemcell Technologies); 40 ng/ml IGF-1 (Stemcell Technologies); 1 μ M Dexamethasone (Sigma-Aldrich) and 1% Pen/strep (Gibco)). 4.3. Reprogramming PBMCs to iPSCs 2.5x10 4 PBMCs were transduced with reprogramming factors (CytoTune®-IPS Reprogramming Kit (Life Technologies)) for 24 h. Cells were washed and kept in EM medium for 48 h. 1x10 5 cells were seeded on feeders (irradiated hFF (ATCC CRL2429)) and cultured in QBSF-60 with 50 μ g/ml of ascorbic acid and 1% pen/strep. On day 15, medium was changed to hESCM: Knock Out DMEM-F12 (Gibco); 20% Knock Out serum (Gibco); 1% glutamine (Gibco); 1% NEAA (Gibco); 0.23 mM β-mercaptoethanol (Gibco); 1% pen-strep and 10 ng/ μ l bFGF (Peprotech)). Colonies with stem-like morphology were manually isolated in the days 21 to 27 post-transduction. Clone 1, named ESi082-A, was adapted to grow in mTeSR1 (Stemcell Technologies) onto Matrigel. 4.4. RT-PCR and qPCR for detection of viral clearance and pluripotency markers 1 μ g of total RNA isolated with RNeasy Mini Kit (Qiagen) was retrotranscribed using QuantiTect Reverse Transcription Kit (Qiagen). RT- Table 1 Characterization and validation. Classification Test Result Data Morphology Photography Normal morphology Fig. 1D Phenotype Qualitative analysis Positive staining for pluripotency markers: OCT4, NANOG, SOX2, TRA-1-81, SSEA3, SSEA4 and alkaline phosphatase. Fig. 1F, 1E Quantitative analysis RT-qPCR analysis of the expression for NANOG and OCT4 Fig. 1G Genotype Karyotype (G- banding) and resolution 46, XY, Resolution 450–500 Fig. 1B Identity Microsatellite PCR (mPCR) OR STR analysis STR analysis. 10 sites tested. All matched Available with the authors mPCR not done N/A Mutation analysis Sequencing chr1:197,201,504: c.613_619del c.498_506del Fig. 1A Southern Blot OR WGS Not done N/A Microbiology and virology Mycoplasma Negative Mycoplasma detection. Tested by luminescence Supplementary Fig. 1 Differentiation potential In vitro embryoid body formation Positive immunostaining for mesodermal muscle actin, endodermal alpha fetoprotein and ectodermal PAX6 Fig. 1H Donor screening HIV 1 +2 Hepatitis B, Hepatitis C Not done N/A Genotype additional info Blood group genotyping Not done N/A Table 2 Reagents details. Antibodies used for immunocytochemistry/flow-cytometry Antibody Dilution Company Cat # and RRID Pluripotency Markers Rabbit anti- OCT4 1:400 Cell Signaling Technology Cat# 2840, RRID: AB_2167691 Rabbit anti- NANOG 1:400 Cell Signaling Technology Cat# 4903, RRID: AB_10559205 Rabbit anti- SOX2 1:400 Cell Signaling Technology Cat# 3579, RRID:AB_2195767 Mouse anti- SSEA4 1:100 Millipore Cat# MAB 4304, RRID: AB_177629 Mouse anti- TRA-1-81 1:100 Stemgent Cat# 09–0069, RRID: AB_2119069 Rat anti- SSEA3 1:100 Thermo Fisher Cat# MA 1–020, RRID: AB_2536682 Differentiation Markers Rabbit anti- PAX6 1:500 Covance Cat# PRB-278P, RRID: AB_291612 Mouse anti- SMA 1:300 Sigma-Aldrich Cat# A5228, RRID: AB_262054 Mouse anti- AFP 1:20 R & D Systems Cat# MAB1368, RRID: AB_357658 Secondary antibodies Donkey anti- Rabbit 594 1:500 Thermo Fisher Scientific Cat# A-21207, RRID: AB_141637 Donkey anti- Mouse 488 1:500 Thermo Fisher Scientific Cat# A-21202, RRID: AB_141607 Rabbit anti- Rat 1:500 Invitrogen Cat# A21210, RRID: AB_2535796 Primers Target, size (bp) Forward/Reverse primer (5′-3′) SeV genome silencing (RTPCR) SeV, 181 GGATCACTAGGTGATATCGAGC/ ACCAGACAAGAGTTTAAGAGATATGTATC KOS, 528 ATGCACCGCTACGACGTGAGCGC/ ACCTTGACAATCCTGATGTGG KLF4, 410 TTCCTGCATGCCAGAGGAGCCC/ AATGTATCGAAGGTGCTCAA cMYC, 532 TAACTGACTAGCAGGCTTGTCG/ TCCACATACAGTCCTGGATGATGATG House-Keeping Gene (RTPCR) GAPDH, 86 ACGACCCCTTCATTGACCTCAACT/ ATATTTCTCGTGGTTCACACCCAT Pluripotency markers (RT- qPCR) NANOG Hs02387400g1 OCT4 Hs01654807s1 House-keeping gene (RT- qPCR) GADPH Hs02786624g1 Targeted mutation analysis/ sequencing Allele c.498–506 del, 262 GCAAGAACTCCTGCCAAC/ AGGCATGTAGCCTCGTTC Allele c.498–506 del, 170 TACTCCTGCTTCTGTGTCC/ GTGATTCAGATATGATCACACTTACC A. Ca˜ nibano-Hern´ andez et al. Stem Cell Research 53 (2021) 102301 4 PCR reaction was performed using MyTaq DNA Polymerase (Bioline GmbH) with the primers listed in Table 2. For Q-PCR, triplicate reactions were prepared with TaqMan Gene expression Master Mix and probes listed in Table 2. 4.5. Immunofluorescence analysis Cells grown in glass coverslips were washed with PBS, fixed in 4% PFA for 15 min, washed twice in PBS and blocked with 2% donkey serum in TPBS (0.2% Triton-X100/PBS) for 1 h. Primary antibody was incubated for 1 h in 1% BSA in TPBS, washed 3 times in TPBS and incubated with secondary antibody diluted in 1% BSA in TPBS for 1 h. After 3 washes, preparations were finished with mounting medium with DAPI. Antibodies are listed in Table 2. 4.6. Alkaline phosphatase Enzymatic activity was detected using AP staining kit II (Stemgent). 4.7. In vitro differentiation iPSC colonies were manually collected and cultured in non-adherent conditions in hESCM without bFGF for 7 days. Embryoid bodies were manually collected and seeded onto gelatinized-glass coverslips, cultured for one week in EBM (DMEM/F12, 10% FBS, 1% GlutaMAX, 1% MEM NEAA, 1% Pen/Strep) and analyzed by immunofluorescence using the antibodies in Table 2. 4.8. Karyotype analysis On passage 11, 30 metaphases were counted and genome integrity was analyzed by G-banding at 400–550 band resolution in Biobanco del SSPA, Granada, Spain. 4.9. Fingerprinting STR analysis was performed form iPSC and PBMC genomic DNA using the GenePrint® 10 System (Promega) in Biobanco del SSPA, Granada, Spain. 4.10. Mycoplasma detection MycoAlert™ PLUS Mycoplasma Detection Kit (Lonza) was used to test for Mycoplasma (Suppl. Fig. 1). Funding This work was supported by Andalusian Ministry of Health, Equality and Social Policies (PI-0099-2018). Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.scr.2021.102301. References Khan K.N., Robson A., Mahroo O.A.R., Arno G., Inglehearn C.F., Armengol M., Waseem N., Holder G. E., Carss K. J., Raymond L.F., Webster A.R., Moore A. T., McKibbin M., van Genderen M.M., Poulter J.A., Michaelides M. & UK Inherited Retinal Disease Consortium, 2018. A clinical and molecular characterisation of CRB1-associated, Eur. J. Human Genetics 26:687–694 doi: 10.1038/s41431-017-0082-2. Quinn, P.M., Pellissier, L.P., Wijnholds, J., 2017. The CRB1 complex: following the trail of crumbs to a feasible gene therapy strategy. Front. Neurosci. 11, 175. https://doi. org/10.3389/fnins.2017.00175. A. Ca˜ nibano-Hern´ andez et al.