Full text
1"
"
The$ sRNA$ NsiR4$ is# in ol ed# in# ni ogen( assimila ion!con ol' in#
cyanobac e ia!by# a ge ing!glu amine* syn he ase* inac i a ing!
ac o 'IF7!
"
S ephan" Klähn1," Ch is oph" Schaal1," Jens" Geo g1," Desi ée" Baumga ne 1," Ge no " Knippen1,"
Ma in"Hagemann2,"Alicia"M."Mu oAPas o 3"and"Wol gang"R."Hess1*"
"
1Gene ics"&"Expe imen al"Bioin o ma ics,"Facul y"o "Biology,"Uni e si y"o "F eibu g,"Ge many"
2Plan " Physiology" Depa men ," Ins i u e" o " Biological" Sciences," Uni e si y" o " Ros ock,"
Ge many"
3Ins i u o" de" Bioquímica" Vege al" y" Fo osín esis," Consejo" Supe io " de" In es igaciones"
Cien í icas"and"Uni e sidad"de"Se illa,"Spain"
"
*Co esponding" au ho :" Wol gang" R." Hess," Uni e si y" o " F eibu g," Facul y" o " Biology,"
Schänzles ."1,"DA79104"F eibu g,"Ge many;"Tel:"+49A(0)761A203A2796;"Fax:"+49A(0)761A203A
2745"
EAmail:"[email p o ec ed] eibu g.de"
"
Running! i le:"Regula ion"by"cyanobac e ial"sRNA"NsiR4
Classi ica ion:"Biological"Sciences"(Plan "Biology"and"Mic obiology)""
""
2"
"
Abs ac !
Glu amine"syn he ase"(GS),"a"key"enzyme"in"biological"ni ogen"assimila ion,"is" egula ed"in"
mul iple" ways" in" esponse" o" a ying" ni ogen" sou ces" and" le els." He e" we" show" a" small"
egula o y"RNA,"NsiR4"(ni ogen"s ess"induced"RNA"4),"which"plays"an"impo an " ole"in" he"
egula ion"o "GS"in"cyanobac e ia."NsiR4"exp ession"in" he"unicellula "Synechocys is+sp."PCC"
6803"and"in" he" ilamen ous,"ni ogenA ixing"Anabaena"sp."PCC"7120"is"s imula ed" h ough"
ni ogenAlimi a ion" ia" N cA," he" global" ansc ip ional" egula o " o " genes" in ol ed" in"
ni ogen" me abolism." NsiR4" is" widely"conse ed" h oughou " he" cyanobac e ial" phylum,"
sugges ing" a" conse ed" unc ion." In+ silico" a ge " p edic ion," ansc ip ome" p o iling" upon"
pulse" o e exp ession" and" si eAdi ec ed" mu agenesis" expe imen s" using" a" he e ologous"
epo e "sys em"showed" ha "NsiR4"in e ac s"wi h" he"5’UTR"o "gi A+mRNA,"which"encodes"
glu amine" syn he ase" inac i a ing" ac o " IF7." In" Synechocys is," we" obse ed" an" in e se"
ela ionship" be ween" he" le els" o " NsiR4" and" he" accumula ion" o " IF7" in+ i o." This" NsiR4A
dependen "modula ion"o "gi A"(IF7)"mRNA"accumula ion"in luenced" he"glu amine"pool"and"
hus"NH4+"assimila ion" ia"glu amine"syn he ase."As"a"second" a ge ,"we"iden i ied"ss 1528,"a"
hi he o" uncha ac e ized" ni ogenA egula ed" gene." Compe i ion" expe imen s" be ween" wild"
ype" and" an" NsiR4" knockAou " mu an " showed" ha " he" lack" o " NsiR4" led" o" dec eased"
acclima ion" capabili ies" o " Synechocys is" owa ds" oscilla ing" ni ogen" le els." These" esul s"
sugges "a" ole" o "NsiR4"in" he" egula ion"o "ni ogen"me abolism"in"cyanobac e ia,"especially"
o " he"adap a ion" o" apid"changes"in"a ailable"ni ogen"sou ces"and"concen a ions."NsiR4"
is" he" i s "iden i ied"bac e ial"sRNA" egula ing" he"p ima y"assimila ion"o "a"mac onu ien ."
"
Key! wo ds:" egula o y" RNA," Synechocys is," ni ogen" assimila ion," glu amine" syn he ase"
inac i a ing" ac o s"
"
" "
3"
"
Signi icance!S a emen !
Ino ganic"ni ogen"assimila ion"is"p ima ily"pe o med" h ough"pho o ophic"o ganisms" ha "
dona e" o ganic" ni ogen" o" he e o ophic" o ganisms." A" key" enzyme" in" his" p ocess,"
glu amine" syn he ase," is" he" a ge " o " mul iple" egula o y" mechanisms." He e" we" desc ibe"
NsiR4," a" small" egula o y" RNA" ha " educes" he" exp ession" o " IF7," an" inhibi o y" ac o " o "
glu amine" syn he ase" in" cyanobac e ia." The" exp ession" o " NsiR4" is" unde " posi i e" con ol"
h ough" he" ansc ip ion" ac o "N cA."N cA"also"induces" he" ansc ip ion"o " he"glu amine"
syn he ase"gene"and" ep esses" he"gene"encoding"IF7."The e o e,"NsiR4"is"a"new"playe "in"
he"N cAAmedia ed" egula ion"o "ni ogen"assimila ion,"which"is"impo an " o "adap a ions" o"
apid"changes"in"a ailable"ni ogen"sou ces"and"concen a ions.""
" "
4"
"
body!!
In oduc ion!
Cyanobac e ia"o igina ed"oxygenic"pho osyn hesis"and"a e"o "subs an ial"mo phological"and"
physiological"di e si y."In"addi ion" o" he"pho osyn he ic" ixa ion"o "ino ganic"ca bon,"some"
cyanobac e ia" also" ix" a mosphe ic" dini ogen," hence" injec ing" combined" ni ogen" sou ces"
in o" he" biogeochemical" cycles." The e o e," cyanobac e ia" play" an" impo an " ole" in" global"
ca bon" and" ni ogen" cycles" (1," 2)." Unicellula " s ains," such" as" he" nonAdiazo ophic"
Synechocys is+ sp." PCC" 6803" (he ea e " Synechocys is"6803)," and" mul icellula " s ains" wi h"
di e en ia ed"cells,"such"as" he"diazo ophic"Anabaena"sp."PCC"7120"(he ea e "Anabaena"
7120),"ha e"been"es ablished"as"widely"accep ed"model"o ganisms.""
Ni ogen! Assimila ion! in! Cyanobac e ia." Cyanobac e ia" u ilize" di e en " ino ganic" and"
o ganic"sou ces"o "combined"ni ogen,"such"as"ammonium"(NH4+),"ni a e"(NO3A),"ni i e"(NO2A
)"and"u ea,"o "some"amino"acids"(3–6)."In acellula ly,"NO3A,"NO2A"and"u ea"a e"con e ed" o"
NH4+."The"a ailabili y" o "NH4+," he" ene ge ically" mos " a o able" ni ogen" sou ce," ep esses"
he"up ake"o "o he "ni ogen"sou ces"(7)."As"in"euka yo ic"algae"and"plan s," he"key"enzyme"
o "ni ogen"assimila ion"is"glu amine"syn he ase"(GS,"encoded"by"glnA),"which"inco po a es"
NH4+"in o"me abolism" ia" he"amida ion"o "glu ama e" o"glu amine."Subsequen ly,"glu ama e"
syn hase" (glu amine" oxoglu a a e" amido ans e ase," GOGAT)" ca alyzes" he" ans e " o " he"
amide" g oup" om" glu amine" o" 2Aoxoglu a a e" (2AOG)," p oducing" wo" molecules" o "
glu ama e."The"pos A ansla ional"inac i a ion"o "GS"is"a"majo " egula o y"mechanism" o"limi "
ni ogen"assimila ion"and"main ain"C/N"balance."Whe eas"in"E.+coli"and"mos "o he "G amA
nega i e" bac e ia," GS" ac i i y" is" modula ed" h ough" adenyla ion/deadenyla ion" (8),"
cyanobac e ia"ha e"e ol ed"a"unique"mechanism"o "GS"inac i a ion"media ed" h ough" he"
small"inhibi o y"p o eins"(inac i a ing" ac o s)"IF7"and"IF17,"encoded"by" he"genes"gi A"and"
gi B," espec i ely"(9)."In"addi ion" o"i s" unc ion"as"subs a e"o " he"GSAGOGAT"cycle,"2AOG"is"
also"a"me aboli e"o " he"TCA"cycle,"connec ing"ni ogen"and"ca bon"me abolism"a "a"cen al"
poin ."Depending"on" he"ni ogen"o "ca bon"a ailabili y," he"le el"o "2AOG" a ies,"making" his"
me aboli e"an"excellen "indica o "o "ni ogen"s a us"and" he"C/N" a io"(10,"11)."
The!Ni ogen!Regula o y!Ne wo k!in!Cyanobac e ia."A " he"molecula "le el,"2AOG" egula es"
he" ac i i y" o " he" main" ansc ip ional" egula o s" o " ni ogen" assimila ion" (N cA," (12," 13))"
5"
"
and"ca bon"me abolism"(NdhR/CcmR,"(14))."Mo eo e ,"2AOG"also"modula es" he"ac i i y"o "
wo"o he " egula o s"o "cyanobac e ial"ni ogen"me abolism:" he"signal" ansduc ion"p o ein"
PII"and" he" egula o y" ac o "PipX."Depending"on" he"2AOG"le el,"which" e lec s" he"ni ogen"
s a us," PipX" in e ac s" wi h" ei he " N cA" o " PII"(15," 16)." Fo " a" schema ic" o e iew" o " he"
ni ogen" egula o y"ne wo k,"see"Appendix,"Figu e!S1."
The" ni ogen" con ol" ansc ip ion" ac o " N cA" binds" as" a" homodime " o" he" conse ed"
palind omic" sequence"GTAAN8ATAC"(17–20)." Unde " ni ogen" excess" (e.g.," in" p esence" o "
NH4+)," he"2AOG"le el"is"low"and"N cA"is"p esen "in"an"inac i e" o m,"which"has"low"a ini y" o"
i s" a ge "p omo e s"(21)."Unde "ni ogen"deple ion,"howe e ," he"2AOG"le el"inc eases"and"
s imula es" he"complex" o ma ion"be ween"PipX"and"N cA"and" he"a ini y"o " he"binding"o "
his"complex" o" a ge "p omo e s"(22,"23)."Depending"on" he"loca ion"o " he"binding"mo i "
ela i e" o" he" ansc ip ional"s a "si e"(TSS),"N cA"can"ac "as"ei he "an"ac i a o "o " ep esso "
(24)."N cA"ac i a es" he" exp ession" o " genes" ha "a e"impo an " when" ni ogen" is" limi ing,"
such"as"ni ogen"up ake"sys ems"(e.g.,"am 1)"and"componen s" o "NO3A"(e.g.,"ni A)"and"NH4+"
assimila ion"(e.g.,"glnA)"(18)."In"con as ,"upon"ni ogen"deple ion,"N cA"ac s"as"a" ep esso "
o "gi A"and"gi B,"which"encode" he"GS"IFs"(24).""
Bac e ial!Small! RNAs! wi h! Regula o y! Po en ial." Bac e ial" small" RNAs" (sRNAs)" can" pos A
ansc ip ionally" ac i a e" o " ep ess" gene" exp ession" (25)." GenomeAwide" mapping" o " TSSs"
e ealed"a"high"numbe "o "po en ially" egula o y"sRNAs"in"cyanobac e ia"(19,"26,"27)."One"o "
sRNAs," he" ligh A egula ed" and" widely" conse ed" sRNA" Ps R1," is" a" key" egula o " o "
pho osyn hesis"(28).""
The" exp ession"o " some" sRNAs" inc eases" in" ni ogenAlimi ed" cells" o " Anabaena"7120" o "
Synechocys is"6803,"quali ying" hese"molecules" as" po en ial" egula o s"wi hin" he"ni ogen"
egula o y" ne wo k." Acco dingly," hese" sRNAs" we e" named" ni ogen" s ess" induced" RNAs"
(NsiR)." The" exp ession" o " NsiR1+is" induced" upon" ni ogen" deple ion," speci ically" in" cells" o "
Anabaena"7120" ha " a e" di e en ia ing" as" ni ogenA ixing" he e ocys s" (29," 30)." NsiR2" and"
NsiR3"ha e"also"been"iden i ied"in"Anabaena"7120"(19),"bu " he" unc ions"o " hese"molecules"
ha e" emained"enigma ic."NsiR4"was" i s "compu a ionally"p edic ed"in"Synechocys is"6803"
(31)" and" subsequen ly" e i ied" as" an" exp essed" sRNA" (called" SyR12)" in" he" genomeAwide"
mapping" o " TSSs" (26)." NsiR4" is"a"70" n " ansc ip " ha " becomes" s ongly" induced" unde "
ni ogen"deple ion"in"Synechocys is"6803"(27).""
6"
"
He e" we" elucida ed" he" molecula " unc ions" o " NsiR4" h ough" he" iden i ica ion" o " wo"
di e en " a ge s," he" mRNAs" o " gi A" and" ss 1528," he" la e " encoding" a" conse ed" bu "
uncha ac e ized"p o ein."We"p esen "e idence" o "an"addi ional"laye "o "GS" egula ion" ia" he"
di ec " in e ac ion" o " NsiR4" wi h" he" 5’UTR" o " he" mRNA" o " he" GS" inac i a ing" ac o " IF7,"
a ec ing" he" exp ession" o " his" molecule" and" he eby" impac ing" GS" ac i i y" and" NH4+"
assimila ion." Thus," NsiR4" is" he" i s " example" o " an" sRNA" con olling" he" assimila ion" o " a"
mac onu ien ."
Resul s!
NsiR4!is!a!Widely!Conse ed!sRNA!in!Cyanobac e ia."The"phylogene ic"conse a ion"o "an"
sRNA" is" an" indica o " o " unc ionali y." The e o e," we" in es iga ed" whe he " NsiR4" homologs"
a e" also" de ec ed" wi hin" he" mo e" han" 200" cyanobac e ial" genomes" publicly" a ailable"
h ough" he"Join "Genome"Ins i u e"(JGI)"da abase"in"Janua y"2015."Using"Blas N,"pu a i e"
nsiR4"homologs" we e" iden i ied" in" a " leas " 38" addi ional" genomes," including" he" closely"
ela ed"Synechocys is"sp." PCC" 6714" (he ea e " e e ed" o" as" Synechocys is"6714)" (32,"33),"
mo e"dis an ly" ela ed"s ains,"such"as"Synechococcus"sp."PCC"7002,"o "se e al"Anabaena"and"
Nos oc"species" (Fig.! 1A)." Homologs" o " NsiR4" we e" no " ound" in" αAcyanobac e ia" (mainly"
ma ine"P ochlo ococcus"and"Synechococcus),"The mosynechococcus,"Gloeobac e "as"well"as"
some"Oscilla o ia+(Fig.!S2)."We"concluded" ha "nsiR4"homologs"exis "in" ep esen a i es" om"
all" i e" mo phological" subsec ions" bu " no " in" all" cyanobac e ia" (34)," sugges ing" a" widely"
conse ed" unc ion.""
In" addi ion" o" Synechocys is"6803," he" exp ession" o " nsiR4" was" obse ed" in" he"
ansc ip omic"da ase s"a ailable" o "Synechocys is"6714,"Anabaena"7120"and"Synechococcus+
sp." PCC" 7002"(19," 35," 36)." The" genomic" in o ma ion" and" mapped" TSSs" indica ed" ha " wo"
dis inc "NsiR4" o ms"o "di e en "leng hs"exis "in"di e en "cyanobac e ia."NsiR4"in"s ains"wi h"
he"longe " o m"(e.g.,"Synechocys is,"Mic ocys is,+Cyano hece)"possesses"an"addi ional"19A20"
n "domain"a " he"5’"end,"capable" o" o m"a"sho "hai pin"(Fig.!1A,B)."O he wise," he"p edic ed"
seconda y"s uc u es"appea ed"simila " o "bo h"NsiR4" ypes,"sugges ing"a"po en ial" ole" o "
he"16"n "singleAs anded" egion,"which"is"nea ly"iden ical"in"all"NsiR4"sequences"(Fig.!1A,B)."
Such" egions" acili a e"in e ac ions"wi h" he" espec i e" a ge "mRNAs.""
7"
"
NsiR4!Exp ession!is!Associa ed!wi h! he!Ni ogen!S a us!and!Posi i ely!Regula ed! h ough!
N cA." NsiR4" is" one" o " he" mos " highly" induced" sRNAs" upon" ni ogen" deple ion" in"
Synechocys is"6803"(27)"and"is" he"secondAmos "abundan "sRNA"in" he"p ima y" ansc ip ome"
(37)."To"de e mine" he" ime"cou se"o "induc ion"and"po en ial"e ec s"o "di e en "ni ogen"
sou ces,"we"measu ed"NsiR4"exp ession"in"wildA ype"(WT)"Synechocys is"6803"g own"unde "
s anda d"condi ions"(ni ogenA eple e,"17.6"mM"NO3A)"and"a e " ans e "in o"ni ogenA ee"
medium."NsiR4"was"de ec ed"a "a"low"le el"in"cells"g own"in" he"p esence"o "NO3A,"s a ed" o"
accumula e"a "a" highe " le el" 12" h"a e " emo ing"NO3A."A e "48A72" h," he" exp ession" was"
app oxima ely" 10A old" highe " han" a " he" s a " o " he" expe imen " (Fig.! 1C,!le " panel)." To"
examine" he"in luence"o " he"ni ogen"sou ce," h ee"WT"cul u es"we e"ini ially"g own"unde "
s anda d" condi ions" and" hen" ans e ed" o" ni ogenA ee" medium." In o" wo" o " hese"
cul u es,"we"added"10"mM"NH4+"o "17.6"mM"NO3A,"cul i a ion"was"con inued" o "24"h,"and"
he" ela i e"NsiR4"abundance"was"analyzed."App oxima ely"10A old"highe "NsiR4"exp ession"
was"obse ed"in"ni ogenAdeple ed"cells"compa ed"wi h"cells"g own"in" he"p esence"o "NO3A."
In"con as ,"in" he"p esence"o "NH4+,"NsiR4"le els" emained"below" he"de ec ion"limi "(Figu e!
1C," igh " panel)." We"concluded" ha " he" exp ession"o "NsiR4" is"in luenced"by" he" ni ogen"
s a us" o " he" cell." Mo eo e ," NsiR4" exp ession" is" also" egula ed" h ough" ni ogen" in"
Synechocys is"6714"and"Anabaena+7120"(19,"35),"sugges ing"a"conse ed" unc ion"associa ed"
wi h"ni ogen"me abolism."
To" examine" whe he " he" ni ogenA egula ed" exp ession" o " NsiR4" is" unde " ansc ip ional"
con ol," we" conduc ed" epo e " gene" assays." The" ups eam" sequence" o "nsiR4+ om"
Synechocys is+ 6803" was" used" o" luxAB"genes" encoding" luci e ase," and" exp ession" was"
measu ed"as"bioluminescence"in+ i o."Indeed," he"p omo e "ac i i y"showed"simila "kine ics"
in" esponse" o"ni ogen"deple ion,"as"obse ed" o " he"sRNA"accumula ion"(Fig.!2A)."In"N cAA
ac i a ed"p omo e s,"N cAAbinding"si es" equen ly"o e lap" he"A35" egion"and"a e"cen e ed"
close" o" posi ion" A41.5" wi h" espec " o" he" TSS" (18," 19)." Indeed," he" sequence" 5’A
GTCAAATAGGCTACA3’,"simila " o" he"consensus" o "N cA"binding"si es"(17),"is"loca ed"48A35"
n "ups eam" he"TSS"o "nsiR4"(a " pos."1289326"on" he"complemen a y"s and)." Mo eo e ,"
po en ial" N cA" binding" si es" exis " ups eam" o " he" pu a i e" nsiR4"homologs" in" all" o he "
s ains" (Figu e! 2C)."We" examined" he" unc ionali y" o " his" si e" in" a" epo e " gene" assay"
compa ing" he" WT" p omo e " wi h" a" mu a ed" e sion" in" which" h ee" nucleo ides" we e"
subs i u ed" (GTCAAATAGGCTAC" o" CTCAAATAGGCATC)." Indeed," he" ac i a ion" o " luxAB"
8"
"
exp ession" h ough"ni ogen"deple ion"was"los "in" he"s ain"ca ying" he"mu a ed"p omo e "
(Fig.!2B)."Mo eo e ,"NsiR4"exp ession"could"no "be"ac i a ed"in" he"ni ogenAdeple ed"cells"
o " an" Anabaena"7120"n cA" mu an " (Fig.! 2D)." These" da a" demons a e" ha " he" NsiR4"
p omo e "is"unde "N cA"con ol"in"bo h"Synechocys is+6803"and"Anabaena"7120.""
Ad anced!Ta ge !P edic ion!and!T ansc ip ome!Analyses!Sugges !gi A!and!ss 1528!as!NsiR4!
Ta ge s."To"p edic "po en ial" a ge s"o "NsiR4,"we"used" he"Cop aRNA"algo i hm,"conside ing"
he" olding,"hyb idiza ion"and"conse a ion"o "a"pa icula "sRNA"(38)."The"highes "in e ac ion"
p obabili y"was"p edic ed" o " he"gi A"(ssl1911)"mRNA"(Table!1)."This"gene"encodes" he"GS"
inac i a ing" ac o "IF7"and"is"also,"bu "nega i ely," egula ed" h ough"N cA.""
To"iden i y"po en ial" a ge "genes"expe imen ally,"we"gene a ed"Synechocys is"s ains"wi h"
al e ed" NsiR4" exp ession," i.e.," o e exp ession" (NsiR4oex)," knockou "(∆nsiR4)" and"
compensa o y" (∆nsiR4::oex)" s ains." To" achie e" inducible"exp ession," we" used" he" NsiR4"
sequence" o" he"pe E"p omo e ,"which"is"speci ically"ac i a ed"in" he"p esence"o "Cu2+."The"
absence"o "NsiR4"in" he"knockou "s ain"and" he"Cu2+Adependen "inducibili y"o "NsiR4"in" he"
o he " wo"s ains"we e"expe imen ally" e i ied"(Fig.!S3)."
The" a ge AsRNA" in e ac ion" equen ly" educes" mRNA" s abili y" (39)." Thus," a" mic oa ay"
expe imen " was" pe o med" wi h" RNA" ex ac ed" om"cells" in" which" NsiR4" was" pulseA
exp essed" h ough" he"addi ion"o "Cu2+" o "12"h."Compa ed"wi h"WT,"in"NsiR4oex" educed"
gi A+ mRNA" abundance" was" obse ed," o " which" an" in e ac ion" was" also" p edic ed" by" he"
Cop aRNA" algo i hm" (compa e" Table! 1"&" Table! S1)." Addi ionally," gi A"exp ession" was"
inc eased" in" ∆nsiR4,"bu " dec eased" upon" in oduc ion" o " he" compensa o y" cons uc "
(∆nsiR4::oex)"(Table!S1)."Ano he "gene,"ss 1528,"exhibi ed"a"simila "pa e n,"sugges ing" ha "
his"gene"is"a"second" a ge "o "NsiR4."The"p oduc "o "ss 1528+is"a"hypo he ical"p o ein,"wi h"a"
domain" (DUF4090)" widely" conse ed" among" cyanobac e ia" (Fig.! S2)." Mo eo e ," simila " o"
gi A," he"exp ession"o " his"p o ein"is" ep essed"unde "ni ogen"deple ion"(40),"sugges ing"a"
unc ion" ela ed" o" he"cellula "ni ogen"s a us."
We"specula ed" ha " he"modula ion"o "NsiR4"exp ession"and"i s"po en ial"impac "on"ni ogenA
associa ed" a ge "genes"migh "also"a ec "g ow h"o " he" ole ance" o"high"concen a ions"o "
NH4+." In" sho A e m" g ow h" expe imen s" s ains" wi h" al e ed" le els" o " NsiR4" showed" no"
no iceable" pheno ype" ega ding" NH4+" ole ance" (Fig.! S4)." Howe e ," in" longA e m" g ow h"
compe i ion" expe imen s," especially" when" he" a ailabili y" o " ni ogen" is" luc ua ing," he"
9"
"
ΔnsiR4"mu an "s ain"showed" educed"g ow h" a es"compa ed" o"WT"(Fig.!3)."These" indings"
di ec ly" suppo " he" physiological" impo ance" o " NsiR4" in" addi ion" o" i s" e olu iona y"
conse a ion," sugges ing" ha " he" p esence" o " NsiR4" has" been" unde " posi i e" selec ion" in"
cyanobac e ia.""
The! ss 1528!Gene! is! Di ec ly! and! Pos OT ansc ip ionally! Regula ed! h ough! NsiR4." The"
changes"obse ed"in" he"mic oa ay"expe imen "we e" e i ied" h ough"a"de ailed"exp ession"
analysis."The"exp ession"o "ss 1528+was"de ec ed"in"WT"unde "s anda d"condi ions"(17.6"mM"
NO3A)," which" was" no " signi ican ly" a ec ed" by" he" addi ion" o " Cu2+" (Fig.! 4A)." Howe e ," in"
s ain" NsiR4oex" ca ying" an" addi ional," Ppe EA egula ed" nsiR4"copy," ss 1528" mRNA"
abundance" was" diminished" upon" NsiR4" induc ion." Consis en ly," ss 1528" mRNA" abundance"
inc eased"in"s ain"∆nsiR4"compa ed" o"WT."In" esponse" o"ni ogen"deple ion," he"ss 1528"
mRNA" le els" dec eased" in" WT" and" NsiR4oex," con i ming" he" NA egula ed" exp ession."
Howe e ," whe eas" he" ss 1528" mRNA" disappea ed" in" WT" a e " 12" h" N" deple ion," he"
exp ession" o " his" gene" emained" a " a" high" le el" in" ∆nsiR4" (Fig.! 4A)." Mo eo e ," ss 1528"
exp ession"did"no "inc ease"when"10"mM"NH4+"was"added" o" he"medium"(Fig.!S5),"indica ing"
ha " he"dec ease"unde "N"deple ion"is"no "di ec ly"N cAAdependen "and"migh "be"exclusi ely"
egula ed" h ough"NsiR4"a " he"pos A ansc ip ional"le el."
To" examine" whe he " a" di ec " NsiR4:ss 1528" in e ac ion" caused" he" obse ed" changes" in"
mRNA" exp ession," he" ss 1528" 5’UTR" was" used" o" he" gene" o " he" supe olde " g een"
luo escen " p o ein" (sg p)" and" coAexp essed" wi h" NsiR4" in" E.+ coli." GFP" luo escence" was"
measu ed" in" s ains" ca ying" a ious" combina ions" o " plasmids" (41)." Compa ed" wi h" he"
con ol"(pXGA0+pJV300)," he"s ain"ca ying" he"ss 1528Ksg p" usion"showed"signi ican "GFP"
luo escence," demons a ing" ha " he" ansla ion" ini ia ion" om" he" ss 1528"5’UTR"o "
Synechocys is"is"also" unc ional"in"E.+coli"(Fig.!4B)."In" he"p esence"o " he"NsiR4Aexp essing"
plasmid," he" GFP" luo escence" dec eased" app oxima ely" 2A old," indica ing" a" di ec "
in e ac ion"be ween"NsiR4"and" he"ss 1528A5’UTR,"which" a ec s" ansla ion." To" e i y" he"
in e ac ion"a " he"p edic ed"si e,"poin "mu a ions"we e"in oduced"in"ss 1528"(pos."+22"and"
+23:"UA>AU,"+1"="TSS)"o "NsiR4"(pos."+16"and"+17:"UA>AU,"Fig.!4D)."Indeed," he"mu a ion"o "
ei he "one"o " hese"sequences"diminished" he"in e ac ion,"indica ed"as" educed" ep ession"
(Fig.!4C)."Howe e ," he"combina ion"o "bo h"mu a ions" es o ed" ep ession"(bo h"mu a ions"
16"
"
epo e " s ains" and" bioluminescence" measu emen s" we e" pe o med" as" desc ibed" (52)."
Ta ge " p edic ion" was" pe o med" using" Cop aRNA" (38," 42)" wi h" he" NsiR4" homologs" o "
Synechocys is"6803," Mic ocys is+ ae uginosa" NIESA843," Cyano hece"sp." ATCC" 51142,"
Cyano hece"sp." PCC" 7424," Cyano hece"sp." PCC" 7822," Synechococcus"sp." PCC" 7002,"
Pleu ocapsa"sp."PCC"7327"and"S anie ia+cyanosphae a"PCC"7437"and"de aul "se ings."
RNA!ex ac ion,!mic oa ays!and!No he n!blo s."The"collec ion"o "Synechocys is"cells," he"
RNA"ex ac ion,"DNase" ea men ,"labeling"and"hyb idiza ion" o"mic oa ays"was"pe o med+
as"p e iously"desc ibed"(55,"56,"57)."Fo "No he n"hyb idiza ion,"Synechocys is"6803"RNA"was"
sepa a ed" on" dena u ing" aga ose" gels," ans e ed" o" HybondAN+" memb anes" (Ame sham,"
Ge many)"and"hyb idized"as"p e iously"desc ibed"(55).""
P o ein! ex ac ion! and! immunoblo s." Fo " analysis" o " IF" accumula ion," 2" µM" CuSO4" was"
added" o"induce" he"pe E"p omo e "eigh "hou s"be o e"addi ion"o "10"mM"NH4Cl"and"20"mM"
TESANaOH"(pH"7.5)."Ex ac s"we e"p epa ed"using"glass"beads"as"p e iously"desc ibed"(56)."
P o eins" we e" ac iona ed" by"15%" SDSAPAGE" and" immunoblo ed" wi h" an iAIF7" (1:2000),"
an iAIF17" (1:2000)" o " an iAT xA" (1:3000)." An iAIF7," an iAIF17" and" an iAT xA" an ise a" we e"
ob ained" om"M.I."Mu oAPas o "and"F.J."Flo encio"and"used"as"desc ibed"(57,"58).""
Repo e ! assays! o ! he! in, i o! e i ica ion! o ! a ge s." We" used" he" epo e " sys em"
desc ibed"be o e"(59)"wi h"sGFP"plasmid"pXGA10ASF"(41)."The"p ime s"used" o "cloning"and"
he" esul ing" plasmids" a e" gi en" in" Tables! S2! and! S3." Fu he " de ails" o " he" gene a ion" o "
es ed"cons uc s"can"be" ound"in" he"SI!Appendix.""
Quan i ica ion!o !amino!acids."Cells"we e"g own"in"100"ml"BG11"con aining"17.6"mM"NO3A."
A e " eaching"an"OD750"o "ca."0.8,"2"µM"CuSO4" and"a e " u he "24"h"10"mM"NH4Cl"we e"
added." Samples" o " 2" ml" we e" aken" p io " o" and" in" a" na ow" ime" se ies" a e " adding"
ammonia."Samples"we e"sho ly"cen i uged"and"cell"pelle s" ozen"in"liquid"ni ogen."F ee"
amino"acids"we e"ex ac ed" om" ozen"cyanobac e ial"cells"wi h"80%"e hanol"a "65°C" o "3"
h."A e "cen i uga ion," he"ex ac ion"was" epea ed" o " he" emaining"cell"pelle ."A e wa ds,"
bo h"supe na an s"we e"combined,"d ied"in"a" acuum"cen i uge"and" eAdissol ed"in"sample"
bu e ."Indi idual"amino"acids"we e"quan i ied" ia"HPLC"(60)."
"
17"
"
Au ho !con ibu ions!
S.K.," J.G.," A.M.M.AP." &" W.R.H." designed" and" supe ised" he" s udy." J.G." &" C.S." pe o med"
genome" analysis" and" a ge " p edic ion." S.K." &" J.G." gene a ed" he" Synechocys is"nsiR4"
mu an s." S.K.," D.B." &" G.K." pe o med" p omo e " analysis." C.S." &" A.M.M.AP." pe o med"
no he n" blo s." A.M.M.AP." pe o med" wes e n" blo " expe imen s." C.S." pe o med" a ge "
e i ica ion" expe imen s." M.H." con ibu ed" he" amino" acid" da a." S.K." pe o med" he"
mic oa ay"da a"analysis,"g ow h"compe i ion"assay"and"p epa ed"all" igu es."S.K.,"A.M.M.AP."
&"W.R.H."e alua ed"and"in e p e ed" he"da a"and"d a ed" he"manusc ip "wi h"con ibu ions"
om"all"au ho s."All"au ho s"p oo ead" he"manusc ip ."
Acknowledgmen s!
This" wo k" was" suppo ed" h ough" g an s" om" he" Fede al" Minis y" o " Educa ion" and"
Resea ch"“e:bio"CYANOSYSII”"0316183"( o"W.R.H."and"M.H.)"and" he"Minis e io"de"Economía"
y"Compe i i idad,"Spain"(g an "BFU2013A48282AC2A1AP" o"A.M.M.AP,"co inanced" h ough" he"
Eu opean"Regional"De elopmen "Fund)."The"au ho s" hank"Gud un"K üge "and"Klaudia"Michl"
o " echnical"assis ance."We" hank"M.I."Mu oAPas o "and"F.J."Flo encio" o "p o iding"an ise a.""
" "
18"
"
Re e ences!
1."" Mon oya" JP," e " al." (2004)" High" a es" o " N2" ixa ion" by" unicellula " diazo ophs" in" he"
oligo ophic"Paci ic"Ocean."Na u e"430(7003):1027–1032."
2."" LaRoche" J," B ei ba h" E" (2005)" Impo ance" o " he" diazo ophs" as" a" sou ce" o " new"
ni ogen"in" he"ocean."J+Sea+Res+53(1–2):67–91."
3."" Oma a" T," And iesse" X," Hi ano" A" (1993)" Iden i ica ion" and" cha ac e iza ion" o " a" gene"
clus e "in ol ed"in"ni a e" anspo "in" he"cyanobac e ium"Synechococcus"sp."PCC7942."
Mol+Gen+Gene "236(2A3):193–202."
4."" Mon esinos" ML," He e o" A," Flo es" E" (1997)" Amino" acid" anspo " in" axonomically"
di e se"cyanobac e ia"and"iden i ica ion"o " wo"genes"encoding"elemen s"o "a"neu al"
amino" acid" pe mease" pu a i ely" in ol ed" in" ecap u e" o " leaked" hyd ophobic" amino"
acids."J+Bac e iol"179(3):853–862."
5."" Mon esinos" ML," Mu oAPas o " AM," He e o" A," Flo es" E" (1998)"
Ammonium/me hylammonium" pe meases" o " a" cyanobac e ium." Iden i ica ion" and"
analysis" o " h ee" ni ogenA egula ed" am "genes" in" Synechocys is"sp." PCC" 6803." J+ Biol+
Chem"273(47):31463–31470."
6."" Vallada es"A,"Mon esinos"ML,"He e o"A,"Flo es"E"(2002)"An"ABCA ype,"highAa ini y"u ea"
pe mease"iden i ied"in"cyanobac e ia."Mol+Mic obiol"43(3):703–715."
7."" Flo es"E,"He e o"A"(2005)"Ni ogen"assimila ion"and"ni ogen"con ol"in"cyanobac e ia."
Biochem+Soc+T ans"33(P "1):164–167."
8."" Me ick"MJ,"Edwa ds"RA"(1995)"Ni ogen"con ol"in"bac e ia."Mic obiol+Re "59(4):604–
622."
9."" Ga cíaADomínguez"M,"Reyes"JC,"Flo encio"FJ"(1999)"Glu amine"syn he ase"inac i a ion"
by"p o ein–p o ein"in e ac ion."P oc+Na l+Acad+Sci+USA"96(13):7161–7166."
10."" Mu oAPas o "MI,"Reyes"JC,"Flo encio"FJ"(2001)"Cyanobac e ia"pe cei e"ni ogen"s a us"
by"sensing"in acellula "2Aoxoglu a a e"le els."J+Biol+Chem"276(41):38320–38328."
11."" Fo chhamme " K" (2004)" Global" ca bon/ni ogen" con ol" by" PII" signal" ansduc ion" in"
cyanobac e ia:" om"signals" o" a ge s."FEMS+Mic obiol+Re "28(3):319–333."
12."" VázquezABe múdez"MF,"He e o"A,"Flo es"E"(2002)"2AOxoglu a a e"inc eases" he"binding"
a ini y"o " he"N cA"(ni ogen"con ol)" ansc ip ion" ac o " o " he"Synechococcus+glnA"
p omo e ."FEBS+Le "512(1A3):71–74."
13."" Tanigawa" R," e " al." (2002)" T ansc ip ional" ac i a ion" o " N cAAdependen " p omo e s" o "
Synechococcus"sp." PCC" 7942" by" 2Aoxoglu a a e" in+ i o." P oc+ Na l+ Acad+ Sci+ USA"
99(7):4251–4255."
19"
"
14."" Daley"SME,"Kappell"AD,"Ca ick"MJ,"Bu nap"RL"(2012)"Regula ion"o " he"cyanobac e ial"
CO2Aconcen a ing"mechanism" in ol es" in e nal"sensing"o " NADP+" and"αAke ogu a a e"
le els"by" ansc ip ion" ac o "CcmR."PLoS+ONE"7(7):e41286."
15."" Lláce " JL," e " al." (2010)" S uc u al" basis" o " he" egula ion" o " N cAAdependen "
ansc ip ion"by"p o eins"PipX"and"PII."P oc+Na l+Acad+Sci+USA"107(35):15397–15402."
16."" Espinosa" J," e " al." (2014)" PipX," he" coac i a o " o " N cA," is" a" global" egula o " in"
cyanobac e ia."P oc+Na l+Acad+Sci+USA"111(23):E2423–2430."
17."" Luque"I,"Flo es"E,"He e o"A"(1994)"Molecula "mechanism" o " he"ope a ion"o "ni ogen"
con ol"in"cyanobac e ia."EMBO+J"13(12):2862–2869."
18."" He e o" A," Mu oAPas o " AM," Flo es" E" (2001)" Ni ogen" con ol" in" cyanobac e ia." J+
Bac e iol"183(2):411–425."
19."" Mi schke" J," Vioque" A," Haas" F," Hess" WR," Mu oAPas o " AM" (2011)" Dynamics" o "
ansc ip ional"s a "si e"selec ion"du ing"ni ogen"s essAinduced"cell"di e en ia ion"in"
Anabaena"sp."PCC7120."P oc+Na l+Acad+Sci+USA"108(50):20130–20135."
20."" Picossi" S," Flo es" E," He e o" A" (2014)" ChIP" analysis" un a els" an" excep ionally" wide"
dis ibu ion" o " DNA" binding" si es" o " he" N cA" ansc ip ion" ac o " in" a" he e ocys A
o ming"cyanobac e ium."BMC+Genomics"15:22."
21."" Luque"I,"VázquezABe múdez"MF,"PazAYepes"J,"Flo es"E,"He e o"A"(2004)"In+ i o"ac i i y"
o " he"ni ogen"con ol" ansc ip ion" ac o "N cA"is"subjec ed" o"me abolic" egula ion"in"
Synechococcus"sp."s ain"PCC"7942."FEMS+Mic obiol+Le "236(1):47–52."
22."" Espinosa" J," Fo chhamme " K," Bu illo" S," Con e as" A" (2006)" In e ac ion" ne wo k" in"
cyanobac e ial" ni ogen" egula ion:" PipX," a" p o ein" ha " in e ac s" in" a" 2Aoxoglu a a e"
dependen "manne "wi h"PII"and"N cA."Mol+Mic obiol"61(2):457–469."
23."" Fo cadaANadal"A,"Fo chhamme "K,"Rubio"V"(2014)"SPR"analysis"o "p omo e "binding"o "
Synechocys is"PCC6803" ansc ip ion" ac o s" N cA" and" CRP" sugges s" c ossA alk" and"
sheds"ligh "on" egula ion"by"e ec o "molecules."FEBS+Le "588(14):2270–2276."
24."" Ga cíaADomínguez"M,"Reyes"JC,"Flo encio"FJ"(2000)"N cA" ep esses" ansc ip ion"o "gi A"
and" gi B," genes" ha " encode" inhibi o s" o " glu amine" syn he ase" ype" I" om"
Synechocys is"sp."PCC"6803."Mol+Mic obiol"35(5):1192–1201."
25."" Wa e s"LS,"S o z"G"(2009)"Regula o y"RNAs"in"bac e ia."Cell"136(4):615–628."
26."" Mi schke"J,"e "al."(2011)"An"expe imen ally"ancho ed"map"o " ansc ip ional"s a "si es"
in" he" model" cyanobac e ium" Synechocys is"sp." PCC6803." P oc+ Na l+ Acad+ Sci+ USA"
108(5):2124–2129."
27."" Kop " M," e " al." (2014)" Compa a i e" analysis" o " he" p ima y" ansc ip ome" o "
Synechocys is"sp."PCC"6803."DNA+Res"21(5):527–539."
20"
"
28."" Geo g" J," e " al." (2014)" The" small" egula o y" RNA" SyR1/Ps R1" con ols" pho osyn he ic"
unc ions"in"cyanobac e ia."Plan +Cell"26(9):3661–3679."
29."" Ionescu" D," Voss" B," O en" A," Hess" WR," Mu oAPas o " AM" (2010)" He e ocys Aspeci ic"
ansc ip ion"o "NsiR1,"a"nonAcoding"RNA"encoded"in"a" andem"a ay"o "di ec " epea s"in"
cyanobac e ia."J+Mol+Biol"398(2):177–188."
30."" Mu oAPas o "AM"(2014)"The"he e ocys Aspeci ic"NsiR1"small"RNA"is"an"ea ly"ma ke "o "
cell"di e en ia ion"in"cyanobac e ial" ilamen s."MBio"5(3):e01079–01014."
31."" Voss"B,"Geo g"J,"Schön"V,"Ude"S,"Hess"WR"(2009)"Biocompu a ional"p edic ion"o "nonA
coding"RNAs"in"model"cyanobac e ia."BMC+Genomics"10:123."
32."" Kop "M,"e "al."(2014)"Compa a i e"genome"analysis"o " he"closely" ela ed"Synechocys is"
s ains"PCC"6714"and"PCC"6803."DNA+Res"21(3):255–266."
33."" Kop " M," e " al." (2014)" Finished" Genome" Sequence" o " he" Unicellula " Cyanobac e ium"
Synechocys is" sp." S ain" PCC" 6714." Genome+ Announc"2(4)."
doi:10.1128/genomeA.00757A14."
34."" Rippka" R," De uelles" J," Wa e bu y" JB," He dman" M," S anie " RY" (1979)" Gene ic"
assignmen s," s ain" his o ies" and" p ope ies" o " pu e" cul u es" o " cyanobac e ia." J+ Gen+
Mic obiol"111(1):1–61."
35."" Kop " M," Klähn" S," Scholz" I," Hess" WR," Voss" B" (2015)" Va ia ions" in" he" nonAcoding"
ansc ip ome" as" a" d i e " o " in e As ain" di e gence" and" physiological" adap a ion" in"
bac e ia."Scien i ic+Repo s"5:9560."
36."" Ludwig" M," B yan " DA" (2012)" Acclima ion" o " he" global" ansc ip ome" o " he"
cyanobac e ium"Synechococcus"sp."s ain"PCC"7002" o"nu ien "limi a ions"and"di e en "
ni ogen"sou ces."F on +Mic obiol"3:145."
37."" Kop " M," Hess" WR" (2015)" Regula o y" RNAs" in" pho osyn he ic" cyanobac e ia." FEMS+
Mic obiol+Re "39(3):301–315."
38."" W igh " PR," e " al." (2013)" Compa a i e" genomics" boos s" a ge " p edic ion" o " bac e ial"
small"RNAs."P oc+Na l+Acad+Sci+USA"110(37):E3487–3496."
39."" Vogel"J,"Wagne "EGH"(2007)"Ta ge "iden i ica ion"o "small"noncoding"RNAs"in"bac e ia."
Cu +Opin+Mic obiol"10(3):262–270."
40."" K asiko "V,"Agui e" on"Wobese "E,"Dekke "HL,"Huisman"J,"Ma hijs"HCP"(2012)"TimeA
se ies" esolu ion"o "g adual"ni ogen"s a a ion"and"i s"impac "on"pho osyn hesis"in" he"
cyanobac e ium"Synechocys is"PCC"6803."Physiol+Plan a um"145(3):426–439."
41."" Co co an"CP,"e "al."(2012)"Supe olde "GFP" epo e s" alida e"di e se"new"mRNA" a ge s"
o " he"classic"po in" egula o ,"MicF"RNA."Mol+Mic obiol"84(3):428–445."
42."" W igh "PR,"e "al."(2014)"Cop aRNA"and"In aRNA:"p edic ing"small"RNA" a ge s,"ne wo ks"
and"in e ac ion"domains."Nucleic+Acids+Res"42:W119–123."
21"
"
43."" Wenne " N," Maes" A," Co adoASampayo" M," Lapouge" K" (2014)" N sZ:" a" no el," p ocessed,"
ni ogenAdependen ," small" nonAcoding" RNA" ha " egula es" Pseudomonas+ ae uginosa"
PAO1" i ulence."En i on+Mic obiol"16(4):1053–1068."
44."" Sha ma" CM," e " al." (2011)" Pe asi e" pos A ansc ip ional" con ol" o " genes" in ol ed" in"
amino" acid" me abolism" by" he" H qAdependen " Gc B" small" RNA." Mol+ Mic obiol"
81(5):1144–1165."
45."" B aue "MJ,"e "al."(2006)"Conse a ion"o " he"me abolomic" esponse" o"s a a ion"ac oss"
wo"di e gen "mic obes."P oc+Na l+Acad+Sci+USA"103(51):19302–19307."
46."" Yuan"J,"e "al."(2009)"Me abolomicsAd i en"quan i a i e"analysis"o "ammonia"assimila ion"
in"E.+coli."Mol+Sys +Biol"5:302."
47."" Saelices"L,"RoblesARengel"R,"Flo encio"FJ,"Mu oAPas o "MI"(2015)"A"co e"o " h ee"amino"
acids"a " he"ca boxylA e minal" egion"o "glu amine"syn he ase"de ines"i s" egula ion"in"
cyanobac e ia."Mol+Mic obiol."96(3):483A496."
48."" Maheswa an"M,"U banke"C,"Fo chhamme "K"(2004)"Complex"Fo ma ion"and"Ca aly ic"
Ac i a ion" by" he" PII" Signaling" P o ein" o " NAAce ylAlAglu ama e" Kinase" om"
Synechococcus+elonga us"S ain"PCC"7942."J+Biol+Chem"279(53):55202–55210."
49."" Mangan" S," Alon" U" (2003)" S uc u e" and" unc ion" o " he" eedA o wa d" loop" ne wo k"
mo i ."P oc+Na l+Acad+Sci+USA"100(21):11980–11985."
50."" Beisel" CL," S o z" G" (2011)" The" baseApai ing" RNA" spo " 42" pa icipa es" in" a" mul iou pu "
eed o wa d" loop" o" help" enac " ca aboli e" ep ession" in" Esche ichia+ coli." Mol+ Cell"
41(3):286–297."
51."" F ías"JE,"Flo es"E,"He e o"A"(1994)"Requi emen "o " he" egula o y"p o ein"N cA" o " he"
exp ession" o " ni ogen" assimila ion" and" he e ocys " de elopmen " genes" in" he"
cyanobac e ium"Anabaena"sp."PCC"7120."Mol+Mic obiol"14(4):823–832."
52."" Klähn" S," e " al." (2014)" Alkane" biosyn hesis" genes" in" cyanobac e ia" and" hei "
ansc ip ional"o ganiza ion."F on +Bioeng+Bio echnol"2:24."
53."" Hein"S,"Scholz"I,"Voß"B,"Hess"WR"(2013)"Adap a ion"and"modi ica ion"o " h ee"CRISPR"
loci"in" wo"closely" ela ed"cyanobac e ia."RNA+Biol"10(5):852–864."
54.""Geo g" J," e " al." (2009)" E idence" o " a" majo " ole" o " an isense" RNAs" in" cyanobac e ial"
gene" egula ion."Mol+Sys +Biol"5:305."
55."" S eglich"C,"e "al."(2008)"The"challenge"o " egula ion"in"a"minimal"pho oau o oph:"nonA
coding"RNAs"in"P ochlo ococcus."PLoS+Gene "4(8):e1000173."
56."" Reyes"JC,"Flo encio"FJ"(1995)"A"no el"mechanism"o "glu amine"syn he ase"inac i a ion"
by"ammonium"in" he"cyanobac e ium"Synechocys is" sp."PCC" 6803."In ol emen "o "an"
inac i a ing"p o ein."FEBS+Le "367(1):45–48."
22"
"
57."" Na a o" F," Ma ínAFigue oa" E," Flo encio" FJ" (2000)" Elec on" anspo " con ols"
ansc ip ion" o " he" hio edoxin" gene" ( xA)" in" he" cyanobac e ium" Synechocys is"sp."
PCC"6803."Plan +Mol+Biol"43(1):23–32."
58."" Galmozzi" CV," Fe nándezAA ila" MJ," Reyes" JC," Flo encio" FJ," Mu oAPas o " MI" (2007)" The"
ammoniumAinac i a ed"cyanobac e ial"glu amine"syn he ase"I"is" eac i a ed"in+ i o"by"a"
mechanism" in ol ing" p o eoly ic" emo al" o " i s" inac i a ing" ac o s." Mol+ Mic obiol"
65(1):166–179."
59."" U ban"JH,"Vogel"J"(2007)"T ansla ional"con ol"and" a ge " ecogni ion"by"Esche ichia+coli"
small"RNAs"in+ i o."Nucleic+Acids+Res"35(3):1018–1037."
60."" Hagemann" M," Vinnemeie " J," Obe pichle " I," Bold " R," Bauwe" H" (2005)" The" glycine"
deca boxylase"complex"is"no "essen ial" o " he"cyanobac e ium"Synechocys is"sp."s ain"
PCC"6803."Plan +Biol+(S u g)"7(1):15–22."
61."" Smi h" C," Heyne" S," Rich e " AS," Will" S," Backo en" R" (2010)" F eibu g" RNA" Tools:" a" web"
se e "in eg a ing"INTARNA,"EXPARNA"and"LOCARNA."Nucleic+Acids+Res"38i:W373–377."
"" "
23"
"
Figu e!Legends!
"
Fig.!1:!The!ni ogenOs ess!induced!RNA!4!(NsiR4)!is!b oadly!conse ed!in!cyanobac e ia."
A:!Alignmen "o "genome"loci"pu a i ely"encoding"NsiR4."Ve i ied"TSSs"a e"boxed"in" ed"(19,"
26," 35)." Roman" Nume als" indica e" he" espec i e" mo phological" subsec ions" (34)." B:!
Conse a ion"o " he"NsiR4"s uc u e."The"consensus"s uc u e"was"p edic ed"using"RNAali old"
(61)" and" 30" andomly" selec ed" NsiR4" homologs" o " bo h" ypes." The" sho " hai pin" was"
p edic ed" o " he" 5’" ex ension" o " long" NsiR4" o ms." The" colo " indica es" he" numbe " o "
di e en "in e ac ing"pai s"(CAG,"GAC,"AAU,"UAA,"GAU"o "UAG)"and" he eby"conse a ion"o " hese"
base" pai s." The" sa u a ion" inc eases" wi h" he" numbe " o " compa ible" base" pai s," hus"
indica ing" he" s uc u al" conse a ion." C:! Ni ogenA esponsi e" exp ession" o " NsiR4" in"
Synechocys is"6803.!Cells"we e" ans e ed" om"s anda d"condi ions"(17.6"mM"NO3A)" o"NO3A
A ee" BG11," o al" RNA" was" sepa a ed," blo ed" and" hyb idized" wi h" 32PAlabeled," singleA
s anded"RNA" p obes."Le "panel:" Exp ession" kine ics"o "NsiR4" in" esponse" o" NAdeple ion."
Righ " panel:" S eadyAs a e" le els" in" esponse" o" he" ni ogen" s a us" media ed" h ough"
di e en "ni ogen"sou ces"o " he"deple ion"o "N."Cells"g own"in" he"p esence"o "NO3A"we e"
washed"and" esuspended"in"media"con aining"17.6"mM"NO3A,"10"mM"NH4+"o "no"ni ogen"
sou ce."The"cells"we e"g own" o "an"addi ional"24"hou s"be o e"RNA"ex ac ion."
"
Fig.!2.!NsiR4!exp ession!is!media ed! h ough!an!N cAOac i a ed!p omo e .!
A:!Bioluminescence"o "a"Synechocys is" epo e "s ain"ha bo ing"a" ansc ip ional" usion"o "
PnsiR4"(A130" o"+49,"TSS"a "+1)"and"luxAB+genes"in" esponse" o"N"deple ion."Ini ially,"cells"
we e"g own"unde "s anda d"condi ions"(17.6"mM"NO3A)"and"subsequen ly" ans e ed" o"NO3A
A ee" BG11" medium." B:! Bioluminescence" o " a" Synechocys is" PnsiR4::luxAB" epo e " s ain"
bea ing"a"mu a ed"N cA"mo i "in" he"p esence"o "17.6"mM"NO3A"(+N)"o "unde "NAdeple ion"
o "24"h"(AN)."To"imp o e"and"compa e"bioluminescence"media ed" h ough"bo h"p omo e s"
unde "+N,"10" mM" glucose" was" added" o" he"cul u es."Thus," he" alues" a e" highe " han" in"
panel" A." Bioluminescence" da a" a e" p esen ed" as" he" means" ±" SD" o " n" independen "
measu emen s"in"a "leas " wo"independen "expe imen s,"including" wo"biological" eplica es"
(="independen " ans o man s)."In"each"expe imen ,"a"s ain"ca ying"a"p omo e less"luxAB"
24"
"
was"used"as"a"nega i e"con ol"(in"each"case"measu ed"in" wo"independen "cul u es,"n=2)."C:!
The"sequences"ups eam"o "nsiR4" om"di e en "cyanobac e ia."Pu a i e"N cA"binding"si es"
and"A10"elemen s"a e"highligh ed."The" e i ied"TSSs"a e"shown"in" ed."D:!Ve i ica ion"o "NA
egula ed" and" N cAAdependen " NsiR4" exp ession" in" Anabaena" 7120" WT" and" an" n cA"
inse ion"mu an " h ough"no he n"blo "analysis."
"
Fig.! 3.!Compe i i e! g ow h! analysis! o ! WT! and! ΔnsiR4.! A:! Expe imen al" se up." Th ee"
independen ,"exponen ially"g owing"cul u es"o "WT"and"ΔnsiR4"we e"dilu ed" o"an"OD750"o "
0.1"and"mixed"1:1."B:"G ow h"pe o mance"du ing"longA e m"cul i a ion."Cul u es"we e" eA
dilu ed"e e y"3"o "4"days" o"an"OD750"o "0.1"and"25"µl"o "a"1:1000"dilu ion"we e"d opped"on"
BG11"aga "pla es"wi h"and"wi hou "40"µg/ml"kanamycin."Da a"a e" he"mean"±"SD"o "WT"and"
ΔnsiR4+as"well"as" h ee"mixed"WT/ΔnsiR4"coAcul u es."Due" o" he"lowe ed"NO3A"con en "(1"
mM"ins ead"o "17.6"mM"NO3A),"a"s ong" luc ua ion"in" he"cellula "N"s a us"could"be"assumed,"
which"was"also"indica ed"by" he"cul u es"swi ching"be ween"g een"o "bleached"appea ance"
a "lowe "(0.1A0.8)"and"highe "(>0.8)"ODs"(see"also"C)."C:!Whole"cell"abso p ion"spec a"o " he"
WT" cul u e" indica ing" cellula " bleaching" was" due" o" pigmen " deg ada ion" as" esponse" o"
ini ia ed"in e nal"N"limi a ion."D:!Numbe "o "gene a ions" ha "we e"obse ed"o e "50"days"a "
a e age" g ow h" a es" o " µ" =" 0.751" ±" 0.065." E:! E olu ion" o " he" a io" be ween" kanamycinA
esis an " (ΔnsiR4)" and" o al" (WT" +" ΔnsiR4)" colony" o ming" uni s" (CFU)" du ing" consecu i e"
cul i a ion"and" eAdilu ion."F:!Pho og aphs"o "CFUs"a " he"beginning"o " he"expe imen "and"
a e "33"and"48"gene a ions"(g)."G:!Ve i ica ion"o " he!ΔnsiR4"mu an "allele" educ ion"(uppe "
band)"compa ed" o" he"WT"allele"(lowe "band)"by"PCR."*To"one"o " he"WT/ΔnsiR4"coAcul u es"
once"pe "day"100"µM"NH4Cl"( .c.)"we e"added" o"in ensi y" he" luc ua ion"in" he"N"a ailabili y."
Howe e ," no" change" in" g ow h" pe o mance" compa ed" o" he" o he " wo" coAcul u es" was"
obse ed."Thus,"all" h ee"coAcul u es"we e"a e aged"as"shown"in"panel"E."
"
Fig.!4.! Ve i ica ion!o ! he! pos O ansc ip ional! egula ion!o !ss 1528! h ough!di ec ! NsiR4!
in e ac ion.!
A:! Changes" in" he" mRNA" abundance" o " ss 1528" in" esponse" o" al e ed" NsiR4" exp ession"
de ec ed" by" hyb idiza ion" wi h" a" singleAs anded" 32PAlabeled" ansc ip " p obe." Ni ogen"
25"
"
deple ion"was"induced"in"cul u es"g own"in" he"p esence"o "2"µM"Cu2+" o "48"h"(="0"h"AN)."A"
ep esen a i e"5S" RNA"loading"con ol"hyb idiza ion"( o "WT)"is"shown.!WT"A"Synechocys is"
6803" wild" ype," NsiR4oex" –" s ain" ca ying" pVZ322APpe E::nsiR4::oop" plasmid"
(o e exp esso )," ∆nsiR4" A" dele ion" mu an ," ∆nsiR4::oex" A" dele ion" s ain" in" which" NsiR4"
exp ession" was" es o ed" by" he" pVZ322APpe E::nsiR4::oop" plasmid." B:! GFP" luo escence"
measu emen s" o " E.+ coli+ TOP10+s ains" wi h" a ious" combina ions" o " plasmids" exp essing"
NsiR4" o " ss 1528Asg pA usions." The" plasmids" pXGA0" (encoding" luci e ase)" and" pJV300"
(encoding"a"con ol"RNA)"we e"used"as"nega i e"con ols"( o "expe imen al"de ails"see"(41)).!
C:! Rep ession" was" calcula ed" by" di iding" he" alues" measu ed" o " ss 1528Asg p" in" he"
p esence" o " pJV300" wi h" he" co esponding" alue" when" NsiR4" was" p esen ."
Au o luo escence" measu ed" o " nega i e" con ol" cells" was" sub ac ed" om" e e y"
measu emen " p io " o" he" calcula ion." The" da a" a e" p esen ed" as" he" means" ±" SD" o " 6"
independen " colonies." D:! P edic ed" in e ac ion" si e" be ween" NsiR4" and" ss 1528,+ and" he"
espec i e" hyb idiza ion" ene gies" o " he" na i e" and" mu a ed" sequences" a " 30°C" ( he"
espec i e"nucleo ides"a e"boxed"in" ed)."The"g ay"box"highligh s" he"ss 1528"s a "codon."In"
he" RNA" sequences," he" numbe s" e e " o" he" TSS" a " posi ion" +1." P edic ions" we e" made"
using"In aRNA""(42).!!
!
Fig.!5.!Changes!in! he!mRNA!abundance!o !gi A!in! esponse! o!al e ed!NsiR4!exp ession.!
A:! Exp ession" kine ics" was" measu ed" a e " Cu2+" addi ion" and" ni ogen" deple ion." Ni ogen"
deple ion"was" induced"in"cul u es" g own"in"p esence"o "2" µM"Cu2+" o "48" h"(=" 0"h"AN)." B:"
Exp ession"o "gi A"a e "adding"10"mM"NH4+."P io " o"NH4+"addi ion," he"s ains"we e"p eA
cul i a ed" o "6"h"in"p esence"o "2"µM"Cu2+."The"o de "o "blo s"is" he"same"as"in"A.!Fo "cla i y,"
only" a" ep esen a i e" 5S" RNA" loading" con ol" hyb idiza ion" o " NsiR4oex" is" shown." WT" A"
Synechocys is" 6803" wild" ype," NsiR4oex" –" WT" s ain" ca ying" pVZ322APpe E::nsiR4::oop"
plasmid" (o e exp ession" s ain)," ∆nsiR4" A" dele ion" mu an ," ∆nsiR4::oex" A" dele ion" s ain" in"
which" NsiR4" exp ession" was" es o ed" by" he" pVZ322APpe E::NsiR4::oop" plasmid." C:!
Ve i ica ion" o " he" di ec " in e ac ion" be ween" NsiR4" and" gi A" using" an" in+ i o+ epo e "
sys em."GFP" luo escence"measu emen s"o "E.+coli+TOP10+s ains"wi h" a ious"combina ions"
o "plasmids"exp essing"NsiR4"o "gi AAsg pA usions."The"plasmids"pXGA0"and"pJV300"we e"used"
as"nega i e"con ols"( o "expe imen al"de ails"see"(41).!D:!Rep ession"calcula ed"by"di iding"
Fig. 5
Fig. 6
Fig. 7
Fig. 8
1
The sRNA NsiR4 is in ol ed in ni ogen assimila ion con ol in
cyanobac e ia by a ge ing glu amine syn he ase inac i a ing
ac o IF7
Supplemen a y Ma e ial
S ephan Klähn1, Ch is oph Schaal1, Jens Geo g1, Desi ée Baumga ne 1, Ge no Knippen1,
Ma in Hagemann2, Alicia M. Mu o-Pas o 3 and Wol gang R. Hess1*
1Gene ics & Expe imen al Bioin o ma ics, Facul y o Biology, Uni e si y o F eibu g, Ge many
2Plan Physiology Depa men , Ins i u e o Biological Sciences, Uni e si y o Ros ock, Ge many
3Ins i u o de Bioquímica Vege al y Fo osín esis, Consejo Supe io de In es igaciones Cien í icas
and Uni e sidad de Se illa, Spain
*Co esponding au ho : Wol gang R. Hess, Uni e si y o F eibu g, Facul y o Biology,
Schänzles . 1, D-79104 F eibu g, Ge many; Tel: +49-(0)761-203-2796; Fax: +49-(0)761-203-
2745; E-mail: [email p o ec ed] eibu g.de
2
Supplemen a y Ma e ials and Me hods
S ains and g ow h condi ions. Fo he gene a ion o nsiR4 mu an s, we used he glucose-
ole an s ain Synechocys is 6803 (GT-Kazusa) p o ided om N. Mu a a (Na ional Ins i u e
o Basic Biology, Okazaki, Japan). Cul i a ion was pe o med in Cu2+- ee BG11 medium (1)
bu e ed wi h 20 mM TES, pH 8.0 a 30°C unde con inuous whi e ligh illumina ion o 50–80
μmol quan a m−2 s−1 and gen le agi a ion. Mu an s ains we e g own in p esence o he
co esponding an ibio ics. To induce ni ogen de iciency, he cells om liquid cul u es we e
ha es ed h ough cen i uga ion ( o 5 min a 4.000 pm and oom empe a u e),
esuspended in NO3-- ee BG11 and cul i a ed u he . To e-es ablish N- eple e condi ions,
NH4Cl o NaNO3 we e added o he espec i e expe imen s. To induce he ec opic exp ession
o NsiR4, 2 µM CuSO4 was added o he cul u es. Anabaena 7120 WT and he mu an s ain
CSE2 (ca ying a s ep omycin esis ance ca idge wi hin he n cA coding egion; (2)) we e
g own wi h bubbling (CO2-en iched ai , 1% ol/ ol) in BG11 wi hou NO3- and supplemen ed
wi h 6 mM NH4Cl, 12 mM TES-NaOH (pH 7.5) and 10 mM NaHCO3. Fo ni ogen s ep-down
expe imen s, he Anabaena cells we e collec ed h ough il a ion, washed and e-suspended
in ni ogen- ee medium (BG11 wi hou NO3-). Fo long- e m g ow h compe i ion
expe imen s, h ee independen , exponen ially g owing cul u es o Synechocys is 6803 WT
and ΔnsiR4 we e dilu ed o an OD750 o 0.1 and mixed in equal numbe s. Cul u es we e g own
in 20 ml BG11 in 100 ml E lenmeye lasks wi h 1 mM NO3- (ins ead o he usual 17.6 mM).
A e 3 o 4 days cul u es we e e-dilu ed o an OD750 o 0.1 and 25 µl o a 1:1000 dilu ion
we e d opped on BG11 aga pla es wi h and wi hou 40 µg/ml kanamycin. Ampli ica ion o
he nsiR4 locus was made using p ime s SyR12_ko_seg_ o / e and genomic DNA o WT and
nsiR4 cul u es and a ep esen a i e, mixed cul u e a e 3, 24 and 45 days.
Genome and p omo e analysis. The 70 n o Synechocys is NsiR4 (pos. 1289326 – 1289257,
complemen a y s and) was used as a e e ence o Blas N sea ches in he JGI da abase.
Howe e , he iden i ica ion o an sRNA gene based on sequence alone is no s aigh o wa d
due o he sho leng h and li le sequence conse a ion. The e o e, he sequences o he
esul ing hi s we e ex ended 100 bp in bo h di ec ions and u he analyzed in mul iple
alignmen s using Clus alW (3). The p esence o nsiR4 in a gi en genome was ega ded as
posi i e when he sequence aligned o he co esponding sequence om Synechocys is and
con ained a po en ial e mina o hai pin. Ini ially, he MEME sea ch ool (4) was used o he
compa a i e analysis o sequences iden i ied ups eam o he iden i ied nsiR4 homologous
genes. To e i y he ac i i y o he nsiR4 p omo e in Synechocys is in i o a sequence spanning
he ange be ween -130 o +49 ( espec i e o he TSS a +1) was used o luxAB epo e genes.
The agmen was ampli ied om he gDNA o Synechocys is ( o oligonucleo ides see Table
S2), ollowed by es ic ion diges ion wi h KpnI and cloning in o he p omo e -p obe ec o
pILA (5). Fo mu agenesis o he N cA mo i , he co esponding plasmid was e-ampli ied using
he p ime s p N c_mu _ w/ e (Table S2). The esul ing plasmids, con aining ei he he na i e
o a mu a ed NsiR4 p omo e , we e used o ans o m a Synechocys is hos s ain ca ying he
luxCDE ope on, which encodes enzymes o he syn hesis o decanal, he subs a e o he
3
luci e ase eac ion. The selec ion o he epo e s ains and bioluminescence measu emen s
we e pe o med as desc ibed (6).
Gene a ion o NsiR4 mu an s ains. A schema ic p esen a ion o he cloning s a egies is
shown in Supplemen a y Figu e S6. To gene a e he NsiR4 knockou s ain (∆nsiR4), wo
agmen s co e ing he adjacen genes sll1697 and sll1698 we e ampli ied om gDNA using
he p ime combina ions 5'SyR12_ o /5'SyR12_Bs GI_ e and 3'SyR12_Ps I_ o /3'SyR12_ e
(Supplemen a y Table S2). The PCR p oduc s we e diges ed wi h he es ic ion
endonucleases Bs GI and Ps I, espec i ely. A kanamycin esis ance ca idge (KmR) was
ampli ied om he ec o pVZ322 using he p ime s Kan_Ps I_ o and Kan_Bs GI_ e , and
subsequen ly diges ed wi h Bs GI and Ps I and liga ed o he compa ible ends o bo h
agmen s using T4 DNA ligase (The mo Scien i ic). The esul ing cons uc comp ising a KmR
lanked by sequences homologous o he genes sll1697 and sll1698 was e-ampli ied using he
p ime s 5'SyR12_ o and 3'SyR12_ e and in oduced in o he cloning ec o pJET1.2. This
plasmid was used o ans o m WT Synechocys is. The mu an cells we e ini ially selec ed on
BG11 aga pla es (0.9% Kobe I aga , Ro h, Ge many) supplemen ed wi h 10 µg ml-1 kanamycin
and subsequen ly g own in he p esence o 50 µg ml-1 in liquid cul u es.
To es ablish he ec opic exp ession o nsiR4, a sel - eplica ing plasmid ca ying he nsiR4 gene
unde con ol o he pe E p omo e , which media es Cu2+- egula ed ansc ip ion in
Synechocys is (7), was p epa ed. The genomic sequence o nsiR4 was ampli ied om
Synechocys is gDNA using he p ime s SyR12_EcoRI_ o and SyR12_EcoRI_ e . The p oduc
was diges ed wi h EcoRI and in oduced in o a ec o as p e iously desc ibed (8). This plasmid
is based on pJET1.2 and con ains an EcoRI si e be ween he pe E p omo e om Synechocys is
( anging om nucleo ide -235 o -1 wi h espec o he TSS a +1), (9) and he oop- e mina o .
The en i e cons uc was in eg a ed in o he Synechocys is ch omosome ia homologous
ecombina ion in o he spkA locus, which is a neu al si e in he WT s ain used he e (8).
Howe e , di e gen om he ini ial idea o ch omosomal in eg a ion we cloned he casse e
Ppe E::nsiR4::oop in o he eplica i e b oad-hos ec o pVZ322. The cons uc was e-
ampli ied using he p ime s spk_km_hindIII_ o and spk_km_xhoI_ e , subsequen ly diges ed
wi h HindIII and XhoI and in oduced in o he plasmid pVZ322, diges ed wi h he same
enzymes (no e ha he KmR o pVZ322 was dele ed a e HindIII/XhoI ea men ). The
esul ing plasmid was ans e ed in o WT Synechocys is and ∆nsiR4 ia conjugal ans e om
E. coli (10), esul ing in he s ains NsiR4oex (in WT) and ∆nsiR4::oex (in ∆nsiR4), espec i ely.
The ecombinan s ains we e selec ed on BG11 aga con aining 1 µg ml-1 gen amycin and also
g own in p esence o he same concen a ion in liquid cul u es.
RNA ex ac ion, mic oa ays and No he n blo s. The collec ion o Synechocys is cells and
RNA ex ac ion was pe o med as p e iously desc ibed (6, 11). P io o he mic oa ay analysis,
10 µg o o al RNA we e ea ed wi h Tu bo DNase (In i ogen) acco ding o he
manu ac u e 's p o ocol and p ecipi a ed wi h e hanol/sodium ace a e. Labeling and
hyb idiza ion we e pe o med as p e iously desc ibed (12), using 3 µg o RNA o he labeling
eac ion and 1.65 µg o labeled RNA o he hyb idiza ion. Fo No he n hyb idiza ion,
4
Synechocys is 6803 RNA was sepa a ed on dena u ing aga ose gels and ans e ed o
Hybond-N+ memb anes (Ame sham, Ge many) h ough capilla y blo ing wi h 20x SSC bu e .
The memb anes we e hyb idized wi h [α-32P]-UTP inco po a ed single-s anded RNA p obes
gene a ed h ough in i o ansc ip ion as p e iously desc ibed (13). The signals we e
de ec ed using a Pe sonal Molecula Image sys em (Pha os FX, BIO-RAD, Ge many) and
analyzed using Quan i y One so wa e (BIO-RAD, Ge many). RNA om Anabaena was isola ed
using ho phenol (14). To al RNA was sepa a ed on u ea-ac ylamide gels and ans e ed o
Hybond N+ memb anes wi h 1x TBE bu e in a semi-d y blo e . The memb anes we e
hyb idized wi h oligonucleo ides labeled wi h γ-32P-dATP and polynucleo ide kinase (p obe o
NsiR4) o wi h p obes labeled wi h γ-32P-dCTP and Ready- o-go DNA labeling ki (Ame sham)
(p obe o 5S RNA).
P o ein ex ac ion and immunoblo s. Synechocys is and de i a i e s ains we e g own in NO3-
-con aining, Cu2+- ee medium. Fo analysis o IF accumula ion, 2 μM CuSO4 was added o
induce ansc ip ion om he pe E p omo e eigh hou s be o e addi ion o 10 mM NH4Cl and
20 mM TES-NaOH (pH 7.5). Samples we e aken p io o and in a na ow ime se ies a e NH4+
addi ion. Cells om di e en ime poin s we e collec ed by cen i uga ion and ozen un il
p o ein ex ac ion. Ex ac s we e p epa ed using glass beads as p e iously desc ibed (15) in
50 mM Hepes-NaOH bu e (pH 7.0), 50 mM KCl, 1 mM EDTA. Fo Wes e n blo analysis
p o eins we e ac iona ed on 15% SDS-PAGE and immunoblo ed wi h an i-IF7 (1:2000), an i-
IF17 (1:2000) o an i-T xA (1:3000). An i-IF7, an i-IF17 and an i-T xA an ise a we e ob ained
om M.I. Mu o-Pas o and F.J. Flo encio and used as desc ibed (16, 17). The ECL Plus
immunoblo ing sys em (GE Heal hca e) was used o de ec he di e en an igens wi h an i-
abbi seconda y an ibodies. Densi ome ic e alua ion was pe o med wi h Quan i y One
so wa e.
Repo e assays o he in i o e i ica ion o a ge s. Fo he expe imen al a ge e i ica ion,
we used he epo e sys em desc ibed by (18) and he sGFP plasmid pXG-10-SF in oduced
by (19). The p ime s used o cloning and he esul ing plasmids a e gi en in Tables S2 and S3.
The en i e 5’UTR con aining he p edic ed NsiR4 in e ac ion sequence and a pa o he coding
egion we e ampli ied om gDNA using he p ime combina ions
_ssl1911_gi A_ o / _ssl1911_gi A_ e o _ss 1528_ w/ _ss 1528_ e and which
co e ed anges om +1 o +123 (gi A) o +1 o +119 (ss 1528) wi h espec o he TSS a
posi ion +1. The i s nucleo ide o he gi A s a codon is a +52, o ss 1528 a +30. Fo gi A
he in o ma ion abou he TSS has been aken om (20), o ss 1528 i was ex ac ed om (9).
The co esponding PCR p oduc was cloned in o he ec o pXG-10-SF ia he endonuclease
si es NsiI/NheI esul ing in a ansla ional usion o he sGFP wi h a unca ed IF7 o Ss 1528
p o ein. The ansc ip ion is media ed by he cons i u i e p omo e PL e O-1. Fo he
p epa a ion o he plasmid es ablishing PLlacO-1-media ed sRNA exp ession in E. coli he nsiR4
gene was ampli ied om gDNA using he p ime s 5_SyR12_long_phos/3_SyR12_xbal, diges ed
wi h XbaI and used o a plasmid backbone which was ampli ied om pZE12-luc (by using he
p ime combina ion PLlacoB/PLacoD) and also diges ed wi h XbaI.
5
Fo he mu agenesis o NsiR4 and he 5’UTRs o gi A and ss 1528, he plasmids ha bo ing he
na i e e sions we e e-ampli ied using he p ime s SyR12_1911_mu _ wd/
SyR12_1911_mu _ e o SyR12_1528_mu _ wd/ SyR12_1528_mu _ e ( o mu a ing NsiR4
pa s in e ac ing wi h gi A and ss 1528, espec i ely) and PXG10_1911_mu _ wd/
PXG10_1911_mu _ e (gi A) o PXG10_1528_mu _ wd/ PXG10_1528_mu _ e (ss 1528) ( o
he espec i e 5’UTRs) and in oduced in o E. coli. Posi ions o mu a ions we e selec ed on
he basis o lowe ed hyb idiza ion ene gies p edic ed by In aRNA (21) while keeping he
seconda y s uc u es as calcula ed wi h RNApdis (22). Fo es ing a ious combina ions o
bo h plasmids, hese we e in oduced in o E. coli TOP10 (In i ogen): e.g. pXG0 + pJV300,
pXG10-gi A + pJV300/pZE12-NsiR4. The plasmids pJV300 and pXG-0 we e used as nega i e
con ol plasmids. The luo escence measu emen was done as desc ibed p e iously (23).
6
Supplemen a y Figu es
Fig. S1: The ni ogen egula o y ne wo k in cyanobac e ia. The scheme was p epa ed based
on e e ences (20, 24–27).
13
Table S2: Lis o oligonucleo ides.
Name o
Oligonucleo ide
Sequence (in 5’ – 3’ di ec ion)
Applica ion
Gene a ion o nsiR4 mu an s ains in Synechocys is sp. PCC 6803
5'SyR12_ o
CTCCGGTCCCAATCCTACGAAGC
Ampli ica ion o sequence
lanking nsiR4 ups eam egion
5'SyR12_Bs GI_ e
GAATGTACAGGCCGGATCGGTAGGCTTTATGTA
G
3'SyR12_Ps I_ o
GAACTGCAGCCCATTGCTTCAGTGGCGGCTTTC
Ampli ica ion o sequence
lanking nsiR4 downs eam egion
3'SyR12_ e
GCCGTCAGACCAACGCAGACC
Kan_Ps I_ o
GAACTGCAGAATAAAAAACGCCCGGCGGCAAC
CGAGCGAATCCCGTCAAGTCAGCGTAATGCTC
Ampli ica ion kanamycin
esis ance casse e om pVZ322
Kan_Bs GI_ e
GAATGTACACAAAGCCACGTTGTGTCTCAAAAT
CTCTG
SyR12_ko_seg_ o
CGTCCCAAATCGAGCAGTGCATG
Ve i ica ion o nsiR4 knockou
mu an s
SyR12_ko_seg_ e
CTAGGGTGTTGCGTTCCACGTTC
SyR12_EcoRI_ o
GAAGAATTCAAGACATAAAGTCAATATCACCCT
CCGATTGC
Ampli ica ion o nsiR4 om
Synechocys is sp. PCC 6803 o
gene a ing an NsiR4 exp essing
plasmid
SyR12_EcoRI_ e
GAAGAATTCGCATGGCAGCTTCTAAAGGACTAA
TAAACTC
spk_km_hindIII_ o
GAAAAGCTTCATTTCCGACACCGAGAAAACC
Ampli ica ion o inse (Ppe E-
NsiR4-oop) om shu le ec o
pJET_spkA::km_Ppe E_
ecoRI_oop o liga ion in o
pVZ322
spk_km_xhoI_ e
GAACTCGAGTGGATGATGGGGCGATTCAG
Oligonucleo ides used o No he n blo s (T7 p omo e s a e unde lined)
w_p o_ss 1528
GATCGCCGCTGGCATTGATTTTGATGGC
Ampli ica ion o PCR empla e
used o in i o ansc ip ion
gene a ing p obes o ss 1528
e _p o_ss 1528
TAATACGACTCACTATAGGGGCGGGAGCGCAT
GGTATTACTGACCCC
e _p o_ssl1911
ATGTCTACTCAACAACAGGCTCGCGCT
Ampli ica ion o PCR empla e
used o in i o ansc ip ion
gene a ing p obes o gi A
(ssl1911)
w_p o_ssl1911
TAATACGACTCACTATAGGGAGCGGCAGCGCG
GGACAACATGGA
5sRNA_ o
TAATACGACTCACTATAGGAGAAAGAGGAACTT
GGCATCGGAC
Ampli ica ion o PCR empla e
used o in i o ansc ip ion
gene a ing p obes o 5S RNA
5sRNA_ e
GTCATGGAACCACTCCGATCCC
Oligo p obe o NsiR4
(Anabaena 7120)
GGTCTGGTTAAGCAATCGGAGGGTAAT
No he n blo o NsiR4 de ec ion
in Anabaena 7120
7120- n5Sa-1
AGTTTTCCTGGTGCCTATG
PCR agmen p obe o de ec ion
o 5S RNA in Anabaena 7120
7120- n5Sa-2
ACCTGGCACCGAGCGATTG
LuxAB epo e assays
Sy 12-KpnI_ w
GGTACCCCACGTTCAAACACTTTTACATTCG
Ampli ica ion o he nsiR4
p omo e om Synechocys is
6803 o cloning in o pILA
epo e -plasmid
Sy 12-KpnI_ e
GGTACCGCAATGGGCGACCTCTAGC
p N c_mu _ w
CTCAAATAGGCATCATAAAGCCTACCGATC
Mu a ion o he pu a i e N cA
mo i ups eam o nsiR4
p N c_mu _ e
GATGCCTATTTGAGGAAAGTTCCCGTAAC
Ta ge e i ica ion in E. coli using a G p Repo e sys em (nucleo ides unde lined and shown in bold e e o
he in oduced poin mu a ions)
_ss 1528_ w
ATGCATAGTAAAATAACTCGAGGGTAATATTGA
TCATGG
Ampli ica ion o pu a i e a ge
gene-sequence con aining he
p edic ed in e ac ion- egion wi h
_ss 1528_ e
GCTAGCCTTGGCTTCGGGAATGGCACTG
14
_ssl1911_gi A_ o
ATGCATAGAGGGTAATTAACCAAAACTTTTTTCA
G
NsiR4. The sequence consis s o
he espec i e 5´UTR and pa o
he coding egion
_ssl1911_gi A_ e
GCTAGCGGATTGTTGACGGTTTTTGATGAATTG
PLlacoB
CGCACTGACCGAATTCATTAA
Ampli ica ion o agmen om
plasmid pZE12_luc
PLlacoD
GTGCTCAGTATCTTGTTATCCG
5_SyR12_long_phos
AAGACATAAAGTCAATATCACCCTCC
Ampli ica ion o nsiR4 (long
e sion) o liga ion in o pZE12-
luc; phospho yla ed
3_SyR12_xbal
GTTTTTTCTAGATAAAGGACTAATAAACTCTAAA
AAGAAAGCC
Re e se p ime o he
ampli ica ion o nsiR4 o liga ion
in o pZE12-luc
PXG10_1911_mu _ e
TGACGATTACTGAAAAAAGTTTTGGTTAATTAC
In oduc ion o a poin mu a ion
in o gi A sequence
PXG10_1911_mu _ w
d
TTCAGTAATCGTCAAGAGGTATTAACTAT
PXG10_1528_mu _ e
CCATGATCAAATTTACCCTCGAGTTATTTTA
In oduc ion o a poin mu a ion
in o ss 1528 sequence
PXG10_1528_mu _ w
d
GTAAATTTGATCATGGCTAATACAACTAAAGGA
SyR12_1911_mu _ e
CGACCTCTAGTAATCGGAGGGTGATATTG
In oduc ion o compensa o y
mu a ion in o nsiR4 sequence
(gi A mRNA as a ge )
SyR12_1911_mu _ wd
CGATTACTAGAGGTCGCCCATTGCTT
SyR12_1528_mu _ e
TGAATTTGACTTTATGTCTTGTGCTCAGT
In oduc ion compensa o y
mu a ion in o nsiR4 sequence
(ss 1528 mRNA as a ge )
SyR12_1528_mu _ wd
ATAAAGTCAAATTCACCCTCCGATTGCTA
15
Table S3: Lis o plasmids.
Plasmid
Plasmid
backbone
Desc ip ion
Ma ke
Re e ence
pJET_spkA::km_Ppe E_
ecoRI_oop
pJET1.2
Shu le ec o o inse ion o
nsiR4-sequence. Gene a ion o
NsiR4 exp essing plasmid
KmR
This s udy
pJET-spkA::km_Ppe E_
nsiR4_oop
pJET1.2
Shu le ec o o e-
ampli ica ion o casse e
Ppe E::nsiR4::oop
KmR
This s udy
pVZ322-Ppe E_NsiR4_
oop_km
pVZ322
Plasmid o coppe -inducible
NsiR4 exp ession in Synechocys is
sp. PCC 6803
GenR, KmR
This s udy
pJET-
ssl1697::km::ssl1698
pJET1.2
Gene a ion o nsiR4 knockou
s ain
KmR
This s udy
pILA
P omo e p obe ec o
ha bou ing he p omo e less
luxAB genes encoding luci e ase,
con ains ecombina ions si es o
in eg a ion in o he
Synechocys is ch omosome
KmR, AmpR
(5)
pILA-PnsiR4
pILA
pILA ha bou ing luxAB unde
con ol o he nsiR4 p omo e
( ange be ween -130 o +49 wi h
espec o he ansc ip ional
s a si eTSS a +1 was used)
KmR, AmpR
This s udy
pILA-PnsiR4_mu
pILA
same as pILA-PnsiR4 bu ca ying
a mu a ed N cA binding mo i
KmR, AmpR
This s udy
pZE12-luc
Gene al exp ession plasmid
AmpR
(29)
pJV300
pZE12-luc
Con ol plasmid, exp essing a ~50
n nonsense ansc ip de i ed
om nB e mina o
AmpR
(30)
pXG0
pZA31-
luc
Plasmid exp essing luci e ase
used as a nega i e con ol; cell
au o luo escence
CmR
(18)
pXG10
pXG0
Plasmid o syn hesis o
ansla ional s GFP usions
CmR
(19)
pXG10_ssl1911
pXG10-SF
GFP epo e plasmid con aining
he gi A 5’UTR plus he ini ial
pa o he coding egion
CmR
his s udy
pXG10_ss 1528
pXG10-SF
GFP epo e plasmid con aining
he ss 1528 5’UTR plus ini ial pa
o he coding egion
CmR
his s udy
pXG10_ssl1911_mu
pXG10-SF
GFP usion plasmid con aining
he gi A 5’UTR wi h mu a ion in
he in e ac ing egion wi h NsiR4
CmR
his s udy
pXG10_ss 1528_mu
pXG10-SF
GFP usion plasmid con aining
he ss 1528 5’UTR wi h mu a ion
in he in e ac ing egion wi h
NsiR4
CmR
his s udy
pZE12_NsiR4
pZE12-luc
Plasmid exp essing NsiR4
AmpR
his s udy
pZE12_NsiR4_mu 1911
pZE12-luc
Plasmid exp essing NsiR4 wi h a
compensa o y mu a ion o he
mu a ion in gi A
AmpR
his s udy
16
pZE12_NsiR4_mu 1528
pZE12-luc
Plasmid exp essing NsiR4 wi h a
compensa o y mu a ion o he
mu a ion in ss 1528
AmpR
his s udy
Supplemen a y Re e ences
1. Rippka R, De uelles J, Wa e bu y JB, He dman M, S anie RY (1979) Gene ic assignmen s, s ain
his o ies and p ope ies o pu e cul u es o cyanobac e ia. J Gen Mic obiol 111(1):1–61.
2. F ías JE, Flo es E, He e o A (1994) Requi emen o he egula o y p o ein N cA o he exp ession
o ni ogen assimila ion and he e ocys de elopmen genes in he cyanobac e ium Anabaena sp.
PCC 7120. Mol Mic obiol 14(4):823–832.
3. La kin MA, e al. (2007) Clus al W and Clus al X e sion 2.0. Bioin o ma ics 23(21):2947–2948.
4. Bailey TL, e al. (2009) MEME SUITE: ools o mo i disco e y and sea ching. Nucleic Acids Res
37(Web Se e issue):W202–208.
5. Kune A, Hagemann M, E dmann N (2000) Cons uc ion o p omo e p obe ec o s o
Synechocys is sp. PCC 6803 using he ligh -emi ing epo e sys ems G p and LuxAB. J Mic obiol
Me h 41(3):185–194.
6. Klähn S, e al. (2014) Alkane biosyn hesis genes in cyanobac e ia and hei ansc ip ional
o ganiza ion. F on Bioeng Bio echnol 2:24.
7. Zhang L, McSpadden B, Pak asi HB, Whi ma sh J (1992) Coppe -media ed egula ion o
cy och ome c553 and plas ocyanin in he cyanobac e ium Synechocys is 6803. J Biol Chem
267(27):19054–19059.
8. Eisenhu M, e al. (2012) The an isense RNA As1_ l 4 in he Cyanobac e ium Synechocys is sp.
PCC 6803 p e en s p ema u e exp ession o he l 4-2 ope on upon shi in ino ganic ca bon
supply. J Biol Chem 287(40):33153–33162.
9. Mi schke J, e al. (2011) An expe imen ally ancho ed map o ansc ip ional s a si es in he
model cyanobac e ium Synechocys is sp. PCC6803. P oc Na l Acad Sci USA 108(5):2124–2129.
10. Zinchenko VV, Pi en IV, Melnik VA, Shes ako SV (1999) Vec o s o he complemen a ion
analysis o cyanobac e ial mu an s. Russ J Gene 35:228–232.
11. Hein S, Scholz I, Voß B, Hess WR (2013) Adap a ion and modi ica ion o h ee CRISPR loci in wo
closely ela ed cyanobac e ia. RNA Biol 10(5):852–864.
12. Geo g J, e al. (2009) E idence o a majo ole o an isense RNAs in cyanobac e ial gene
egula ion. Mol Sys Biol 5:305.
13. S eglich C, e al. (2008) The challenge o egula ion in a minimal pho oau o oph: non-coding
RNAs in P ochlo ococcus. PLoS Gene 4(8):e1000173.
14. Mohamed A, Jansson C (1989) In luence o ligh on accumula ion o pho osyn hesis-speci ic
ansc ip s in he cyanobac e ium Synechocys is 6803. Plan Mol Biol 13(6):693–700.
17
15. Reyes JC, Flo encio FJ (1995) A no el mechanism o glu amine syn he ase inac i a ion by
ammonium in he cyanobac e ium Synechocys is sp. PCC 6803. In ol emen o an inac i a ing
p o ein. FEBS Le 367(1):45–48.
16. Na a o F, Ma ín-Figue oa E, Flo encio FJ (2000) Elec on anspo con ols ansc ip ion o he
hio edoxin gene ( xA) in he cyanobac e ium Synechocys is sp. PCC 6803. Plan Mol Biol
43(1):23–32.
17. Galmozzi CV, Fe nández-A ila MJ, Reyes JC, Flo encio FJ, Mu o-Pas o MI (2007) The ammonium-
inac i a ed cyanobac e ial glu amine syn he ase I is eac i a ed in i o by a mechanism in ol ing
p o eoly ic emo al o i s inac i a ing ac o s. Mol Mic obiol 65(1):166–179.
18. U ban JH, Vogel J (2007) T ansla ional con ol and a ge ecogni ion by Esche ichia coli small
RNAs in i o. Nucleic Acids Res 35(3):1018–1037.
19. Co co an CP, e al. (2012) Supe olde GFP epo e s alida e di e se new mRNA a ge s o he
classic po in egula o , MicF RNA. Mol Mic obiol 84(3):428–445.
20. Ga cía-Domínguez M, Reyes JC, Flo encio FJ (2000) N cA ep esses ansc ip ion o gi A and gi B,
genes ha encode inhibi o s o glu amine syn he ase ype I om Synechocys is sp. PCC 6803.
Mol Mic obiol 35(5):1192–1201.
21. W igh PR, e al. (2014) Cop aRNA and In aRNA: p edic ing small RNA a ge s, ne wo ks and
in e ac ion domains. Nucleic Acids Res 42(Web Se e issue):W119–123.
22. Lo enz R, e al. (2011) ViennaRNA Package 2.0. Algo i hms Mol Biol 6:26.
23. W igh PR, e al. (2013) Compa a i e genomics boos s a ge p edic ion o bac e ial small RNAs.
P oc Na l Acad Sci USA 110(37):E3487–3496.
24. Mu o-Pas o MI, Reyes JC, Flo encio FJ (2005) Ammonium assimila ion in cyanobac e ia.
Pho osyn Res 83(2):135–150.
25. Schwa z R, Fo chhamme K (2005) Acclima ion o unicellula cyanobac e ia o mac onu ien
de iciency: eme gence o a complex ne wo k o cellula esponses. Mic obiology (Reading, Engl)
151(P 8):2503–2514.
26. Ohashi Y, e al. (2011) Regula ion o ni a e assimila ion in cyanobac e ia. J Exp Bo 62(4):1411–
1424.
27. Espinosa J, e al. (2014) PipX, he coac i a o o N cA, is a global egula o in cyanobac e ia. P oc
Na l Acad Sci USA 111(23):E2423–2430.
28. Quas C, e al. (2013) The SILVA ibosomal RNA gene da abase p ojec : imp o ed da a p ocessing
and web-based ools. Nucleic Acids Res 41(Da abase issue):D590–596.
29. Lu z R, Buja d H (1997) Independen and igh egula ion o ansc ip ional uni s in Esche ichia
coli ia he LacR/O, he Te R/O and A aC/I1-I2 egula o y elemen s. Nucleic Acids Res 25(6):1203–
1210.
30. Si ka A, P ei e V, Tedin K, Vogel J (2007) The RNA chape one H q is essen ial o he i ulence
o Salmonella yphimu ium. Mol Mic obiol 63(1):193–217.
18