Posttranscriptional regulation of glutamine synthetase in the filamentous cyanobacterium Anabaena sp. PCC 7120: Differential expression between vegetative cells and heterocysts

JOURNAL OF BACTERIOLOGY, Sep . 2010, p. 4701–4711 Vol. 192, No. 18 0021-9193/10/$12.00 doi:10.1128/JB.00222-10 Copy igh © 2010, Ame ican Socie y o Mic obiology. All Righ s Rese ed. Pos ansc ip ional Regula ion o Glu amine Syn he ase in he Filamen ous Cyanobac e ium Anabaena sp. PCC 7120: Di e en ial Exp ession be ween Vege a i e Cells and He e ocys s 䌤 Ca la V. Galmozzi, Lo ena Saelices, F ancisco J. Flo encio, and M. Isabel Mu o-Pas o * Ins i u o de Bioquímica Vege al y Fo osín esis, CSIC-Uni e sidad de Se illa, Ame´ ico Vespucio 49, E-41092 Se ille, Spain Recei ed 2 Ma ch 2010/Accep ed 8 July 2010 Genes homologous o hose implica ed in glu amine syn he ase (GS) egula ion by p o ein-p o ein in e ac- ion in he cyanobac e ium Synechocys is sp. s ain PCC 6803 a e conse ed in se e al cyanobac e ial sequenced genomes. We in es iga ed his GS egula o y mechanism in Anabaena sp. s ain PCC 7120. In his s ain he sys em ope a es wi h only one GS inac i a ion ac o (inac i a ion ac o 7A [IF7A]), encoded by open eading ame (ORF) asl2329 (gi A). Following addi ion o ammonium, exp ession o gi A is de ep essed, leading o he syn hesis o IF7A, and consequen ly, GS is inac i a ed. Upon ammonium emo al, he GS ac i i y e u ns o he ini ial le el and IF7A becomes unde ec able. The global ni ogen con ol p o ein N cA binds o he gi A p omo e . Cons i u i e high exp ession le els o gi A we e ound in an Anabaena n cA mu an (CSE2), indi- ca ing a ep esso ole o N cA. In i o s udies demons a e ha Anabaena GS is no inac i a ed by Synecho- cys is IFs (IF7 and IF17), indica ing he speci ici y o he sys em. We cons uc ed an Anabaena s ain exp essing a second inac i a ing ac o , con aining he amino- e minal pa o IF17 om Synechocys is used o IF7A. GS inac i a ion in his s ain is mo e e ec i e han ha in he wild ype (WT) and esembles ha obse ed in Synechocys is. Finally we ound di e en ial exp ession o he IF sys em be ween he e ocys s and ege a i e cells o Anabaena. Glu amine syn he ase (GS) ca alyzes he ATP-dependen ami- da ion o glu ama e o yield glu amine. This enzyme ope a es sequen ially wi h he enzyme glu ama e syn hase (GOGAT), which ca alyzes he ans e o he amide g oup om glu amine o 2-oxoglu a a e o yield wo molecules o glu ama e. This pa hway (commonly known as he GS-GOGAT cycle) ep e- sen s he connec ing s ep be ween ca bon and ni ogen me ab- olism. In mos o he sys ems s udied, con ol o GS ac i i y esponds o ca bon and ni ogen signals. In he p esence o abundan ca bon sou ces, ni ogen de iciency esul s in a high le el o GS ac i i y. In con as , when he ni ogen sou ce is abundan , GS ac i i y is down egula ed (12, 14). In cyanobac e ia, GS ype I (he e e e ed o as GS) is modula ed a he ansc ip ional and pos ansc ip ional le els, depending on he ca bon and ni ogen supply (19). The pos - ansla ional modi ica ion by adenylyla ion ha occu s in en- e obac e ial glu amine syn he ase does no exis in cyanobac- e ia. Howe e , in hese o ganisms an ammonium-dependen GS pos ansla ional egula ion mechanism in ol ing p o ein- p o ein in e ac ion has been epo ed (8, 28). This sys em has been s udied in de ail in he cyanobac e ium Synechocys is sp. s ain PCC 6803 and consis s o a e e sible in e ac ion o GS wi h wo small p o eins, inac i a ion ac o 7 (IF7) and IF17, encoded by he gi A and gi B genes, espec i ely (8). The anal- ysis o mu an s ains de oid o IF7, IF17, o bo h e ealed ha each o hese p o eins con ibu es o GS inac i a ion in i o, and a maximal le el o inac i a ion was obse ed when bo h p o eins we e p esen (8). The exp ession o gi A and gi B genes, encoding IF7 and IF17, espec i ely, is ep essed by N cA, he main ac o esponsible o ni ogen con ol in cya- nobac e ia (9, 10). Thus, when ammonium is added o he medium, IF7 and IF17 a e exp essed and GS is inac i a ed. Ammonium emo al p o okes ep ession o gi genes and also de e mines he apid deg ada ion o IF7 and IF17 p e iously accumula ed upon ammonium addi ion (6). In ilamen ous cyanobac e ia, ea ly s udies by O and Ha- selko n demons a ed ha GS om Anabaena sp. s ain PCC 7120 is con olled nei he by adenylyla ion no by eedback inhibi ion by glu amine; howe e , le els o glu amine syn- he ase a e lowe in ammonium-g own cells han in cells g own using ni a e o dini ogen as he ni ogen sou ce (25, 26). As in o he cyanobac e ia, exp ession o he s uc u al gene o glu amine syn he ase (glnA) is egula ed a he ansc ip ional le el in Anabaena and his con ol is media ed by N cA (5). The p omo e egion o he glnA gene has a complex s uc u e in his s ain and has been well cha ac e ized unde di e en ni ogen egimens in ege a i e cells and he e ocys s (31). Genes homologous o gi A o gi B ha e been ound in many cyanobac e ial genomes, al hough hey seem o be absen in P ochlo ococcus. Howe e , ammonium-p omo ed down egula- ion o glu amine syn he ase ac i i y has been well documen ed only in Synechocys is sp. PCC 6803. The e o e, we ound i in e es ing o explo e he ope a ion o he GS egula o y mech- anism media ed by inac i a ing ac o s (IF7 o IF17 homologs) in o he cyanobac e ial g oups. Anabaena sp. PCC 7120 possesses a single e edoxin-dependen GOGAT (Fd-GOGAT) enzyme, whe eas Synechocys is ha bo s bo h NADH-dependen and e e- doxin-dependen GOGAT enzymes (16, 22). In addi ion, Fd- GOGAT is absen in he e ocys s om Anabaena, indica ing * Co esponding au ho . Mailing add ess: Ins i u o de Bioquímica Veg- e al y Fo osín esis, Ame´ ico Vespucio 49, E-41092 Se ille, Spain. Phone: 34-954-489573. Fax: 34-954-460065. E-mail: [email p o ec ed]. 䌤 Published ahead o p in on 16 July 2010. 4701 on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om he lack o a comple e GS-GOGAT pa hway in hese cells (16). Hence, we decided o u he in es iga e GS egula ion and ammonium sensing in bo h cell ypes om his model cya- nobac e ium. He e we demons a e ha GS om a ilamen- ous cyanobac e ium is also egula ed pos ansc ip ionally by he IF-media ed sys em, which is N cA dependen . We also analyze he speci ici y o he in e ac ion be ween IFs and GSs om di e en s ains. Fu he mo e, using g p as a epo e gene, we show a di e en ial ammonium sensing be ween he - e ocys s and ege a i e cells. MATERIALS AND METHODS S ains and cul u e condi ions. Anabaena sp. PCC 7120 and Synechocys is sp. PCC 6803 wild- ype (WT) s ains and he Anabaena s ains gene a ed in his wo k, he ⌬gi A, ACHI, and AGFP s ains, we e g own pho oau o ophically a 30°C in BG11 medium (29) supplemen ed wi h 1 g li e ⫺1 NaHCO 3 (BG11C) and bubbled wi h a con inuous s eam o 1% ( ol/ ol) CO 2 in ai unde con in- uous luo escen illumina ion (50 ␮mol pho ons 䡠m ⫺2 䡠s ⫺1 whi e ligh ). The CSE2 s ain was cul i a ed in BG11C medium supplemen ed wi h 5 mM NH 4 Cl and 10 mM N- is(hyd oxyme hyl)-me hyl-2-aminoe hanesul onic acid (TES) bu e , pH 7.5. The mosynechococcus elonga us BP-1 was g own unde he same condi ions desc ibed abo e o Anabaena and Synechocys is bu a 45°C. Fo pla e cul u es, BG11C liquid medium was supplemen ed wi h 1% (w / ol) aga . Am- monium ea men o cul u es was pe o med by addi ion o 10 mM NH 4 Cl and 20 mM TES bu e , pH 7.5. Ammonium emo al was ca ied ou by ha es ing he cells by il a ion, washing hem, and esuspending hem wi h BG11C. To place cul u es unde dini ogen g ow h condi ions, cells om BG11C medium o om BG11C supplemen ed wi h NH 4 Cl we e ha es ed by il a ion a oom empe a u e, washed, and esuspended in BG11 0 C medium (BG11C medium wi hou NaNO 3 ). Inse ional mu agenesis o he gi A gene in Anabaena. Two agmen s o 575 and 400 bp, encompassing pa o he asl2329 locus and he 5⬘ egion and pa o he asl2329 locus and he 3⬘ egion, espec i ely, we e ampli ied by PCR using Anabaena genomic DNA. These agmen s we e cloned in o pGEM-T plasmid (P omega), gene a ing he plasmid pAN3. This plasmid con ains a dele ion o he asl2329 locus and also a BamHI es ic ion si e. This si e was used o clone aSm Sp C.S3 casse e (27) om pRL463 (pUC18/19 con aining L.HEH1 and C.S3; nomencla u e o Elhai and Wolk [4]) in bo h o ien a ions, gene a ing plasmids pANSP(⫹) and pANSP(⫺), espec i ely. XhoI-diges ed agmen s om pANSP(⫹) o pANSP(⫺) we e liga ed o XhoI-diges ed pRL278 ec o (1), gene a ing he a ge ing plasmids pRLANSP(⫹) and pRLANSP(⫺), espec- i ely. To gene a e ⌬gi A(⫹) and ⌬gi A(⫺) s ains, plasmids pRLANSP(⫹) and pRLANSP(⫺), espec i ely, we e in oduced in o he Anabaena wild- ype s ain by conjuga ion (3). Subs i u ion o wild- ype gi A by C.S3-in e up ed e sions was con i med by Sou he n blo analysis. Sequencing o gi A locus. The gi A locus was PCR ampli ied om genomic DNA o wild- ype Anabaena and he CSE2 mu an s ain by using p ime s 5⬘CTCTTGCAGTGTTCTGTTGCTGG3⬘and 5⬘GAGTTACTTCCTCTAATA ACAACC3⬘. Di ec sequencing o PCR p oduc s was ca ied ou by he Eu o ins MWG ope on sequencing se ice. Conjuga ion o wild- ype and mu a ed gi A o he CSE2 s ain. The gi A wild- ype e sion was ampli ied by PCR using p ime s 5⬘GATCAGATCTCTC TTGCAGTGTTCTGTTGCTGG3⬘and 5⬘GATCAGATCTGGAAGTAACTT CAACAATGAG3⬘and Anabaena DNA as empla e. The gi A mu a ed e sion was gene a ed by a wo-s ep PCR p ocess using p ime s 5⬘GATGCGCTAATA TTAGCAAGTGAAGAATCG3⬘and 5⬘CGATTCTTCACTTGCTAATATTA GCGCATC3⬘ o in oduce mu a ions, and he same p ime s we e used o am- pli y he wild- ype e sion in he second s ep. F agmen s con aining bo h gi A e sions we e BglII diges ed and liga ed o BglII-diges ed pCSAV81 (31), gen- e a ing plasmids pWTgi A and pMTgi A. These plasmids we e ans e ed by conjuga ion (3) o s ain CSE2. The co ec in eg a ion o hese cons uc s in he nucA-nuiA egion o he Anabaena ␣megaplasmid was checked by PCR. GS assay. GS ac i i y was de e mined in si u by using he Mn 2⫹ -dependen ␥-glu amyl ans e ase assay in cells pe meabilized wi h mixed alkyl ime hylam- monium b omide (MTA) (17). Fo he analysis o he in i o GS-IF in e ac ion, binding eac ions we e ca ied ou in a inal olume o 20 ␮l con aining pu i ied Anabaena o Synechocys is GS and inc easing amoun s o IF7, IF17, IF7A, o IF17N/IF7A in HEPES-NaOH bu e , pH 7.0, 50 mM KCl. A e he GS-IF complex o ma ion, he same GS assay desc ibed abo e bu wi hou MTA addi- ion was pe o med. One uni o GS ac i i y co esponds o he amoun o enzyme ha ca alyzes he syn hesis o 1 ␮mol min ⫺1 o ␥-glu amylhyd oxama e. RNA isola ion and No he n blo analysis. To al RNA was isola ed om 25-ml samples o Anabaena cul u es a he mid-exponen ial phase (3 o 5 ␮g/ml chlo- ophyll). Ex ac ions we e pe o med by o exing cells in he p esence o phe- nol-chlo o o m and acid-washed baked glass beads (0.25- o 0.3-mm diame e ; B aun, Melsungen, Ge many) as p e iously desc ibed (7). Fo No he n blo ing, 15 ␮g o o al RNA was loaded pe lane and elec opho esed on dena u ing o maldehyde-con aining 1.2% aga ose gels. T ans e o nylon memb anes (Hy- bond N-plus; Ame sham Pha macia Bio ech), p ehyb idiza ion, hyb idiza ion, and washes we e pe o med as ecommended by he manu ac u e . PCR-syn- hesized agmen s encompassing he en i e gi A,gi B,o glnA genes we e used as p obes. As a con ol, he il e s we e ep obed wi h a 640-bp DNA agmen con aining he cons i u i ely exp essed RNase P RNA gene ( npB) om Anabaena (33). Hyb idiza ion signals we e quan i ied wi h a Cyclone Phospho sys em (Packa d). P o ein exp ession and pu i ica ion. Fo IF7A-His 6 , IF7-His 6 , IF17-His 6 , and IF17N/IF7A-His 6 exp ession, NdeI-XhoI agmen s con aining he co espond- ing gi gene we e syn hesized by PCR and cloned in o he pET24a(⫹) plasmid (No agen, La Jolla, CA) o gene a e pASET24, pSET24, pLET24, and pALSET24 plasmids, espec i ely. Cons uc ion o he gi B/gi A chime ic gene o IF17N/IF7A p o ein exp ession is desc ibed below. Exponen ially g owing Esch- e ichia coli BL21 cells ans o med wi h each o hese plasmids we e ea ed wi h 0.5 mM isop opyl-␤-D- hiogalac oside o 4 h. IF17-His 6 was pu i ied om E. coli as p e iously desc ibed (6). IF7A-His 6 , IF7-His 6 , and IF17N/IF7A-His 6 we e pu i ied by Ni-a ini y ch oma og aphy using His-Bind ma ix (No agen) ollow- ing he manu ac u e ’s ins uc ions. F ac ions ha showed GS inac i a ion ac- i i y we e pooled and subjec ed o gel il a ion ch oma og aphy using a HiLoad 16/60 Supe dex 75 gel il a ion column (GE Heal hca e) unning on an Ak a as p o ein liquid ch oma og aphy (FPLC) sys em. Fo Anabaena GS exp ession, a NdeI-BamHI agmen including a his idine- agged modi ied e sion o he glnA gene was syn hesized by PCR and cloned in o he pET-3a plasmid (No agen, La Jolla, CA) o gene a e pAGS. Exponen- ially g owing E. coli BL21 cells ans o med wi h he pAHGS plasmid we e ea ed wi h 0.5 mM isop opyl-␤-D- hiogalac oside o 4 h. Anabaena His-GS was pu i ied by Ni-a ini y ch oma og aphy using His-Bind ma ix (No agen) ollow- ing he manu ac u e ’s ins uc ions. F ac ions ha showed GS ac i i y we e pooled and subjec ed o gel il a ion using a HiLoad 16/60 Supe dex 200 gel il a ion column (GE Heal hca e) unning on an Ak a FPLC sys em. Fo Synechocys is GS exp ession, a p e iously desc ibed his idine- agged mod- i ied e sion o he glnA gene (8) was cloned in o pBluesc ip SK(⫹) in he same o ien a ion as he plac p omo e o gene a e he pSHGS plasmid. Synechocys is His-GS was pu i ied om E. coli DH5␣cells ans o med wi h pSHGS using he same me hods desc ibed abo e o Anabaena His-GS. Fo Anabaena N cA exp ession, a NdeI-XhoI agmen encompassing he en i e n cA gene was syn hesized by PCR and cloned in o he pET24a(⫹) plasmid (No agen, La Jolla, CA) o gene a e pAN cA. Exponen ially g owing E. coli BL21 cells ans o med wi h pAN cA plasmid we e ea ed wi h 0.5 mM isop opyl-␤-D- hiogalac oside o 4 h. Anabaena N cA was pu i ied by Ni-a ini y ch oma og aphy using His-Bind ma ix (No agen) ollowing he manu ac u e ’s ins uc ions. Fo u he pu i ica ion, he sample was subjec ed o gel il a ion ch oma og aphy using a HiLoad 16/60 Supe dex 75 gel il a ion column (GE Heal hca e) unning on an Ak a FPLC sys em. An i-IF7A an ibody p oduc ion and Wes e n blo ing. An i-IF7A an ise um was ob ained acco ding o s anda d immuniza ion p o ocols by injec ing pu i ied IF7A-His 6 in o abbi s. Pu i ied polyclonal an ibodies ob ained agains Synecho- coccus sp. s ain PCC 6301 glu amine syn he ase (15) we e used o de ec Anabaena glu amine syn he ase. An ibodies ob ained agains Synechocys is sp. PCC 6803 hio edoxin A (T xA) we e used o de ec Anabaena T xA. Fo Wes e n blo analysis, p o eins we e ac iona ed by 15% SDS-PAGE acco ding o he me hod o Laemmli (11) and immunoblo ed wi h an i-IF7A (1:2,000), an i-T xA (1:3,000), o an i-GS (1:15,000). The ECL Plus immunoblo ing sys- em (Ame sham) was used o de ec he di e en an igens wi h an i- abbi seconda y an ibodies conjuga ed o ho se adish pe oxidase (1:12,000). Enhanced chemiluminescence (ECL) signals we e quan i ied using a ChemiDocXRS ap- pa a us (Bio-Rad, He cules, CA) and he Quan i yOne p og am. P ime ex ension analysis. Oligonucleo ide PEIF1 (5⬘GATATTGGCGCAT CATAATGG3⬘; om nucleo ide 47 o 23 o he coding egion), end labeled wi h T4 polynucleo ide kinase and [␥- 32 P]dATP (3,000 Ci mmol ⫺1 ), was used o p ime ex ension analysis o gi A. Annealing and ex ension eac ions using o al RNA om Anabaena we e pe o med as p e iously desc ibed (9). Ex ension p oduc s we e analyzed on a polyac ylamide sequencing gel oge he wi h a sequencing eac ion mix u e o he gi A 5⬘ egion using PEIF1 oligonucleo ide. 4702 GALMOZZI ET AL. J. BACTERIOL. on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om Gel e a da ion assays. N cA-His 6 , exp essed and pu i ied as desc ibed abo e, was used in gel e a da ion assays. DNA agmen s we e end labeled wi h [␣- 32 P]dCTP using Sequenase e sion 2.0 enzyme. The binding eac ions and elec opho esis we e ca ied ou as p e iously desc ibed (21). The Pgi A1 p omo e p obe was ob ained by BglII diges ion o a PCR-ampli ied agmen using oligonucleo ides N cA1 (5⬘CTAGCGGCCGCAGTGTTCTGTTGC3⬘) and N cA2 (5⬘GCGCAGATCTCCTATG3⬘). The Pgi A2 p omo e p obe was ob ained by No I diges ion o a PCR-ampli ied agmen using oligonucleo ides N cA2 and N cA3 (5⬘CTAGCGGCCGCAATTACATAAGTATTACA3⬘). Gene a ion o he ACHI Anabaena s ain. To gene a e a chime ic gene be- ween gi B om Synechocys is and gi A om Anabaena, unde he con ol o he gi B p omo e , wo o e lapping DNA agmen s we e ampli ied by PCR. A agmen con aining he gi B p omo e and pa o he coding egion was am- pli ied om Synechocys is genomic DNA using oligonucleo ides P17EcoRI (5⬘C ATCCAGCCCGAATTCCATCTCCCTCG3⬘) and A17NH (5⬘ATAGACATTT GGCTGGGAGCCGCAGCGAC3⬘). Ano he agmen , con aining he gi A coding egion and pa o he 3⬘ egion, was ampli ied om Anabaena genomic DNA using oligonucleo ides AIFNH (5⬘CCAGCCAAATGTCTATTCAAGAA AAATCTCG3⬘) and AIFPs I (5⬘GATCCTGCAGGGAAGTAACTTCAACAA TGAG3⬘). The chime ic gene was PCR syn hesized om hese wo agmen s and cloned a e EcoRI/Ps I diges ion in o pCSEL24 plasmid (23), diges ed wi h he same enzymes, ende ing pACHI. This plasmid was in oduced in o Anabaena by conjuga ion (3). The co ec in eg a ion o his cons uc in he nucA-nuiA egion o he Anabaena ␣megaplasmid was checked by PCR. Gene a ion o AGFP Anabaena s ain and isualiza ion o g een luo escen p o ein (GFP). A p omo e less g p gene was PCR ampli ied om pCSEL19 (18) wi h p ime s 5⬘CTAGGACTGTATGTCTAAAGGAGAAGAAC3⬘and 5⬘CTA GGACTGTACGTCTTATTTGTATAGTTCATCCATGC3⬘. This agmen was AhdI diges ed and liga ed o pANSP(⫺) plasmid (desc ibed abo e), con aining he Anabaena gi A genomic egion wi h a dele ion o he asl2329 open eading ame (ORF), diges ed wi h he same enzyme. The esul ing plasmid, pAGFP1, con ains a ansla ional usion be ween he gi A p omo e egion and p omo e - less g p. A XhoI-diges ed agmen om pAGFP1 was liga ed o XhoI-diges ed pRL278 ec o (1), gene a ing he a ge ing plasmid pAGFP2. To gene a e he AGFP s ain, pAGFP2 was in oduced in o he Anabaena wild- ype s ain by conjuga ion (3). These plasmids can be in eg a ed upon homologous ecombi- na ion in he gi A locus o Anabaena. The co ec in eg a ion was con i med by Sou he n blo analysis. The accumula ion o he GFP epo e was analyzed by lase con ocal mic os- copy as desc ibed p e iously (18). RESULTS Compa a i e GS inac i a ion/ eac i a ion p ocesses in di - e en cyanobac e ia. Taking in o accoun ha ORFs homol- ogous o he Synechocys is gi A and gi B genes a e p esen in se e al cyanobac e ium sequenced genomes, we decided o examine i he addi ion o ammonium causes inac i a ion o GS in o he membe s o he phylum, as desc ibed o Synecho- cys is (8). Figu e 1 shows compa a i e kine ics o his p ocess in he he e ocys - o ming, model cyanobac e ium Anabaena sp. PCC 7120, he he mophilic s ain The mosynechococcus elon- ga us BP-1, and Synechocys is sp. PCC 6803. Addi ion o am- monium p o okes a quick d op in GS ac i i y in he The mo- synechococcus and Synechocys is s ains; howe e , in Anabaena he p ocess is slowe , and by 6 h ollowing ammonium addi ion, GS ac i i y eaches only abou 60% o he ini ial le el. Am- monium emo al leads o a apid eco e y o GS ac i i y in all he s ains analyzed (Fig. 1). Dele ion mu an s o asl2329 ORF om Anabaena sp. PCC 7120 a e impai ed in GS inac i a ion. The Anabaena asl2329 ORF sha es homology wi h bo h GS inac i a ion ac o s om Synechocys is (IF7 and IF17) (8). To es whe he his ORF is in ol ed in Anabaena GS inac i a ion, we cons uc ed dele ion mu an s o his gene (Fig. 2A) and in es iga ed he ammonium- dependen GS inac i a ion p ocess in wild- ype (WT) Anabaena and mu an s ain cul u es. GS ac i i ies we e sim- ila in he wo s ains gene a ed [⌬gi A(⫹) and ⌬gi A(⫺) s ains]. Mo eo e , as shown in Fig. 2B, GS ac i i y shows only mino changes (less han 15%) a e ammonium addi ion in asl2329 ORF dele ion mu an s compa ed o he wild- ype s ain. These esul s demons a e ha his gene is he gi A o holog in Anabaena (8) and ha he p oduc o his ORF is a GS inac i a ion ac o (he e called IF7A). Anabaena gi A gene exp ession depends on ni ogen s a us. As a i s s ep in he cha ac e iza ion o gi A gene exp ession, we analyzed he gi A mRNA le el in pa allel wi h IF7A accu- mula ion in he ammonium-media ed GS inac i a ion/ eac i- a ion p ocesses. To moni o he cellula le el o IF7A, we p oduced speci ic an ibodies agains his p o ein. Figu e 3A shows ha ammonium addi ion o ni a e-g own cells p o okes an inc ease o gi A mRNA and ha his le el emains ele a ed du ing he ammonium ea men . Ammonium emo al esul s in a d op o gi A ansc ip , eaching he s eady-s a e le el obse ed in ni a e-g own cells wi hin 1 h. Wi h espec o he p o ein IF7A, i was unde ec able in ni a e-g own cells and accumula ed a e ammonium addi ion. Howe e , ammonium emo al led o a apid dec ease in IF7A abundance, and he p o ein was no de ec able 1 h a e ammonium elimina ion (Fig. 3B). In pa allel wi h No he n and Wes e n blo ing ex- pe imen s, we measu ed GS ac i i y o e he same ime cou se (Fig. 3C). A p ecise in e se co ela ion be ween IF abundance and GS ac i i y was obse ed. As a con ol o p o ein loading, memb anes o Wes e n blo ing expe imen s we e incuba ed also wi h an i-T xA an ibodies. Thio edoxin A (T xA) is con- s i u i ely exp essed, independen ly o he ni ogen sou ce (2). FIG. 1. Time cou se o he GS inac i a ion and eac i a ion p o- cesses in h ee di e en cyanobac e ia. Cells o Anabaena 7120, Syn- echocys is 6803, and The mosynechococcus elonga us we e g own in BG11C medium using ni a e as ni ogen sou ce. A he ime indica ed by an a ow, 10 mM NH 4 Cl was added and GS ans e ase ac i i y was de e mined in si u. An a ow also indica es he ime a which cells we e washed wi h ammonium- ee medium and GS eac i a ion ook place. One hund ed pe cen GS ac i i ies co espond o 926, 1,540, and 1,138 mU mg o p o ein ⫺1 o Anabaena,Synechocys is, and The mosynecho- coccus, espec i ely. VOL. 192, 2010 GS POSTTRANSCRIPTIONAL REGULATION IN ANABAENA PCC 7120 4703 on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om Anabaena GS is no inac i a ed by he Synechocys is IFs. To cha ac e ize in i o he GS-IF7A in e ac ion, we pu i ied Anabaena GS and IF7A exp essed in E. coli. In o de o s udy he speci ici y o he GS-IF in e ac ion, we analyzed also he componen s o he p e iously cha ac e ized GS inac i a ion sys em om Synechocys is (GS, IF7, and IF17) (8). The h ee pu i ied inac i a ion ac o s (IF7, IF17, and IF7A) inhibi ed Synechocys is GS, bu only IF7A was able o inhibi Anabaena GS (Fig. 4). In addi ion, IF7A-Synechocys is GS in e ac ion seems o be s onge han IF7A-Anabaena GS in e ac ion, because equal amoun s o his inac i a ing ac o p o oke s onge inhibi ion o Synechocys is GS han o Anabaena GS (Fig. 4C). N cA egula es he Anabaena gi A p omo e . To iden i y he p omo e egion o he gi A gene (Pgi A), he ansc ip ion s a poin (TSP) o he gene was de e mined by p ime ex en- sion analysis. The gi A TSP was mapped o nucleo ide ⫺43 wi h espec o he ansla ion s a codon (Fig. 5A). Fou nucleo ides ups eam o he TSP, a pu a i e ⫺10 box in he o m TATATT was ound. No ob ious ⫺35 box was de ec ed. As obse ed in RNA blo ing expe imen s, he p ime ex en- sion p oduc om he gi A p omo e was mo e abundan in samples om cells g own in he p esence o ammonium han in samples om hose g own in he p esence o ni a e o using RNA om ni ogen- ixing cells. Taking in o accoun he in lu- ence o ni ogen s a us on he exp ession o gi A and he FIG. 2. Analysis o he Anabaena asl2329 mu an s ain. (A) Sche- ma ic ep esen a ion o he asl2329 genomic egion in he wild- ype s ain and si e o inse ion o he CS3 casse e, con aining he aadA gene in bo h o ien a ions, o gene a e ⌬gi A(⫹) and ⌬gi A(⫺) s ains, espec i ely. (B) Ammonium-dependen GS inac i a ion in Anabaena WT and ⌬gi A mu an s. Cells we e g own in BG11C medium using ni a e as ni ogen sou ce. A 10 mM concen a ion o NH 4 Cl was added (a ow), and GS ans e ase ac i i y was de e mined in si u a he indica ed imes. The cu es ep esen a i hme ic means om h ee independen expe imen s and hei s anda d de ia ion alues. FIG. 3. IF7A exp ession du ing he GS inac i a ion/ eac i a ion p ocesses. A he ime indica ed by an a ow, 10 mM NH 4 Cl was added o Anabaena cells cul i a ed wi h ni a e as ni ogen sou ce. An a ow also indica es he ime a which cells we e washed wi h ammonium- ee medium and GS eac i a ion ook place. (A) No he n blo assay o he gi A gene unde di e en ni ogen condi ions. To al RNA was isola ed om cells g own wi h ni a e (0) and a e ammonium addi- ion (⫹NH 4 ⫹ ) o emo al (⫺NH 4 ⫹ ) a he indica ed imes (min). Gels we e blo ed and hyb idized wi h he gi A p obe. The il e s we e s ipped and ehyb idized wi h an npB p obe as a loading con ol. (B) Wes e n blo assay o IFA du ing GS inac i a ion/ eac i a ion p ocesses. F om he same cul u e as ha used o No he n blo analysis, samples we e aken om ni a e-g own cells (0) and a e ammonium addi ion (⫹NH 4 ⫹ ) o emo al (⫺NH 4 ⫹ ) a he indi- ca ed imes (min). To al p o eins we e isola ed and esol ed by SDS-PAGE, blo ed, and incuba ed wi h an i-IF7A and an i-T xA an ibodies. (C) Time cou se o he GS ac i i y. Samples we e aken, du ing he inac i a ion and eac i a ion p ocesses, o de e mina- ion o GS ac i i y. 4704 GALMOZZI ET AL. J. BACTERIOL. on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om p e iously desc ibed N cA-dependen ep ession o gi genes om Synechocys is sp. PCC 6803 (9), he p esence o N cA binding si es in he gi A p omo e egion was analyzed. Two consensus N cA binding si es (13) cen e ed a posi ions ⫺28.5 and ⫺77.5, espec i ely, ups eam o he gi A TSP we e ound (Fig. 5B). I is wo h no ing ha he N cA consensus si e cen e ed a posi ion ⫺28.5 wi h espec o he TSP is loca ed a exac ly he same dis ance om he ⫺10 box as is he ep essing N cA binding si e desc ibed o he gi A p omo e om Syn- echocys is (Fig. 5B). To es i N cA binds o Pgi A, elec opho e ic mobili y shi assays using pu i ied Anabaena N cA p o ein we e pe o med. Anabaena N cA was exp essed in E. coli and pu i ied as a his idine- agged e sion. Binding assays we e pe o med wi h wo DNA agmen s, Pgi A1, which spans posi ions ⫺134 o ⫹36 wi h espec o he TSP, and a sho e agmen , Pgi A2, which spans posi ions ⫺77 o ⫹36 and lacks he GTA iple o he consensus N cA binding si e cen e ed a posi ion ⫺77.5. When N cA was incuba ed wi h Pgi A1, wo N cA-DNA com- plexes we e de ec ed (Fig. 6A); howe e , when he Pgi A2 p obe was used, only one N cA-DNA complex could be de- ec ed (Fig. 6B). These esul s indica e ha N cA binds in i o o bo h consensus ecogni ion si es ound in he gi A p omo e egion. On he o he hand, 2-oxoglu a a e has been epo ed o inc ease he binding a ini y o N cA o se e al ni ogen- eg- ula ed p omo e s (32). As shown in Fig. 6A, he p esence o his me aboli e in he binding assay has a posi i e e ec on N cA ecogni ion o Pgi A. To demons a e ha he ansc ip ional egula o N cA con- ols he syn hesis o he gi A mRNA, we de e mined he le el o gi A ansc ip in he N cA mu an s ain CSE2 (5). As a con ol, we checked he le el o exp ession o glnA, he an- sc ip ion o which is posi i ely con olled by N cA (5, 31). We analyzed he s eady-s a e mRNA le els o hese genes in he wild ype and in he CSE2 s ain unde h ee di e en condi- ions: ni a e u iliza ion, ammonium u iliza ion, and ni ogen dep i a ion. Ammonium-g own CSE2 o wild- ype cells we e ans e ed o 6h oni a e- o ammonium-con aining me- dium o o ni ogen- ee medium, and samples we e aken o RNA isola ion. As p e iously epo ed, he amoun o glnA mRNA in he wild- ype s ain inc eased upon incuba ion in medium con aining ni a e o no combined ni ogen. Howe e , induc ion was se e ely impai ed in CSE2 mu an cells (Fig. 7A). gi A ansc ip le els we e high in wild- ype ammonium- g own cells and we e down egula ed upon incuba ion in me- dium con aining ni a e o no combined ni ogen. In con as , gi A ansc ip le els in CSE2 cells emained high unde all condi ions es ed. These esul s demons a e ha N cA e- p esses he gi A p omo e . In addi ion we s udied he accumula ion o he IF7A p o ein in he wild ype and he CSE2 mu an s ain unde he h ee ni ogen egimens analyzed. Fo his pu pose, we pe o med Wes e n blo analysis and ound ha IF7A accumula ed in he wild- ype cells cul i a ed wi h ammonium, bu his p o ein was unde ec able unde he o he ni ogen condi ions. On he o he hand, IF7A was also unde ec able in CSE2 cells unde all condi ions es ed. We also analyzed he le el o GS in bo h s ains unde he same condi ions, using an i-GS an ibodies. As shown in Fig. 7B, he amoun o GS is lowe in CSE2 cells han in he WT, unde he di e en ni ogen egimens. I he GS-IF in e ac ion is c i ical o IF s abili y as desc ibed o he Synechocys is sys em (6), he low le el o he IF7A a ge p o- ein (GS) ound in CSE2 cells may con ibu e o he lack o IF7A accumula ion in his s ain. Howe e , he di e ence in FIG. 4. In i o econs i u ion o Synechocys is and Anabaena GS inac i a ion. Synechocys is GS (1.7 ␮g) and Anabaena GS (2.2 ␮g) we e incuba ed wi h inc easing quan i ies o IF7 (A), IF17 (B), and IF7A (C) in a inal olume o 20 ␮l. Inac i e GS-IF complexes we e allowed o o m du ing 2 min, and GS ans e ase ac i i y was de e mined. One hund ed pe cen ac i i y co esponds o 0.4 uni o GS. VOL. 192, 2010 GS POSTTRANSCRIPTIONAL REGULATION IN ANABAENA PCC 7120 4705 on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om amoun s o GS be ween he wo s ains, WT and CSE2, is no ha much. To analyze he possibili y ha he absence o IF7A in CSE2 cells was due o ano he eason, we decided o se- quence he PCR-ampli ied gi A gene om genomic DNA o bo h s ains. A poin mu a ion, gi A49C⬎T, encoding he sub- s i u ion Q17STOP, was ound in ou independen PCR am- pli ica ions o he gi A gene om he CSE2 s ain. The mu a- ion posi ion is indica ed as he nucleo ide dis ance om he i s nucleo ide o he s a codon o he mu a ion si e. No mu a ion was ound in he gi A gene ampli ied om he WT Anabaena s ain. The ea ly e mina ion o IF7A p o ein in he CSE2 s ain mus be he eason why we could no obse e FIG. 5. P ime ex ension analysis o he gi A ansc ip . (A) To al RNA (20 ␮g) om mid-log Anabaena cells g own wi h ammonium (NH 4 ⫹ ) o ni a e (NO 3 ⫺ ) o g own wi h ni a e and incuba ed o 7 h in he absence o any ni ogen sou ce (N 2 ) was used o p ime ex ension analysis, as desc ibed in Ma e ials and Me hods. A sequencing ladde ca ied ou wi h he same p ime as ha used o p ime ex ension is also shown. The ansc ip ional s a si e is ma ked wi h an as e isk on he sequence, and a pu a i e ⫺10 sequence is boxed. (B) Alignmen o Anabaena and Synechocys is gi p omo e s. N cA binding si es a e shaded in g ay, and ⫺10 egions a e boxed. The consensus sequence o he N cA-ac i a ed p omo e is also shown. FIG. 6. Gel e a da ion analysis o he binding o N cA o he gi A p omo e egion. Two DNA agmen s we e used: Pgi A1, encompassing he wild- ype gi A p omo e (A), con aining wo pu a i e N cA binding si es, and Pgi A2, deple ed o he i s iple o one o he N cA binding si es (B). Each iple o pu a i e N cA binding si es is ep esen ed by a small black box in Pgi A1 and Pgi A2 schemes. Bo h p obes we e end labeled and incuba ed in he p esence o pu i ied N cA p o ein, 5 o 250 nM (lanes 1 o 7 and 9 o 15, espec i ely). Pgi A1 was also incuba ed wi h 250 nM N cA in he p esence o 0.6 mM 2-oxoglu a a e (lane 7) o a 200- old excess o he same unlabeled agmen (lane 8). 4706 GALMOZZI ET AL. J. BACTERIOL. on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om accumula ion o ha p o ein in his s ain. To u he in es i- ga e i his inding is meaning ul, we decided o in oduce wo di e en cons uc s in he CSE2 s ain. One o hem con ained he wild- ype gi A gene and i s p omo e egion, and he o he con ained he same DNA agmen bu wi h wo poin mu a- ions in he gi A coding egion: gi A40C⬎T, encoding he sub- s i u ion Q14STOP, and gi A46C⬎T, encoding he subs i u ion Q16STOP. A e conjuga ion, colonies we e ob ained using CSE2 cells as ecipien and ei he plasmid pWTgi A (wild- ype gi A gene) o plasmid pMTgi A (mu an gi A gene). Howe e , u he g ow h o exconjugan s bea ing he wild- ype e sion o gi A in eg a ed in he nucA-nuiA egion o he ␣megaplasmid was e y poo . Two amoun s om cellula suspensions o ex- conjugan s we e spo ed on pla es (Fig. 7C). Whe eas all ex- conjugan s bea ing he mu an e sion o gi A g ew well, he g ow h o s ains con aining he wild- ype e sion o gi A was negligible. Analysis o an Anabaena s ain exp essing wo inac i a ion ac o s. Synechocys is and The mosynechococcus elonga us bo h display apid inac i a ion o GS ollowing addi ion o ammo- nium compa ed o Anabaena (6) (Fig. 1). Since bo h Synecho- cys is and The mosynechococcus elonga us ha bo wo inac i a - ing ac o s, IF7 and IF17, and wo IF17 homologous p o eins, espec i ely, i migh be inqui ed whe he he slow esponse in Anabaena is ela ed o he lack o any IF17 homologous p o- ein. We also know om p e ious s udies ha IF7 and IF17 display di e en s abili ies and ha he 82- esidue-long amino- e minal pa o IF17 may be esponsible o he di e en s abili ies obse ed (6; unpublished esul s). Thus, we p o- ceeded o gene a e an Anabaena s ain exp essing an IF17-like GS inac i a ion ac o . Fo his pu pose we cons uc ed a chi- me ic gene be ween gi B om Synechocys is and gi A om Anabaena, in o de o exp ess a modi ied e sion o IF7A wi h he 82- esidue-long amino- e minal pa o IF17 used o i s amino e minus, unde he con ol o he gi B p omo e . This cons uc was in oduced in Anabaena by conjuga ion (3) and in eg a ed, h ough homologous ecombina ion, in he nucA- nuiA egion o he ␣megaplasmid. The esul ing Anabaena s ain, ACHI, con ains he unal e ed gi A gene in he ch omo- some and he chime ic gene gi B/gi A in he ␣megaplasmid. Be o e analyzing GS inac i a ion/ eac i a ion p ocesses in he ACHI s ain, we wan ed o es in i o inac i a ion o Anabaena GS by he chime ic p o ein IF17N/IF7A. Fo his pu pose we pu i ied his p o ein exp essed in E. coli and s ud- ied i s capaci y o inac i a e Anabaena GS compa a i ely wi h IF7A. Figu e 8A shows ha he chime ic p o ein is much less e ec i e han IF7A on GS inac i a ion. We p oceeded hen o he in i o analysis o WT and ACHI s ains; we es ed in bo h FIG. 7. Exp ession le els o N cA-con olled genes in he CSE2 mu an . Ammonium-g own wild- ype and CSE2 Anabaena cul u es we e di ided in o h ee aliquo s. Aliquo s we e ans e ed o 6h oni a e-con aining medium (NO 3 ⫺ ) o o ni ogen- ee medium (N 2 ) o we e main ained in ammonium-con aining medium (NH 4 ⫹ ). (A) Samples we e aken o o al RNA isola ion. Fi een mic og ams o o al RNA was dena u ed, sepa a ed by elec opho esis, blo ed, and hyb idized wi h gi A and glnA p obes. Hyb idiza ion signals we e quan i ied wi h a Cyclone S o age Phospho sys em au o adiog aphy appa a us. gi A and glnA le els we e no malized o hose o npB. I should be no ed ha 100% co esponds o he maximal signal o hyb idiza ion o each p obe and, hus, signals om di e en p obes canno be compa ed. (B) F om he same cul u es as hose used o No he n blo analysis, samples we e aken o Wes e n blo ing. To al p o eins we e isola ed and esol ed by SDS-PAGE, blo ed, and incuba ed wi h an i-IF7A and an i-T xA an ibodies. The il e was s ipped and incuba ed wi h an i-GS an ibodies. (C) G ow h o CSE2 exconjugan s ha bo ing wild- ype (WT1 o WT4) o mu an (MT1 o MT4) e sions o he gi A gene. Fi e mic oli e s o cellula suspensions om he di e en s ains and a 1/10 dilu ion we e spo ed on ammonium-con aining BG11 pla es. Pho os we e ob ained a e 2 weeks o incuba ion. VOL. 192, 2010 GS POSTTRANSCRIPTIONAL REGULATION IN ANABAENA PCC 7120 4707 on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om s ains he mRNA le el o gi genes in pa allel wi h IF7A and IF17N/IF7A accumula ion in he ammonium-media ed GS in- ac i a ion/ eac i a ion p ocesses. Figu e 8B shows ha ammo- nium addi ion o ni a e-g own cells p o okes an inc ease o gi A mRNA in he WT s ain and o he gi B/gi A chime ic gene in he ACHI s ain. Wi h espec o he p o ein le els, in he ACHI s ain bo h p o eins, IF7A and IF17N/IF7A, accumu- la ed a e ammonium addi ion and dec eased upon ammo- nium emo al (Fig. 8C). In pa allel wi h No he n and Wes e n blo ing expe imen s, we measu ed GS ac i i y o e he same ime cou se in he wo s ains. A clea di e ence in GS ac i i y could be obse ed a e ammonium addi ion (Fig. 8D). Whe eas he ACHI s ain eached abou 40% o he ini ial ac i i y in he i s 2 h, he WT s ain showed he ypical slow Anabaena GS inac i a ion. Pgi A is ep essed in he e ocys s. The GS egula o y sys em is s ic ly dependen on he global ni ogen con ol egula o N cA in bo h Synechocys is (9) and Anabaena (see abo e). No ably, a di e en ial n cA gene exp ession be ween he e o- cys s and ege a i e cells has been desc ibed in Anabaena (23, 24). The e o e, i would be o in e es o analyze gi exp ession along he Anabaena ilamen s. Fo his s udy we analyzed in i o he exp ession o a gi A-g p ansla ional usion. This con- s uc was in oduced in Anabaena by conjuga ion (3) and FIG. 8. GS inac i a ion/ eac i a ion p ocesses in he ACHI s ain. (A) In i o inac i a ion o Anabaena GS wi h IF7A o IF17N/IF7A. Anabaena GS (1.65 ␮g) was incuba ed wi h inc easing quan i ies o IF7A o IF17N/IF7A in a inal olume o 20 ␮l. Inac i e GS-IF complexes we e allowed o o m o 2 min, and GS ans e ase ac i i y was de e mined. One hund ed pe cen ac i i y co esponds o 0.3 uni o GS. Wild- ype and ACHI Anabaena s ains we e g own in BG11C using ni a e as ni ogen sou ce. A he ime indica ed by an a ow in panel D, 10 mM NH 4 Cl was added. An a ow in panel D also indica es he ime a which cells we e washed wi h ammonium- ee medium and GS eac i a ion ook place. (B) No he n blo assay o he gi genes unde di e en ni ogen condi ions. To al RNA was isola ed om cells g own wi h ni a e (0) and a e ammonium addi ion (⫹NH 4 ⫹ ) a he indica ed imes (min). Gels we e blo ed and hyb idized wi h gi A (WT s ain) and gi B (ACHI s ain) p obes. Fil e s we e s ipped and ehyb idized wi h an npB gene p obe as a loading con ol. (C) Wes e n blo assay o IF7A and IF17N/IF7A p o eins du ing he GS inac i a ion/ eac i a ion p ocesses. Samples we e aken om ni a e-g own cells (0) and a e ammonium addi ion (⫹NH 4 ⫹ )o emo al (⫺NH 4 ⫹ ) a he indica ed imes (min). To al p o eins we e isola ed and esol ed by SDS-PAGE, blo ed, and incuba ed wi h an i-IF7A and an i-T xA an ibodies. (D) F om he same cul u es as hose used o No he n and Wes e n analysis, GS ans e ase ac i i y was de e mined in si u. 4708 GALMOZZI ET AL. J. BACTERIOL. on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om in eg a ed h ough homologous ecombina ion in he gi A lo- cus. The esul ing Anabaena s ain, AGFP1, was examined by luo escence mic oscopy. A delayed ammonium-dependen in- duc ion o gi genes in ni ogen-s a ed cells has been epo ed o Synechocys is (9). This delay is likely due o he high 2-oxo- glu a a e le els unde hese condi ions (20). Assuming a sim- ila scena io in ni ogen- ixing Anabaena cells (16, 21, 30), we analyzed by No he n blo ing gi A induc ion a e ammonium addi ion in wild- ype Anabaena cells om diazo ophic o ni- a e-supplied cul u es. A delayed gi A induc ion was obse ed in ni ogen- ixing cells (no shown). Taking his in o accoun , we moni o ed Pgi A induc ion in he AGFP1 s ain. Cells o his s ain we e cul i a ed in ni a e-con aining medium and hen ans e ed o ni ogen- ee medium. Once ma u e he - e ocys s we e obse ed by ligh mic oscopy (24 h), 10 mM ammonium was added and samples we e aken o luo es- cence mic oscopy analysis a 3, 4.5, and 6.5 h. Upon ammo- nium addi ion, GFP exp ession in ege a i e cells becomes highe han ha obse ed in he e ocys s. Such di e en ial ex- p ession is clea ly obse ed a 4.5 and 6.5 h (Fig. 9). This obse a ion sugges s ha de ep ession o he gi A p omo e is no obse ed in he e ocys s, and hus, he GS inac i a ion sys em is ep essed in his ype o cell. DISCUSSION The wo k p esen ed he e e eals ha he GS pos ansc ip- ional egula ion sys em desc ibed i s in he Synechocys is sp. PCC 6803 s ain is no es ic ed o his cyanobac e ium. In ac , genes homologous o gi A and gi B om Synechocys is ha e been ound in se e al cyanobac e ial genomes bu seem o be absen in s ains o he genus P ochlo ococcus. He e we show ha he gi A gene om he ilamen ous, ni ogen- ixing cyanobac e ium Anabaena sp. PCC 7120 is esponsible o GS inac i a ion in his o ganism. I is wo h no ing ha he gene ic con ex s o gi A genes in se e al genomes o ilamen ous cya- nobac e ia a e simila . In hese s ains, Anabaena sp. PCC 7120, Anabaena a iabilis ATCC 29413, Nos oc punc i o me sp. PCC 73102, Nodula ia sp. s ain PCC 9350, and Anabaena azollae, he gi A gene is loca ed downs eam and on he oppo- si e s and om he GS-encoding gene, glnA. This ac aises he possibili y o addi ional GS egula o y mechanisms, medi- a ed by he gi A gene, a ec ing glnA a he mRNA le el, which would be conse ed in ilamen ous cyanobac e ia. Fu he - mo e, his p oximal localiza ion o he GS/IF coding genes may be ela ed o genome eo ganiza ion phenomena o coe olu- iona y p ocesses. In his sense, ou obse a ion ha only IF7A is able o inac i a e Anabaena GS in i o (Fig. 4) is consis en wi h his possible coe olu ion. The cha ac e iza ion o gi A exp ession in Anabaena e eals ha ammonium-media ed up egula ion o his gene is no ansi o y, as desc ibed o gi genes in Synechocys is (8). The slow GS inac i a ion obse ed in Anabaena migh be he ea- son why gi A exp ession emains high du ing ammonium ea - men . In Synechocys is, ammonium addi ion p o okes a s ong dec ease in he 2-oxoglu a a e pool and hus gi genes a e de ep essed. Howe e , a quick GS inac i a ion leads o he inc ease o he 2-oxoglu a a e amoun and N cA-media ed e- p ession o gi genes akes place again (9, 20). In his ega d, Synechocys is mu an s ains ha ha bo only he gi A gene beha e simila ly o Anabaena wi h espec o GS inac i a ion and gi A exp ession (no shown). Analysis o he Anabaena gi A p omo e e ealed he p es- ence o wo N cA binding si es; one o hem is cen e ed a posi ion ⫺28.5 in espec o he TSP, which is a localiza ion desc ibed o N cA- ep essed p omo e s, cen e ed down- s eam o posi ion ⫺40.5 (9). The o he si e, cen e ed a posi- ion ⫺77.5, is a pu a i e ac i a o si e because some N cA- ac i a ed p omo e s ha e been desc ibed o bea N cA binding si es ups eam o posi ion ⫺41.5 no ma ching he s uc u e o he canonical N cA-ac i a ed p omo e , wi h an N cA binding box cen e ed a ⫺40.5 (9, 14). One p omo e in which N cA ac s bo h as an ac i a o and as a ep esso has been desc ibed; his is he case o he gl X gene om Synechococcus elonga us, bu i s egula o y pa e n is unique among he N cA- egula ed genes. In he case o he Anabaena gi A gene, he esul s ob- ained wi h he n cA mu an s ain (CSE2) clea ly demons a e FIG. 9. GFP luo escence o Anabaena s ain ca ying he gi A-g p usion (AGFP1). GFP luo escence mic og aphs o diazo ophically g own ilamen s a e incuba ion wi h 10 mM ammonium o 3, 4.5, o 6.5 h. Ligh ansmission mic og aphs (le column), phycobilip o ein au o luo- escence (middle column), and GFP luo escence ( igh column) a e shown o each condi ion. Whi e iangles poin o he e ocys s. VOL. 192, 2010 GS POSTTRANSCRIPTIONAL REGULATION IN ANABAENA PCC 7120 4709 on July 20, 2017 by USE/BCTA.GEN UNIVERSITARIAh p://jb.asm.o g/Downloaded om