Impact of heavy metals in the microalga Chlorella sorokiniana and assessment of its potential use in cadmium bioremediation

Aquatic Toxicology Impact of heavy metals in the microalga Chlorella sorokiniana and assessment of its potential use in cadmium bioremediation --Manuscript Draft-- Manuscript Number: AQTOX-D-21-00399R1 Article Type: Research Paper Keywords: microalgae; heavy metal; nitrogen uptake; accumulation; enzymatic activity; gene expression Corresponding Author: Javier Vigara Fernández, Dr. Universidad de Huelva - Campus El Carmen Huelva, Andalucia SPAIN First Author: Antonio Leon-Vaz, Dr. Order of Authors: Antonio Leon-Vaz, Dr. Rosa León, Dr. Inmaculada Giráldez, Dr. Jose María Vega, Dr. Javier Vigara Fernández, Dr. Abstract: The chlorophyte microalga Chlorella sorokiniana was tested for the bioremediation of heavy metals pollution. It was cultured with different concentrations of Cu+2, Cd+2, As (III) and As (V), showing a significant inhibition on its growth at concentrations of 500 µM Cu+2, 250 µM Cd+2, 750 µM AsO3-3 and 5 mM AsO4-3 or higher. Moreover, the consumption of ammonium was also studied, showing significant differences for concentrations higher than 1 mM of Cu+2 and As (III), and 5 mM of As (V). The determination of intracellular heavy metals concentration revealed that Chlorella sorokiniana is an outstanding Cd accumulator organism, able to accumulate 11,232 mg kg-1 of Cd, and removing 65% of initial concentration of this heavy metal. Finally, antioxidant enzymes, such as catalase (CAT) and ascorbate peroxidase (APX), and enzymes involved in the production of glutamate and cysteine, such as glutamine syntethase (GS), glutamate dehydrogenase (GDH), O-acetylserine (thiol) lyase (OASTL) and NAD-isocitrate dehydrogenase (NAD-IDH) were studied both at gene expression and enzymatic activity levels. These enzymes exhibited different grades of upregulation, especially in response to Cd and As stress. However, GS expression was downregulated when Chlorella sorokiniana was cultured in the presence of these heavy metals. Suggested Reviewers: Alexandra Dubini, Dr. Universidad de Cordoba Facultad de Ciencias [email protected] Expert in bioremediation Simona Carfagna, Dr. Università degli Studi di Napoli Federico II: Universita degli Studi di Napoli Federico II [email protected] Expert in microalgae and metallic stress Johann Andersen-Ranberg, Dr. University of Copenhagen Department of Plant Biology and Biotechnology: Kobenhavns Universitet Institut for Plantebiologi og Bioteknologi [email protected] Expert in microalgae and plants Ismaiel Mostafa Zagazig University [email protected] Expert in microalgae Powered by Editorial Manager® and ProduXion Manager® from Aries Systems Corporation Impact of heavy metals in the microalga Chlorella sorokiniana 1 and assessment of its potential use in cadmium bioremediation 2 3 Antonio León-Vaz1, Rosa León1, Inmaculada Giráldez2, José María Vega3, Javier 4 Vigara1* 5 6 1. Laboratory of Biochemistry. Faculty of Experimental Sciences. Marine International 7 Campus of Excellence and REMSMA. University of Huelva, 210071 Huelva, Spain 8 2. Department of Chemistry. Research Center in Technology of Products and Chemical 9 Processes, PRO2TECS. University of Huelva. Campus el Carmen s/n 21071, Huelva, Spain. 10 3. Plant Biochemistry and Molecular Biology Department, Faculty of Chemistry, University 11 of Seville, 41012 Seville, Spain. 12 *Corresponding author: [email protected] 13 Highlights: 14 - C. sorokiniana can tolerate high concentrations of Cu, Cd, As (III) and As (V) 15 - Ammonium consumption is affected only at high concentrations of heavy metals 16 - C. sorokiniana can accumulate up to 11,000 mg kg-1 of Cd 17 - Antioxidant enzymes are overexpressed in the presence of these metals 18 - N and S assimilation metabolism is also altered by the presence of heavy metals 19 20 Keywords: microalgae, heavy metal, nitrogen uptake, accumulation, enzymatic activity, gene 21 expression 22 23 Abstract 24 The chlorophyte microalga Chlorella sorokiniana was tested for the bioremediation of heavy 25 metals pollution. It was cultured with different concentrations of Cu+2, Cd+2, As (III) and As (V), 26 showing a significant inhibition on its growth at concentrations of 500 µM Cu+2, 250 µM Cd+2, 27 750 µM AsO3-3 and 5 mM AsO4-3 or higher. Moreover, the consumption of ammonium was also 28 studied, showing significant differences for concentrations higher than 1 mM of Cu+2 and As (III), 29 and 5 mM of As (V). The determination of intracellular heavy metals concentration revealed that 30 Chlorella sorokiniana is an outstanding Cd accumulator organism, able to accumulate 11,232 mg 31 Manuscript File Click here to view linked References kg-1 of Cd, and removing 65% of initial concentration of this heavy metal. Finally, antioxidant 32 enzymes, such as catalase (CAT) and ascorbate peroxidase (APX), and enzymes involved in the 33 production of glutamate and cysteine, such as glutamine syntethase (GS), glutamate 34 dehydrogenase (GDH), O-acetylserine (thiol) lyase (OASTL) and NAD-isocitrate dehydrogenase 35 (NAD-IDH) were studied both at gene expression and enzymatic activity levels. These enzymes 36 exhibited different grades of upregulation, especially in response to Cd and As stress. However, 37 GS expression was downregulated when Chlorella sorokiniana was cultured in the presence of 38 these heavy metals. 39 40 1. INTRODUCTION 41 Heavy metals are hazardous pollutants especially dangerous for aquatic ecosystems. The mining 42 and mineral treatment activities, which produce wastewater with Cu, Cd or As, among others, are 43 the main cause of pollution by heavy metals of the aquatic ecosystems. These heavy metals have 44 a high impact in all the organisms present in the polluted environments, especially in microalgae 45 (Salama et al., 2019). It has been described that metal stress can induce the increase of reactive 46 oxygen species (ROS) and the expression of enzymes involved in the elimination of these 47 molecules, such as catalase (CAT), glutathione reductase (GR) or ascorbate peroxidase (APX) 48 (Sabatini et al., 2009). Moreover, other cellular pathways involved in nutrients assimilation or 49 metabolism are also affected by heavy metals (Devriese et al., 2001; León-Vaz et al., 2021). 50 Additionally, alterations in the DNA, mutagenesis and other toxic effects have also been described 51 in microalga and other aquatic organisms exposed to heavy metals (Salama et al., 2019). Thus, 52 understanding these responses and the metabolic modifications produced under metal stress 53 conditions is essential for the development of heavy metals phycoremediation procedures. 54 Different heavy metal remediation methods, such as chemical precipitation, ion-exchange, 55 flocculation or membrane filtration, have been developed with different results (Salama et al., 56 2019). On the other hand, an increasing number of studies have shown the potential of bacteria 57 and microalgae, in order to remove heavy metals from aquatic environments (Li et al., 2020). 58 Microalgae have been reported to have several advantages for bioremediation of heavy metal 59 compared to bacteria and fungi, because of their tolerance and high accumulation capacity. 60 Although exposure to heavy metals may affect growth and metabolism of microalgae, many 61 species are able to deal with high concentrations of these compounds and remove them from 62 wastewater (Debelius et al., 2009). As a consequence, microalgae could be a cost-effective and 63 ecologically safe alternative for remediation of heavy metals in aquatic environments and an 64 excellent model, providing important information about the physiological impact of these 65 contaminants in plant cells 66 In this context, the microalga Chlorella sorokiniana (C. sorokiniana) emerges as an excellent 67 alternative to develop bioremediation strategies. This chlorophyte presents a wide range of 68 advantages over other microalgae. Not only can C. sorokiniana tolerate a broad range of 69 temperature (Yoshida et al., 2006), but also can grow under different adverse conditions, 70 including wastewaters or heavy metal wastes (León-Vaz et al., 2019; Liang et al., 2017). In 71 addition, the microalga shows a high growth rate compared to other chlorophytes explored for 72 their use in phycoremediation, such as Chlamydomonas reinhardtii, Chlorella minutissima. or 73 Scenedesmus sp. (Salama et al., 2019). As a consequence, C. sorokiniana could be an optimal 74 candidate to study the response of plant cells to heavy metals stress and evaluate its accumulation 75 capacity and its possible use in bioremediation. 76 The aim of the present study is to determine the response of the microalga C. sorokiniana to the 77 presence of Cu+2, Cd+2, and the metalloid As (III and V), focussing on its bioaccumulation 78 capacity, growth and ammonium consumption rates. These elements are common wastes 79 generated in pyrite extraction (Taggart et al., 2006), an important activity in the pyrite belt located 80 in the SW of the Iberian Peninsula . Moreover, the effect of these elements on the gene expression 81 and the activity level of several enzymes involved in antioxidant and nitrogen and sulphur 82 metabolism of the microalga has also been studied. 83 84 2. MATERIALS AND METHODS 85 2.1. Algal strain and culture conditions 86 C. sorokiniana 211-32 was kindly provided by the Institute of Plant Biochemistry and 87 Photosynthesis (IBVF; Seville, Spain). The microalga cells were grown at 27 ºC in TAP (Tris- 88 acetate-phospate) media with acetate and ammonium concentrations previously optimized (León- 89 Vaz et al., 2019), under continuous agitation (150 rpm) and white light irradiation (150 E m-2 s- 90 1). When indicated, different concentrations of CuCl2, CdCl2, NaAsO2 or Na2HAsO4 were added 91 to the culture medium and pH was adjusted out to 6.5-7 before autoclaving. 92 93 2.2. Analytical determinations 94 Dry weight (DW) was determined as previously described in León-Vaz et al. (2019), using 5 mL 95 of culture, and drying the filters overnight at 90 °C. 96 For ammonium determination in culture medium, total ionic strength was calculated with an 97 ammonium ion selective electrode, as described in León-Vaz et al. (2019). 98 99 2.3. Bioconcentration factor (BCF) calculation 100 Cooper, cadmium and arsenic content in lyophilized cells or culture media of C. sorokiniana was 101 determined by Inductively Coupled Plasma Mass Spectrometry (ICP-MS). Freeze-dried cells 102 (0.05 g) were digested as described in León-Vaz et al. (2021). Samples were measured in an 103 Agilent 7700 spectrometer (Agilent Technologies, Santa Clara, CA, USA). The BCF was 104 calculated as described in Ellison et al., (2014), with the equation: 105 𝑩𝑪𝑭 = 𝐶𝑏 𝐶𝑤 106 where Cb is the concentration of the heavy metal in dry algal biomass (mg kg-1) and Cw is the 107 concentration in culture medium (mg L-1). 108 109 2.4. Preparation of crude extract 110 At 42h of culture, C. sorokiniana cells were harvested by centrifugation and traces of heavy 111 metals in culture media were eliminated by washing with Milli-Q water. Cells were then 112 resuspended in 50 mM Tris-HCl pH 8.0 buffer at 0.2 g fresh weight mL-1, in a bashing beads tube. 113 The cells were disrupted by agitation with glass beads in a Digital Disruptor Genie® (Scientific 114 Industries, Bohemia, NY, USA) for 3 cycles of 30 s, and the homogenate was centrifuged twice 115 at 14000 x g for 20 min. The supernatant obtained was used as the crude extract source. Bio-Rad 116 Bradford assay was used to determined protein in crude extract according to the manufacture 117 protocol, using BSA as standard. 118 119 2.5. Enzyme assays 120 All the assays were performed with the crude extract prepared as above indicated. APX and CAT 121 assays were performed as previously described Daud et al. (2014) and Martins and English, 122 (2014), respectively. GDH was measured kinetically as described Gronostajski et al. (1978) for 123 C. sorokiniana. GS and OASTL activities were determined colorimetrically, measuring the γ- 124 glutamyl hydroxamate and L-cysteine formed respectively, as described in Devriese et al. (2001). 125 Finally, NAD-IDH activity was measured as described by Domínguez et al. (2003). 126 127 2.6. qRT-PCR analysis 128 C. sorokiniana total RNA was extracted according to Arriola et al. (2018) using Direct-zol RNA 129 Kit (Zimo Research, Irvine, CA, USA). Gene expression experiments were carried out in a 130 Mx3000P Multiplex Quantitative PCR qPCR Equipment (Stratagene) using 1 μL of the cDNA as 131 template and the SYBR® Premix Ex Taq, Bulk Mix (Takara Bio, Kusatsu, Japan), as previously 132 described (Rengel et al., 2018). Each qPCR measurement was carried out in triplicate using 133 specific primers for the APX, CAT, GS, GDH, OASTL and NAD-IDH encoding genes (Table 1). 134 The 18s gene (KF673387), which expression was constitutive under the different conditions used, 135 as has been previously stated (Wan et al., 2014), was used as hosekeeping gene to normalize 136 mRNA abundance. The fold change in gene expression was calculated using the relative 137 quantification 2−ΔΔCT approach (Pfaffl, 2001). 138 Table 1. Oligonucleotides used as primers for quantitative RT-PCR experiments 139 Primer Name Gene Bank Accession number no. Name Sequence APX PRW20193.1 qAPXF GTTCCACGACGCCGGCTCCTACA qAPXR CTGCCGCCCCACTGCCACCTTGAT CAT PRW57738.1 qCATF CCCACCTGCGGCGTCAAGTTCCT qCATR CGGTGGCGCTGCGTGTCCTGGTA GS PRW34037.1 qGSF CACCGGCCCCCTGGAGACC qGSR GCAGGGGGATGCGGATGGAG GDH PRW44353.1 qGDHF AGATGGGCGGCCGCGTGGTAGC qGDHR GCCGCCGCCGTTGGTGAAGATG NAD-IDH PRW57886.1 qNADIDHF GTGGTGCCCGGCGTGGTGGAGTC qNADIDHR CCCGTTGGCGCCGATGTTGC OASTL PRW20938.1 qOASTLF GCAACCCGGGGCCCCACAAGAT qOASTLR GGAACAGCGCGGACGACAGGTAGC 18sCS KF673387.1 q18sCSF TCCGCCGGCACCTTATGAGAAATC q18sCSR CGCGTGCGGCCCAGAACA APX, ascorbate peroxidase 6; CAT, catalase isoenzyme 1; GS, glutamine synthetase; GDH, glutamate 140 deshydrogenase 1 isoform X1; NAD-IDH, isocitrate dehydrogenase [NAD] catalytic subunit 141 mitochondrial; OASTL, cysteine synthase chloroplastic; 18sCS, Chorella sorokiniana 18s ribosomal gene. 142 2.7 Statistical analysis 143 All measures were carried out by triplicate and represented as mean value ± SD. Significance of 144 values was considered for *p < 0.05 and **p < 0.01. Statistical analyses were performed using 145 STATISTICA 8.1 software (Dell, Round Rock, Tx, USA), by comparing mean values using one- 146 way analysis of variance (ANOVA). 147 148 3. RESULTS AND DISCUSSION 149 3.1. Effect of heavy metals exposure on C. sorokiniana growth 150 The influence of different concentrations of Cu, Cd, As (III) and As (V) on the growth of C. 151 sorokiniana was studied, being these concentrations between 0.1-5 mM, 50-500 M, 0.25-5 mM, 152 and 2.5-50 mM for Cu, Cd, As (III) and As (V), respectively. As shown in Fig.1A, C. sorokiniana 153 growth was affected at a concentration of 500 M of Cu, with a significant decrease of total 154 biomass reached at 72 h, being 20 % lower than control culture (p < 0.05). However, the microalga 155 could grow even in the presence of 1 mM Cu, reaching 70% of the biomass obtained in the control 156 culture. These results show the high tolerance of C. sorokiniana to Cu, higher than other 157 microalgae such as Chlamydomonas reinhardtii and Scenedesmus acuminatus (Table 2). High 158 tolerance to this heavy metal has been also described for organisms which live in Cu contaminated 159 soils (Table 2). 160 161 Fig.1: Growth curve of C. sorokiniana cultured with different concentrations of Cu+2 (A), Cd+2 (B), 162 As III (C), and As V (D). Cells were cultured in optimized TAP media, as described in Materials and 163 Methods. * Significant differences in biomass between control and heavy metal treatment at p < 0.05. 164 On the other hand, the tolerance of C. sorokiniana to Cd was lower than to Cu (Fig.1B). The 165 microalga has, in the presence of Cd concentrations until 200 M Cd, growth rates similar to the 166 control. At higher concentrations, despite growing with a normal rate during the first 24 h, the 167 cultures experimented a considerable growth inhibition thereafter. Moreover, significant 168 differences in total biomass obtained at 72 h were observed for cultures with 250 or 500 µM of 169 Cd (75 and 55 % of the control biomass, respectively). This could be due to the higher toxicity of 170 Cd, which is able to inhibit the synthesis of chlorophylls and the photosynthesis, or induce the 171 production of ROS, as has been described in our previous studies with Chlamydomonas 172 reinhardtii (Domínguez et al., 2003). However, C. sorokiniana is more tolerant to Cd than other 173 microalga species, such as Chlamydomonas reinhardtii, Skeletonema marinoi or Thalassiosira 174 baltica (Table 2). 175 Table 2. Comparison of tolerance to heavy metals in different organisms 176 Heavy metal Organism Tolerance Reference Cu Chlamydomonas reinhardtii 200 µM (Nowicka et al., 2016) Scenedesmus acuminatus 50 µM (Hamed et al., 2017) Elsholtzia haichowensis 50-6300 mg kg-1 soil (Li et al., 2007) Chlorella sorokiniana 1 mM This study Cd Chlamydomonas reinhardtii 50-300 µM (Domínguez et al., 2003) Skeletonema marinoi 3.3-13 µM (Andersson et al., 2020) Thalassiosira baltica 1.3-5.2 µM (Andersson et al., 2020) Chlorella sorokiniana 50-500 µM This study As III Nannochloropsis sp. 1 mM (Upadhyay et al., 2016) Chlorella sp. 300 µM (Levy et al., 2005) Monoraphidium arcuatum 200 µM (Levy et al., 2005) Chlorella sorokiniana 1 mM This study As V Chlorella vulgaris 2.7 mM (Jiang et al., 2011) Dunaliella salina 20 mM (Wang et al., 2017) Chlorella sp. 60 µM (Levy et al., 2005) Monoraphidium arcuatum 30 µM (Levy et al., 2005) Chlorella sorokiniana 50 mM This study 177 As Fig.1C shows, C. sorokiniana tolerated concentrations until 750 M As (III), without a 178 significant decrease of growth rate or final biomass reached, being capable to live even at the 179 concentrations of 1 mM (60 % of control dry weight, at 72 h). The tolerance observed for As (V), 180 was higher than to arsenite, and the decrease of the growth was proportional to concentration of 181 this metalloid, with significant differences in final biomass obtained at 5 mM (Fig.1D). 182 Furthermore, C. sorokiniana is able to tolerate a concentration of 50 mM As (V) in the culture 183 medium, showing only a partial yet substantial inhibition of its growth rate. It has been described 184 that microalgae have different mechanisms to cope with As toxicity, including oxidation from As 185 (III) to As (V), methylation of As species or formation of arsenosugars (Wang et al., 2015). 186 Similar adaptation mechanisms can be the cause of the enormous tolerance of C. sorokiniana to 187 arsenate, which is much higher than the observed in Chlorella vulgaris (Table 2) and similar to 188 marine microalgae Dunaliella salina or Nannochloropsis sp. (Table 2). 189 Fig.2 shows the relation between heavy metal concentrations and growth rates, calculated as 190 previously described (León-Vaz et al., 2019). In Cd cultures, two responses were observed; one 191 until 200 M, where growth rate was maintained at 80% of that of the control; and another one 192 upon this concentration, where there was a quick inhibition of relative growth rate. In fact, at 500 193 μM Cd+2, the microalga growth rate was 40 % of the value observed in the control culture, much 194 higher tolerance than that reported for other microalgae species (Table 2). Cu and As (III) caused 195 a lower effect on the growth rate of C. sorokiniana, with values of 70% for Cu and 90% for As 196 (III), of the observed in the control culture at this concentration. In addition, at concentrations 197 lower than 200 μM, the microalga kept over 90 % of the growth rate with all the heavy metals 198 tested. These results indicated that C. sorokiniana is shown as a robust microalga able to tolerate 199 high concentrations of heavy metals and metalloids, compared to other microalgae such as 200 Chlamydomonas reinhardtii, Scenedesmus acuminatus, Chlorella sp. or Dunaliella salina (Table 201 2). 202 Furthermore, in the concentration ranges showed in Fig.2A, As (V) did not provoke a significant 203 effect on growth rate. This demonstrated that C. sorokiniana can tolerate higher concentrations 204 of As (V) than As (III), being the growth rate with 20 mM As (V) over 40 % of the values observed 205 in the control culture (Fig.2B). It has been described that AsO4-3 is analogue to PO43, so it is 206 incorporated into cells via phosphate transporters. As a consequence, there could be an uptake 207 competition between these ions (Wang et al., 2017). TAP medium has a high concentration of 208 phosphate compared to other culture media (2.16 g L-1 PO4-3), which means a low ratio As/P and, 209 consequently, this competition could explain the high arsenate tolerance and the behaviour of the 210 growth rate. 211 353 Fig.4: Relative gene expression of antioxidants and N and S enzymes from C. sorokiniana under 354 metallic stress measured after 42 h of culture. Ascorbate peroxidase (APX), catalase (CAT), glutamine 355 sinthetase (GS), glutamate dehydrogenase (GDH), NAD isocitrate dehydrogenase (IDH) and O- 356 acetylserine (thiol) lyase (OASTL) gene expression was measured after 42 h of culture. * Significant 357 differences between control and heavy metal treatment at p < 0.05 and ** at p < 0.01. 358 It has been previously described that, under abiotic stress situations, the amination activity of 359 GDH to produce L-glutamate increases, indicating its important role in the adaptive mechanisms 360 of the microalga in response to metallic stress conditions (Devriese et al., 2001). Moreover, it has 361 been widely described that this enzyme plays a leading role in N assimilation when 362 microorganisms are cultured in a rich ammonium media (Vega, 2019). All these data corroborate 363 the lead role of GDH under abiotic stress, and are in agreement with the increases showed in Fig.3 364 and Fig.4. This is remarkable in Cd cultures, which show 7 times the GDH gene expression and 365 1.6 times the GDH enzymatic activity than the control. These results agree with previous 366 proteomic studies of our research group that postulated an upregulation of glutamate biosynthesis 367 when C. sorokiniana is cultivated with 250 µM Cd (León-Vaz et al., 2021). For As (III) and (V) 368 there was also a slightly upregulation at GDH gene expression level (Fig. 4), whereas did not 369 affect at enzymatic level (Fig. 3). Similar behaviour has been reported in Brassica juncea 370 cultivated with As (Praveen et al., 2019). However, it is important to indicate that in the presence 371 of Cu, C. sorokiniana GDH suffered an inhibition, both on gene expression and enzymatic activity 372 level. 373 Another enzyme involved in the synthesis of L-glutamate is NAD-IDH, which supplies the α- 374 ketoglutarate skeleton carbon needed (Vega, 2019). Fig.3 shows a significant increase of NAD- 375 IDH activity in Cd and As (III) cultures, compared to the control. In addition, there is a significant 376 increase of gene expression in Cd, As (III) and As (V) cultures, being 5, 6 and 12 times higher 377 than in the control, respectively (Fig.4). Previous studies have demonstrated a similar behaviour 378 of IDH activity in the model microalga Chlamydomonas reinhardtii under Cd-stress (Domínguez 379 et al., 2003), probably due to the demand of α-ketoglutarate needed for the glutamate and PCs 380 synthesis. Although there are no many studies with IDH in these stress conditions, previous works 381 showed the importance this enzyme in alleviating the oxidative stress produced by As (Rodríguez- 382 Ruiz et al., 2019). 383 On the other hand, OASTL is an enzyme involved in S metabolism which catalyses the 384 biosynthesis of cysteine (Vega, 2019), another amino acid needed for the synthesis of PCs. Fig.3 385 shows an increase in OASTL activity, between 1.2 and 2 times more than control, being 386 significant in Cd, As (III) and As (V). In addition, Fig.4 shows similar results for gene expression 387 in these cultures, being between 4 and 8 times the gene expression of the control cultures. The 388 OASTL activation and the GDH and IDH upregulation observed in Cd cultures, demonstrates that 389 the supply of Glu and Cys needed for PCs synthesis and vacuolar transport mediated by PCs are 390 guaranteed. This is in agreement with the Cd accumulation data previously mentioned (Table 4), 391 and the proteomics results reported by León-Vaz et al. 2021, where an increase in size and number 392 of C. sorokiniana vacuoles have been reported when the microalga was cultured under Cd stress. 393 In the same way, the increase of Cys content under As stress has been previously reported in 394 plants and microalgae in order to alleviate oxidative damages (Rodríguez-Ruiz et al., 2019; 395 Upadhyay et al., 2016). Finally, there was a minor increase of OASTL gene expression and 396 enzymatic activity when C. sorokiniana was cultivated with Cu, following the same tendency that 397 the other enzymes studied. 398 399 5. CONCLUSIONS 400 This study demonstrates that C. sorokiniana is a robust microalga able to tolerate high 401 concentrations of Cu, Cd and As, without significant growth rate inhibition. We have observed in 402 the microalga an important upregulation of the antioxidant enzymes and the enzymes involved in 403 synthesis of the amino acids glutamate and cysteine, which are precursors of the phytochelatins, 404 as response to metal stress. As a consequence of these metabolic alterations, C. sorokiniana is 405 able to cope with such high heavy metal concentrations. The high Cd accumulation capacity of 406 this microalga, its capacity of removal it, and its high tolerance to this element, makes of C. 407 sorokiniana an excellent organism for the potential bioremediation of this heavy metal. 408 409 Acknowledgments 410 This work was supported in part by research grants from the European governments (INTERREG 411 VAPOCTEP-2014-2020; 0055_ALGARED_PLUS_5_E), the Operative FEDER Program‐ 412 Andalucía 2014‐2020, the University of Huelva (UHU-1257518), and by the European Regional 413 Development Fund through the Agencia Estatal de Investigación grant (PID 2019-110438RB- 414 C22). 415 416 6. REFERENCES 417 Andersson, B., Godhe, A., Filipsson, H.L., Rengefors, K., Berglund, O., 2020. 418 Differences in metal tolerance among strains, populations, and species of marine 419 diatoms – Importance of exponential growth for quantification. Aquat. Toxicol. 420 226, 105551. https://doi.org/10.1016/j.aquatox.2020.105551 421 Anu, P.R., Bijoy Nandan, S., Jayachandran, P.R., Don Xavier, N.D., Midhun, A.M., 422 Mohan, D., 2018. Toxicity effects of zinc on two marine diatoms, under varying 423 macronutrient environment. Mar. Environ. Res. 142, 275–285. 424 https://doi.org/10.1016/j.marenvres.2018.10.013 425 Arriola, M.B., Velmurugan, N., Zhang, Y., Plunkett, M.H., Hondzo, H., Barney, B.M., 426 2018. Genome sequences of Chlorella sorokiniana UTEX 1602 and Micractinium 427 conductrix SAG 241.80: implications to maltose excretion by a green alga. Plant J. 428 93, 566–586. https://doi.org/10.1111/tpj.13789 429 Atay, Ş., Özkoç, H.B., Uslu, V.R., 2013. Sediment toxicity for evaluation of sediment 430 quality guidelines and bioavailability of copper and zinc. Fresenius Environ. Bull. 431 22, 1031–1042. 432 Chandrashekharaiah, P.S., Debanjan, S., Dasgupta, S., Banik, A., 2021. Cadmium 433 biosorption and biomass production by two freshwater microalgae Scenedesmus 434 acutus and Chlorella pyrenoidosa: An integrated approach. Chemosphere 269, 435 128755. https://doi.org/10.1016/j.chemosphere.2020.128755 436 Chen, B.L., Huang, Q., Lin, X.J., Shi, Q.Q., Wu, S.G., 1998. Accumulation of Ag, Cd, 437 Co, Cu, Hg, Ni and Pb in Pavlova viridis Tseng (Haptophyceae). J. Appl. Phycol. 438 10, 371–376. https://doi.org/10.1023/A:1008048410419 439 Daud, M.K., Mei, L., Najeeb, U., Khan, M.A., Deeba, F., Raza, I., Batool, A., Zhu, S.J., 440 2014. In vitro cadmium-induced alterations in growth and oxidative metabolism of 441 upland cotton (Gossypium Hirsutum L.). Sci. World J. 2014. 442 https://doi.org/10.1155/2014/309409 443 Debelius, B., Forja, J.M., DelValls, Á., Lubián, L.M., 2009. Toxicity and 444 bioaccumulation of copper and lead in five marine microalgae. Ecotoxicol. 445 Environ. Saf. 72, 1503–1513. https://doi.org/10.1016/j.ecoenv.2009.04.006 446 Devriese, M., Tsakaloudi, V., Garbayo, I., León, R., Vílchez, C., Vigara, J., 2001. 447 Effect of heavy metals on nitrate assimilation in the eukaryotic microalga 448 Chlamydomonas reinhardtii. Plant Physiol. Biochem. 39, 443–448. 449 https://doi.org/10.1016/S0981-9428(01)01257-8 450 Domínguez, M.J., Gutiérrez, F., León, R., Vílchez, C., Vega, J.M., Vigara, J., 2003. 451 Cadmium increases the activity levels of glutamate dehydrogenase and cysteine 452 synthase in Chlamydomonas reinhardtii. Plant Physiol. Biochem. 41, 828–832. 453 https://doi.org/10.1016/S0981-9428(03)00114-1 454 Ellison, M.B., De Nys, R., Paul, N.A., Roberts, D.A., 2014. Growth and metal 455 bioconcentration by conspecific freshwater macroalgae cultured in industrial waste 456 water. PeerJ 2014. https://doi.org/10.7717/peerj.401 457 Gill, S.S., Tuteja, N., 2010. Reactive oxygen species and antioxidant machinery in 458 abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 48, 909–930. 459 https://doi.org/10.1016/j.plaphy.2010.08.016 460 Gronostajski, R.M., Yeung, A.T., Schmidt, R.R., 1978. Purification and properties of 461 the inducible nicotinamide adenine dinucleotide phosphate-specific glutamate 462 dehydrogenase from Chlorella sorokiniana. J. Bacteriol. 134, 621–628. 463 https://doi.org/10.1128/jb.134.2.621-628.1978 464 Hamed, S.M., Selim, S., Klöck, G., AbdElgawad, H., 2017. Sensitivity of two green 465 microalgae to copper stress: Growth, oxidative and antioxidants analyses. 466 Ecotoxicol. Environ. Saf. 144, 19–25. 467 https://doi.org/10.1016/j.ecoenv.2017.05.048 468 Jiang, Y., Purchase, D., Jones, H., Garelick, H., 2011. Technical note: Effects of 469 arsenate (as5+) on growth and production of glutathione (GSH) and phytochelatins 470 (PCS) in Chlorella Vulgaris. Int. J. Phytoremediation 13, 834–844. 471 https://doi.org/10.1080/15226514.2010.525560 472 León-Vaz, A., León, R., Díaz-Santos, E., Vigara, J., Raposo, S., 2019. Using agro- 473 industrial wastes for mixotrophic growth and lipids production by the green 474 microalga Chlorella sorokiniana. N. Biotechnol. 51, 31–38. 475 https://doi.org/10.1016/j.nbt.2019.02.001 476 León-Vaz, A., Romero, L.C., Gotor, C., León, R., Vigara, J., 2021. Effect of cadmium 477 in the microalga Chlorella sorokiniana: A proteomic study. Ecotoxicol. Environ. 478 Saf. 207. https://doi.org/10.1016/j.ecoenv.2020.111301 479 Levy, J.L., Stauber, J.L., Adams, M.S., Maher, W.A., Kirby, J.K., Jolley, D.F., 2005. 480 Toxicity, biotransformation, and mode of action of arsenic in two freshwater 481 microalgae (Chlorella sp. and Monoraphidium arcuatum). Environ. Toxicol. Chem. 482 24, 2630–2639. https://doi.org/10.1897/04-580R.1 483 Li, H., Watson, J., Zhang, Y., Lu, H., Liu, Z., 2020. Environment-enhancing process for 484 algal wastewater treatment, heavy metal control and hydrothermal biofuel 485 production: A critical review. Bioresour. Technol. 298, 122421. 486 https://doi.org/10.1016/j.biortech.2019.122421 487 Li, M., Xiong, Z., Dai, L., Huang, Y., 2007. Effects of copper on nitrogen assimilation 488 in copper-tolerant and non-tolerant populations of Elsholtzia haichowensis S. 489 Water. Air. Soil Pollut. 184, 323–333. https://doi.org/10.1007/s11270-007-9419-8 490 Liang, S., Kang, Y., Zeng, L., Qin, Y., Wang, L., Zhang, Q., Luo, J., 2017. How 491 chlorella sorokiniana and its high tolerance to Pb might be a potential Pb 492 biosorbent. Polish J. Environ. Stud. 26, 1139–1146. 493 https://doi.org/10.15244/pjoes/67532 494 Martins, D., English, A.M., 2014. Catalase activity is stimulated by H2O2 in rich 495 culture medium and is required for H2O2 resistance and adaptation in yeast. Redox 496 Biol. 2, 308–313. https://doi.org/10.1016/j.redox.2013.12.019 497 Nowicka, B., Pluciński, B., Kuczyńska, P., Kruk, J., 2016. Prenyllipid antioxidants 498 participate in response to acute stress induced by heavy metals in green microalga 499 Chlamydomonas reinhardtii. Environ. Exp. Bot. 123, 98–107. 500 https://doi.org/10.1016/j.envexpbot.2015.11.008 501 Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time 502 RT-PCR. Nucleic Acids Res. 29. https://doi.org/10.1093/nar/29.9.e45 503 Praveen, A., Pandey, A., Gupta, M., 2019. Nitric oxide alters nitrogen metabolism and 504 PIN gene expressions by playing protective role in arsenic challenged Brassica 505 juncea L. Ecotoxicol. Environ. Saf. 176, 95–107. 506 https://doi.org/10.1016/j.ecoenv.2019.03.054 507 Raikova, S., Piccini, M., Surman, M.K., Allen, M.J., Chuck, C.J., 2019. Making light 508 work of heavy metal contamination: the potential for coupling bioremediation with 509 bioenergy production. J. Chem. Technol. Biotechnol. 94, 3064–3072. 510 https://doi.org/10.1002/jctb.6133 511 Rengel, R., Smith, R.T., Haslam, R.P., Sayanova, O., Vila, M., León, R., 2018. 512 Overexpression of acetyl-CoA synthetase (ACS) enhances the biosynthesis of 513 neutral lipids and starch in the green microalga Chlamydomonas reinhardtii. Algal 514 Res. 31, 183–193. https://doi.org/10.1016/j.algal.2018.02.009 515 Rodríguez-Ruiz, M., Aparicio-Chacón, M. V., Palma, J.M., Corpas, F.J., 2019. Arsenate 516 disrupts ion balance, sulfur and nitric oxide metabolisms in roots and leaves of pea 517 (Pisum sativum L.) plants. Environ. Exp. Bot. 161, 143–156. 518 https://doi.org/10.1016/j.envexpbot.2018.06.028 519 Sabatini, S.E., Juárez, Á.B., Eppis, M.R., Bianchi, L., Luquet, C.M., Ríos de Molina, M. 520 del C., 2009. Oxidative stress and antioxidant defenses in two green microalgae 521 exposed to copper. Ecotoxicol. Environ. Saf. 72, 1200–1206. 522 https://doi.org/10.1016/j.ecoenv.2009.01.003 523 Salama, E.S., Roh, H.S., Dev, S., Khan, M.A., Abou-Shanab, R.A.I., Chang, S.W., 524 Jeon, B.H., 2019. Algae as a green technology for heavy metals removal from 525 various wastewater. World J. Microbiol. Biotechnol. 35, 1–19. 526 https://doi.org/10.1007/s11274-019-2648-3 527 Santiago-Martínez, M.G., Lira-Silva, E., Encalada, R., Pineda, E., Gallardo-Pérez, J.C., 528 Zepeda-Rodriguez, A., Moreno-Sánchez, R., Saavedra, E., Jasso-Chávez, R., 2015. 529 Cadmium removal by Euglena gracilis is enhanced under anaerobic growth 530 conditions. J. Hazard. Mater. 288, 104–112. 531 https://doi.org/10.1016/j.jhazmat.2015.02.027 532 Taggart, M.A., Figuerola, J., Green, A.J., Mateo, R., Deacon, C., Osborn, D., Meharg, 533 A.A., 2006. After the Aznalcóllar mine spill: Arsenic, zinc, selenium, lead and 534 copper levels in the livers and bones of five waterfowl species. Environ. Res. 100, 535 349–361. https://doi.org/10.1016/j.envres.2005.07.009 536 Torres, M.A., Barros, M.P., Campos, S.C.G., Pinto, E., Rajamani, S., Sayre, R.T., 537 Colepicolo, P., 2008. Biochemical biomarkers in algae and marine pollution: A 538 review. Ecotoxicol. Environ. Saf. 71, 1–15. 539 https://doi.org/10.1016/j.ecoenv.2008.05.009 540 Upadhyay, A.K., Mandotra, S.K., Kumar, N., Singh, N.K., Singh, L., Rai, U.N., 2016. 541 Augmentation of arsenic enhances lipid yield and defense responses in alga 542 Nannochloropsis sp. Bioresour. Technol. 221, 430–437. 543 https://doi.org/10.1016/j.biortech.2016.09.061 544 Vega, J.M., 2019. Progress in botany, in: Cánovas, F., Lüttge, U., Leuschner, C., 545 Risueño, M.-C. (Eds.), Progess in Botany. pp. 1–40. 546 https://doi.org/10.1038/1941023a0 547 Wan, M., Jin, X., Xia, J., Rosenberg, J.N., Yu, G., Nie, Z., Oyler, G.A., Betenbaugh, 548 M.J., 2014. The effect of iron on growth, lipid accumulation, and gene expression 549 profile of the freshwater microalga Chlorella sorokiniana. Appl. Microbiol. 550 Biotechnol. 98, 9473–9481. https://doi.org/10.1007/s00253-014-6088-6 551 Wang, Y., Zhang, C., Zheng, Y., Ge, Y., 2017. Bioaccumulation kinetics of arsenite and 552 arsenate in Dunaliella salina under different phosphate regimes. Environ. Sci. 553 Pollut. Res. 24, 21213–21221. https://doi.org/10.1007/s11356-017-9758-y 554 Wang, Ya, Wang, S., Xu, P., Liu, C., Liu, M., Wang, Yulan, Wang, C., Zhang, C., Ge, 555 Y., 2015. Review of arsenic speciation, toxicity and metabolism in microalgae. 556 Rev. Environ. Sci. Biotechnol. 14, 427–451. https://doi.org/10.1007/s11157-015- 557 9371-9 558 Yoshida, N., Ikeda, R., Okuno, T., 2006. Identification and characterization of heavy 559 metal-resistant unicellular alga isolated from soil and its potential for 560 phytoremediation. Bioresour. Technol. 97, 1843–1849. 561 https://doi.org/10.1016/j.biortech.2005.08.021 562 563