Desing and construction of reporter modules for monitoring the activity of the TrcR regulator from the cyanobacterium Anabaena

Desing and construction of reporter modules for monitoring the activity of the TrcR regulator from the cyanobacterium Anabaena Instituto de Bioquímica Vegetal y Fotosíntesis, C.S.I.C and Universidad de Sevilla Dates: Feb 7, 2024 to July 15-16 Daniel Presentation date: July 15-16, 2024 This work was supported by funds from Ayuda 221 del IV Plan Propio de Docencia "IMPULSANDO LA CALIDAD DE LOS TRABAJOS FIN DE MÁSTER DE INVESTIGACIÓN EN EL MÁSTER EN GENÉTICA MOLECULAR Y BIOTECNOLOGÍA”, Universidad de Sevilla and by Grant PID2021-128477NB-I00 from MCIN/AEI/10.13039/501100011033/ FEDER, UE. ABSTRACT Transcription factors are crucial regulators of gene expression, enabling bacteria to adapt and survive under varying environmental conditions. Recent research has uncovered a novel stress response in the cyanobacterium Anabaena sp. PCC 7120 that mediates acclimation to a general slow down in translation. This response is probably regulated by many transcription factors among which, TrcR, a protein from the ribbon-helix-helix family has been identified as the regulator of a sub-set of genes. This family has unique structural and functional attributes, setting it apart from other TF families. In this study, we have focused on designing, developing, and testing new reporter systems to facilitate in vivo research on this stress response and on the regulation mediated by TrcR. This work paves the way for the fine analysis of the translational stress response of Anabaena and the unique functionalities of ribbon-helix-helix transcription factors. Keywords: Ribon-helix-helix regulador, cyanobacteria, reporter system, translational stress, auto-regulator. 1. Introduction Transcription factors (TFs) are main players in the regulation of gene expression in bacteria, controlling the first and arguably the most important step, transcription initiation (Balleza et al., 2008). These proteins possess a DNA-binding domain that allows them to attach to specific DNA sequences, thus hindering or facilitating the association of the transcription machinery to target promoters (Seshasayee et al., 2011). The activity of TFs can be modulated by various conditions including changes in their expression levels, degradation rates, or alterations in their DNA-binding capabilities. Such regulation is often triggered directly or indirectly by environmental changes, making TFs key coordinators in the cellular responses for acclimation to external stimuli. By managing the transcription of target genes, TFs enable bacteria to swiftly adjust their expression profile in response to fluctuating environmental conditions (Balleza et al., 2008). TFs are often classified based on the structure of their DNA-binding domains. In prokaryotes, a large number of TFs possess a helix-turn-helix motif, which involves an α-helix fitting into the major groove of DNA to bind specific promoter sequences (Schreiter & Drennan, 2007). While the helix-turn-helix motif is the most common, other motifs also occur. Among the diverse families of TFs, the ribbon-helix-helix (RHH) family stands out for its unique structural and functional attributes. These TFs are characterized by a compact, globular domain composed of a beta sheet ribbon followed by two alpha helices. This domain binds to a specific DNA sequence through the major groove of the DNA helix, forming a stable protein-DNA complex. What sets the RHH family apart is its mode of DNA recognition and binding. Unlike many other transcription factor families, which rely on alpha helices for binding and recognition, RHH TFs utilize the beta sheet within their DNA binding domain (Schreiter & Drennan, 2007). In this work we will be focusing on cyanobacteria, a remarkable phylum of phototrophic Gram-negative bacteria that are unique among prokaryotes in their ability to conduct oxygenic photosynthesis. Cyanobacteria have played a pivotal role in the history of Earth and the evolution of life forms in the biosphere as mayor players of the Great Oxygenation Event (GOE) during the Precambrian era, around 2.45 billion years ago. This key event catalysed a gradual rise in oxygen levels in the oceans and the atmosphere, profoundly shaping the course of evolution and the development of life forms on the planet (Sánchez-Baracaldo et al., 2022). Furthermore, cyanobacteria are the evolutionary ancestors of the chloroplasts of eukaryotic phototrophs and the recently discovered nitroplast, underscoring their enduring impact on the biological landscape (Shih, 2015) (Coale, et al., 2024). Present-day cyanobacteria exhibit astounding morphological diversity and thrive in various ecosystems, ranging from marine and freshwater environments to terrestrial habitats. Their ubiquitous presence underscores their significance in Earth's biogeochemical cycles and their contribution to the planet's ecological balance (Garcia-Pichel, 2009). Anabaena sp. PCC 7120 (also known as Nostoc sp. PCC 7120), referred to as Anabaena in this study, is a multicellular cyanobacterium exhibiting a filamentous organization with communicating cells. Anabaena has been extensively used as a model organism for research on cell differentiation, due to its capacity to differentiate cells specialized in nitrogen fixation named heterocyst. In these filaments, there is a division of labour so that photosynthesis and nitrogen fixation occur in distinct cells namely, vegetative cells and heterocysts, respectively (Flores and Herrero, 2010). However, heterocysts only differentiate when nitrogen compounds are scarce, in other conditions filaments are composed of photosynthetic cells with similar appearance and physiology. To survive and adapt to changes in its natural environment, Anabaena has developed a plethora of mechanisms to respond to different types of stress. The coordination of transcription and translation is crucial for cellular adaptation and gene expression regulation and, as previously discussed, transcription factors play a vital role in these responses. Therefore, understanding how Anabaena regulates gene expression is essential for understanding its ability to survive in diverse environments. Recent studies by Santamaría-Gómez et al., (2021) unveiled a novel response to stress in the translation apparatus in Anabaena. They found that a long operon of tRNA genes, named trn, initially regarded as cryptic due to its minimal expression, was dramatically induced during translational stress, thereby enhancing the organism's survivability under such conditions. Moreover, their research identified a group of genes encoding proteins related to gene translation, ribosome assembly or RNA metabolism exhibiting a similar expression pattern. The promoters of the trn operon and co-regulated genes contained a conserved palindromic sequence, often organized in pairs of direct repeats, suggesting regulation by a common TF (Figure 1). Experimental results confirmed the pivotal role of these tandem direct repeats in controlling the expression of such genes. Furthermore, transcriptomic analysis of Anabaena under translational stress unveiled that genes containing these regulatory sequences constituted a sub-set of the large number of genes that are induced upon translational stress. The TF that regulates this sub-set of genes by binding to the direct repeat sequences in their promoters was recently identified by Wang et al. (2023) through the analysis of mutants resistant to an amino acid analog. This TF belongs to the RHH family and was named TrcR. They observed that induction of translational stress using chloramphenicol led to a decrease in TrcR levels, thereby enabling the expression of the regulated genes. However, the specific mechanism underlying these changes remained elusive. Collectively, these studies have advanced our understanding of the Anabaena's response to translational stress and have shed light on the complex coordination between transcription and translation in Anabaena. However, many aspects of TrcR and its regulation remain unexplored. An interesting observation was that TrcR regulates its own expression, which has multiple implications regarding the dynamics of expression of trcR and its regulon. Theoretical and experimental research has shown that autoregulation can help reduce the transcription variability caused by the inherent stochastic nature of biochemical processes (Thattai and Van Oudenaarden, 2001; Becskei and Serrano, 2000). Another interesting observation was that trcR is separated by a short intergenic sequence (66 bp) from an upstream divergent operon (Figure 2). Therefore, this short intergenic sequence harbors the trcR promoter and the promoter of the divergent operon overlapping in opposite strands. Both promoters are regulated by TrcR and direct repeats for TrcR binding are observed. Given the palindromic nature of these sequences, these direct repeats are readable on both strands of the DNA, raising the question of how does binding of TrcR occurs to repress transcription from both promoters. Most prokaryotic repressors operate through occluding the recognition sequences for RNA polymerase or by preventing transcription initiation. The localization of the direct repeats overlapping with promoter sequences on both strands, is consistent with the former mechanism, but research is still needed to understand how TrcR binding to its target sequences can repress transcription from both DNA strands. The major aim of this work is to design, develop and test reporter systems to facilitate research on the regulation mediated by TrcR. Our goal is to create robust and reliable tools that could accurately monitor the activity of TrcR under various conditions, serving as an experimental platform to investigate its regulatory features. These systems are expected to enhance our understanding of the response mediated by TrcR and the knowledge on the RHH TFs and their unique functionalities. 2. Materials and methods 2.1. Strains and growth conditions Cyanobacterial strains used in this work are described in Table 1. The Anabaena sp. PCC 7120 and derivative strains were grown in BG11 medium (Rippka et al., 1979). Cultures were incubated at 30°C with illumination (20 µE m-2 s-1 from LED lamps) in Erlenmeyer flasks with shaking or in plates in medium solidified with 1% Difco agar. Antibiotics were added if required at the following concentrations: spectinomycin (Sp) and streptomycin (Sm) each at 5 µg mL- 1 in solid media or 2 µg mL-1 in liquid media, neomycin (Nm) was added at 25 µg mL-1 in solid media or 5 µg mL-1 in liquid media. Antibiotic resistance of the strains used in this work is described in Table 1. E. coli strains used in this work are described in Table 2. Strains DH5α and BL21(DE3) were cultured at 37ºC in LB (Luria-Bertani) culture medium (Sambrook & Russell, 2001). Solid media cultures were placed in an incubator, and those in liquid media were incubated in a New Brunswick Innova 43 shaker with agitation (220 r.p.m.). When required, antibiotics were added at the following concentrations: chloramphenicol (Cm) at 25 µg mL-1, Sm at 25 µg mL-1 and Sp at 100 µg ml-1. 1mM isopropyl -D-1- thiogalactopyranoside (IPTG) was added to plate cultures for the induction of TrcR expression. Lennox growth medium (Lennox, 1955) was used to culture E. coli strain BL21(DE3) since the basal level of IPTG-inducible genes was observed to be lower than in LB. Solid media cultures were placed in an incubator, and those in liquid media were incubated in a New Brunswick Innova 43 shaker with agitation (220 r.p.m.) both at 37ºC. When required, antibiotics were added at the same concentrations as in LB medium (see above). 2.2. DNA extraction Plasmids from E. coli strains were purified using the GeneJet plasmid Miniprep Kit (Thermo Scientific), following the instructions of the manufacturer. 2.3. DNA fragment purification DNA fragments resulting from digestion with restriction enzymes were separated by agarose gel electrophoresis, excised from the gel and purified using the GeneJet kit (Thermo Scientific) following the instructions of the manufacturer. In those cases where the digestion yielded a single fragment, it was purified after inactivation of the enzyme with the GeneJet kit (ThermoScientific). PCR products were purified with the same kit. Homemade G25 gel filtration columns were used for buffer exchange or salt removal of DNA fragment preparations. 2.4. PCR (Polymerase Chain Reaction) Oligonucleotides used for PCR are listed in Table 3) PCR reactions that required highfidelity amplification were performed either with Q5 high-fidelity polymerase (New England BioLabs) or with Phusion highfidelity polymerase (Thermo Scientific). Reactions were performed in a total volume of 25 µL, including 12.5 µL of commercial Master Mix, which contains the enzyme polymerase, dNTPs, magnesium salts, and a buffering compound. Additionally, 2.5 µL of each 10 µM primer stock and a variable volume containing from 0.1 to 10 ng of template DNA were added to the mixture. PCR reactions with Q5 polymerase (New England BioLabs) were performed in a total volume of 50 µL. Each reaction included 2.5 µL of each 10 µM primer stock, 0.5 µL of Q5 polymerase, 10 µL of the commercial buffer provided by the manufacturer, 1 µL of a dNTPs mix (each dNTP at a concentration of 2 mM) and a variable volume of template DNA (ranging from 0.1 to 10 ng). BIOTAQ polymerase (Meridian BIOSCIENCE) was used for PCR reactions that did not require high-fidelity amplification, such as those for the analysis of transformant colonies. These reactions were prepared in a final volume of 25 µL. Each reaction mixture contained 1.25 µL of each 10 µM primer stock, 0.5 µL of BIOTAQ polymerase, 2.5 µL of the commercial buffer provided by the manufacturer, 2.5 µL of a dNTP mix (each dNTP at a concentration of 2 mM), and 1 µL of 50 mM MgCl2. For colony analysis, biomass from colonies on a plate was mixed directly with the other components. 2.5. Restriction enzyme digestion We used SnapGene software (GSLBiotech, http://www.snapgene.com) to determine the expected band lengths and select restriction enzymes for the purpose of verifying plasmid structures. Restriction reactions were typically performed in a 15 µL volume, including 5 units of each FastDigest restriction enzyme (ThermoScientific), 3 µL of plasmid preparation containing 50-100 ng of DNA and 1.5 µL of the buffer provided by the manufacturer. Large scale restriction reactions to obtain DNA fragments for cloning were performed in a volume of 25 µL containing 0.5 µL of each FastDigest restriction enzyme (ThermoScientific), 2.5 µL of the buffer provided by the manufacturer and a varying volume of plasmid or DNA fragment preparation containing several hundreds of nanograms of DNA. In both cases reaction mixtures were incubated at 37ºC for 1 hour. 2.6. Electrophoresis DNA fragments were analyzed by electrophoresis in 0.6-1,5 % agarose gels using 0,5X TBE (45 mM Tris-borate, 45 mM boric acid, 1 mM EDTA) as running buffer. DNA bands were visualized adding 2.5 µL of the fluorescent molecule RedSafe (iNtRON Biotechnology) per 100 mL of gel. Electrophoreses were performed applying an intensity of 60-70 mA in an electrophoresis tank (Apollo). 2.7. Ligation Ligation reactions were performed using varying volumes (tipically 10-25 µL) depending on the concentrations of the fragments. The mixture was composed of 1/10 commercial buffer provided by the manufacturer and 1 µL of T4 DNA ligase enzyme (ThermoScientific). The mixture was incubated at 22ºC overnight. 2.8. Gibson assembly Gibson assembly was used to combine DNA fragments in an ordered manner. For this reaction the fragments were mixed in approximately equimolar concentrations with an equivalent volume of NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs). The reaction mixture was incubated at 50ºC for 15 minutes. 2.9. E. coli transformation assay For this work we used competent cells of E. coli DH5α and E. coli BL21(DE3) prepared by the CIC-Cartuja Culture Service (https://www.ciccartuja.es/en/services/cicca rtuja/servicio-de-cultivos-biologicos/). DH5α cells were transformed by heat shock. In order to this, competent cells were mixed with 1-5 µL of Gibson reaction or ligation reaction. This mixture was incubated on ice for 15 minutes before being subjected to a heat shock at 42ºC for 90 seconds. Then, the mixture was incubated on ice for another 5 minutes before adding 1 ml of liquid LB medium and incubating them for 1 hour in agitation at 37ºC. Finally, the cells were plated on solid LB medium with the appropriate antibiotics and cultured overnight at 37ºC. BL21(DE3) cells were trasformed by electroporation. For this, competent cells were mixed with 0.5 µL of plasmid preparation. The mixture was placed in an ice-cold 2 mm electroporation cuvette (gTPbio). The cuvette was placed in a BIO-RAD MicroPulser and subjected a 2.50 kV pulse. Immediately after, 1 ml of Lennox liquid media at room temperature was added to the cuvette, mixed thoroughly, transferred a 1 ml Eppendorf tube and incubated for 1 hour in agitation at 37ºC. Finally, the cells were plated on solid Lennox medium with the appropriate antibiotics and cultivated overnight at 37ºC. 2.10. Sequencing To analyse the sequence of our plasmids we made use of the StabVida Sanger sequencing service (https://www.stabvida.com/es). The results were analysed using NCBI BLAST (https://blast.ncbi.nlm.nih.gov/BlastAlign.c gi). 2.11. Introduction of DNA into Anabaena Anabaena triparental conjugation assays were conducted based on the protocol previously described by Elhai and Wolk (1988). Plasmid conjugation into Anabaena is limited by its restriction-modification systems. To minimize this, the plasmid of interest was first introduced in the E. coli strain HB101(pRL623). The pRL623 plasmid, known as the helper plasmid, carries genes encoding the methylases that protect DNA from the three endonucleases of Anabaena. Cell suspensions of HB101 cells containing pRL623 and the plasmid of interest were mixed in a small volume (100- 200 µL) with cell suspensions of E. coli ED8654 carrying the pRL443 conjugative plasmid, which encodes the machinery required for conjugation. This mixture was incubated at 37ºC for 2 hours without agitation. After this, the mixture was combined with a suspension of Anabaena cells containing 10 µg of chlorophyll and spread on Immobilon HATF08550 membranes (Merck) placed on BG11 plates supplemented with 5% liquid LB. These plates were incubated for 24 hours at 30ºC in an illuminated growth chamber. Following this initial incubation, the filter was transferred to a plate containing BG11 medium for another 24 hours, and then to a BG11 selective plate with the appropriate antibiotics. The filters were transferred to fresh plates daily to maintain antibiotic effectiveness until visible colonies were obtained. 2.12. Chlorophyll determination The chlorophyll levels were determined by analysing a chlorophyll extract from the concentrated Anabaena culture using the method described by MacKinney (Mackinney, 1941). First, cells from the culture were collected by centrifugation for 1 minute at 13000 x g. To prepare the chlorophyll extract, 100 µL of the concentrate were mixed with 900 µL of methanol and agitated in a vortex for 1 minute. Afterward, the mixture was centrifuged for 1 minute at 13000 x g and the absorbance at 665 nm of the supernatant was measured using a BioMate-5 spectrophotometer (Thermo Scientific). These measurements were then used to estimate the chlorophyll content considering an extinction coefficient of 74.46 ml·mg- 1·cm-1. 2.13. Microscopy Reporter protein fluorescence was visualized with a Leica DM6000B fluorescence microscope, and FITCL5 filter, and photographed with an ORCA-ER camera (Hamamatsu) with the following excitation and emisions band-passes: GFP excitation band-pass, 480/40; emission band-pass, 527/20), New Turquoise (excitation band-pass, 436/20; emission band-pass, 480/40) and mVenus (excitation band-pass, 500/20; emission band-pass, 535/20). Total fluorescence was determined using imageJ by collecting fluorescence signals in manually defined filaments. 2.14. Plasmid construction Plasmids used in this work are described in Table 4). Plasmid construction is explained in Figure 3. The pDNA27 plasmid consists of a reporter module containing the New Turquoise and mVenus reporter genes under the control of the PtrcR/Pasr0855 divergent promoter, inserted into the pRL25C replicative plasmid which contains the C.S3 (SmSp) resistance cassette (Figure 3). Its construction involved several key steps, starting with the design of the modified promoter. To facilitate this modification, we used two partially complementary 60 nucleotide-long oligonucleotides, Pall0854-1 and Pall0854-2 (Table 3). These oligonucleotides were designed to generate a double stranded DNA fragment encompassing the intergenic region between trcR and asr0855 upon annealing and extension by PCR. Each nucleotide also included a canonical Shine- Dalgarno sequence on their 5’ ends, intended to replace the original ribosome binding sites of these promoters. In addition, these oligonucleotides contained adaptor sequences for Gibson assembly with the reporter genes. To construct pDNA27, we took advantage of a previous construct named pDNA15 (Neyra and López-Igual, unpublished). This construct contained the New Turquoise and mVenus genes separated by an artificial promoter, which we aimed to replace. pDNA15 was amplified by PCR with divergent primers F-mVenus2 and New Turquoise-F (Table 3). These primers also introduced adaptor sequences on each end for Gibson assembly with the fragment described in the previous paragraph. The construction of the pDNA27 plasmid was verified through PCR, restriction digestion and sequencing, confirming the correct assembly of the reporter module. To construct pDNA28, the New Turquoise-PtrcR/Pasr0855-mVenus module of pDNA27 was amplified by PCR with primers mVenus-R-EcoRI and R-Turq-new- pAUV (Table 3), which were specifically designed to introduce EcoRI restriction sites at both ends of the module. The PCR fragment was digested with FastDigest EcoRI enzyme (Thermo Scientific) and ligated to the pCSEL24 (Olmedo-Verd et al., 2006) digested with EcoRI. The structure of the pDNA28 plasmid was verified by PCR, restriction digestion analysis, and sequencing. The restriction analysis also confirmed the orientation of the insert within the new plasmid The pDNA30 plasmid was designed to drive the expression of the TrcR transcriptional regulator in E. coli. To achieve this the pACYCDuet-1 plasmid was selected as it has a replication origin compatible with our previous construct, pDNA27 and a Cm resistance cassette. We took advantage of a previously generated preparation of pACYCDuet-1 vector digested with NcoI and SalI restriction enzymes that was used as a template for PCR amplification with Duet-R and Duet-F primers (Table 3). These primers produced an open pACYCDuet-1 plasmid with two 10-nucleotide-long adapter sequences on both ends, complementary to the ends of the trcR gene for Gibson assembly. trcR was amplified by PCR amplification using Anabaena 7120 genomic DNA as the template, and the 8-all0854-F and 9-all0854- R primers (Table 3). These primers generated a trcR gene insert with two 10- nucleotide adapter sequences on both ends, complementary to the ends of the linearized pACYCDuet-1 vector. Both PCR products were joined by Gibson assembly. The structure of the pDNA30 plasmid was verified by PCR, restriction digestion analysis, and sequencing. 3. Results and Discussion 3.1. Generation and testing of a reporter system to analyze regulation mediated by TrcR in Anabaena As part of its research on the regulation of the trn operon, the host group developed and evaluated a reporter system designed to assess the regulatory elements shared by the trn promoter and co-regulated genes (Santamaría-Gómez et al., 2021). This system is based on several strains, each containing the gene encoding the green fluorescent protein (GFP) fused to either the promoter of the housekeeping initiator tRNA (tRNAi) or to modified versions of it, whereby direct repeats for TrcR binding have been introduced at various locations. One of these strains, named Ci32, harbors the unmodified tRNAi promoter, which is a strong constitutive promoter (Figure 4A, upper panel) fused to gfp and serves as a positive control. Only one of the strains tested by Santamaría-Gómez et al., named Ci33 (Figure 4A, lower panel), acquired the regulatory dynamics characteristic of the trn operon. In this strain, direct repeats were introduced in the tRNAi promoter so that they overlapped the -10 box and the transcription start site, mimicking the configuration found in the trn promoter and the promoters of other co-regulated genes. In Ci33, the reporter gene's expression was repressed under normal conditions, but the addition of chloramphenicol provoked de-repression. Such experiment demonstrated that transplantation of these direct repeats into the tRNAi promoter transformed this constitutive promoter into a regulated one that replicated the expression pattern of the trn operon. This shift in the pattern of expression demonstrated that the direct repeats were responsible for the regulation of the trn operon. The recent discovery of TrcR as the transcriptional regulator (Wang et al., 2023), combined with the construction of a ΔtrcR mutant in the host lab, prompted us to investigate the validity of this reporter system in this mutant. In order to this, it was decided to introduce both the pCi32 and pCi33 constructs into the ΔtrcR mutant and assess their expression. The pCi32 construct, with its unmodified tRNAi promoter, would serve as a positive control as previously used by Santamaría-Gómez et al. In contrast, the pCi33 construct would allow us to specifically monitor the expression of a TrcR-regulated promoter in the ΔtrcR mutant. pCi32 and pCi33 are non-replicative plasmids in Anabaena that carry a region of the neutral nuc-nui site for integration by single recombination. Therefore, by selecting for the antibiotic resistance in these plasmids, only those clones where the plasmid has integrated would survive. Once single recombinants of Ci32 and Ci33 in the ΔtrcR background were obtained, we utilized fluorescence microscopy to analyse the expression of GFP in the different strains. As in previous experiments by Santamaría-Gómez et al., we assessed fluorescence of the strains in the absence or presence of increasing yet sublethal concentrations of chloramphenicol. By comparing the expression patterns of the reporter genes in both the WT and ΔtrcR backgrounds, we aimed to discern the specific regulatory effects of TrcR and validate the functionality of our reporter system for the study of TrcR-mediated regulation. pCi32-derived strains (Ci32 WT and Ci32 ΔtrcR) showed high fluorescence in both genetic backgrounds regardless of the conditions (Figure 4C, lower left panel). This observation was corroborated by the statistical analysis of the images (Figure 4D, left plot), which showed that differences due to conditions or genetic background were not significant. Since GFP expression in these controls is free from repression, the fluorescence level in these strains helped to establish the maximum of expression of the reporter gene, serving as a reference for comparison with other samples. As expected, the Ci33 reporter in the WT genetic background (Ci33 WT) responded to chloramphenicol treatment exactly as shown by Santamaría-Gómez et al. By contrast, Ci33 in the ΔtrcR genetic background (Ci33 ΔtrcR) showed constitutive high fluorescence (Figure 4C, bottom right panel), indicating that the absence of TrcR provokes des-repression. These observations were supported by the analysis and quantification of the images (Figure 4D, right plot), which showed no statistically significant differences in fluorescence levels between samples of Ci33 ΔtrcR in different chloramphenicol concentrations. When images of Ci32 ΔtrcR and Ci33 ΔtrcR were quantified and compared, it was observed that both exhibited similar levels of fluorescence, wich suggested that there are no other regulators or regulatory sequences in the promoters of these two reporter systems. Taken together, these results confirmed that TrcR is responsible for the regulation by binding to the two direct repeats identified by Santamaría-Gómez et al. Additionally, these findings validate our reporter system for further research on TrcR and its transcriptional regulation mechanisms. Table 1. Cyanobacterial strains used in this work Strain Description Resistance Reference/Source Anabaena sp. PCC 7120 WT - Pasteur Culture Collection ΔtrcR trcR mutant obtained through genetic substitution with the C.K1 resistance cassette Nm Velázquez-Suárez et al Unpublished Ci32 Reporter module consisting of gfp under the control of tRNAi promoter integrated in the nucA-nuiA site. Sm, Sp Santamaría-Gómez et al. (2021) Ci33 Reporter module consisting of gfp under the control of a modified tRNAi promoter integrated in the nucA- nuiA site. Sm, Sp Santamaría-Gómez et al. (2021) DNA28 Reporter module containing the divergent promoter PtrcR/asr0855, controlling the expression of the reporter genes mVenus and New Turquoise. has Integrated into the nucA- nuiA site. Sm, Sp This work ΔtrcR Ci32 trcR mutant strain with Ci32 reporter module integrated in the nucA- nuiA site Nm, Sm, Sp This work ΔtrcR Ci33 trcR mutant strain with Ci33 reporter module integrated in the nucA- nuiA site. Nm, Sm, Sp This work ΔtrcR DNA28 trcR mutant strain with DNA28 reporter module integrated in the nucA- nuiA site. Nm, Sm, Sp This work Table 2. E. coli strains used in this work Stain Reference Genotype Usage DH5α Hanahan (1983) F- supE44 hsdR17 (rk-mk+) recA1 girA96 (Nalr) endA1 thi-1 relA1 Δ(lacZYA-argF) (Ø80lacZ ΔM15) U59 Used for plasmid construction and cloning purposes ED8654 Murray et al. (1977) lac-3/lacY1 supE44 supF58 hsdR514 (rk-mk-) recA56 mcrA1 metB1 lacY galk2 galT22 trpR55 Used for plasmid conjugation into Anabaena HB101 Boyer and Roulland- Dussoix (1969) F- hdsS20 (rB-mB-) leu supE44 ara14 galK2 lacY1 proA2 rpsL20 xy-5mtl-1 recA13 mcrB Used for plasmid conjugation into Anabaena Bl21(DE3) Studier and Moffatt (1986) E. coli B dcm ompT hsdS(rB-mB-) gal Used for plasmid testing Table 3. Oligonucleotides used in this work Name Sequence Usage F-mVenus2 5’- CAATAGGAAGGAGATAAACCATGGCTAGCAAAGGAGAGGAAC- 3’ These were used as primers for a PCR reaction to amplify a 11.7 kb region of pDNA15 adding 10bp long adapter sequences. New_Turquoise- F 5’- AAAATCGAAGGAGATAAACCATGGTCTCCAAAGGCGAAGAAC- 3’ Pall0854-1 5’-GGTTTATCTCCTTCCTATTGAACATTTCTTT AAACATACTACACTTGTATTACTATCCTG -3’ These were used to assemble the Pall0854/asr0855 promoter replacing the ribosome binding sites and adding 10bp long adapter sequences Pall0854-2 5’-GGTTTATCTCCTTCGATTTTTCTCCTTAAAG TATGGACAGGATAGTAATACAAGTGTAGT-3’ Duet-F 5’- AGTCGGCTAGGCTTGCGGCCGCATAATG -3’ These were as primers for a PCR reaction to amplify a 3.9 kb region of pACYCDuet-1 adding 10bp long adapter sequences. Duet-R 5’- TTGTGTGCATGGTATATCTCCTTA TTAAAGTTAAACAAAATTATTTC -3’ 8-all0854-F 5’-GAGATATACCATGCACACAATCGCTCG -3’ These were used as primers for a PCR reaction to amplify a 337bp fragment corresponding to the ORF of trcR adding 10bp long adapter sequences. 9-all0854-R 5’-GGCCGCAAGCCTAGCCGACTAAACTCTCGACAC -3’ mVenus-R- EcoRI 5’-TAAGAATTCAAACATGAGTTATTTGTATAGTTCGTCC -3’ These were used as primers for a PCR reaction to amplify a 1.5 kb long fragment of pDNA27 containing the mVenus New Turquoise genes under the Pall0854/asr0855 adding EcoRI restriction sites at the ends. R-Turq-new- pAUV 5’-AAGAATTCTTATTTGTAGAGTTCATCCATGCCCAAG -3’ Table 4. Plasmids used in this work Name Resistance Description Source pACYCDuet-1 Cm Plasmid containing a T7 polymerase dependent promotor for the controlled expression of cloned genes. Novagen pCSEL24 Sm, Sp Plasmid with a E.coli replication origin compatible with pACYCDuet-1. Olmedo-Verd et al. (2006) pDNA15 Km Plasmid containing the mVenus and New Turquoise genes under the Pdiv promoter. Neyra and Lopez Igual Unpublished pDNA27 Km Plasmid containing the mVenus New Turquoise under the Pall0854/asr0855 promoter. This work pDNA28 Sm, Sp Plasmid for the integration of a reporter module containing mVenus and New Turquoise under the Pall0854/asr0855 promoter into the nucA- nuiA site in Anabaena. This work pCi32 Sm, Sp, Ap Plasmid for the integration of a reporter module containing gfp under the control of tRNAi promoter into the nucA-nuiA site in Anabaena. Santamaría-Gómez et al. (2021) pCi33 Sm, Sp, Ap Plasmid for the integration of a reporter module containing gfp under the control of modified tRNAi promoter into the nucA-nuiA site in Anabaena. Santamaría-Gómez et al. (2021) A B C Fig. 1 TrcR binding sequence. (A) Comparison of promoters of genes regulated by TrcR. -35 and -10 boxes are indicated in light blue color and the transcription start site in red. The direct repeats are highlighted in pink. Adapted from Santamaría-Gómez et al. (2021) (B) The consensus binding motif of TrcR. Adapted from Santamaría-Gómez et al. (2021) (C) Diagram of the general structure of a promoter regulated by TrcR, whereby the blue boxes indicate the -10 and -35 boxes and the pink arrows represent the direct repeats and a bent arrow represents the transcription start site. -35 asr0855 asr0856 asr0857 trcR 5’ 5’ 3’ 3’ -10 PtrcR -10 -35 Pasr0855 Fig. 2 Diagram of the overlapping PtrcR/Pasr0854 promoters showing both DNA strands. The -35 and -10 boxes are indicated by the light blue boxes. The transcription start sites are indicated by the black bent arrows. The TrcR direct repeats are indicated by the brown boxes. A B C Fig. 3 Plasmid construction scheme. Grey arrows indicate steps in the construction process, black horizontal labelled arrows indicate oligonucleotides used, black vertical arrows indicate a restriction site, and the pink text indicate the process taken in each step. (A) Diagram showing the construction process for the pDNA27 plasmid. The preparation of the vector is shown on the left and the preparation of the PtrcR/Pasr0855 promoter is shown on the right. SD represents the addition of new Shine-Dalgarno sequences. (B) Diagram showing the construction process for the pDNA30 plasmid. The preparation of the vector is shown on the left and the preparation of the trcR insert is shown on the right (C) Diagram showing the construction process for the pDNA28 plasmid. The preparation of the insert is shown on the left and the preparation of the vector is shown on the right. A B Cm 0 Cm 10 C WT Ci32 (Control) ∆trcR Genetic background Cm 0 Cm 10 Ci33 Ci32 gfp -10 -35 gfp -10 -35 Ci33 Cm Ci32 gfp -10 -35 gfp -10 -35 Ci33 Cm 20 Cm 20 1 10 100 1000 10000 WT ΔtrcR Fluorescence (Arbitrary units) Genetic background Ci32 (Control) Cm0 Cm10 Cm20 1 10 100 1000 10000 WT ΔtrcR Fluorescence (Arbitrary units) Ci33 Cm0 Cm10 Cm20 Fig. 4 Testing of the Ci32/Ci33 reporter system. (A) Diagram of the Ci32 and Ci33 constructs. The blue boxes indicate the -10 and -35 boxes, and the pink arrows represent the direct repeats (B) Diagram of the proposed regulation of the Ci32 and Ci33 constructs, where Cm represents chloramphenicol added to the medium, and the pink oval represents TrcR (C) Images from fluorescence microscopy of the Ci32 (Left panel), used as a positive control, and Ci33 (Right panel) constructs in the WT and ΔtrcR genetic backgrounds. The strains were cultivated in BG11 solid medium adding the indicated concentrations of chloramphenicol in µg ml-1. The genetic background is indicated on the left. (D) Plots showing the fluorescence levels of the Ci32 (Left panel) and Ci33 (Right panel) in the WT and ΔtrcR genetic backgrounds. 30 cells from the panels shown in panel C or equivalent panels were quantitated and the average fluorescence. The genetic background is indicated in the X axis and the fluorescence in the Y axis, in arbitrary units. Bars indicating average fluorescence and standard deviation are shown. Legend on the bottom indicates the concentrations of chloramphenicol added in µg ml-1. D A C ΔtrcR DNA28 WT DNA28 Cm 0 Cm 10 Cm 20 B abcd e f ghi j k l 0 500 1000 1500 2000 2500 3000 Cm0 Cm10 Cm20 Fluorescence (Arbitrary units) WT DNA28 a b c d e f Cm0 Cm10 Cm20 ∆trcR DNA28 gh i j k l 0 500 1000 1500 2000 2500 3000 Fluorescence (Arbitrary units ) Cm0 a b g h WT DNA28 ∆trcR DNA28 Fig. 5 Testing of a reporter system for the divergent promoters PtrcR/Pasr0855 in Anabaena. (A) Diagram illustrating the regulation of the DNA28 construct of our reporter system. The blue boxes indicate the -10 and -35 boxes of the polymerase binding site, the pink arrows represent the direct repeats, the large colored arrows represent the genes encoding the fluorescent reporter proteins, Cm represents chloramphenicol added to the medium, and the pink oval represents TrcR. (B) Images of fluorescence microscopy of the DNA28 construct in the WT and ΔtrcR genetic backgrounds. The strains were cultivated in BG11 solid growth medium supplementing with Cm at the indicated concentrations (in µg mL-1) fluorescence microscopy. 30 cells from the panels shown in panel B or equivalent panels were quantitated. The fluorescence in the Y axis is in arbitrary units. Bars indicating average fluorescence and standard deviation are shown. Yellow bars indicate fluorescence levels in the mVenus emission maxima (535 nm) and blue bars indicate fluorescence levels in the New Turquoise emission maxima (480 nm). Bars are labeled with letters to identify the corresponding images in panel B. The top plot shows fluorescence levels in the absence of chloramphenicol, as indicated above. The genetic background is indicated on the X axis. The bottom plots shows fluorescence levels in varying concentration of chloramphenicol as indicated in the X axis in µg mL-1. The genetics backgrounds are indicated on the top. New Turq mVenus PtrcR/Pasr0855 Cm TrcR The genetic background is indicated on the left. There are two images per set. The yellow (left) images shows fluorescence in the mVenus emission maxima (535 nm) and the blue image (right) shows fluorescence in the New Turquoise emission maxima (480 nm). The white letters serve to identify the corresponding bars on the plots in C. The bottom panels show fluorescent microscopy images from the WT and ΔtrcR used as negative controls for fluorescence. (C) Plots showing the fluorescence levels of DNA28 in the WT and ΔtrcR genetic background analyzed with (Control) Ø Ø (Control) Ø pDNA30 pDNA27 Ø pDNA27 pDNA30 B A CLB LB+IPTG T7 Promotor IPTG pDNA27 pDNA30 New Turq mVenus PtrcR/Pasr0855 TrcR trcR Fig. 6 Testing of E. coli reporter system for the divergent promoters PtrcR/Pasr0855. (A) Diagram of the pDNA27 and pDNA30 constructs of the reporter system and their regulation. IPTG represents the addition of IPTG to the medium, the blue boxes indicate the -10 and -35 boxes of the polymerase binding site, and the pink arrows represent the direct repeats, and the pink oval represents TrcR (B) Images of the petri dishes with Lennox solid growth media containing the colonies from plasmids co-transformation. The plasmids introduced are indicated where the top row represent pRL25C or its derivative plasmids and the bottom row represents pACYCDuet-1 or derivative plasmids. Ø indicates the empty vector. Top images were taken using white light and bottom images were taken using UV light (365nm) (C) Images of petri dishes with LB solid media, 1mM IPTG was added to the growth medium when indicated. Biomass from colonies shown in panel B was spread on the dishes following the top right diagram. Top images were taken using white light and bottom images were taken using UV light (365nm). On the bottom right there are zoom ins of the areas indicated by the black squares. Fluorescent and nonfluorescent colonies can be observed. A nonfluorescent colony is shown in a red circle in the bottom panel.