Squalene targets pro- and anti-inflammatory mediators and pathways to modulate over-activation of neutrophils, monocytes and macrophages

1 Squalene targets pro- and anti-inflammatory mediators and pathways to modulate over-activation of neutrophils, monocytes and macrophages Ana Cárdeno1*, Marina Aparicio-Soto1, Sergio Montserrat-de la Paz1,2, Beatriz Bermúdez1,2, Francisco J.G. Muriana2, Catalina Alarcón-de-la-Lastra1 1Department of Pharmacology, Faculty of Pharmacy, University of Seville, Profesor García González Street 2, 41012 Seville, Spain. 2Laboratory of Cellular and Molecular Nutrition, Instituto de la Grasa, CSIC, Ctra. De Utrera, km. 1, Campus Universitario Pablo de Olavide, Edificio 46, 41013 Seville, Spain. *Corresponding Author: Ana Cárdeno Galván Department of Pharmacology, Faculty of Pharmacy, University of Seville. Profesor García González Street 2, 41012 Seville (Spain) Tel: +34 954 557469, Fax: +34 954 556 074 E-mail: [email protected] Postprint of Journal of Functional Foods Volume 14, April 2015, Pages 779–790 2 HIGHLIGHTS 1. Squalene has anti-inflammatory activities on LPS-mediated inflammatory response. 2. Squalene targets pro-inflammatory mediators such as TLR4, iNOS, COX-2 or MPO. 3. Squalene enhanced expression of anti-inflammatory enzymes (HO-1). 4. Squalene modulated Nrf2, NF-κB, MAPKs, MMPs and PPARγ signalling pathways. 5. Squalene prevents the over activation of neutrophils/monocytes/macrophages. 3 ABSTRACT Squalene is a natural triterpene consumed as an integral part of the human diet. Increasing evidence demonstrates that squalene has antioxidant, cardioprotective and anti-carcinogenic activities. Nevertheless, its anti-inflammatory properties remain unclear. The effects of squalene on lipopolysaccharide (LPS)-mediated inflammatory response in murine macrophages and human monocytes and neutrophils were investigated. Squalene reduced intracellular levels of ROS, nitrites, cytokines (TNF-α, IL-1β, IL-6 and IFN-γ) and pro-inflammatory enzymes (iNOS, COX-2 and MPO), including a decreased expression of TLR4 and key proteins for signalling pathways mediated by NF-κB (IκBα), MAPKs (JNK) and MMPs (1, 3 and 9). In addition, squalene enhanced expression levels of anti-inflammatory enzymes (HO-1) and transcription factors (Nrf2 and PPARγ). This study establishes that squalene has significant potential for management of inflammatory conditions characterized by an over-activation of neutrophils/monocytes/macrophages and thereby for the efficient termination of the inflammatory response. Keywords: Squalene Inflammation Macrophages Monocytes Neutrophils 4 1. Introduction Squalene (2,6,10,15,19,23-hexamethyl tetracosahexaene) is a natural lipid belonging to the terpenoid family, containing six isoprene units, and a biochemical precursor of cholesterol biosynthesis and other biological substances. Besides, to be synthesized in the liver and the skin of human, squalene is widely present in nature, especially in wheat germ, rice bran, shark liver and olive oils. Therefore, it is consumed as an integral part of the human diet. Up to date, anticancer, antioxidant, drug carrier, detoxifier, skin hydrating and emollient activities of squalene have been reported both in animal models and in vitro environments (Kim & Karadeniz, 2012; Reddy & Couvreur, 2009). In fact, squalene is a highly effective antioxidant acting as a direct reactive oxygen species (ROS) scavenging agent reducing intracellular oxidant stress and also protects human skin surfaces from lipid peroxidation as a quencher of singlet oxygen (Kabuto, Yamanushi, Janjua, Takayama, & Mankura, 2013). Moreover, this natural isoprenoid has been shown to ameliorate atherosclerotic lesions through the reduction of CD36 scavenger receptor expression in macrophages (Granados-Principal et al., 2012), in addition to important cardioprotective effects in several experimental models mainly by blocking lipid peroxidation (Lou-Bonafonte, Arnal, Navarro, & Osada, 2012; Sabeena Farvin et al., 2004). However, although the importance as a powerful antioxidant agent of squalene has been largely described (Kim & Karadeniz, 2012), its anti-inflammatory properties still remain unclear. Monocytes and macrophages are closely related to phagocytic cells that cooperate during the onset, progression and resolution of inflammation (Soehnlein & Lindbom, 2010). Pro-inflammatory, metabolic and immune stimuli increase recruitment of monocytes from blood vessels to peripheral sites where the differentiation into macrophages and dendritic cells occurs contributing to host defence, tissue remodelling 5 and repair (Gordon & Taylor, 2005; Shi & Pamer, 2011). Furthermore, neutrophils, as a key component of the inflammatory response, generate chemotactic signals that attract monocytes and dendritic cells, and influence whether macrophages differentiate to a predominantly pro- or anti-inflammatory state (Nathan, 2006). In these cell types, lipopolysaccharide (LPS) acts as an endotoxin by its binding to the CD14/TLR4/MD2 receptor complex, which promotes the secretion of pro-inflammatory cytokines such as tumour necrosis factor alpha (TNF-α), interleukin (IL)-8, IL-6 or interferon gamma (IFN)-γ among others (Chanput, Mes, Vreeburg, Savelkoul, & Wichers, 2010). Moreover, some transcription factors such as the peroxisome proliferator-activated receptor gamma (PPARγ), nuclear transcription factor (NF)-kB, nuclear factor-E2- related factor-2 (Nrf2) or mitogen-activated protein kinase (MAPK) family (Jung et al., 2010; Kang & Kim, 2013) have been shown to be major effectors in the LPS-induced inflammatory response through the induction of several pro-inflammatory enzymes including inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX)-2 (Takahashi, Kozaki, Yatabe, Achiwa, & Hida, 2002) or antioxidant enzymes, such as heme oxygenase 1 (HO-1) (Alexander, Mathie, & Peters, 2011). Importantly, matrix metalloproteinases (MMPs) regulate aspects of immune cell development, effector function, migration and ligand–receptor interactions and activate signal transduction pathways that control cytokine biosynthesis and direct systemic inflammation or barrier immunity. For this reason, the stimulation with LPS constitutes an excellent model for the screening and subsequent evaluation of the effects of candidate drugs on the inflammatory pathway (Sanchez Miranda, Perez Ramos, Fresan Orozco, Zavala Sanchez, & Perez Gutierrez, 2013). Therefore, we investigated the anti-inflammatory activity of squalene on LPS- stimulated murine peritoneal macrophages and human blood monocytes and 6 neutrophils. In this model, redox changes, myeloperoxidase (MPO) activity, proinflammatory (IL-1β, IL-6, TNF-α and IFN-γ) and anti-inflammatory (IL-10) cytokines production, gene/protein expression of pro-inflammatory (iNOS and COX-2) and antiinflammatory (HO-1) enzymes were measured. NF-kB, Nrf2, MAPKs, MMPs (MMP-1, MMP-3 and MMP-9) and PPARγ signalling pathways were also explored to understand the underlying mechanisms by which squalene may prevent inflammation. 2. Materials and methods 2.1. Murine peritoneal macrophage isolation Thirty 8–10 weeks-old male Swiss mice (Harlan Interfauna Ibérica, Barcelone, Spain) weighing 20-30 g were injected intraperitoneally with 1 ml of sterile thioglycollate medium (10 g w/v) (Scharlau, Barcelone, Spain). After 3 days, murine peritoneal macrophages were isolated as described previously (Cardeno, Sanchez-Hidalgo, Aparicio-Soto, & Alarcon-de-la-Lastra, 2014). Cells were treated with 5 µg/ml LPS from E. coli (Sigma-Aldrich, Madrid, Spain) in presence or absence of squalene (12.5, 25 and 50 µM) for 18 h. All animal care and experimental procedures complied with the Guidelines of the European Union regarding animal experimentation (Directive of the European Counsel 86/609/EC), followed a protocol observed by the Animal Ethics Committee of the University of Seville and reported in accordance with the ARRIVE guidelines for reporting experiments involving animals. 2.2. Human monocyte and neutrophil isolation Study subjects were recruited at Virgen del Rocio University Hospital, Seville, Spain. Venous blood were obtained from healthy adult volunteers (<35 years old) non-smokers and not taking any medication. Donors were recognised as healthy, according to medical history and routine laboratory test. Neutrophils were isolated by dextran 7 sedimentation (2% dextran/0.9% NaCl) coupled to differential centrifugation over Histopaque 1077 (Sigma-Aldrich, Madrid, Spain). Residual erythrocytes were removed using hypotonic lysis with 0.2% and 1.6% saline solutions. The purity of neutrophils preparation was >97% by trypan blue exclusion. Peripheral blood mononuclear cells (PBMCs) were isolated by centrifugation over Ficoll Histopaque (Sigma-Aldrich, Madrid, Spain) gradient and monocytes isolated from PBMCs using positive selection with CD14 MicroBeads according to the manufacturer’s instructions (MACS, Myltenyi Biotec, Madrid, Spain). Monocytes were tested for purity by CD14 fluorescein isothiocyanate labeling and fluorescence-activated cell sorter analysis using a FACScanto II flow cytometer and FACSDiva software (BD) (Varela et al., 2011). Following isolation, the cells were suspended in a RPMI 1640 medium supplemented with L-glutamine, penicillin, streptomycin and 1% heat-inactivated fetal bovine serum. Neutrophils were seeded at a density of 3x106 cells/ml and monocytes at 5x105 cells/ml. Cells were treated with 0.1 µg/ml LPS in presence or absence of squalene (50 µM) for 18 h. The study conformed to the principles outlined in the Helsinki Declaration of the World Medical Association. 2.3. Reagents Squalene was purchased by Sigma-Aldrich and was always freshly prepared as stock solutions in dimethyl sulphoxide (DMSO) (Panreac, Barcelona, Spain) and diluted to desired concentration in the culture medium. The assayed concentrations of squalene in murine macrophages were 12.5, 25 and 50 µM. Squalene concentration in human monocytes and neutrophils (50 µM) was selected based on the previous result obtained in murine macrophages. The final concentration of DMSO in the culture medium was ≤1% in all experiments and it had not significantly influence cell response (data not shown). 8 2.4. Cell viability Cells seeded in 96-well plates (1x105 cells/well) were incubated in presence or absence of different squalene concentrations for 18 h. At the end of the exposure time, the effect on cell growth/viability was analysed by sulphorhodamine B (SRB) (Sigma-Aldrich) assay (Skehan et al., 1990). Cell survival was measured as the percentage of absorbance compared with that obtained in control cells (non-treated cells). 2.5. Measurement of intracellular ROS Intracellular ROS production was measured using 2',7'-dichlorfluorescein-diacetate (DCFH-DA) (Sigma-Aldrich, St Louis, MO, USA). DCFH-DA penetrates into the cells and is hydrolysed by intracellular esterases to the non-fluorescent 2,7- dichlorofluorescein (DCFH), which can be rapidly oxidized to the highly fluorescent 2,7-dichlorofluorescein (DCF) in the presence of ROS. Peritoneal macrophages were seeded at 1x106 cells/well in 24-well plates, incubated with or without squalene and after 30 min treated with LPS for 18 h. The fluorescence intensity was measured as described previously (Cardeno et al., 2014). Results were expressed as intracellular ROS production percentage compared with LPS control cells (stimulated LPS-treated cells). H2O2 (100 µM) (30% pure) (Panreac, Barcelona, Spain) was used as pro-oxidant positive control. 2.6. Measurement of nitrite production Peritoneal macrophages in 24-well plates were incubated in presence or absence of squalene (12.5, 25 or 50 µM), and 30 min later treated with LPS for 18 h. The culture supernatants (100 µl) were transferred to a 96-well assay plate mixed with Griess reagent (Sigma, St Louis, MO, USA). The amount of nitrite, as an index of NO generation, was determined by a spectrophotometric method using the Griess reaction (Moorcroft, Davis, & Compton, 2001) and obtained by extrapolation from a standard 9 curve with sodium nitrite. The absorbance at 540 nm was measured by an enzymelinked immunosorbent assay reader (BioTek, Bad Friedrichshall, Germany). Results were expressed as the nitrite production percentage compared with LPS control cells (stimulated untreated cells). Dexamethasone 1 µM (Sigma-Aldrich) was used as a positive control (data not shown). 2.7. Isolation and immunoblotting detection of cytoplasmic and nuclear proteins Peritoneal macrophages (1×106 cell/ml) were incubated in presence or absence of squalene and treated with LPS for 18 h. Then, cells were rinsed, scraped off and collected in ice-cold PBS containing a cocktail of protease and phosphatase inhibitors and processed as described (Sanchez-Hidalgo, Martin, Villegas, & Alarcon De La Lastra, 2005) in order to isolate cytoplasmic or nuclear proteins. Protein concentration was measured for each sample using a protein assay reagent (BioRad, Hercules, CA, USA) according to the Bradford´s method and using γ-globulin as a standard (Bradford, 1976). Aliquots of supernatant contains equal amount of protein (20 µg) were separated on 10% acrylamide gel by sodium dodecyl sulphate polyacrylamide gel electrophoresis. In the next step, the proteins were electrophoretically transferred into a nitrocellulose membrane and incubated with specific primary antibodies: rabbit anti-COX-2 and rabbit anti-iNOS (Cayman, Ann Arbor, MI, USA) (1:2500 and 1:1000, respectively), rabbit anti-inhibitory NF-κB protein alpha (IκBα) (Cell Signalling, Danvers, MA, USA) (1:1000), rabbit anti-p65, mouse anti-phosphorylated c-Jun N-terminal kinases (JNK), rabbit anti-JNK, mouse anti-phosphorylated p38, rabbit anti-p38 (Santa Cruz Biotechnology, Santa Cruz, CA, USA) (1:1000) and rabbit anti-Nrf2 (Santa Cruz Biotechnology) (1:500), overnight at 4ºC. After rinsing, the membranes were incubated with a horseradish peroxidase-labelled (HRP) secondary antibody anti-rabbit (Cayman Chemical, Ann Arbor, MI, USA) (1:50000) or anti-mouse (Dako, Atlanta, GA, USA) 16 ROS-mediated damage that mediates the progression of inflammatory disorders (Kang & Lee, 2012). Therefore, modulators of ROS production and ROS-induced signalling pathways could represent potential targets for anti-inflammatory intervention (K. J. Kim, Yoon, & Lee, 2012). Our study demonstrated that squalene has the capacity to inhibit ROS intracellular generation and to activate Nrf2 signalling by the increase of total Nrf2 protein expression (Gjyshi et al. 2014); Nrf2 is a master regulator of cellular antioxidant processes against ROS that has a cytoprotective role against acute inflammatory response (Jung et al., 2010). Activated macrophages are also known to stimulate the expression of a number of inflammatory mediators that include iNOS and COX-2 (Epelman, Lavine, & Randolph, 2014). NO acts as an intracellular messenger in modulating the formation of endogenous ROS such as hydrogen peroxide and peroxynitrite that orchestrate inflammatory responses (Li, Xue, Geng, & Chen, 2012). Moreover, COX-2 activity also leads to ROS production inducing tissue damage (O'Connor, Lapointe, Beck, & Buret, 2010). We found that LPS-mediated increase of iNOS and COX-2 activity was markedly attenuated by squalene in murine peritoneal macrophages. Collectively, these data suggest that squalene may dampen intracellular oxidant stress in response to inflammatory stimulus via blocking iNOS, COX-2 and Nrf2 signalling pathways. MAPKs are essential for both induction and propagation of LPS-mediated inflammatory response in macrophages (Radnai et al., 2009). MAPKs include extracellular signalregulated kinases (ERK-1 and -2), JNKs and p38 (Gurgis, Ziaziaris, & Munoz, 2014). Previous studies have recognized that JNK and p38 MAPK are primarily involved in LPS-induced expression of iNOS and COX-2 in macrophages (Kyriakis & Avruch, 2012; Kwon et al. 2013). In the present study, we found that LPS-mediated phosphorylation of JNK, but not p38 MAPK, was markedly attenuated by squalene in 17 murine peritoneal macrophages. Taking NF-κB as a dimeric redox-sensitive transcription factor that is downstream of MAPKs signalling, binds to the promoter of a vast collection of inducible pro-inflammatory genes including iNOS and COX-2 (Lee & Surh, 2012; Tak & Firestein, 2001) and coordinates its activity with Nrf2 (Cardozo et al., 2013), we also analysed the effect of squalene on phosphorylation of IκB proteins. IκBs are a family of related proteins required for cytoplasmic sequestration of five NF- κB member subunits [RelA/p65, RelB, c-Rel, NF-kB1 (p50/p105) and NF-kB2 (p52/p100)] as an inactive complex in unstimulated cells; the major IκB protein is IκBα (Tak & Firestein, 2001). Consistently, our data show that squalene induced a reduction of IκBα phosphorylation and degradation, decreasing p65-NF-κB levels and gene expression of NF-κB target genes (TNF-α and IL-1β) in LPS-activated murine peritoneal macrophages. Therefore, squalene emerges as a potentially important molecule for modulating inflammatory processes involving JNK and NF-κB signalling pathways. Recent evidence suggests that the heme-enzyme MPO, whose expression remains restricted to neutrophils and monocytes, is a critical determinant for the course of inflammation (Liu et al., 2014; Nussbaum, Klinke, Adam, Baldus, & Sperandio, 2013). MPO catalyses via the MPO-hydrogen peroxide-halide system the production of highly reactive intermediates such as hypochlorous acid that interfere with various cell functions; MPO also has extracatalytic properties that contribute to injury in inflamed tissues. The present study demonstrates that LPS-mediated increase of MPO expression was markedly attenuated by squalene in human neutrophils and monocytes. This finding is in accordance with the above described antioxidant and anti-inflammatory effects of squalene in murine peritoneal macrophages. Consistent with this activity, squalene also induced HO-1 up-regulation in LPS-activated human neutrophils and monocytes. HO-1 18 is an Nrf2-regulated gene and its inducible expression has been described as a host defence mechanism that protects against oxidative stress and contributes to the antiinflammatory activity (Araujo, Zhang & Yin, 2012). Recognition of LPS by mainly TLR4 initiates several signalling cascades leading to the activation of NF-κB and MAPK pathways that mediate the expression of inflammatory cytokines and transactivation of pro-inflammatory enzymes such as iNOS and COX-2 in cells of innate system (Chang et al., 2014; Murad, 2014). Our study shows that squalene abrogated gene expression of TLR4, TNF-α, IL-1β, IL-6, IFN-γ, iNOS and COX-2 in LPS-activated human neutrophils and monocytes. All of these effects are likely contributing to the idea of squalene as a disruptor of TLR mediated proinflammatory responses in several types of inflammatory cells. MMPs, particularly LPS-induced interstitial collagenase-1 (MMP-1), stromelysin-1 (MMP-3) and gelatinase B (MMP-9), have been reported to be involved in inflammation by degrading components of the extracellular matrix and regulating cytokine signalling through coupling with COX-2 and NF-κB/MAPK pathways (Lai, Zhou, Shankavaram, Peng, & Wahl, 2003; Nissinen & Kahari, 2014; Steenport et al., 2009). Our results demonstrate that squalene repressed gene expression of MMP-1 and MMP-3 in LPS-activated human neutrophils but MMP-1 and MMP-9 in LPS-activated human monocytes, revealing another mechanism by which squalene can supress inflammation probably at the level of the transmigration, recruitment or influx of inflammatory cell subsets (Nissinen & Kahari, 2014). These findings are in accordance with the above-described effects of squalene on COX-2 gene expression in human monocytes, and COX-2 protein expression and NF-κB/MAPK pathways in murine peritoneal macrophages. We further demonstrate that squalene induced PPARγ upregulation in LPS-activated human neutrophils and monocytes. PPARγ is known to 19 modulate oxidative stress-sensitive and NF-κB pathways (Bordet, Gele, Duriez, & Fruchart, 2006), and plays a pivotal role in the dynamic balance among overall matrix synthesis, deposition and degradation by inhibiting MMP expression in inflamed tissues (Jeon et al., 2014). While the cardioprotective effects of squalene have been largely described and discussed (M. Liu et al., 2014; Y. Liu et al., 2009; Ostlund, Racette, & Stenson, 2002; Scolastici, Ong, & Moreno, 2004; Zhang, Yeung, Huang, & Chen, 2002) the hypothesis of squalene as anti-inflammatory compound remains almost unexplored. However, it has been recorded that the unsaponifiable fraction of virgin olive oil, which contains 40% of squalene, has anti-inflammatory effects in vitro in murine macrophages (Cardeno et al., 2014) and prevented in vivo acute colitis in mice (Sanchez-Fidalgo et al., 2012). It is therefore important to investigate the possible beneficial effects of squalene as a non-synthetic anti-inflammatory dietary complement. Although, the major weakness of this study is that only in vitro effects of squalene in murine and human inflammatory cells were addressed, it does provide the first evidence that squalene has antioxidant and anti-inflammatory activities by mechanisms targeting pro-inflammatory (iNOS, COX-2, NF-κB, MAPKs, MPO, TLR4, MMPs) and anti-inflammatory (Nrf2, HO-1, PPARγ) mediators and pathways in closely related phagocytic cells that cooperate during the onset, progression and resolution of inflammation. 5. Conclusion Taken together, our results suggest that squalene has significant potential for management of inflammatory conditions characterized by an over-activation of neutrophils/monocytes/macrophages and thereby for the efficient termination of the inflammatory response. 20 Acknowledgements This work was supported by funds from the Spanish Ministerio de Ciencia e Innovación (MICINN) (AGL2008-02475, AGL2011-26949 and AGL2011-29008) and Junta de Andalucía (P-10AGR-6609 and P09-CVI-5007). The authors gratefully acknowledge the assistance of Centre for Technology and Innovation Research, University of Seville (CITIUS). SM has the benefit of a FPI fellowship (BES-2012-056104) of MICINN. Conflicts of interest The authors state no conflict of interest. 21 References Alexander, S. P., Mathie, A., & Peters, J. A. (2011). Guide to Receptors and Channels (GRAC), 5th edition. British Journal of Pharmacology, 1, 324. Andreakos, E., Sacre, S. M., Smith, C., Lundberg, A., Kiriakidis, S., Stonehouse, T., Foxwell, B. M. (2004). Distinct pathways of LPS-induced NF-kappa B activation and cytokine production in human myeloid and nonmyeloid cells defined by selective utilization of MyD88 and Mal/TIRAP. Blood, 103, 2229- 2237. Araujo, J.A., Zhang, M., & Yin, F. (2012). Heme Oxygenase-1, Oxidation, Inflammation, and Atherosclerosis. Frontiers in Pharmacology, 3, 119. Bordet, R., Gele, P., Duriez, P., & Fruchart, J. C. (2006). PPARs: a new target for neuroprotection. Journal of neurology, neurosurgery, and psychiatry, 77, 285- 287. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry, 72, 248-254. Brune, B., Dehne, N., Grossmann, N., Jung, M., Namgaladze, D., Schmid, T., Weigert, A. (2013). Redox control of inflammation in macrophages. Antioxidants & redox signaling. Cardeno, A., Sanchez-Hidalgo, M., Aparicio-Soto, M., & Alarcon-de-la-Lastra, C. (2014). Unsaponifiable fraction from extra virgin olive oil inhibits the inflammatory response in LPS-activated murine macrophages. Food Chemistry, 147, 117-123. Cardozo, L. F., Pedruzzi, L. M., Stenvinkel, P., Stockler-Pinto, M. B., Daleprane, J. B., Leite, M., Jr., & Mafra, D. (2013). Nutritional strategies to modulate 22 inflammation and oxidative stress pathways via activation of the master antioxidant switch Nrf2. Biochimie, 95, 1525-1533. Chang, J., Kim, B. M., & Chang, C. H. (2014). Co-stimulation of TLR4 and Dectin-1 Induces the Production of Inflammatory Cytokines but not TGF-beta for Th17 Cell Differentiation. Immune network, 14, 30-37. Chanput, W., Mes, J., Vreeburg, R. A., Savelkoul, H. F., & Wichers, H. J. (2010). Transcription profiles of LPS-stimulated THP-1 monocytes and macrophages: a tool to study inflammation modulating effects of food-derived compounds. Food and Function, 1, 254-261. de Araujo, T. H., Okada, S. S., Ghosn, E. E., Taniwaki, N. N., Rodrigues, M. R., de Almeida, S. R., Albuquerque, R. C. (2013). Intracellular localization of myeloperoxidase in murine peritoneal B-lymphocytes and macrophages. Cell Immunology, 281, 27-30. Epelman, S., Lavine, K. J., & Randolph, G. J. (2014). Origin and Functions of Tissue Macrophages. Immunity, 41, 21-35. Gjyshi, O., Bottero, V., Veettil, M.V., Dutta, S., Singh, V.V., Chikoti, L., & Chandran, B. (2014). Kaposi's sarcoma-associated herpesvirus induces Nrf2 during de novo infection of endothelial cells to create a microenvironment conducive to infection. PLoS Pathogens 10:e1004460. Gordon, S., & Taylor, P. R. (2005). Monocyte and macrophage heterogeneity. Nature reviews. Immunology, 5, 953-964. Granados-Principal, S., Quiles, J. L., Ramirez-Tortosa, C. L., Ochoa-Herrera, J., Perez- Lopez, P., Pulido-Moran, M., & Ramirez-Tortosa, M. C. (2012). Squalene ameliorates atherosclerotic lesions through the reduction of CD36 scavenger 23 receptor expression in macrophages. Molecular nutrition & food research, 56, 733-740. Gurgis, F. M., Ziaziaris, W., & Munoz, L. (2014). Mitogen-activated protein kinaseactivated protein kinase 2 in neuroinflammation, heat shock protein 27 phosphorylation, and cell cycle: role and targeting. Molecular pharmacology, 85, 345-356. Helenius, M., Kyrylenko, S., Vehviläinen, P., & Salminen, A. (2001). Characterization of aging-associated up-regulation of constitutive nuclear factor-kappa B binding activity. Antioxidants & redox signaling, 3, 147-156. Jaiswal, A. K. (2004). Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radical Biology & Medicine, 36, 1199-1207. Jeon, Y., Jung, Y., Kim, M. C., Kwon, H. C., Kang, K. S., Kim, Y. K., & Kim, S. N. (2014). Sargahydroquinoic acid inhibits TNFalpha-induced AP-1 and NF- kappaB signaling in HaCaT cells through PPARalpha activation. Biochem Biophys Res Commun. Jung, C. H., Kim, J. H., Park, S., Kweon, D. H., Kim, S. H., & Ko, S. G. (2010). Inhibitory effect of Agrimonia pilosa Ledeb. on inflammation by suppression of iNOS and ROS production. Immunological Investigations, 39, 159-170. Jung, K. H., Hong, S. W., Zheng, H. M., Lee, H. S., Lee, H., Lee, D. H., Hong, S. S. (2010). Melatonin ameliorates cerulein-induced pancreatitis by the modulation of nuclear erythroid 2-related factor 2 and nuclear factor-kappaB in rats. Journal of pineal research, 48, 239-250. Kabuto, H., Yamanushi, T. T., Janjua, N., Takayama, F., & Mankura, M. (2013). Effects of squalene/squalane on dopamine levels, antioxidant enzyme activity, 24 and fatty acid composition in the striatum of Parkinson's disease mouse model. Journal of oleo science, 62, 21-28. Kaminska, B. (2005). MAPK signalling pathways as molecular targets for antiinflammatory therapy--from molecular mechanisms to therapeutic benefits. Biochimica et biophysica acta, 1754, 253-262. Kang, I. S., & Kim, C. (2013). Taurine Chloramine Administered In Vivo Increases NRF2-Regulated Antioxidant Enzyme Expression in Murine Peritoneal Macrophages. Advances in Experimental Medicine and Biology, 775, 259-267. Kang, J. W., & Lee, S. M. (2012). Melatonin inhibits type 1 interferon signaling of tolllike receptor 4 via heme oxygenase-1 induction in hepatic ischemia/reperfusion. Journal of Pineal Research, 53, 67-76. Khokha, R., Murthy, A., & Weiss, A. (2013). Metalloproteinases and their natural inhibitors in inflammation and immunity. Nature Reviews. Immunology, 13, 649-665. Kim, K. J., Yoon, K. Y., & Lee, B. Y. (2012). Low molecular weight fucoidan from the sporophyll of Undaria pinnatifida suppresses inflammation by promoting the inhibition of mitogen-activated protein kinases and oxidative stress in RAW264.7 cells. Fitoterapia, 83, 1628-1635. Kim, S. K., & Karadeniz, F. (2012). Biological importance and applications of squalene and squalane. Advances in food and nutrition research, 65, 223-233. Kwon, D.J., Ju, S.M., Youn, G.S., Choi, S.Y., & Park, J. (2013). Supression of iNOS and COX-2 expression by flavokawain A via blockade of NF-kB and AP-1 activation in RAW 264.7 macrophages. Food and chemical toxicology, 58, 479- 486. 25 Kyriakis, J. M., & Avruch, J. (2012). Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10-year update. Physiological reviews, 92, 689-737. Lai, W. C., Zhou, M., Shankavaram, U., Peng, G., & Wahl, L. M. (2003). Differential regulation of lipopolysaccharide-induced monocyte matrix metalloproteinase (MMP)-1 and MMP-9 by p38 and extracellular signal-regulated kinase 1/2 mitogen-activated protein kinases. Journal of immunology, 170, 6244-6249. Lee, H. N., & Surh, Y. J. (2012). Therapeutic potential of resolvins in the prevention and treatment of inflammatory disorders. Biochemical pharmacology, 84, 1340- 1350. Li, D. Y., Xue, M. Y., Geng, Z. R., & Chen, P. Y. (2012). The suppressive effects of Bursopentine (BP5) on oxidative stress and NF-ĸB activation in lipopolysaccharide-activated murine peritoneal macrophages. Cellular Physiology and Biochemistry, 29, 9-20. Liu, M., Boussetta, T., Makni-Maalej, K., Fay, M., Driss, F., El-Benna, J., . . . Guichardant, M. (2014). Protectin DX, a double lipoxygenase product of DHA, inhibits both ROS production in human neutrophils and cyclooxygenase activities. Lipids, 49, 49-57. Liu, Y., Xu, X., Bi, D., Wang, X., Zhang, X., Dai, H., . . . Zhang, W. (2009). Influence of squalene feeding on plasma leptin, testosterone & blood pressure in rats. The Indian journal of medical research, 129, 150-153. Lou-Bonafonte, J. M., Arnal, C., Navarro, M. A., & Osada, J. (2012). Efficacy of bioactive compounds from extra virgin olive oil to modulate atherosclerosis development. Molecular nutrition & food research, 56, 1043-1057. 32 percentage of LPS-control. Data shown are means ± SEM (n = 3). *P < 0.05 and ***P < 0.001 vs. LPS-control. Table 1S. Sequences of RT-PCR primers for gene expression analysis Target GenBank accession number Direction Sequence (5’→3’) MPO NM_000250 Forward Reverse CAGCCCAGATATACCCCTCA GACAACACAGGCATCACCAC HO NM_002133 Forward Reverse AGCTCCTGCAACTCCTCAAA GGGTGATAGAAGAGGCCAAGA TLR4 NM_138554 Forward Reverse CTGCCACATGTCAGGCCTTAT AATGCCCACCTGGAAGACTCT iNOS NM_000625 Forward Reverse ACCCAGACTTACCCCTTTGG GCCTGGGGTCTAGGAGAGAC COX-2 NM_000963 Forward Reverse TTCAAATGAGATTGTGGAAAAAT AGATCATCTCTGCCTGAGTATCTT IL-1beta NM_000576 Forward Reverse GGGCCTCAAGGAAAAGAATC TTCTGCTTGAGAGGTGCTGA TNF-alpha NM_000594 Forward Reverse TCCTTCAGACACCCTCAACC AGGCCCCAGTTTGAATTCTT IL-6 NM_000600 Forward Reverse TACCCCCAGGAGAAGATTCC TTTTCTGCCAGTGCCTCTTT IL-10 NM_000572 Forward Reverse GCCTAACATGCTTCGAGATC TGATGTCTGGGTCTTGGTTC IFN- gamma NM_000619 Forward Reverse CAGGCAGGACAACCATTACTGGGATGCTC TGAACTCATCCAAGTGATGGCTGAACTGTCG MMP-1 NM_ 001145938 Forward Reverse CTGCTTGACCCTCAGAGACC ATGCTGAAACCCTGAAGGTG MMP3 NM_002422 Forward Reverse GAGTGTCGGAGTCCAGCTTC GCAGTTTGCTCAGCCTATCC MMP9 NM_004994 Forward Reverse CAGGGATCTCCCCTCCTTAG GTCTTGTGGAGGCTTTGAGC PPAR- gamma NM_005037 Forward Reverse GCTGTGCAGGAGATCACAGA GGGCTCCATAAAGTCACCAA Table 1S GAPDH NM_001289746 Forward Reverse CACATGGCCTCCAAGGAGTAAG CCAGCAGTGAGGGTCTCTCT HPRT NM_000194 Forward Reverse ACCCCACGAAGTGTTGGATA AAGCAGATGGCCACAGAACT Figure 1 Click here to download high resolution image Figure 2 Click here to download high resolution image Figure 3 Click here to download high resolution image Figure 4 Click here to download high resolution image Figure 5 Click here to download high resolution image Figure 6 Click here to download high resolution image