Processing of DNA Polymerase-Blocking Lesions during Genome Replication Is Spatially and Temporally Segregated from Replication Forks

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is an Accepted Manuscript of an article published by Elsevier in: MOLECULAR CELL on 2008, available at: https://doi.org/10.1016/j.molcel.2019.09.015” Processing of DNA polymerase-blocking lesions during genome replication is spatially and temporally segregated from replication forks Ronald P. Wong1, Néstor García-Rodríguez1,2, Nicola Zilio1, Mária Hanulová1,3 and Helle D. Ulrich1 * 1 Institute of Molecular Biology, Ackermannweg 4, D – 55128 Mainz, Germany 2 present address: Centro Andaluz de Biología Molecular y Medicina Regenerativa (CABIMER), Universidad de Sevilla-CSIC-Universidad Pablo de Olavide, Sevilla, Spain 3 present address: Instituto Gulbenkian de Ciência, Rua da Quinta Grande, 6, 2780-156 Oeiras, Portugal *correspondence: [email protected] 2 SUMMARY Tracing DNA repair factors by fluorescence microscopy provides valuable information about how DNA damage processing is orchestrated within cells. Most repair pathways involve ssDNA, making Replication Protein A (RPA) a hallmark of DNA damage and replication stress. RPA foci emerging during S phase in response to tolerable loads of polymerase-blocking lesions are generally thought to indicate stalled replication intermediates. We now report that in budding yeast they predominantly form far away from sites of ongoing replication, and they do not overlap with any of the repair centers associated with collapsed replication forks or double-strand breaks. Instead, they represent sites of postreplicative DNA damage bypass involving translesion synthesis and homologous recombination. We propose that most RPA and recombination foci induced by polymerase-blocking lesions in the replication template are clusters of repair tracts arising from replication centers by polymerase repriming and subsequent expansion of daughter-strand gaps over the course of S phase. KEYWORDS DNA damage bypass, DNA replication, DNA replication stress, daughter-strand gaps, homologous recombination, PCNA, RAD6 pathway, RPA, translesion synthesis, ubiquitin 3 INTRODUCTION Appropriate management of DNA damage and replication stress is critical for avoiding the malignant transformation of a cell. Analysis of the dynamic behavior of DNA lesions and DNA repair factors by fluorescence microscopy has provided a wealth of information about their activities in the chromatin environment of the nucleus (Hauer and Gasser, 2017). Budding yeast has served as a convenient experimental system for this purpose due to the limited complexity of its chromatin structure. The most detailed insight has been obtained for the repair of DNA double-strand breaks (DSBs), as these can be introduced site-specifically by endonucleases and can therefore be tracked directly by means of binding sites for fluorescently marked reporter proteins (Jasin and Haber, 2016). Upon DSB formation, the DNA termini gain mobility, but unless they are rapidly repaired they relocate to the nuclear periphery, involving nuclear pore components as well as the nuclear envelope as anchoring points (Dion et al., 2012; Horigome et al., 2014; Kalocsay et al., 2009; Lisby et al., 2003; Mine-Hattab and Rothstein, 2012; Nagai et al., 2008; Oza et al., 2009). Observation of homologous recombination (HR) factors Rad52, Rad51 and Rad54 in response to DSBs induced by g-irradiation has revealed a convergence of lesions into repair centers, apparent as 1-2 bright foci where HR proteins accumulate for DSB processing and repair (Burgess et al., 2009; Lisby et al., 2004; Lisby et al., 2001). Analyzing the response to replication stress in the same manner has been more challenging because the associated structures are less well defined than an endonuclease-induced DSB. Spontaneous Rad52 foci are observed in ca. 20% of cells in S and G2 phase, and treatment with various DNA-damaging agents as well as defects in checkpoint signaling or DNA polymerase function greatly enhance this number (Barlow and Rothstein, 2009; Dion et al., 2013; Lisby et al., 2001; Meister et al., 2005; Nielsen et al., 2009). Based on these results, it has been proposed that replication stress-induced foci – similar to DSBs – arise from dysfunctional or collapsed replication forks congregating in defined repair centers. Consistent with the intra-nuclear localization of DSBs, treatments that induce replication fork collapse, such as prolonged exposure to hydroxyurea (HU) or a combination of HU and the alkylating agent methyl methanesulfonate (MMS), cause an engagement of early origins with nuclear pores, possibly indicating formation of one-ended DSBs (Nagai et al., 2008). Intriguingly, Su et al. (Su et al., 2015) also reported a transient nuclear pore association of an expanded CAG repeat, a sequence prone to the formation of secondary structure, as part of its natural replication. This event was again interpreted to reflect a compromised fork, but whether the associated structure represents a one-ended DSB, an intact fork stripped of its protein components, a reversed fork or a single-stranded region behind the fork has remained unclear. In contrast, reversible stalling of replication forks by means of short-term HU treatment does not give rise to HR foci or cause a relocation to nuclear pores (Lisby et al., 2004; Nagai et al., 2008). 4 These observations raise the question of what structures underlie spontaneous and replication stressinduced foci. Based on indirect approaches, it has been postulated that they include non-DSB structures (Gonzalez-Prieto et al., 2013; Lettier et al., 2006). Since they accumulate during replication with a maximum in G2 phase, they were proposed to arise from nicks or postreplicative stretches of ssDNA (daughter-strand gaps) that – in analogy to DSBs – coalesce into repair centers for processing (Gonzalez-Prieto et al., 2013). A major pathway for daughter-strand gap formation involves polymerase re-priming at lesions in the replication template (Lehmann and Fuchs, 2006). Such gaps, expected to harbor a lesion within the ssDNA region, serve as substrates of the RAD6 pathway of DNA damage bypass, also called DNA damage tolerance. It allows cells to complete DNA replication in the presence of lesions (Cipolla et al., 2016) and involves either a set of damage-tolerant DNA polymerases capable of copying damaged DNA in a process called translesion synthesis (TLS) or a recombination-mediated exchange of genetic information with the sister chromatid called template switching (TS). Both transactions are governed by the ubiquitylation of the replication clamp, PCNA (Hoege et al., 2002; Stelter and Ulrich, 2003). In addition, damage can be resolved in a RAD6-independent manner also involving HR, sometimes named “salvage recombination” (Branzei and Szakal, 2016). Damage bypass can in principle proceed either at a stalled replication fork or – if re-priming generates a daughter-strand gap – in a postreplicative fashion (Daigaku et al., 2010; Karras and Jentsch, 2010). However, the factors controlling the balance between fork- and gap-associated damage bypass, between TLS and TS, and their spatiotemporal organization in the nucleus are poorly understood. In order to gain insight into the nature and fate of ssDNA during replication of damaged DNA, we have followed the ssDNA-binding Replication Protein A (RPA) complex as the most direct indicator of ssDNA and at the same time an essential activator of the RAD6 pathway (Davies et al., 2008). During undisturbed S phase in budding yeast, RPA forms small speckles associated with replication centers, but co-localizes with HR factors in larger, distinct foci in response to most types of genotoxic stress (Burgess et al., 2009). In our experiments, we have used manageable doses of MMS or UV damage to elucidate the relationship of ssDNA to DNA damage bypass events, their localization with respect to other known centers of DNA repair in the nucleus and their origin from stalled replication forks versus daughter-strand gaps. We report here that under conditions of replication stress induced by polymerase-blocking lesions in the template, RPA foci can indeed serve as faithful indicators of DNA damage bypass tracts. They are largely resolved via the RAD6 pathway, involving both TS and TLS activities but also complemented by salvage recombination. In contrast to HR foci arising from the processing of DSBs or damaged replication forks, we find no evidence for a congregation of individual RPA foci or a significant overlap 5 with other known repair centers such as nuclear pores, the nuclear periphery or intra-nuclear quality control (INQ) centers. Moreover, our observations challenge the prevalent view that spontaneous or replication stress-induced repair foci generally represent stalled replication forks. Instead, they suggest a model where these foci originate in the wake of replication forks as local clusters of ssDNA due to multiple replisome re-priming events in spatial proximity. Subsequent Exo1-dependent expansion over time contributes to the gradual emergence of discernable RPA foci in regions of replicated DNA that are resolved locally by the action of the RAD6 pathway and by salvage HR. Thus, we provide evidence that in budding yeast non-DSB lesions are processed predominantly in a manner that is both temporally and spatially well segregated from ongoing replication. 6 RESULTS The dynamics of MMS-induced RPA foci largely reflects postreplicative events, but provides no evidence for a congregation of lesions into repair centers In order to examine the distribution of damage-induced ssDNA over the course of the cell cycle, we exposed yeast cultures synchronized in the G1 phase to a single dose of MMS and monitored the DNA damage response upon release into S phase in the absence of the damaging agent (Figure 1A). We had previously shown that cells mount a transient checkpoint response under these conditions, but do not accumulate DSBs and recover without significant loss of viability (Daigaku et al., 2010; Garcia- Rodriguez et al., 2018a). Cell cycle stage was monitored by flow cytometry (FACS) and detection of the S- and G2-specific cyclins, Clb6 and Clb2, and checkpoint activation by means of Rad53 phosphorylation (Figure 1B, S1A). Progression of replication was analyzed by pulsed-field gel electrophoresis (PFGE), exploiting the inability of replication intermediates to enter the gel (Figure 1C). Collectively, this analysis indicated completion of replication around 75 min. Ubiquitylation of PCNA early in S phase indicated activation of the RAD6 pathway (Figure 1B, S1A). A comparable pattern resulted from ultraviolet (UV) irradiation as a damaging agent (Figure S1B). When we monitored ssDNA in fixed cells by fluorescence microscopy using GFP-tagged Rfa1, the large subunit of the RPA complex, we observed a gradual accumulation of distinct foci above the speckled pattern associated with replication (Figure 1D-E, S1A). Their appearance coincided with entry into S phase, reaching a maximum around completion of S phase at 75 min after release. In G2/M, the number of foci slowly declined. As expected, foci formation was strongly enhanced by MMS (Figure 1D). UV irradiation gave rise to a very similar distribution of foci (Figure S1B). In the course of the cell cycle, the RPA signal appeared to change from a pattern of multiple small foci to a few bright spots (Figure 1E). This behavior was reminiscent of the merging of DSB-induced foci into repair centers (Lisby and Rothstein, 2004). Thus, in order to follow RPA dynamics in real time, we employed live-cell imaging. Figure S1C shows that this more sensitive method detects higher numbers of foci even in undamaged cells, but with a similar timing. Individual foci were tracked at 30, 60 and 90 min after release into S phase (Figure S1D and Supplemental Videos 1-5) and classified into those that persisted during the entire interval, those that either appeared or were resolved during imaging, and transient ones that emerged and disappeared again within the 3-min interval (Figure S1E-F). Median lifetimes of the foci were estimated (bearing in mind that the numbers for all but the transient events represent minimal values) and were found to increase in the course of S phase and into G2/M (Figure 1F). At the same time, the fraction of new events (appearances and transient foci) declined in G2/M, whereas the fraction of persistent foci increased (Figure S1E). This pattern is consistent with an accumulation of a few long-lived foci in G2/M cells and thus resembles the convergence of DSBs reported previously. Yet, among the more than 350 foci tracked in a total of 158 cells, we did not 7 observe a single incidence of a merging between foci. Thus, in contrast to DSB-induced foci, the growth of individual MMS-induced RPA centers and the decline in their numbers do not appear to involve a congregation of smaller foci, but rather a local expansion and subsequent resolution. RPA foci can serve as proxy for damage bypass events PCNA ubiquitylation requires recruitment of Rad18 to chromatin, which in turn depends on the presence of RPA levels higher than those required for replication fork progression (Davies et al., 2008). We thus asked whether the RPA foci might represent sites of DNA damage bypass. In that case, their resolution should depend on a functional RAD6 pathway. We followed RPA foci in a strain expressing RAD18, encoding the ubiquitin ligase that is rate-limiting for PCNA ubiquitylation, under control of a doxycycline-repressible promoter (Daigaku et al., 2010; Garcia-Rodriguez et al., 2018a). Cells were synchronized, exposed to MMS and released as before, but in the absence of Rad18 (Figure 1G). Under these conditions, we had previously found cells to accumulate in G2/M phase with an activated checkpoint (Daigaku et al., 2010). We now noted that foci were not efficiently resolved unless RAD18 expression was induced by removal of doxycycline. These observations are consistent with our previous finding that DNA damage bypass can be delayed until after completion of genome replication (Daigaku et al., 2010). Importantly, they demonstrate that the majority of RPA foci represent events whose resolution requires the RAD6 pathway. TLS, TS and salvage HR contribute to the resolution of damage-induced RPA foci In order to determine which branch of the RAD6 pathway, TLS or TS, contributed to the resolution of RPA foci, we repeated our analysis in strains carrying deletions of either the genes encoding the TLS polymerases (tls D : rev1 D rev3 D rad30 D ) or of UBC13, required for PCNA polyubiquitylation and TS. While formation and resolution of MMS-induced foci in tls D cells proceeded with WT-like kinetics, ubc13 D mutants exhibited a mild delay in their resolution and in passage through mitosis (Figure 2A). A similar, but more severe defect resulted from deletion of the cognate ubiquitin ligase gene, RAD5 (Figure S2A). Inactivation of both branches of damage bypass in tls D ubc13 D cells caused a noticeable increase in the number of foci, a severe resolution defect and an extended G2/M arrest (Figure 2A). This result indicates that both TLS and TS contribute to the processing of RPA foci, and they can compensate for each other to some degree. Upon exposure to elevated doses of MMS or in response to UV irradiation, we observed a higher dependence on TLS (Figure S2B-C), suggesting that the balance between TLS and TS could be influenced by both the damage load and the type of lesion. 8 Our assays with RAD18-deficient and tls D ubc13 D cells revealed a low, but measurable decline in the number of RPA foci over time. In order to rule out a merging of foci in this damage bypass-deficient background, we determined the size and intensity of Rfa1GFP foci over an extended time course by livecell imaging (Figure S2D-F). Upon MMS treatment, both the size and the intensity of individual RPA foci increased gradually in the course of S phase, but plateaued at a time when the number of foci started to decline (WT: 75 min; rad18 D : 105 min). This plateauing suggests that the decline in the number of foci is predominantly due to resolution rather than coalescence, even in the absence of Rad18 (Figure S2D-F). In order to test whether Rad18-independent recombination was responsible for this process, we examined RPA foci in rad18 D rad54 D mutants. Rad54 functions at a late step in HR (Ceballos and Heyer, 2011), and the mutant strongly sensitizes rad18 D or tls D ubc13 D mutants towards DNA damage (Figure S2G), implying that it acts in a parallel pathway. Resolution of RPA foci was completely blocked in rad18 D rad54 D cells (Figure 2B), indicating that the salvage HR pathway contributes to the processing of ssDNA during and after S phase, at least in the absence of a functional RAD6 pathway. HR factor Rad52, but not TLS polymerase Rev1 follows the pattern of damage-induced RPA foci Having shown that RPA foci can serve as proxy for damage bypass events, we used this insight to assess the relative distribution of TS and TLS factors over time. In order to track TS and salvage HR, we visualized GFP-tagged Rad52 in combination with mRuby-tagged Rfa1. We found a high degree of overlap between the two signals (Figure 3A), although Rfa1 foci were more numerous and developed earlier, consistent with the notion that association of RPA precedes the loading of HR factors onto ssDNA (Figures S1C, S3A). The overlap was strong, both based on entire cells (Figure 3B-C) and when analyzing individual foci (Figure S3B-C). These results indicate that HR proteins become persistent and integral components of RPA foci soon after their formation. In contrast to Rad52, foci of TLS polymerases were difficult to detect in intact cells, even when Rev1 was tagged with four copies of GFP (Figure S3D). We therefore resorted to chromatin spreads, which had successfully been used to monitor chromatin-associated Rev1 in budding yeast (Conde et al., 2010; Gallego-Sanchez et al., 2012). Damage-induced RPA foci can be detected in this assay with an efficiency comparable to live-cell imaging (Figure S3E). Upon immunofluorescence staining we also detected a chromatin signal in spreads from cells carrying a REV19myc allele under control of its own promoter (Figure S3F-H). However, unlike RPA foci, the percentage of spreads with Rev1 foci as well as the overall Rev1 signal did not correlate with exposure to MMS (Figure 3D-E). Instead, it reflected the damageindependent increase in Rev1 abundance over the cell cycle (Waters and Walker, 2006) (Figure S3J). Considering that TLS and TS can partly substitute for each other, we repeated this analysis in a ubc13 D strain, where damage bypass should rely more heavily on the TLS polymerases. Yet, again we detected 15 Elegant studies in yeast employing 2D gel electrophoresis and electron microscopy have given detailed insight into the mechanism of TS, concluding that the reaction mostly initiates from internal gaps rather than 3’-termini (Branzei et al., 2008; Giannattasio et al., 2014; Lopes et al., 2006). Consistent with a re-priming model of gap formation, this approach has demonstrated the importance of primase/polymerase a for proper distribution of ssDNA at stressed forks (Fumasoni et al., 2015). Despite such insight, the temporal and spatial organization of gap expansion and subsequent filling relative to the replication fork have remained unknown. Based on our pulse-chase analysis, it appears that gap expansion is maximal at a time when replication forks are already far away from the lesion or even when bulk genome replication is complete. Under our experimental conditions, resolution by gap filling during the chase period proceeded with a half-life of approximately 15 min (Figure 6G, H). Yet, inactivation of the TS factors Rad5 and Ubc13 was found to cause delays in replication fork progression through MMS-damaged DNA (Ortiz-Bazan et al., 2014). Although our approach does not rule out a highly transient, fork-associated reaction that avoids the accumulation of ssDNA/RPA above the level associated with unperturbed replication, we consider this scenario unlikely. After all, we previously found that RPA directly contributes to the ubiquitylation of PCNA by recruiting Rad18 to chromatin, and productive damage bypass requires significantly more RPA than replication fork progression (Davies et al., 2008). Thus, the absence of visible RPA foci in regions of ongoing replication argues against a significant recruitment of Rad18 to these sites. Similarly, although HR factors have been reported to associate with forks and facilitate replication of MMS-damaged DNA (Gonzalez-Prieto et al., 2013; Hashimoto et al., 2010), they do not give rise to detectable foci in replication centers, suggesting that additional recruitment of these factors precedes productive damage bypass. Importantly, our model does not need to invoke a cell cycle regulation that would actively delay recruitment of HR factors until G2/M phase (Prado, 2014). Instead, efficient recruitment might require a threshold amount of RPA-covered ssDNA, which might only be reached after completion of S phase. It should be noted, however, that our data by no means exclude a fork-associated mode of damage bypass in some situations. In fact, Kowalski and coworkers reported a function of Rad5 in promoting recombination at early replication forks in response to the anti-tumor drug adozelesin (Minca and Kowalski, 2010). This compound forms bulky adducts to the minor groove of the DNA and was found to be strongly fork-stalling (Wang et al., 2001). Hence, it is possible that the degree to which a lesion interferes with overall replisome progression or re-priming dictates the site of damage bypass. Moreover, the importance of factors promoting replication fork reversal in human cells suggests that the balance between fork- and gap-associated TS might be regulated differently in vertebrates (Poole and Cortez, 2017). 16 Finally, an interesting, but still unresolved question pertains to the activities of the TLS polymerases. A temporal separation between TS and TLS is suggested by the notion that Rad5 protein levels peak in S phase (Ortiz-Bazan et al., 2014), whereas the TLS polymerase Rev1 is most abundant in G2/M phase (Waters and Walker, 2006). Yet, while TLS clearly contributes to the resolution of postreplicative RPA/HR foci in G2/M, particularly under conditions of high damage loads or after UV irradiation (Figure 2, S2), we were unable to detect a damage-dependent increase in chromatin association of Rev1. Even its enhanced overlap with RPA in response to DNA damage (Figure 3G) might mostly reflect the increased number of RPA foci under these conditions. It is conceivable that the TLS process is too transient to give rise to detectable foci in yeast. However, we do not yet understand the significance of Rev1 foci accumulating on the chromatin damage-independently in late S and G2/M phase. Here we have used the model organism S. cerevisiae to demonstrate that a large portion of the response to replication-blocking lesions and spontaneous replication stress occurs at a significant distance from active replication forks in postreplicative repair territories. It will be instructive to examine to what extent our findings apply to vertebrate cells, where a temporal separation between ubiquitin-dependent and -independent modes of TLS has been reported (Edmunds et al., 2008). Despite the higher complexity of their chromatin structure, most of the principles of genome maintenance are fundamentally conserved among eukaryotes, suggesting that attempts to understand and manipulate the response to replication stress for therapeutic purposes should not exclusively focus on the replication fork as a target. ACKNOWLEDGMENTS We would like to thank Laura Tomini and Sonja Braun for expert technical assistance, IMB’s Media Lab and the Flow Cytometry, Bioinformatics and Microscopy Core Facilities for technical support, Susan Gasser, Philippe Pasero, Elmar Schiebel, Bruce Stillman and George Yakoub for reagents, and Felix Prado for critical reading of the manuscript. Funding for this work was provided by the European Research Council (ERC AdG 323179, DAMAGE BYPASS) and the Deutsche Forschungsgemeinschaft (DFG, German Research Foundation, project number 393547839 – SFB 1361, sub-project 07). AUTHOR CONTRIBUTIONS Conceptualization, R.W., N.G.R. and H.D.U.; Methodology and Investigation, R.W. and N.G.R.; Formal Analysis, Software and Visualization, R.W., N.Z. and M.H.; Writing – Original Draft, H.D.U. and R.W.; Writing – Review & Editing, all authors; Supervision and Funding Acquisition, H.D.U. 17 DECLARATION OF INTERESTS The authors declare no competing interests. FIGURE LEGENDS Figure 1. MMS-induced RPA foci form during S phase and require Rad18 for resolution in G2/M. A. Experimental scheme. Cells arrested in G1 phase with alpha-factor (aF) were exposed to 0.02% MMS for 30 min before release into the cell cycle without MMS. Transition to the next cell cycle was blocked by addition of nocodazole at the time of release. B. Western blot and FACS analysis for monitoring cell cycle stage, checkpoint activation and PCNA ubiquitylation. The latter was determined by denaturing purification of HisPCNA from total extracts, followed by blotting against ubiquitin and PCNA. An independent biological replicate is shown in Figure S1A. C. Analysis of yeast chromosome patterns by pulsed-field gel electrophoresis and ethidium bromide staining. D. Quantification of Rfa1GFP foci, detected by fluorescence microscopy (see panel E), in undamaged cells or after exposure to MMS. Error bars indicate standard deviations from three independent experiments. The FACS profile of the “+ MMS” samples is identical to that in panel B. Data from one replicate (+ MMS) are shown in Figure S1A. E. Images of Rfa1GFP foci, detected by fluorescence microscopy of cells fixed at the indicated time points after incubation with or without MMS as described in panel A. F. Lifetimes of RPA foci increase in late S and G2/M phase. MMS-treated live cells harboring Rfa1GFP were imaged every 6 s for 3-min intervals at the indicated times, and Rfa1GFP foci were tracked in ca. 50 cells per time point (see Figure S1D-F and supplemental videos). While lifetimes of transient foci were determined precisely, numbers plotted for persistent foci or those appearing or being resolved in each interval represent minimal values. Horizontal lines indicate the 25-, 50- and 75-percentiles. G. Efficient resolution of RPA foci requires Rad18. Rfa1GFP foci were quantified in a strain harboring a doxycycline-repressible allele of RAD18 (Tet-RAD18). Cells were treated as in panel A, but in the absence of Rad18. After 180 min, the culture was split, and foci were monitored (in fixed cells) either in the continued absence of Rad18 (-) or upon re-expression (+) via doxycycline removal. Figure 2. Resolution of MMS-induced RPA foci involves TLS, TS and salvage recombination. A. Resolution of RPA foci is compromised upon inactivation of TLS and TS. Cultures of WT cells and the indicated mutants were exposed to MMS as in Figure 1A, and samples were collected for quantification of Rfa1GFP foci (in fixed cells) and FACS analysis. Transition to the next S phase was blocked by addition of alpha-factor 1 h after release into S phase. 18 B. Salvage HR is responsible for resolution of RPA foci in the absence of a functional RAD6 pathway. Cultures of rad18 D and rad18 D rad54 D mutants were treated as in Figure 1A, and Rfa1GFP foci were quantified in live cells. Figure 3. Spontaneous and MMS-induced RPA foci coincide with Rad52, but the TLS polymerase Rev1 associates with chromatin independently. A. Damage-induced RPA foci co-localize with the HR factor Rad52. Cells harboring Rfa1mRuby (magenta) and Rad52GFP (green) were treated as in Figure 1A and subjected to live-cell fluorescence microscopy at the indicated time points. B. Quantification of Rfa1mRuby foci and overlap with Rad52 in undamaged cells and after exposure to MMS. C. Quantification of Rad52GFP foci and overlap with RPA in undamaged cells and after exposure to MMS. D. Rev1 accumulates on chromatin damage-independently. Cells harboring Rev19myc and Rfa1mRuby were treated as in panel A or left undamaged, and samples were subjected to FACS analysis and chromatin spreading for Rev1 detection by immunofluorescence with an anti-myc antibody. Error bars represent standard deviations from three independent experiments. E. Average Rev1 signals per spread nucleus, performed on the same data set as in panel D (A.U.: arbitrary fluorescence units). F. Co-localization of Rev1 with RPA increases after exposure to MMS and upon inactivation of TS. Chromatin spreads were prepared as in panel D from WT or ubc13 D cells. Signals of Rev19myc (magenta) were detected by immunofluorescence, and Rfa1mRuby signals (green) were imaged directly. G. Percentage of Rev19myc foci co-localizing with Rfa1mRuby and their overlap. Rev1 foci were categorized according to the percentage of their volume covered by RPA. Statistical analysis: Mann-Whitney test, *p<0.05; **p<0.01; ****p<0.0001; ns: not significant. Cell cycle profiles are shown in Figure S3M. Figure 4. Exo1-Pif1 and Mre11 differentially contribute to emergence and resolution of MMS- induced RPA/HR foci. A. Deletion of EXO1 delays both formation and resolution of MMS-induced RPA/HR foci. Quantification of Rfa1mRuby and Rad52GFP foci of live WT (W) and exo1 D (D) cells co-expressing both tagged alleles after treatment as described in Figure 1A. Mean numbers of foci are indicated below the graph. Statistical analysis: Mann-Whitney test, * p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. B. Deletion of PIF1 alone has no strong effect on the formation or resolution of RPA/HR foci. Analysis of pif1 D mutants was performed as in panel A. C. Deletion of EXO1 and PIF1 results in significant delays in the formation and resolution of RPA/HR foci. Analysis of exo1 D pif1 D mutants was performed as in panel A. D. Depletion of Mre11 accelerates formation of MMS-induced RPA/HR foci in early S phase, but interferes with resolution in G2/M. G1-cells harboring Mre11AID*-9myc were incubated in the absence or presence of auxin to either maintain (+) or deplete Mre11 (-), followed by treatment and analysis as in panel A. Functionality of the degron tag is shown in Figure S7B. 19 Figure 5. MMS-induced RPA foci do not localize to known repair centers. A. RPA foci are not enriched at nuclear pores. Cells harboring Rfa1YFP (green) and CFPNup49 (blue) in a nup133 D N background were treated as described in Figure 1A and subjected to live-cell imaging. Top: representative images of cells in mid-S and G2 phase. Bottom: Rfa1YFP foci were scored for overlap with CFPNup49. The dashed line indicates the percentage of overlap (3.3%) expected for a random distribution, calculated based on the relative volumes of the CFPNup49 patch and the nucleus. B. RPA foci are not enriched at the nuclear periphery. Cells harboring Rfa1YFP (green) and 3xNLSmCherry (red) were treated and imaged as in panel A. Top: representative image of Rfa1YFP and 3xNLSmCherry (left) and the segmentation of this image into Rfa1YFP foci (green) and nuclear zones of equal volume (grey shades). Bottom: distribution of Rfa1YFP within the three zones. Dashed lines indicate values expected for a random distribution in the nucleus. C. RPA foci rarely co-localize with INQs. Cells harboring Rfa1mRuby and Cmr1GFP were treated and imaged as in panel A. Top: representative images of Rfa1mRuby and Cmr1GFP in mid-S and G2 phase. Bottom: Rfa1mRuby foci were scored for overlap with Cmr1GFP. D. Cell cycle distribution of Rfa1mRuby and Cmr1GFP foci (data from panel C). Figure 6. MMS-induced RPA foci emerge in postreplicative repair territories. A. RPA foci rarely overlap with the MCM complex. Cells harboring Rfa1mRuby (magenta) and Mcm44GFP (green) were treated as described in Figure 1A and subjected to live-cell imaging. B. Expanded view of Rfa1mRuby (magenta) and Mcm44GFP (green) in late S phase. C. Quantification of the overlap of Rfa1mRuby with Mcm44GFP. D. Experimental scheme for probing the positions of RPA foci relative to replicons by pulse-chase analysis. E. Schematic illustration of the EdU labeling strategy. EdU-labeled, replicated DNA (magenta) moves out of the stationary replication center, marked by the MCM complex, into a postreplicative territory during the chase period. F. Representative images of Rfa1mRuby (green) and the EdU label (magenta) on chromatin spreads prepared from samples collected as in panel D. G. Single-stranded DNA emerges predominantly in postreplicative chromatin. Images of spread nuclei (panel F) were quantified by calculating for each EdU-labeled region the percentage covered by Rfa1mRuby. Horizontal lines indicate the 25-, 50- and 75-percentiles, and mean values are given below the graph. Statistical analysis: Mann-Whitney test, * p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns: not significant. An independent biological replicate is shown in Figure S6E. H. HR foci emerge predominantly in postreplicative chromatin. Images of spread nuclei from cells harboring Rad52mRuby were analyzed as in panel G. I. Experimental scheme of detecting postreplicative DNA synthesis by EdU labeling (top) and images of EdU-stained cells (bottom). J. Magnification of representative nuclei, showing EdU and Rfa1GFP signals. K. Quantification of the overlap of EdU and Rfa1GFP. 20 Figure 7. Model for the emergence of postreplicative repair territories (PORTs). A. MMS-induced RPA/HR foci emerge locally as a consequence of replication. Lesions in the template do not cause extensive replication fork uncoupling or stalling, but give rise to small daughter-strand gaps while the newly replicated DNA moves out of the replication centers. Gaps are subsequently expanded by the actions of Exo1 and Pif1, giving rise to visible RPA foci as a result of their spatial proximity. Resolution via HR-mediated damage processing takes place within these regions. B. Spatial arrangement of PORTs in the nucleus relative to other known sites of damage processing. 21 STAR Methods KEY RESOURCES TABLE REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-ubiquitin (clone P4D1) Cell Signaling Cat#3936; RRID: AB_331292 Rabbit polyclonal anti-Clb6 Santa Cruz Cat#y-380 Rabbit polyclonal anti-Clb2 Santa Cruz Cat#y-180 Mouse monoclonal anti-myc (clone 9E10) Enzo Life Sciences Cat#BML-SA294; RRID:AB_10541551 Mouse monoclonal anti-myc (clone 4A6) Merck Millipore Cat#05-724; RRID: AB_309938 Mouse monoclonal anti-Rad53 Susan Gasser N/A Rat monoclonal anti-tubulin (clone YL1/2) Sigma-Aldrich Cat#92092402; RRID:CVCL_J781 Rabbit polyclonal anti-PCNA In-house N/A Goat anti-Mouse IgG (H+L) Superclonal™ secondary antibody, Alexa Fluor 647-labeled ThermoFisher Scientific A28181 Chemicals, peptides, and recombinant proteins Indole-3-acetic acid sodium salt (auxin) Sigma-Aldrich Cat#I5148 Alpha-factor (synthetic peptide) ProteoGenix SAS N/A Methyl methanesulfonate Sigma-Aldrich Cat#129925 5-Ethynyl-2’-deoxyuridine (EdU) Sigma-Aldrich Cat#900584 BlockAid ThermoFisher Scientific Cat#B10710 Doxycycline hydrochloride Sigma-Aldrich Cat#D3447 Concanavalin A Sigma-Aldrich Cat#L7647 Lipsol® Dynalon Labware Cat#504004-0000 Critical commercial assays Click-iT Plus EdU Alexa Fluor 647 Imaging Kit ThermoFisher Scientific Cat#C10640 Experimental models: organisms & strains S. cerevisiae: strain background DF5 ATCC ATCC:200912 S. cerevisiae: strain background W303-1B Philippe Pasero ATCC:201238 Other yeast strains: see Table S1 This study N/A Oligonucleotides Oligonucleotides for PCR: see Table S2 This study N/A Recombinant DNA pYM-GFP-HIS3MX6 (pYM44) Janke et al., 2004 Euroscarf: P30256 pYM-GFP-natNT2 This study N/A pYM-YFP-hphNT1 (pYM40) Janke et al., 2004 Euroscarf: P30252 YIp204-PADH1-3xNLS-mCherry This study N/A pFA6a-mRuby-CaURA3 Lee et al., 2013 Addgene: #44888 pFA6a-link-yomRuby2-SpHis5 Lee et al., 2013 Addgene: #44858 pFA6a-link-yomRuby2-kanMX4 Lee et al., 2013 Addgene: #44953 pYM-4xGFP-kanMX4 Elmar Schiebel N/A pYM-9myc-hphNT1 (pYM20) Janke et al., 2004 Euroscarf: P30306 pNat-AID*-9myc Morawska et al., 2013 Addgene: #99523 pRS406-CFP-Nup49 Susan Gasser N/A pUN100-nup133DN Susan Gasser N/A YIp204-AFB2 This study N/A YIp128-HISPOL30 Windecker and Ulrich, 2008 N/A 22 pFA6a-kanMX4 Janke et al., 2004 N/A pFA6a-natNT2 Janke et al., 2004 Euroscarf: P30346 pFA6a-hphNT1 Janke et al., 2004 Euroscarf: P30347 pFA6a-HIS3MX6 Janke et al., 2004 N/A pFA6a-URA3 pFA6a-Sld3-allA-kanMX4 Zegerman and Diffley, 2010 N/A pDbf4-Dbf4-4A-HIS3 Zegerman and Diffley, 2010 N/A pRS306-mcm474-174 Sheu et al. 2016 N/A CMVp-tetR’-SSN6 (pCM244) Belli et al., 1998 Euroscarf: P30334 tetO7-kanMX4 (pCM225) Belli et al., 1998 Euroscarf: P30342 YIp204-PADH1-3xNLS-mCherry This study N/A pRS3015 ATCC ATCC: 77144 Software and Algorithms Image J Fiji https://fiji.sc/ N/A TrackMate https://imagej.net/TrackM ate N/A Pandas https://pandas.pydata.org/ N/A FlowJo V10 FlowJo, LLC N/A SoftWoRx GE Healthcare N/A Prism 7 GraphPad N/A LAS X Leica N/A CONTACT FOR REAGENT AND RESOURCE SHARING For all strains and reagents generated in this study or any other questions regarding the methods please contact Helle D. Ulrich ([email protected]). EXPERIMENTAL MODEL All Saccharomyces cerevisiae strains used are haploid with mating type a and are derived either from DF5 or W303 (see Table S1). METHODS DETAILS Yeast strain construction and culture conditions All strains were cultured in YPD or low fluorescence synthetic complete (SC) media supplemented with appropriate amino acids at 30˚C. Strains carrying gene deletions or tags were generated with standard PCR-based methods as described (Janke et al., 2004; Lee et al., 2013) or by combining relevant modifications by mating and tetrad dissection. The strain carrying a doxycycline-repressible allele of RAD18 (Tet-RAD18) has been described previously (Daigaku et al., 2010). The auxin-inducible degron tag (AID*-FLAG) was introduced as described (Morawska and Ulrich, 2013). The strain carrying 23 mcm4Δ74-174, dbf4-19A and sld3-38A was generated as described (Sheu et al., 2016). For cell cycle analysis, cells were synchronized in G1 by addition of 2 µg/mL alpha-factor every hour for 2 h. For time course experiments involving fixation (Fig 1B-E, 1G, 2A, S1A-B, S2A-C), entry into a second round of replication was prevented either by release into 15 µg/mL nocodazole or by hourly addition of 2 µg/mL alpha-factor, starting 1 h after release into S phase. Cells were treated with or without 0.02% MMS for 30 minutes or with 20 J/m2 UV as indicated before release into S phase in the absence of damaging agent. To degrade AID*-FLAG-tagged Mre11, auxin was added at a final concentration of 250 µM to G1-arrested cells 30 min before release. Doxycycline was used at 2 µg/mL to repress RAD18 expression. Analysis of proteins in cell extracts Total yeast extracts were prepared by trichloroacetic acid (TCA) precipitation as described (Morawska and Ulrich Yeast 2013). PCNA and its modified forms were isolated for analysis under denaturing conditions from strains carrying His-tagged PCNA as described (Davies and Ulrich, 2012). Proteins were resolved by SDS-PAGE and transferred onto nitrocellulose or PVDF membranes for western blotting. Relevant proteins were detected using mouse monoclonal anti-ubiquitin antibody, rabbit anti-Clb6 polyclonal antibody, rabbit anti-Clb2 polyclonal antibody, and mouse monoclonal anti-myc (clone 9E10). Rabbit polyclonal anti-PCNA and rat monoclonal anti-tubulin antibodies were generated inhouse and mouse monoclonal anti-Rad53 antibody was a kind gift from Susan Gasser. Cell cycle analysis Cells were fixed with 70% ethanol and incubated at 4˚C for at least 1 h. Samples were washed twice with 50 mM sodium citrate pH 7.0, incubated with 80 µg/mL RNaseA at 50˚C for 1 h, and with 80 µg/mL proteinase K at 50˚C for 1 h. Samples were then stained with 32 µg/mL propidium iodide and sonicated on a low setting for 3 seconds. DNA content was analyzed by flow cytometry with a FACSVerse cytometer (BD Biosciences), and data were analyzed with FlowJo v10 software (FlowJo, LLC). Pulsed-field gel electrophoresis (PFGE) G1-arrested cells were exposed to 0.02% MMS for 30 minutes before release into the cell cycle. At the indicated time points, cells were inactivated with 0.1% sodium azide, and genomic DNA was prepared in low-melting agarose plugs as described (Garcia-Rodriguez et al., 2018a). Briefly, 5×107 cells per plug were spheroplasted and embedded in 1% low-melting agarose, digested with proteinase K for 2 days at 42˚C and washed extensively in TE buffer. Yeast chromosomes were resolved by PFGE in a 1% agarose gel using a CHEF-DRIII system (BioRad) run at 14˚C for 24 h at 6 V/cm with a ramped switch time from 60 to 120 s at a 120˚ angle. Gels were stained with ethidium bromide (0.5 µg/mL) for 30 min and destained with water before imaging. 24 Fluorescence microscopy For imaging of fixed cells, samples were collected at relevant time points, and cells were fixed with 2.5% formaldehyde in 0.1 M potassium phosphate buffer (pH 6.4) for 10 min at room temperature, washed twice with 0.1 M potassium phosphate buffer (pH 6.6) and resuspended in 0.1 M potassium phosphate buffer (pH 7.4). Cells were permeabilized with 0.5% Triton X100 and stained with 0.5 µg/mL DAPI for 10 min before imaging on an AF7000 widefield fluorescence microscope (Leica) equipped with a 63× (NA = 1.4) oil immersion objective, ORCA-Flash 4.0 V2 digital CMOS camera (Hamamatsu), LED light source (SOLA, lumencor) and LAS X software (Leica). Z-stacks with 19 planes (step size: 0.2 µm) were acquired. GFP signals were recorded with an L5 filter, DAPI signals with an A4 filter, and differential interference contrast (DIC) was used for whole-cell images. For live-cell imaging, cells were plated on concanavalin A-coated chambered coverslips with glass bottom (Ibidi) and washed twice with media before imaging with a DeltaVision Elite system (GE Healthcare) equipped with a 60× oil immersion objective (NA = 1.42), Scientific CMOS camera, InsightSSITM solid state illumination and SoftWoRxTM software with built-in deconvolution algorithm. Fluorescent proteins CFP, YFP, GFP and mCherry were imaged with their optimized filters, mRuby2 with a TRITC filter, and DIC was used for whole-cell images. Z-stacks with 18-30 planes (step size: 0.2 µm) were acquired for each image. Images were reconstructed with a deconvolution algorithm from SoftWoRxTM. All live-cell imaging was performed in an environmental control chamber at 30˚C. For tracking Rfa1GFP foci in live cells, imaging was performed as described above at 6 s intervals for 3 min. Prior to these experiments, it was confirmed that cells imaged in this manner experienced no delay in budding during entry into S phase. A moderate delay in the time to cell division compared to non-imaged cells indicated that phototoxicity is not negligible, but tolerable under these conditions. For immunofluorescence of chromatin spreads (prepared as described below), images were obtained with the DeltaVision Elite system as described above. DAPI signals were acquired with a DAPI filter, and Alexa Fluor 647 with a Cy5 filter. Images were reconstructed by deconvolution (SoftWoRxTM). Chromatin spreads, immunofluorescence and Click reactions For chromatin spreads, 10 OD600 cells were collected and inactivated with 0.1% sodium azide. Cells were spheroplasted in sorbitol mix (1.2 M sorbitol, 0.1 M potassium phosphate pH 6.5) with 0.4 mg/mL zymolyase 20T, washed once in MES stop solution (0.1 M MES pH 6.4, 1 mM EDTA, 0.5 mM MgCl2, 1 M sorbitol) and resuspended in 0.5 mL MES stop solution. To prepare spreads, 20 µL spheroplasts, 40 µL of fixing solution (4% paraformaldehyde, 3.4% sucrose), 80 µL of 1% Lipsol, and 80 µL of fixing solution were added sequentially to a clean coverslip with brief mixing by swirling between additions. Samples were spread on coverslips with a glass rod and left to dry overnight. Slides were then washed A C B E 0 15 30 45 60 75 90(min) D G 0 15 30 45 60 75 90105120 135 150 (min) αF MMS (0.02%) Wash and release 90 min 30 min 0 15 30 45 60 75 90 105 120 135 (min) HisPCNA-Ub3 HisPCNA-Ub2 Rad53-P Rad53 HisPCNA HisPCNA HisPCNA-Ub1 *Clb6 Ub PCNA PCNA high exp. Rad53 Clb6 Clb2 150 DNA content 1n 2n DNA content 1n 2n 1 2 3 1 2 3 Clb2 0 90 120 180 0 20 40 60 80 100 % cells with foci 210 270 300 330 360 240 Rad18 -+ --- -+ -+ -+ -+ -+ - Time after release (min) 1n 2n Figure 1 0 15 30 45 60 75 90120150 Time after release (min) + MMS 1n 2n 0 15 30 45 60 75 - MMS 0 20 40 60 80 100 % cells with foci 5 m 0 30 45 60 - MMS + MMS 0 45 75 120 Transient foci Persistent foci, appearances & resolutions (minimum) lifetime (s) Time after release (min) 30 60 90 60 120 180 0 F Main and Supplemental Figures BA % cells with foci Time after release (min) 0 15 30 45 60 75 105120 150 165180210 90 135 WT Time after release (min) tls∆ 0 15 30 45 60 75 105120 150 165180210 90 135 1n 2n 0 20 40 60 80 100 0 20 40 60 80 100 % cells with foci Time after release (min) ubc13∆ 0 15 30 45 60 75 105120 150 165180210 90 135 0 20 40 60 80 100 Time after release (min) tls∆ ubc13∆ 0 15 30 45 60 75 105120 150 165180210 90 135 1n 2n 0 20 40 60 80 100 30 45 60 75 105135165210270 0 20 40 60 80 100 % cells with foci Time after release (min) 330 rad18∆ 30 45 60 75 105135165210270 0 20 40 60 80 100 % cells with foci Time after release (min) 330 rad18∆ rad54∆ 1 2 3 1 2 3 Figure 2 A D B % nuclei with Rev1 foci E F G 30 75 105 5 µm Rad52GFP Rfa1mRuby merge no yesoverlap with Rad52: Rfa1 % cells with Rfa1 foci 30 45 60 75 90 - MMS + MMS 105120 Time after release (min) 30 45 60 75 90 0 20 40 60 80 100 Rad52 % cells with Rad52 foci 30 45 60 75 90 - MMS + MMS 105120 Time after release (min) 30 45 60 75 90 0 20 40 60 80 100 no yes overlap with Rfa1: 0 30 60 75 0 Time after release (min) 30 75 100 - MMS + MMS Rev1 Average Rev1 signal on chromatin (A.U. x103) 0 30 60 75 0 30 75 100 - MMS + MMS Rev1 Time after release (min) 0 4 8 12 - MMS + MMS + MMS WTubc13∆ Rev19myc/ Rfa1mRuby 5 µm C Figure 3 0 20 40 60 80 100 1 2 3 1n 2n 1n 2n < 50% none overlap with Rfa1: > 50% ns ** **** ns ***** **** ns ns **** **** Rev1 0 30 60 0 30 0 5 10 15 20 25 % Rev1 foci 75 100 0 30 60 0 30 75 100 - MMS + MMS - MMS + MMS WT ubc13∆ (min) 100 A 30 45 60 75 90 120 0 20 40 60 80 100 % cells with Rfa1 foci (min) 105 ** ** ** * 0.8 2.5 3.0 2.8 2.2 1.2 0.8 1.1 2.1 2.4 2.3 1.6 0.9 0.9 WWWWWWW Mean no. of foci B C * * * **** ***** * * **** 1 2 3 ** *** * 0.6 1.8 2.5 2.1 1.7 1.1 0.8 1.7 1.3 2.0 1.7 1.5 1.1 1.0 * 1 2 3 *** **** **** ** Rfa1 Rad52WT vs exo1∆ WT vs pif1∆ WT vs exo1∆ pif1∆ Figure 4 0 20 40 60 80 100 % cells with Rad52 foci WWWWWWW 30 45 60 75 90 120105 30 45 60 75 90 120 0 20 40 60 80 100 % cells with Rfa1 foci (min) 105 1.1 2.5 2.9 2.5 1.6 0.9 0.6 0.8 2.0 2.5 2.2 1.6 0.6 0.6 WWWWWWW Mean no. of foci 1 2 3 0.3 2.0 2.1 1.7 1.2 0.7 0.4 0.4 1.6 1.9 1.5 1.1 0.5 0.4 0 20 40 60 80 100 % cells with Rad52 foci WWWWWWW 30 45 60 75 90 120105 30 45 60 75 90 120 0 20 40 60 80 100 % cells with Rfa1 foci (min) 105 1.3 2.5 2.7 2.9 1.9 1.0 0.5 1.2 1.7 2.2 1.8 1.5 1.3 0.7 WWWWWWW Mean no. of foci 0.3 1.6 2.3 2.0 1.3 0.8 0.4 0.5 0.9 1.9 1.6 1.3 1.1 0.8 0 20 40 60 80 100 % cells with Rad52 foci WWWWWWW 30 45 60 75 90 120105 DWT vs Mre11 depletion 1 2 3 0 20 40 60 80 100 % cells with Rad52 foci ** **** ******** 0.6 1.8 2.5 2.1 1.7 1.1 0.8 1.7 1.3 2.0 1.7 1.5 1.1 1.0 + - + - + - + - + - + - + - 30 45 60 75 90 120105 0 20 40 60 80 100 % cells with Rfa1 foci *** **** **** *** **** 30 45 60 75 90 120105 0.8 2.5 2.7 2.6 1.7 0.7 0.6 1.5 2.5 2.9 2.1 2.1 1.7 1.4 + - + - + - + - + - + - + - (min) Mean no. of foci Mre11 A C D Mid-S (45 min) G2 (75 min) Rfa1mRuby/ Cmr1GFP Rfa1YFP/ 3xNLSmCherry 1 2 3zone Mid-S (45 min) G2 (75 min) Rfa1YFP/ CFPNup49 5 µm 5 µm 3.3% noyesoverlap with Nup49: 0 20 40 60 80 100 % Rfa1 foci 30 45 60 90 105 120 75(min) 33% 67% 1 µm 0 20 40 60 80 100 % Rfa1 foci 30 45 60 90 105 120 75(min) B noyesoverlap with Cmr1: 0 20 40 60 80 100 % Rfa1 foci 30 45 60 90 105 120 75(min) 0 20 40 60 80 100 % cells with Rfa1 foci 30 45 60 90 105 120 75(min) 0 20 40 60 80 100 % cells with Cmr1 foci 30 45 60 90 105 120 75 (min) Rfa1 Cmr1 Figure 5 1 2 3 A C D Figure 6 0 30 60 75 (min) αF MMS (0.02%) Wash and release 5 min EdU pulse Thymidine chase F G pulse % EdU vol with Rfa1 chase 30 60 75 (min) % EdU vol with Rad52 pulse chase 30 60 75 (min) Late S (60 min) B E H Mean 0.9 10.7 5.4 Mean 2.3 11.5 5.6 Rfa1 Rad52 DNA lesion Postreplicative Replicative EdU pulse EdU chase EdU label active replisomes Early S (30 min) Late S (60 min) G2 (105 min) Mcm44GFP Rfa1mRuby 5 µm Merge 1 µm 30 (pulse) 60 (chase) EdU Rfa1mRuby Merge 1 µm min **** ** ** 0 50 100 *** * ns 0 40 80 noyesoverlap with Mcm4: (min) 0 20 40 60 80 100 % Rfa1 foci 30 45 60 75 90 120105 Replication origin RPA Rad52 noyes overlap with EdU: (min) 0 20 40 60 80 100 % Rfa1 foci 75 105 noyes overlap with Rfa1: (min) 0 20 40 60 80 100 % EdU foci 75 105 75 105 5 µm EdU/Rfa1GFP I J K 0 45 75 105 (min) αF MMS (0.02%) Wash and release 15 min EdU pulse 5 µm EdU 45 75 105 Figure 7 Postreplicative chromatin Replicative chromatin resection A B Replication origin re-priming Rad52 loading Nuclear pores INQ Nuclear envelope PORTs Replication centers DNA lesion RPA Rad52 Exo1/ Pif1 inactive MCM helicase active MCM helicase 0 15 30 45 60 75 90 120 150 0 20 40 60 80 100 % cells with foci Time after release (min) 105 135 A B 0 20 40 60 80 100 % cells with foci Time after release (min) 180 210165 195 240 0 15 30 45 60 75 90 120 150105 135 Figure S1 1 2 ≥3 1 2 ≥3 0 15 30 45 60 75 90 105 120 135 (min) HisPCNA-Ub3 HisPCNA-Ub2 Rad53-P Rad53 HisPCNA HisPCNA HisPCNA-Ub1 *Clb6 Ub PCNA PCNA high exp. Rad53 Clb6 Clb2 150 DNA content 1n 2n DNA content Clb2 *Clb6 Clb6 Clb2 DNA content 1n 2n DNA content 0 15 30 45 60 75 90 105 120 135 (min) HisPCNA-Ub3 HisPCNA-Ub2 HisPCNA HisPCNA HisPCNA-Ub1 Ub PCNA PCNA high exp. 150 Clb2 30 45 60 75 90 % cells with RPA foci 105120 Time after release (min) 30 45 60 75 90 Live-cell analysis 0 20 40 60 80 100 - MMS + MMS MMS-induced foci UV-induced foci C Resolution Appearance D Time (s) 0 180 1 μm Resolution Appearance 18 102 120 180 108 114 120 168 0 180 30 60 90 Persistent Appearance Resolution Transient Time after release (min) F Time (s) Number of events min Persistent Appearance Resolution Transient Total Number of cells 30 9 14 12 15 50 51 60 55 30 38 39 162 49 90 54 24 32 33 143 58 Events per cell (mean) min Persistent Appearance Resolution Transient Total 30 0.18 0.27 0.24 0.29 0.98 60 1.12 0.61 0.78 0.80 3.31 90 0.93 0.41 0.55 0.57 2.46 Fraction of events (%) min Persistent Appearance Resolution Transient 30 18 28 24 30 60 34 19 23 24 90 38 17 22 23 E Figure S1. Damage-induced RPA foci appear in S phase and are gradually resolved without evidence for merging, Related to Figure 1 A. Biological replicate of the experiment shown in Figure 1B. Left: FACS profiles, Rad53, Clb6 and Clb2 protein levels and PCNA ubiquitylation in samples treated with a single dose of MMS in G1 phase. Right: distribution of Rfa1GFP foci at the indicated time points after release into S phase. B. UV irradiation induces a pattern of RPA foci in S and G2 phase similar to MMS treatment. G1-arrested cells were irradiated with 20 J/m2 UV light (254 nm) and analyzed as described for the MMS-based experiments in panel A and Figure 1. C. Fluorescence microscopy of live cells results in the detection of higher numbers of spontaneous and MMS-induced RPA foci than imaging of fixed cells. Rfa1GFP foci were quantified in live-cell images taken at the indicated time points after release into S phase. Cells were either left undamaged or treated with a single dose of MMS before release as described in Figure 1A. D. Tracking of RPA foci in live cells reveals their dynamic behavior. Left: representative images of local emergence and resolution of Rfa1GFP foci, recorded at the indicated times during a 3-min interval of imaging (frames: every 6 s). Cells harboring Rfa1GFP were exposed to a single dose of MMS as described in Figure 1A and imaged 60 min after release into S phase in the absence of MMS. Right: Rfa1GFP foci were tracked as shown in the supplemental videos 1 and 2, using an ImageJ plugin (TrackMate), and tracks of individual foci are plotted over the 3-min interval, each line representing a single focus. Positions corresponding to the frames shown on the left are indicated by arrows. Additional examples are shown in the supplemental videos 3-5. E. Summary of the dynamic behavior of RPA foci in cells exposed to a single dose of MMS as described in Figure 1A. Rfa1GFP foci were tracked for 3 min in ca. 50 cells per time point as described in panel D. F. Graphical representation of the Rfa1GFP tracks from the experiment described in panel D. Figure S2 A D E 0 1 2 3 WT rad18∆ 30 45 60 75 105 135 30 45 60 75 105 135 210 270165 330 Time after release (min) Foci size (μm3) 128 256 512 1024 2048 4096 8192 16384 32768 65536 WT rad18∆ 30 45 60 75 105 135 30 45 60 75 105 135 210 270165 330 Time after release (min) Foci intensities (A.U.) F % cells with foci 0 15 30 45 60 75 105120 90 135 1n 2n 0 15 30 45 60 75 105120 90 135 Time after release (min) Time after release (min) WT 0 20 40 60 80 100 rad5∆ 0 20 40 60 80 100 B Time after release (min) 0 30 60 90 120150 210240180 Time after release (min) 0 30 60 90 120150 210240180 1n 2n % cells with foci WT tls∆ 0 20 40 60 80 100 0 20 40 60 80 100 Time after release (min) 0 30 60 90 120150 210240180 Time after release (min) 0 30 60 90 120150 210240180 1n 2n % cells with foci ubc13∆ 0 20 40 60 80 100 tls∆ ubc13∆ 0 20 40 60 80 100 C UV irradiation Time after release (min) 0 15 30 45 60 75 105120 150 165180210 90 135 Time after release (min) 0 15 30 45 60 75 105120 150 165180210 90 135 1n 2n % cells with foci WT tls∆ 0 20 40 60 80 100 0 20 40 60 80 100 Time after release (min) 0 15 30 45 60 75 105120 150 165180210 90 135 Time after release (min) 0 15 30 45 60 75 105120 150 165180210 90 135 1n 2n % cells with foci ubc13∆ 0 20 40 60 80 100 tls∆ ubc13∆ 0 20 40 60 80 100 % cells with foci 30 45 60 75 105135 WT 30 45 60 75 105135 210270165 330 rad18∆ Time after release (min) 0 20 40 60 80 100 0 20 40 60 80 100 G High MMS 1 2 ≥3 Live-cell analysis Untreated 0.0001% 0.0003% 0.0005% 5 J/m210 J/m220 J/m2 RFA1GFP RFA1GFP rad54∆ RFA1GFP rad18∆ RFA1GFP tls∆ ubc13∆ RFA1GFP rad54∆ rad18∆ RFA1GFP rad54∆ tls∆ ubc13∆ MMS UV Figure S5. RPA foci are not enriched at nuclear pores or INQs, Related to Figure 5 A. MMS-induced RPA foci accumulate with a WT-like pattern in nup133 ∆ N mutants. Rfa1YFP foci were quantified after treating the indicated strains as described in Figure 5A. B. MMS-induced RPA foci are not enriched at nuclear pores in rad18 ∆ cells. Rfa1YFP foci were scored for their overlap with the CFPNup49 signal in WT and rad18 ∆ cells as described in Figure 5A. C. Cmr1 forms spontaneous foci in S phase. Rfa1mRuby and Cmr1GFP foci were quantified in synchronized undamaged live cells. D. Spontaneous RPA foci rarely co-localize with INQ. Rfa1mRuby foci shown in panel C were scored for their overlap with the Cmr1GFP signal. E. DNA damage bypass does not impede resolution of Crm1 foci. MMS-induced Rfa1mRuby and Cmr1GFP foci were quantified in rad18 ∆ mutants as described in panel A. F. Persistent RPA foci in rad18 ∆ do not co-localize with INQ. Rfa1mRuby foci shown in panel E were scored for their overlap with the Cmr1GFP signal. Figure S6 Mcm44GFP A B Mcm44GFP/ Rfa1mRuby Early S 30 min Late S 45 min G2 60 min D E C F no yesoverlap with Mcm4: (min) 0 20 40 60 80 100 % Rfa1 foci 30 45 60 75 90 5 µm Mcm44GFP/ Rfa1mRuby 5 µm WT vs dbf4-19A sld3-38A mcm4ΔN pulse chase 30 60 75 (min) 0 5 10 15 * **** * **** 60 75 chase w/o thymidine Total EdU signal on chromatin (A.U. x104) **** **** 1n 2n 0 50 100 **** ** ns pulse % EdU vol with Rfa1 chase 30 60 75 Mean 1.7 14.1 10.4 (min) 1 2 ≥3 0.0 0.1 0.6 0.9 1.6 1.8 2.2 0.0 0.2 0.8 1.2 2.0 2.3 2.2 0 20 40 60 80 100 % cells with Rfa1 foci Wm Wm Wm Wm Wm Wm W m 30 45 60 75 90 120105 2.4 2.9 W m 150 * * ** * Mean no. of foci (min) GEdU DAPI Bright field Rfa1GFP Figure S6. MMS-induced RPA foci emerge in postreplicative chromatin, Related to Figure 6 A. Relative distribution of Mcm4 and RPA in undamaged cells. Mcm44GFP and Rfa1mRuby were imaged in synchronized undamaged cells as described in Figure 6A. B. Spontaneous RPA foci rarely co-localize with Mcm4. Spontaneous Rfa1mRuby foci recorded as in panel A were scored for their overlap with the Mcm44GFP signal. C. Montages of images used for the analysis shown in Figure 6A-C, showing Mcm4 and RPA signals in the different z planes of S-phase cells (imaged 60 min after release from G1 arrest). D. Addition of thymidine effectively reduces EdU incorporation during S phase. Cells were subjected to the treatment scheme shown in Figure 6D, but either including or omitting thymidine during the chase period, and the total EdU signal was quantified on individual spread nuclei prepared from samples collected at the indicated time points. Horizontal lines indicate the 25-, 50- and 75-percentiles. Statistical analysis: Mann-Whitney test, * p<0.05; **p<0.01; ****p<0.0001. Cell cycle progression was monitored by FACS. E. An independent biological replicate of the experiment shown in Figure 6G. F. Representative images used for quantification of EdU (magenta) and Rfa1GFP (green) shown in Figure 6K. The panels include the DAPI signals (blue) used for defining the masks corresponding to the nuclei during image analysis (yellow outlines). S phase cells were excluded from the analysis. Note that EdU staining outside the nuclear areas likely represents mitochondrial DNA. G. Derepression of late-origin firing enhances the emergence of MMS-induced RPA foci. Rfa1GFP foci were scored in live WT and dbf4-19A sld3-38A mcm4ΔN cells synchronized in G1 and released into 0.05% MMS (W: WT; m: mutant). Statistical analysis: Mann-Whitney test, *p<0.05. Figure S7 WT RFA1GFP RFA1mRuby-Ura RFA1mRuby-Kan HisPOL30 RFA1GFP rad18∆ Tet-RAD18 Tet-RAD18 RFA1GFP Untreated 0.001% 0.005% 0.01% 25 J/m250 J/m275 J/m2 WT rev1∆ RFA1mRuby REV19myc RFA1mRuby REV14GFP RFA1mRuby WT rad52∆ RFA1mRuby RFA1mRuby RAD52GFP RAD52GFP WT RFA1mRuby RFA1mRuby MCM44GFP Rfa1 taggingRad52 taggingRev1 tagging Replisome tagging Untreated 50 J/m275 J/m2 0.001%0.0005% 10 mM 20 mM WT MRE11 MRE11AID*-FLAG mre11∆ RFA1mRuby RAD52GFP WT MRE11 MRE11AID*-FLAG mre11∆ RFA1mRuby RAD52GFP + Auxin Tubulin FLAG 90 0 30 60 90250 µM Auxin (min) MRE11AID*-FLAG WT B C A - Auxin MMS UV MMS HUUV Figure S7. Epitope tags used in this study do not compromise functionality of the tagged proteins, Related to STAR Methods: Construction of yeast strains A. The functionality of fluorescently or 9myc-tagged proteins was confirmed by analyzing growth and DNA damage sensitivities in spot assays. Ten-fold serial dilution of respective strains (starting from OD600 = 0.5) were spotted onto YPD plates and irradiated with the indicated doses of UV light (254 nm) or onto YPD plates containing the indicated contentrations of MMS. Growth was scored after incubation at 30˚C for 2 days. Untagged strains and deletion mutants of relevant genes served as controls. Tagged alleles of CMR1 and NUP49 have been described by others (Gallina et al., 2015; Schober et al., 2009). B. The functionality of AID*-tagged Mre11 was confirmed by analyzing growth and DNA damage sensitivities of the MRE11AID*-FLAG strain in spot assays in the absence and the presence of 250 µM auxin. Assays were performed as described in panel A. Untagged WT as well as MRE11 and mre11 ∆ strains harboring Rfa1mRuby and Rad52GFP served as controls. The assays show that the degron tag does not interfere with growth or damage resistance in the absence of auxin, but confers an mre11 ∆ -like phenotype on auxin-containing plates. C. The AID* degron effectively induces degradation of Mre11 within 60 min. Total cell extracts were prepared from WT and MRE11AID*-FLAG strains at the indicated time points after addition of 250 µM auxin to exponential cultures and analyzed by western blotting with an anti-FLAG antibody. Probing against Tubulin served as a loading control. Table S1. Yeast strains, Related to STAR Methods: Construction of yeast strains Strain Genotype No Reference DF5 his3- ∆ 200, leu2-3,2-112, lys2-801, trp1-1(am), ura3- 52, MATa 003 (1) RFA1GFP DF5 RFA1GFP::HIS3MX6, MATa 3435 This study RFA1GFP HisPOL30 DF5 RFA1GFP::HIS3MX6, LEU2::HisPOL30, MATa 3503 This study RFA1GFP tls ∆ DF5 rev1 ∆ ::URA3, rev3 ∆ ::kanMX4, rad30 ∆ ::HIS3MX6, RFA1 GFP ::natNT2, MATa 3505 This study RFA1GFP ubc13 ∆ DF5 ubc13 ∆ ::HIS3MX6, RFA1GFP::HIS3MX6, MATa 3507 This study RFA1GFP rad5 ∆ DF5 rad5 ∆ ::hphNT1, RFA1GFP::HIS3MX6, MATa 3796 This study RFA1GFP rad18 ∆ DF5 rad18 ∆ ::hphNT1, RFA1GFP::HIS3MX6, MATa 4179 This study RFA1GFP tls ∆ ubc13 ∆ DF5 rev1 ∆ ::URA3, rev3 ∆ ::kanMX4, rad30 ∆ ::HIS3MX6, ubc13 ∆ ::HIS3MX6, RFA1 GFP ::natNT2, MATa 3504 This study RFA1GFP rad54 ∆ DF5 rad54 ∆ ::hphNT1, RFA1GFP::HIS3MX6, MATa 4660 This study RFA1GFP rad54 ∆ rad18 ∆ DF5 rad18 ∆ ::hphNT1, rad54 ∆ ::natNT2, RFA1 GFP ::HIS3MX6, MATa 4661 This study RFA1GFP rad54 ∆ tls ∆ ubc13 ∆ DF5 rev1 ∆ ::URA3, rev3 ∆ ::kanMX4, rad30 ∆ ::HIS3MX6, ubc13 ∆ ::HIS3MX6, rad54 ∆ ::hphNT1, RFA1 GFP ::natNT2, MATa 4662 This study Tet-RAD18 RFA1GFP DF5 tetO 7 -RAD18::kanMX4, LEU2::CMVp-tetR’-SSN6, RFA1 GFP ::HIS3MX6, MATa 3436 This study RFA1mRuby2 DF5 RFA1mRuby2::CaURA3, MATa 4191 This study RFA1mRuby2 RAD52GFP DF5 RAD52GFP::HIS3MX6, Rfa1mRuby2::CaURA3, MATa 4254 This study RFA1mRuby2 REV14GFP DF5 RFA1mRub2y::SpHIS5, REV14GFP::kanMX4, MATa 4197 This study RFA1mRuby2 REV19myc DF5 RFA1mRuby2::CaURA3, Rev19myc::hphNT1, MATa 4518 This study RFA1mRuby2 REV19myc ubc13 ∆ DF5 ubc13 ∆ ::HIS3MX6, RFA1mRuby2::CaURA3, Rev1 9myc ::hphNT1, MATa 4685 This study RFA1mRuby2 RAD52GFP exo1 ∆ DF5 exo1 ∆ ::kanMX4, RAD52GFP::HIS3MX6, Rfa1 mRuby2 ::CaURA3, MATa 4320 This study RFA1mRuby2 RAD52GFP pif1 ∆ DF5 pif1 ∆ ::natNT2, RAD52GFP::HIS3MX6, Rfa1 mRuby2 ::CaURA3, MATa 4314 This study RFA1mRuby2 RAD52GFP exo1 ∆ pif1 ∆ DF5 exo1 ∆ ::kanMX4, pif1 ∆ ::natNT2, RAD52 GFP ::HIS3MX6, Rfa1 mRuby2 ::CaURA3, MATa 4321 This study RFA1mRuby2 RAD52GFP MRE11 AID*-9myc DF5 RAD52GFP::HIS3MX6, Rfa1mRuby2::CaURA3, MRE11 AID*-9myc ::natNT2, TRP1::YIp204-AFB2, MATa 4355 This study RFA1YFP MPS3mCherry CFP Nup49 DF5 RFA1YFP::hphNT1, MPS3mCherry::HIS3MX6, URA3::pRS406- CFP Nup49, pRS315-LEU2, MATa 4501 This study RFA1YFP MPS3mCherry CFPNup49 nup133 ∆ N DF5 nup133 ∆ :: natNT2, RFA1YFP::hphNT1, MPS3mCherry::HIS3MX6, URA3::pRS406-CFPNup49, pUN100-nup133 ∆ N-LEU2, MATa 4471 This study RFA1YFP MPS3mCherry CFPNup49 nup133 ∆ N rad18Δ DF5 nup133::natNT2, rad18 ∆ ::kanMX4, RFA1YFP:: hphNT1, MPS3mCherry::HIS3MX6, URA3::pRS406- CFP Nup49, pUN100-nup133 ∆ N-LEU2, MATa 4512 This study RFA1YFP 3xNLS-mCherry DF5 RFA1YFP::hphNT1, TRP1::YIp204-3xNLS-mCherry, MATa 4517 This study RFA1mRuby CMR1GFP DF5 RFA1mRuby2::kanMX4, CMR1GFP::HIS3MX6, MATa 4189 This study RFA1mRuby CMR1GFP rad18 ∆ DF5 rad18 ∆ ::hphNT1, RFA1mRuby2::kanMX4, CMR1 GFP ::HIS3MX6, MATa 4516 This study RFA1mRuby MCM44GFP DF5 RFA1mRuby2::CaURA3, MCM44GFP::kanMX4, MATa 4226 This study W303 GPD-TK 7 W303 RAD5+ URA3::GPD-TK 7 , phENT1-LEU2, MATa 2959 (2) W303 RFA1mRuby GPDTK7 W303 RAD5+ RFA1mRuby2::HIS3MX6, URA3::GPD-TK 7 , phENT1-LEU2, MATa 4223 This study W303 RFA1GFP GPD-TK 7 W303 RAD5+ RFA1GFP::HIS3MX6, URA3::GPD-TK 7 , phENT1-LEU2, MATa 3655 This study W303 MCM44GFP Rad52 mRuby GPD-TK7 W303 RAD5+ MCM44GFP::kanMX4, RAD52mRuby2:: HIS3MX6, URA3::GPD-TK7, phENT1-LEU2, MATa 4311 This study Tet-RAD18 mcm4 ∆ 74- 174 dbf4-19A sld3-38A RFA1GFP DF5 tetO 7 -RAD18::kanMX4, LEU2::CMVp-tetR’-SSN6, TRP1::p404-BrdU-inc, HIS3::pDbf4-Dbf4-4A, dbf4 ∆ ::SpURA3, Sld3-allAHis10Myc13::kanMX4, mcm4 ∆ 74-174, RFA1 GFP ::natNT2, MATa 4001 This study (1) Finley, D., Ozkaynak, E., and Varshavsky, A. (1987). The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses. Cell 48, 1035-1046. (2) Lengronne, A., Pasero, P., Bensimon, A., and Schwob, E. (2001). Monitoring S phase progression globally and locally using BrdU incorporation in TK+ yeast strains. Nucleic Acids Res. 29, 1433-1442. Table S2. Oligonucleotides, Related to STAR Methods: Construction of yeast strains Gene Primer Name Sequence Gene-specific primers RFA1 RFA1 GFP/YFP tagging F GAAGCCGACTATCTTGCCGATGAGTTATCCAAGGCTTTGT TAGCTCGTACGCTGCAGGTCGAC RFA1 GFP/YFP/mRuby tagging R TCTCATATGTTACATAGATTAAATAGTACTTGATTATTTGA TACAATCGATGAATTCGAGCTCG RFA1 mRuby tagging F GAAGCCGACTATCTTGCCGATGAGTTATCCAAGGCTTTGT TAGCTGGTGACGGTGCTGGTTTA RFA1 tag test F ACACAGCTTGAATTACAGGGCTGAAG RAD52 RAD52 GFP tagging F GTTGGAAGACCAAAGATCAATCCCCTGCATGCACGCAAG CCTACTCGTACGCTGCAGGTCGAC RAD52 GFP/mRuby tagging R TAAATAATGATGCAAATTTTTTATTTGTTTCGGCCAGGAA GCGTTATCGATGAATTCGAGCTCG RAD52 mRuby tagging F GAGAAGTTGGAAGACCAAAGATCAATCCCCTGCATGCAC GCAAGCCTACTGGTGACGGTGCTGGTTTA RAD52 tag test F GCTCAAACCCAGAGGCAGA REV1 REV1 4×GFP/9myc tagging F ATAAACATACTTACCAGACTGTGCGTAAACTTGACATGG ACTTTGAAGTTCGTACGCTGCAGGTCGAC REV1 4×GFP/9myc/knockout tagging R TTCGCAAACTGCGTGTTTACTGTATGCTGAAATGTTTTTTT TTTTTTAATATCGATGAATTCGAGCTCG REV1 knockout F ACAGATTTTCTCAAAATAAATCGATACTGCATTTCTAGGC ATATCCAGCGCGTACGCTGCAGGTCGAC REV1 9myc tag test F GGAGGGCCGCATGAAAAAGAT REV1 4×GFP tag test R ACGCCTAGACGACTGGGG REV1 knockout test F CCAATCTGTAAGCCAGATTAAA REV3 REV3 knockout F ATTTGAGTCAATACAAAACTACAAGTTGTGGCGAAATAA AATGTTTGGAACGTACGCTGCAGGTCGAC REV3 knockout R ATAGAAACAAATAACTACTCATCATTTTGCGAGACATATC TGTGTCTAGAATCGATGAATTCGAGCTCG REV3 knockout test F CTTTGTTCCATTCCACTCAAAT RAD30 RAD30 knockout F TAGCGCAGGCCTGCTCATTTTTGAACGGCTTTGATAAAAC AAGACAAAGCCGTACGCTGCAGGTCGAC RAD30 knockout R ATCAGGACGTTTTAGTTGCTGAAGCCATATAATTGTCTAT TTGGAATAGGATCGATGAATTCGAGCTCG RAD30 knockout test F CGCTACCTAATCCTGCCGATCATAGG RAD18 RAD18 knockout F CAAGTGAGCATCACAGCTACTAAGAAAAGGCCATTTTTA CTACTCCGTACGCTGCAGGTCGAC RAD18 knockout R AAATGTGCACAAGCTAACAAACAGGCCTGATTACATATA CACACCATCGATGAATTCGAGCTCG RAD18 knockout test F GGGCTGGAGTTATCATATCACATAG UBC13 UBC13 knockout F CCAATATTAGCAAATAAGGTCAGGTTCATTGTAACATAGT TAGAACGTACGCTGCAGGTCGAC UBC13 knockout R GATATATATTTATATATTCAGTTGAGAAAACTTATACAGA AATGAATCGATGAATTCGAGCTCG UBC13 knockout test F GGGCATCTAACAGGAATTTG RAD5 RAD5 knockout F TCAAAAGGCCTTAGAAACACACCTAAAGTCTTACAGTATC ACAATCGTACGCTGCAGGTCGAC RAD5 knockout R AAAATAATAATAAATAAAGTCTTTATATATGAGTATGTGG TATGAATCGATGAATTCGAGCTCG RAD5 knockout test GCAGAAGAGCAAGGCTTTGTAA EXO1 EXO1 knockout F ACCACATTAAAATAAAAGGAGCTCGAAAAAACTGAAAGG CGTAGAAAGGACGTACGCTGCAGGTCGAC EXO1 knockout R TTTTCATTTGAAAAATATACCTCCGATATGAAACGTGCAG TACTTAACTTATCGATGAATTCGAGCTCG EXO1 knockout test F ACGCGTCTTTAGCAAAGGCG RAD54 RAD54 knockout F CAGAACTTAGCTCTATTTCAAGGTACCATATATATTTCCTT ATAACTGATGCGTACGCTGCAGGTCGAC RAD54 knockout R CGAATTCTACTTTTTGTTTTTGTTTTATAAGTACATGTATG TAAGAGATCAATCGATGAATTCGAGCTCG RAD54 knockout test F GATCTAACTGAAGCGAAGG NUP133 NUP133 knockout F ATGAGTGAAAAAAAAGTACATCTTCGTTTGCGGAAGGAA CTTAGCGTACCCGTACGCTGCAGGTCGAC NUP133 knockout R GTATTCTACAGTGTTGGTTTCATAGTTGATGGTATAGTTT TTTTCTTTCGATCGATGAATTCGAGCTCG NUP133 knockout test ATCGATATACCAAATCACTTTCCAA PIF1 PIF1 knockout F TGTAATATTATCCATTGAGCGATTAGCTTACTTGTATCAAT CAATTTTACCGTACGCTGCAGGTCGAC PIF1 knockout R GATTATTATAGCAGTTTGTATTCTATATAACTATATGTATT AATATGTACATCGATGAATTCGAGCTCG PIF1 knockout test F GGACGCTTCAAATGCCTT MRE11 MRE11 AID*-9myc tagging F GGACGCCAAAGACGGATATTCTTGGAAGTCTCCTTGCTA AGAAAAGAAAACGTACGCTGCAGGTCGAC MRE11 AID*-9myc tagging R AAGCCCTTGGTTATAAATAGGATATAATATAATATAGGG ATCAAGTACAAATCGATGAATTCGAGCTCG MRE11 tag test F TACTGACGAAGAGGACGCTAGTTAT CMR1 CMR1 GFP tagging F AAAAAGCTGCCAAGATTGGTGGGTTATTAAAACCTTCCG AACTTGATGATCGTACGCTGCAGGTCGAC CMR1 GFP tagging R AATAAAAGGGAAAAAATATTGGAAATTTAAAGAATGATA CGCCACCGCCTATCGATGAATTCGAGCTCG CMR1 tag test F TGGTTTATGATAACAAGATTTCGGT MCM4 MCM4 4×GFP tagging F TTGTCCTTGGCGAGGGTGTAAGGAGATCAGTTCGCCTGA ATAACCGTGTCCGTACGCTGCAGGTCGAC MCM4 4×GFP tagging R TAATTAGTATTTATTAATTGTTACGCAGGGAATGATTGTA GTAGACAGCAATCGATGAATTCGAGCTCG MCM4 tag test R TGTTTTGAAATCTCGGCACCGAC Tagging- & knockout-specific primers N/A GFP/ YFP/ knockout test R (use with specific test F primers) AAGGAGGGTATTCTGGGCC N/A 4×GFP test F (use with specific test R primers) TGATTTTGATGACGAGCGTAAT N/A mRuby2 test R (use with specific test F primer) AGGATTACCTTCACCTTCCCC