Integration of omics and bioinformatics to identify new therapeutic targets for Acinetobacter baumannii. Virulence role of CarO in Acinetobacter baumannii infections
Abstract
Acinetobacter baumannii remains a significant and difficult-to-treat pathogen that causes a range of interactions with the human host from asymptomatic colonization and carriage in the skin, intestinal tract, and respiratory tract to invasive infection, such as nosocomial pneumonia or bacteraemia. Especially, this pathogen affects critically-ill and immunocompromised patients admitted to Intensive Care Units (ICUs), causing them severe infections, which are associated with long hospital stay and high mortality rates. The success of this bacterium is due to a combination of several factors, highlighting its extraordinary ability to develop antimicrobial resistance that results in the rapid nosocomial spread of strains resistant to almost all known antimicrobials, including including the last reservoirs of our antimicrobial arsenal such as the carbapenems, worldwide. Thus, in the recent global priority list of antimicrobial-resistant bacteria of the World Health Organization, carbapenem-resistant A. baumannii (CRAB) is considered as a “critical priority” for the development of new antimicrobials, due to the lack of therapeutic options. This situation has promoted the search of new therapeutic strategies to deal with multidrug-resistant (MDR) A. baumannii strains displaying additional carbapenem-resistance, and non-antimicrobial approaches aimed at bacterial virulence factors may represent a promising alternative. Nevertheless, our knowledge on A. baumannii pathogenesis and virulence traits is still relatively scarce. In this Doctoral Thesis, and in order to stop the evolution of A. baumannii infections, we aimed to study more deeply the pathogenesis of CRAB infections using omics and bioinformatics to ultimately discover new therapeutic targets for anti-A. baumannii drugs. Firstly, we studied MDR/CRAB isolates from tracheobronchial aspirate samples of ICU adult patients who suffered A. baumannii bacteraemic ventilator-associated pneumonia (VAP) or remained exclusively colonised by this pathogen. We analysed the in vitro and in vivo virulence of these isolates, in order to know if the invasive isolates exhibited higher virulence than the colonising ones, but no differences were found. Moreover, when the whole-genome sequencing (WGS) data of these isolates were analysed following different approaches, again we did not find any difference between both phenotypes regarding their clonal relationship, antimicrobial resistance mechanisms, or known virulence determinants. However, the invasive A. baumannii isolates exhibited higher levels of expression of the outer membrane protein (OMP) OmpA than the colonising ones, suggesting that those phenotypes depend on the regulation of already-known or still unknown virulence factors, instead of on the genomic content. Secondly, six bacteraemic MDR/CRAB clinical isolates obtained from six clinically homogeneous ICU adult patients with bacteraemia secondary to VAP, who were subjected to optimal colistin treatment but with radically different clinical outcomes, were comparatively analyzed by WGS complemented with proteomic and immunoblot techniques. These analyses indicated that the carO gene, encoding for the second most abundant β-barrel protein of the A. baumannii outer membrane (OM), CarO, was interrupted by different disruptive events in the isolates from patients who recovered from infection, while it was intact in the isolates from patients who did not survive. When the virulence role of A. baumannii CarO was analyzed in model systems, an isogenic mutant lacking carO (ATCC 17978 ΔcarO) showed lower ability in vitro to adhere and invade cultured human lung epithelial cells, and exhibited a higher minimum lethal dose and a lower dissemination potential into essential organs and fluids in a murine model of peritoneal sepsis. All of the above deficiencies were reverted in the ATCC 17978 ΔcarO mutant transformed with a carO expression plasmid restoring OM CarO levels. Thus, the results presented here reveal a previously unnoticed virulence role for the A. baumannii OMP CarO, which may be responsible of the poor clinical outcome and therefore a potential target for the development of novel anti-A. baumannii drugs.
Full text
PhD Thesis Integration of omics and bioinformatics to identify new therapeutic targets for Acinetobacter baumannii. Virulence role of CarO in Acinetobacter baumannii infections. Gema Labrador Herrera Doctoral Program of Molecular Biology, Biomedicine and Clinical Research Department of Medicine University of Seville Seville 2020 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
3 DOCTORAL THESIS Integration of omics and bioinformatics to identify new therapeutic targets for Acinetobacter baumannii. Virulence role of CarO in Acinetobacter baumannii infections. Gema Labrador Herrera Seville 2020 Doctoral Program of Molecular Biology, Biomedicine and Clinical Research Department of Medicine University of Seville Directors: Dr. Jerónimo Pachón Díaz Dr. María Eugenia Pachón Ibáñez Dr. Alberto Acedo Bécares Tutor: Dr. Jerónimo Pachón Díaz Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
5 Departamento de Medicina El Dr. Jerónimo Pachón Díaz, Profesor Emérito de Medicina de la Universidad de Sevilla e Investigador Responsable del Grupo de Enfermedades Infecciosas del Instituto de Biomedicina de Sevilla, como Director y Tutor de la Tesis Doctoral, la Dra. María Eugenia Pachón Ibáñez, Investigadora Posdoctoral perteneciente al programa “Nicolás Monardes” (C1-0038-2019), como Directora de la Tesis Doctoral, y el Dr. Alberto Acedo Bécares, Co-fundador y Director Ejecutivo de la empresa AC-Gen Reading Life, como Director de la Tesis Doctoral, CERTIFICAN: Que la Tesis para optar al grado de Doctor por la Universidad de Sevilla que lleva por título “Integration of omics and bioinformatics to identify new therapeutic targets for Acinetobacter baumannii. Virulence role of CarO in Acinetobacter baumannii infections.” ha sido realizada por la Licenciada Doña Gema Labrador Herrera bajo nuestra supervisión, considerando que reúne los requisitos necesarios para su presentación. Para que conste a los efectos oportunos, expiden la presente certificación en Sevilla, a 10 de abril de 2020. Jerónimo Pachón Díaz Director y Tutor María Eugenia Pachón Ibáñez Directora Alberto Acedo Bécares Director Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
7 DOCTORAL THESIS FUNDING This work was supported by the Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía, Industria y Competitividad (PI12/02553) and by Plan Nacional de I+D+i 2013-2016 and Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Economía, Industria y Competitividad, Spanish Network for Research in Infectious Diseases (REIPI RD12/0015/0001; RD12/0015/0012; RD16/0016/0009) - cofinanced by European Development Regional Fund “A way to achieve Europe”, Operative program Intelligent Growth 2014-2020. G.L.H. is supported by the program i-PFIS (Doctorados IIS-empresa en Ciencias y Tecnologías de la Salud; IFI15/00128), Ministerio de Economía y Competitividad, Instituto de Salud Carlos III, Spain. M.E.P.I. is a postdoctoral researcher belonging to the program “Nicolás Monardes” (C1-0038-2019), Servicio Andaluz de Salud, Junta de Andalucía, Spain. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
9 SCIENTIFIC PRODUCTION RESULTING FROM THE THESIS Publications 1. Labrador-Herrera G, Álvarez-Marín R, López-Rojas R, Smani Y, Cebrero- Cangueiro T, Rueda A, Pérez-Florido J, Pachón J, Pachón-Ibáñez ME. Draft genome sequences of seven multidrug-resistant Acinetobacter baumannii strains, isolated from respiratory samples in Spain. Genome Announc. 2016; 4 (2). DOI: 10.1128/genomeA.00083-16. 2. Labrador-Herrera G, Pérez-Pulido AJ, Álvarez-Marín R, Casimiro-Soriguer CS, Cebrero-Cangueiro T, Morán-Barrio J, Pachón J, Viale AM, Pachón-Ibáñez ME. Virulence role of the outer membrane protein CarO in carbapenem-resistant Acinetobacter baumannii. Submitted to Journal of Infection. Congress communications 1. (Oral presentation) Labrador-Herrera G, Álvarez-Marín R, López-Rojas R, Smani Y, Rueda A, P. Florido J, López FJ, Praena J, Pachón J, Pachón-Ibáñez ME, Pachón J. Estudio de los mecanismos de resistencia antimicrobiana mediante la secuenciación del genoma completo en cepas clínicas de Acinetobacter baumannii. XVI Congreso Sociedad Andaluza de Enfermedades Infecciosas. 11-13 December 2014; Almeria, Spain. 2. (Poster) Labrador-Herrera G; Álvarez-Marín R, López-Rojas R, Smani Y, Rueda A, Pérez-Florido J, López FJ, Praena, J, Pachón J, Pachón-Ibáñez ME. Study of the antimicrobial resistance mechanisms of Acinetobacter baumannii clinical isolates by whole-genome sequencing. 25th European Congress of Clinical Microbiology and Infectious Diseases. 25-28 April 2015; Copenhagen, Denmark. 3. (Oral presentation) Labrador-Herrera G, Pérez-Pulido A, Casimiro-Soriguer CS, Pulido-Fresneda M, Hermosín-Montes JM, Álvarez-Marín R, Smani Y, Pachón J, Pachón-Ibáñez ME. Integration of omics and bioinformatics tools to identify new Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
17 RESEARCH STAYS PERFORMED DURING THE DOCTORAL THESIS 1. Group of Protein and Immunological Systems Biology (PISB) at the Department of System Biology of the Technical University of Denmark. 3 months (28 April–28 July 2015); Lyngby, Denmark. 2. Bioinformatics Department of the private company AC-Gen Reading Life. 1 year (10th June 2019 – 10th June 2020); Valladolid, Spain. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 19 ABBREVIATIONS…………………………………………………………………....29 ABSTRACT……………………………………………………………………...….... 33 INTRODUCTION…………………………………………………………………….37 1. Clinical relevance of Acinetobacter baumannii………………………………….......39 1.1. Epidemiological situation and most frequent clinical manifestations of A. baumannii……………………………………………………………………39 1.1.1. Reservoirs, transmission mechanisms and epidemiological situation of Acinetobacter infections……………………………………………..39 1.1.2. Most frequent clinical manifestations……………………………44 1.1.2.1. Respiratory infections…………………………………..44 1.1.2.2. Bacteraemia…………………………………………….45 1.1.3. Differentiation between A. baumannii colonisation and infection………………………………………………………………...46 1.2. Prognosis of infections caused by A. baumannii……………………………47 1.2.1. Mortality and morbidity associated with pneumonia by A. baumannii. Prognostic factors…………………………………………..47 1.2.2. Mortality and morbidity associated with bacteraemia by A. baumannii. Prognostic factors………………………………………......48 1.3. Antimicrobial resistance: current epidemiological situation and resistance mechanisms of A. baumannii……………………………………………………49 1.3.1. Importance of carbapenem resistance in A. baumannii…………...53 1.3.2. Main mechanisms of resistance to carbapenems in A. baumannii............................................................................................53 2. A. baumannii virulence factors……………………………………………………….54 2.1. Outer membrane proteins (OMPs)……………………………………….…56 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 20 2.2. Capsular polysaccharides and lipopolysaccharides (LPS)………………….57 2.3. Phospholipase………………………………………………………………58 2.4. Biofilm formation………………………………………………………..…58 2.5. Quorum sensing (QS)………………………………………………………59 2.6. Metal acquisition systems…………………………………………………..59 2.7. Outer membrane vesicles…………………………………………………...60 2.8. Protein secretion systems…………………………………………………...60 3. Treatment of infections caused by A. baumannii……………………………………..61 3.1. Current treatment and drug options……………………………………...…61 3.1.1. Carbapenems……………………………………………………..61 3.1.2. Sulbactam………………………………………………………...62 3.1.3. Polymyxins……………………………………………………….62 3.1.4. Tetracyclines……………………………………………………..64 3.1.5. Tigecycline……………………………………………………….64 3.1.6. Combined therapy………………………………………………..65 3.2. Novel and future treatment options…………………………………………66 3.2.1. New antibiotics…………………………………………………...66 3.2.2. Anti-virulence drugs…………………………………………...…68 3.2.2.1. Inhibition of OMPs……………………………………..69 3.2.2.2. Inhibition of LPS synthesis………………………..……69 3.2.2.3. Inhibition of biofilm formation…………………………70 3.2.2.4. Inhibition of QS………………………………………...70 3.2.2.5. Iron chelation…………………………………………...71 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 21 3.2.3. Repurposing drugs………………………………………………..71 3.2.4. Antimicrobial peptides…………………………………………...72 3.2.5. Phage therapy…………………………………………………….73 3.2.6. Photodynamic therapy……………………………………………73 3.2.7. Immunotherapy…………………………………………………..74 4. Omics techniques used to identify novel drug targets………………………………...74 FUNDAMENTS…………………………………………………………………….....77 HYPOTHESES………………………………………………………………………..81 OBJECTIVES……………………………………………………………………...….85 MATERIALS AND METHODS……………………………………………..………89 Chapter I. Study of the mechanisms involved in the pathogenesis of colonising and bacteraemic ventilator-associated pneumonia (VAP) producing A. baumannii clinical isolates…………………………………………………………………………91 Objective 1. To select colonising and invasive isolates according to specific criteria………………………………………………………………………………….91 1.1. Patient cohort……………………………………………………………….91 1.2. Selection criteria for colonising and invasive isolates………………………93 Objective 2. To evaluate the clonal relationship and in vitro virulence of colonising and invasive isolates. Selection of isolates for further studies………………………93 2.1. Pulsed-field gel electrophoresis (PFGE) typing…………………………….93 2.2. In vitro virulence study……………………………………………………..95 2.2.1. Human lung epithelial cell cultures………………………………95 2.2.2. Cell viability assay………………………………………………..95 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 22 Objective 3. To study the in vivo virulence and antimicrobial susceptibility patterns of colonising and invasive isolates…………………………………………………….96 3.1. In vivo virulence study……………………………………………………...96 3.1.1. Animals………………………………………………………….. 97 3.1.2. Experimental murine model of peritoneal sepsis: determination of lethal doses (LD) LD0, LD50, and LD100…................................................97 3.2. Determination of the minimum inhibitory concentration (MIC) of different antimicrobials…………………………………………………………………...97 Objective 4. To perform whole-genome sequencing (WGS) and data analysis (multilocus sequence typing (MLST), antimicrobial resistance and virulence determinants) of the colonising and invasive isolates………………………………..99 4.1. DNA extraction, WGS and data processing (read preprocessing, assembly, contig filtering, protein-coding gene prediction and annotation)……………….99 4.2. MLST typing……………………………………………………………...100 4.3. Identification of antimicrobial resistance mechanisms……………………100 4.4. Identification of virulence factors…………………………………………101 Objective 5. To find new mechanisms of infection by comparing colonising and invasive isolates……………………………………………………………………… 101 5.1. Comparative genomic study………………………………………………101 5.2. Determination of ompA expression levels by quantitative reversetranscription polymerase chain reaction (qRT-PCR)…………………………..102 Statistical analyses of Chapter I…………………………………………………..…103 Chapter II. Identification of potential A. baumannii virulence factors of bacteraemic A. baumannii isolates recovered from clinically homogeneous adult patients with radically different clinical outcomes……………………………………………..….104 Objective 1. To select bacteraemic isolates according to specific criteria…………104 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 23 1.1. Selection criteria…………………………………………………………..104 Objective 2. To study the clonal relationship and antimicrobial susceptibility patterns in the bacteraemic A. baumannii isolates………………………………….104 2.1. PFGE typing………………………………………………………………104 2.2. Determination of the MIC of different antimicrobials…………………….104 Objective 3. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the bacteraemic A. baumannii isolates…………..105 3.1. DNA extraction, WGS and data processing (read preprocessing, assembly, contig filtering, protein-coding gene prediction and annotation)………………105 3.2. MLST typing……………………………………………………..……….105 3.3. Identification of antimicrobial resistance mechanisms……………………105 3.4. Identification of virulence factors…………………………………………106 Objective 4. To find new bacterial virulence mechanisms that may be influencing patient mortality: genomic, transcriptomic, and proteomic approaches……….....106 4.1. Comparative genomic study between isolates from non-surviving patients and isolates from surviving patients………………………………………….…….106 4.1.1. Differential protein-coding genes analyses……………………...106 4.1.2. CarO sequence alignments and analysis………………………...107 4.2. Comparative study of ompA expression levels between isolates from nonsurviving patients and isolates from surviving patients by qRT-PCR…………107 4.3. Comparative proteomic studies between isolates from non-surviving patients and isolates from surviving patients…………………………………………...107 4.3.1. OMP profiles and immunoblot analyses………………………...107 4.3.2. Tandem mass tags-6 plex………………………………………..108 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 24 Objective 5. To analyse the virulence role of CarO in A. baumannii using model systems………………………………………………………………………………..109 5.1. Laboratory bacterial strains, growth conditions, and antibiotics…………..109 5.2. OMPs profiles and immunoblot analyses…………………………………110 5.3. Growth curves: separately and in competition…………………………….110 5.4. In vitro virulence study……………………………………………………111 5.4.1. Human lung epithelial cells cultures and infection………………111 5.4.2. Bacterial adherence and invasion of cultured human lung epithelial cells……………………………………………………………………111 5.5. In vivo virulence studies…………………………………………………..111 5.5.1. Animals and experimental murine model of peritoneal sepsis…..111 5.5.2. Determination of minimal lethal doses (MLD) and survival analysis………………………………………………………………...112 5.5.3. In vivo dissemination……………………………………………112 Statistical analyses of Chapter II……………………………………………………112 RESULTS………………………………………………………………………….…115 Chapter I. Study of the mechanisms involved in the pathogenesis of colonising and bacteraemic VAP producing A. baumannii clinical isolates………………………..117 Objective 1. To select colonising and invasive isolates according to specific criteria………………………………………………………………………….……..117 Objective 2. To evaluate the clonal relationship and in vitro virulence of colonising and invasive isolates. Selection of isolates for further studies……………………...118 2.1. Molecular typing of the isolates by PFGE. Selection of "true" bacteraemic VAP-producing isolates……………………………………………………….118 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
CONTENTS 25 2.2. In vitro virulence of the colonising and invasive isolates. Selection of the colonising and invasive isolates with the lowest and highest in vitro virulence, respectively……………………………………………………………………121 Objective 3. To study the in vivo virulence and antimicrobial susceptibility patterns of colonising and invasive isolates………………………………………………..….123 3.1. In vivo virulence of the colonising and invasive isolates…………………..123 3.2. Antimicrobial susceptibility profiles of the colonising and invasive isolates………………………………………………………………………...125 Objective 4. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the colonising and invasive isolates…………….…127 4.1. WGS data processing………………………………….…………………..127 4.2. Molecular typing of the isolates by MLST………………………………..128 4.3. Antimicrobial resistance mechanisms………………………………….....130 4.4. Virulence factors………………………………………………………….133 Objective 5. To find new mechanisms of infection by comparing colonising and invasive isolates……………………………………………………………...……….138 5.1. Comparative genomic study between colonising and invasive isolates...…138 5.2. Comparative study of ompA expression levels between colonising and invasive isolates……………………………………………………………….138 Chapter II. Identification of potential A. baumannii virulence factors of bacteraemic A. baumannii isolates recovered from clinically homogeneous adult patients with radically different clinical outcomes………………………………………...………140 Objective 1. To select bacteraemic isolates according to specific criteria…………140 Objective 2. To study the clonal relationship and antimicrobial susceptibility patterns in the selected bacteraemic A. baumannii isolates……………..........…….142 2.1. Molecular typing of the isolates by PFGE…………………………………142 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
33 ABSTRACT Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ABSTRACT 35 Acinetobacter baumannii remains a significant and difficult-to-treat pathogen that causes a range of interactions with the human host from asymptomatic colonization and carriage in the skin, intestinal tract, and respiratory tract to invasive infection, such as nosocomial pneumonia or bacteraemia. Especially, this pathogen affects critically-ill and immunocompromised patients admitted to Intensive Care Units (ICUs), causing them severe infections, which are associated with long hospital stay and high mortality rates. The success of this bacterium is due to a combination of several factors, highlighting its extraordinary ability to develop antimicrobial resistance that results in the rapid nosocomial spread of strains resistant to almost all known antimicrobials, including including the last reservoirs of our antimicrobial arsenal such as the carbapenems, worldwide. Thus, in the recent global priority list of antimicrobial-resistant bacteria of the World Health Organization, carbapenem-resistant A. baumannii (CRAB) is considered as a “critical priority” for the development of new antimicrobials, due to the lack of therapeutic options. This situation has promoted the search of new therapeutic strategies to deal with multidrug-resistant (MDR) A. baumannii strains displaying additional carbapenem-resistance, and non-antimicrobial approaches aimed at bacterial virulence factors may represent a promising alternative. Nevertheless, our knowledge on A. baumannii pathogenesis and virulence traits is still relatively scarce. In this Doctoral Thesis, and in order to stop the evolution of A. baumannii infections, we aimed to study more deeply the pathogenesis of CRAB infections using omics and bioinformatics to ultimately discover new therapeutic targets for anti-A. baumannii drugs. Firstly, we studied MDR/CRAB isolates from tracheobronchial aspirate samples of ICU adult patients who suffered A. baumannii bacteraemic ventilator-associated pneumonia (VAP) or remained exclusively colonised by this pathogen. We analysed the in vitro and in vivo virulence of these isolates, in order to know if the invasive isolates exhibited higher virulence than the colonising ones, but no differences were found. Moreover, when the whole-genome sequencing (WGS) data of these isolates were analysed following different approaches, again we did not find any difference between both phenotypes regarding their clonal relationship, antimicrobial resistance mechanisms, or known virulence determinants. However, the invasive A. baumannii isolates exhibited higher levels of expression of the outer membrane protein (OMP) OmpA than the colonising ones, suggesting that those phenotypes depend on the regulation of already-known or still unknown virulence factors, instead of on the genomic content. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ABSTRACT 36 Secondly, six bacteraemic MDR/CRAB clinical isolates obtained from six clinically homogeneous ICU adult patients with bacteraemia secondary to VAP, who were subjected to optimal colistin treatment but with radically different clinical outcomes, were comparatively analyzed by WGS complemented with proteomic and immunoblot techniques. These analyses indicated that the carO gene, encoding for the second most abundant β-barrel protein of the A. baumannii outer membrane (OM), CarO, was interrupted by different disruptive events in the isolates from patients who recovered from infection, while it was intact in the isolates from patients who did not survive. When the virulence role of A. baumannii CarO was analyzed in model systems, an isogenic mutant lacking carO (ATCC 17978 ΔcarO) showed lower ability in vitro to adhere and invade cultured human lung epithelial cells, and exhibited a higher minimum lethal dose and a lower dissemination potential into essential organs and fluids in a murine model of peritoneal sepsis. All of the above deficiencies were reverted in the ATCC 17978 ΔcarO mutant transformed with a carO expression plasmid restoring OM CarO levels. Thus, the results presented here reveal a previously unnoticed virulence role for the A. baumannii OMP CarO, which may be responsible of the poor clinical outcome and therefore a potential target for the development of novel anti-A. baumannii drugs. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
37 INTRODUCTION Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 39 1. Clinical relevance of Acinetobacter baumannii. 1.1. Epidemiological situation and most frequent clinical manifestations of A. baumannii. 1.1.1. Reservoirs, transmission mechanisms and epidemiological situation of Acinetobacter infections. Acinetobacter spp. are ubiquitous in nature and can be found in different wet environments, such as moist soil/mud, wetlands, ponds, water treatment plants, fish farms, dump sites, and even seawater, but also on vegetables, animals, and humans (2-4). Nonetheless, despite non-baumannii Acinetobacter spp. have predominated in surveillance studies of skin colonisation, particularly among healthy individuals, morepathogenic species, such as A. baumannii, has rarely been identified as a coloniser of skin among healthy patients (5, 6). Acinetobacter was initially considered a commensal opportunist, but the increasing utilization of complex intensive care since the 1960s (associated with an increasing ubiquity and intensity of mechanical ventilation, central venous and urinary catheterization, and antimicrobial therapy) has caused a surge in the frequency and severity of Acinetobacter infections (7, 8). Today, Acinetobacter infections have spread rapidly through hospitals across the globe, occurring the highest density of infections in intensive care units (ICUs). In the European Centre for Disease Prevention and Control (ECDC) point prevalence survey of healthcare-acquired infections (HAIs) and antimicrobial use in European acute care hospitals in the period 2011-2012, Acinetobacter spp. were the 11th most frequently isolated microorganisms (3.6%) in microbiologically documented HAIs, and more specifically, the 5th in pneumonia/lower respiratory tract infections, the 8th in bloodstream infections, the 9th in urinary tract infections, and the 11th in surgical site infections (9). These frequencies are similar in ICUs from United States (USA) (10), but in Asian and certain Latin American countries, Acinetobacter is one of the three most common causes of bacteraemia and nosocomial pneumonia (11-13). Thus, Spellberg et al. estimated that 1 million (range, 600,000 to 1,400,000) cases of Acinetobacter infections occur annually worldwide, according to published frequencies of HAIs (14). Among Acinetobacter spp., A. baumannii is the most important pathogen associated with HAIs (15). In fact, most A. baumannii infections occur in critically ill patients and account Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 40 for up to 20% of infections in ICUs worldwide (16). A. baumannii is characterized by its great persistence in the environment, being able to survive for long periods on dry surfaces, its high tolerance to stressful or unfavourable situations, its relatively high virulence, and its extraordinary capability to develop resistance to antibiotics, as well as to disinfectants and biocides (7, 17, 18). These characteristics are closely related to its epidemiology and facilitate, within the nosocomial context, its localization in all types of medical and surgical material, furniture, surfaces and even in air near to carrier patients (19-22). The human being can also be a reservoir of A. baumannii. The oropharyngeal cavity and the respiratory tract of patients with mechanical ventilation are the locations where most frequently is isolated, followed by the gastrointestinal tract, which is considered a persistent reservoir of multidrug-resistant (MDR) strains (23-25). The main transmission mechanism of A. baumannii inside the hospital are health care personnel hands, which become contaminated after coming into contact with a carrier patient or with contaminated surfaces or fomites (26, 27). Outbreaks have also been reported from direct contact with medical procedures or instruments, such as unduly decontaminated respiratory support material (28, 29). The occurrence and dissemination of A. baumannii poses major medical and organizational burdens to healthcare facilities since infections caused by A. baumannii are difficult to treat, and because eradication of this pathogen from the hospital environment and prevention of further spreading might require solid targeted measures, such as the isolation of patients and temporary closure of wards (30, 31). Moreover, the continuous appearance of nosocomial outbreaks worldwide stands out, as well as the presence of endemic patterns in some hospital centres, making control and eradication even more difficult and favouring the emergence of extensively drug-resistant (XDR) isolates or even pandrug-resistant (PDR) ones (26, 32-34). In fact, our hospital (University Hospital Virgen del Rocío, Seville, Spain), experienced a two decades-long hyperendemic situation with A. baumannii, with an outbreak of PDR A. baumannii in 2002 (35) and a second outbreak of XDR A. baumannii resistant to colistin in the adult ICU in 2012 (36). Despite several interventions along this long period, only a multicomponent intervention program, performed from January 2009 to August 2017 by a multidisciplinary team, were effective in controlling XDR A. baumannii outbreak and eradicating the endemic MDR A. baumannii in our hospital (36). This effective and necessary multifaceted program included the following measures: environmental Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 41 decontamination, hand hygiene instruction and surveillance, antimicrobial stewardship program, isolation and contact precautions, active surveillance for MDR A. baumannii colonisation, weekly report, and regular meetings with the staff of the affected areas. Outbreaks characteristics vary depending on the conditions of the hospital (if there are one or multiple sources), and on the particularities of the strain, since some strains have greater tendency to spread in an endemic form than others (30). Moreover, very alike strains not epidemiologically related have been isolated from different places at different times. These clones are generally MDR, genetically stable and with high capacity to survive in hospital settings. The local, national, and international spread of these clones is facilitated by the increase of international travels, including the transfer of patients between hospitals and countries (37). Comparative typing of A. baumannii outbreak strains from geographically distributed European hospitals demonstrated the occurrence of three successful clones, originally named “European clones I–III” (38, 39). These clones have subsequently been identified worldwide and accordingly re-named as “international clones (IC) I–III” (40). In addition to these major clones, a wide geographic distribution of other clones has been reported (41, 42). The emergence of such highly successful clones seems to play a leading role in the increasing global occurrence of infections by this pathogen (40). Particularly, the international clone clonal complex (CC) 92 (Bartual/Oxford scheme (43)/CC2 (Pasteur scheme (40)) (44, 45) is by far the largest and most widely distributed one (Figure 1A), showing a broad international distribution among 34 countries (Italy, Spain, Germany, United Kingdom (UK), Greece, Netherlands, Denmark, Czech Republic, France, Poland, Turkey, Norway, Sweden, Portugal, Ireland, Belgium, Romania, Japan, China, Korea, Thailand, India, Malaysia, Philippines, Taiwan, Singapore, Vietnam, Lebanon, Brazil, South Africa, Reunion, Tahiti, New Caledonia, USA, and Australia) (Figure 1C) (46). CC92/CC2 extensively includes outbreak and MDR isolates (47). In these isolates, carbapenem resistance is mainly mediated by βlactamases encoded by blaOXA-51-like, blaOXA-23-like, blaOXA-24/40-like, and/or blaOXA-58-like genes (Figures 1D-E). Additionally, the clone included several isolates producing the 16S rRNA methylase ArmA (Figure 1F), as well as one isolate resistant to colistin (48). The intra-clonal diversity of phenotypic and genotypic resistance characteristics among isolates of CC92/CC2 could be due to the scattered occurrence of this clone worldwide, resulting in access to a wide range of varied pools of transmissible resistance elements (49). CC92/CC2 is closely linked with international clone II (Figure 1B) and the OXA- Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 48 The clinical relevance of colonisation, at least when it occurs in airways, is still unknown, but needs to be elucidated. In this context, it is worth noting a retrospective case-control study performed by Gkrania-Klotsas et al., which compared all patients colonised or infected with MDR A. baumannii with all patients colonised or infected with MDR Pseudomonas aeruginosa in the same year (96). They observed a significantly higher mortality in the A. baumannii group, even after adjusting for stay in an ICU (P = 0.0002), concluding that colonisation or infection by MDR A. baumannii may be an independent risk factor for increased mortality. Multiple risk factors for mortality of nosocomial pneumonia due to A. baumannii have been identified: underlying chronic diseases, clinical severity of the pneumonia or baseline situation measured with different scores, inappropriate empirical treatment or use of antimicrobials in the previous 28 days, are the most important (86, 97, 98). Carbapenem resistance has been linked to mortality in some studies, such as that of Zheng et al. (86), in which patients with nosocomial pneumonia caused by carbapenem-resistant A. baumannii (CRAB) had a higher mortality than those with pneumonia by carbapenemsusceptible A. baumannii (45.6% vs. 29.9%, P = 0.02). However, in this case, the resistance of the causal strain was not selected as a risk factor for mortality in the multivariate analysis, while the inappropriate treatment did; suggesting that the difficulty in establishing an adequate treatment is what increases the mortality of CRAB infections. 1.2.2. Mortality and morbidity associated with bacteraemia caused by A. baumannii. Prognostic factors. Crude mortality rates in patients with A. baumannii bacteraemia are high, and varied between 30-76%, according to the case series and the distribution of risk factors (99, 100). Moreover, the prognosis of A. baumannii bacteraemia is worse compared to bacteraemia by other genospecies of the genus Acinetobacter. In this regard, Lee et al. detected a 30- day crude mortality of 29.7% for bacteraemia by A. baumannii, with an OR = 2.23 (95% CI = 1.053-4.821) with respect to the mortality of bacteraemia by other Acinetobacter species (101). Nonetheless, it has been difficult to distinguish between attributable mortality and that attributed to the underlying illnesses and comorbid conditions of patients. On the one Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 49 hand, in a retrospective case-control study carried out by Blot et al., no significant differences in mortality were found (102). Similarly, in a case control study, Jang et al. reported that the underlying illnesses seemed to play a more pivotal role than the infection itself as a cause of death (103). On the other hand, in another retrospective study comparing patients with A. baumannii bacteraemia with controls without bacteraemia, an attributable mortality of 36.5% was reported (104). Furthermore, in a recent study performed by Ballouz et al., the crude mortality rate was 63.5% and a 70.3% of the deaths were attributed to the bacteraemia, showing the significant impact of the bacteraemia on patients' outcome (105). In addition, in a prospective cohort study performed by our group, patients with bacteraemic VAP had a tendency to higher mortality than VAP patients without bacteraemia (42.9% vs. 20.9%, P = 0.1) (106). Multiple risk factors associated with mortality in patients with A. baumannii bacteraemia have been identified, including factors similar to those previously mentioned: serious underlying disease (Charlson index > 3, malignant neoplasm or other diseases such as chronic obstructive pulmonary disease or cerebrovascular disease) with a high degree of dependence, low levels of serum albumin, admission to ICU prior to bacteraemia, previous surgery or solid organ transplant at the same admission, mechanical ventilation, severe sepsis, elevated acute physiology and chronic health evaluation II (APACHE II), prior antibiotic exposure, inappropriate definitive treatment, and drug resistance, specially to carbapenems (101, 105, 107, 108). A study that specifically analysed patients with CRAB bacteraemia showed a 30-day mortality of 48%, being the severity of the baseline disease and the presence of immunosuppression the only predictors of mortality (109). In addition, Chopra et al. evaluated the sulbactam susceptibility (110) showing its importance, as the mortality for bacteraemia by carbapenem and sulbactam-resistant A. baumannii was 43%, while it was 20% for those by A. baumannii susceptible to any of these antibiotics. 1.3. Antimicrobial resistance: current epidemiological situation and resistance mechanisms. A. baumannii exhibits a wide variety of resistance mechanisms to antimicrobial agents, with strains highly resistant to most clinically available antibiotics (15). Some European countries reported that more than half of Acinetobacter spp. isolates were resistant to all Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 50 antimicrobial categories under surveillance (carbapenems, fluoroquinolones and aminoglycosides) (9). This phenomenon has increasingly become a matter of great concern for stakeholders and the scientific community worldwide. Consequently, Tacconelli et al. in 2017 published a list of antibiotic-resistant “priority pathogens”, which includes the 12 families of bacteria that pose the greatest threat to human health and for which development of new antibiotics is urgently needed. In this list, CRAB is considered as “priority 1” (critical) (111). A. baumannii presents innate resistance mechanisms against multiple antimicrobials (including glycopeptides, lincosamides, macrolides, and streptogramins) on its core genome, but additionally, strains can easily accumulate new resistance mechanisms through chromosomal mutations and acquisition of resistance genes via horizontal transfer (112). Almost all antimicrobial resistance mechanisms so far described have been found in A. baumannii, such as drug-inactivating enzymes (β-lactamases, aminoglycoside-modifying enzymes (AMEs)…), modification of target sites (topoisomerase IV/DNA gyrase (parC/gyrA), ArmA, penicillin-binding proteins (PBPs), lipopolysaccharide (LPS)…), permeability defects (CarO, 33-36 kDa protein…), or active efflux pumps (AdeABC, TetB…) (Table 1) (15, 113, 114). Frequently, genes that confer resistance to antimicrobials are clustered together within an antibiotic-resistance island, which accumulates in specific genetic regions of the large accessory genome (115). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 51 Antimicrobial mechanism of action Antimicrobial category/agent Main resistance mechanisms Examples Inhibition of bacterial cell wall synthesis β-lactams Inactivating enzymes β-lactamases: - Chromosomal cephalosporinase (AmpC) - Narrow spectrum: TEM, SHV - Extended spectrum: TEM, SHV, CTX-M, PER, VEB - Carbapenemases: * Class A: KPC * Class B: IMP, VIM, NDM * Class D: OXA-23-like, -24/40- like, -51-like, -58-like, -143-like, - 235-like Target modification Low affinity PBPs (mutations in PBP1, 2, or 3, or replacement) Decreased outer membrane permeability Decreased expression of OMPs CarO, 33–36 kDa protein, OprD-like protein Overexpression of efflux pumps AdeABC β-lactamase inhibitor with additional antibacterial activity Sulbactam Inactivating enzymes Multiple copies of blaTEM-1D ISAba1 upstream ampC Target modification Low affinity PBPs (mutations in PBP1 and PBP3) Overexpression of efflux pumps AdeABC Disruption of the outer membrane and alteration of the cytoplasmic membrane Polymyxins (colistin) Target modification Plasmid-mediated mcr genes (LPS modification) Mutations in the PmrA/B twocomponent system (LPS modification) Table 1. Major resistance mechanisms found in A. baumannii (table modified from (1)). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 52 Mutations in LPS biosynthesis genes lpxA, lpxC, lpxD (LPS loss) Porin loss OmpW Inhibition of protein synthesis Aminoglycosides Inactivating enzymes AMEs (AAC, ANT, APH) Target modification Ribosomal methylation by ArmA Overexpression of efflux pumps AdeABC, AdeM Tetracyclines Inactivating enzyme TetX Target protection TetM Efflux pumps Multidrug: AdeABC (overexpression); drug specific: TetA, TetB Glycylcyclines Overexpression of efflux pumps AdeABC Alteration of nucleic acid structure or metabolism Quinolones Target modification Mutations in quinolone resistance determining regions of gyrA and parC Target protection Plasmid-mediated Qnr proteins (QnrA, QnrB, QnrS) Overexpression of efflux pumps Class RND: AdeABC, AdeIJK and AdeFGH; class MATE: AbeM; class SMR: AbeS Rifampicin Inactivating enzyme Arr-2 Target modification Mutations in conserved regions of rpoB Modification of antibiotic permeability and overexpression of efflux pumps Not defined Blocking synthesis and utilization of metabolic factors Sulfonamides Target modification Alternative drug-resistant variants of the target enzyme (Sul1, Sul2, Sul3) Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 53 PBP: penicillin-binding protein; OMP: outer membrane protein; LPS: lipopolysaccharide; AME: aminoglycoside-modifying enzyme; RND: resistance nodulation cell division; MATE: multidrug and toxic compound extrusion; SMR: small multidrug resistance. 1.3.1. Importance of carbapenem resistance in A. baumannii. Carbapenems have been considered the treatment of choice for infections caused by MDR A. baumannii. However, an increasing number of A. baumannii isolates have developed carbapenem resistance in recent years, which has being strongly associated with prior use of carbapenems. A worldwide collection of 5127 Acinetobacter spp. collected between 2005 and 2009 from 140 hospitals in 32 countries in North America (17.1%), Europe (22.9%), Latin America (25.2%) and the Asia-Pacific region (34.8%), showed the overall nonsusceptibility rate to imipenem and meropenem to be 45.9 and 48.2%, respectively. However, the nonsusceptibility percentages had increased from 27.8 and 37.5% (for imipenem and meropenem, respectively) to 62.4 and 64.4%, when compared 2005 results with those from 2009 (116). Moreover, six countries (Belgium, Italy, Malta, Portugal, Slovakia and Spain) that collected during 2009 detailed resistance data from microorganisms associated with ICU-acquired infections reported CRAB isolates to be up to 80% (117). And, more recently, a study derived from the Magic Bullet clinical trial described that 97% of the A. baumannii isolates collected from patients from 15 hospitals in Greece, Italy and Spain during 2012-2015 were resistant to imipenem, and these were always associated with an acquired carbapenemase, OXA-23 (80%), OXA-24/40 (4.6%), OXA-58 (1.5%) or OXA-23/58 (1.5%) (118). 1.3.2. Main mechanisms of resistance to carbapenems in A. baumannii. Carbapenem resistance mechanisms often work synergistically, including the production of antimicrobial-degrading enzymes, efflux pumps, and porin mutations (112). The most prevalent mechanism of carbapenem resistance in A. baumannii is enzymatic degradation by carbapenemases, mainly carbapenem-hydrolyzing class D β-lactamases (CHDLs), also named as OXA-type enzymes, and to a lesser content class B β-lactamases, also named as metallo-β-lactamases (MBLs) (119), and the class A β-lactamase KPC (120). More specifically, acquired OXA-type CHDLs of the OXA-23, OXA-24/40 and OXA- Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 54 58 subfamilies, and the intrinsic OXA-51-type are the most common among A. baumannii isolates (121). Furthermore, several insertion sequences (IS), mainly ISAba1 and ISAba 3, have been described to play a major role in the overexpression of these carbapenemaseencoding genes. Efflux pumps can extrude a variety of antimicrobial agents and compounds to the external environment, and therefore its overexpression can reduce the accumulation of antibiotics, being another efficient mechanism for carbapenem resistance (122). To date, the major efflux mechanism associated with carbapenem resistance in A. baumannii is the chromosomally encoded tripartite efflux pump, AdeABC (123-125). This pump is the first identified resistance-nodulation-cell division (RND)-type efflux pump and its overproduction confers resistance to aminoglycosides and decreased susceptibility to tetracycline, fluoroquinolones, chloramphenicol, erythromycin, trimethoprim and ethidium bromide, as well as to netilmicin and meropenem (126). A. baumannii intrinsically have a smaller number and size of porins compared with other GNB, contributing to the intrinsic outer membrane (OM) impermeability (112). Porins are outer membrane proteins (OMPs) able to form channels allowing the transport of molecules, including antimicrobials, across lipid bilayer membranes. Moreover, variations in the structure or regulation of porin expression can provide another mechanism to become resistant to carbapenems (127). To date, three porins have been implicated in carbapenem resistance when their expression is reduced: CarO, Omp 33-36 and OprD (127), although a more recent work suggests the OprD may in fact not be involved (128). The carbapenem-associated OMP, also called CarO (a 29 kDa protein), is the most characterized porin in A. baumannii in this aspect. The analysis of strains with high minimum inhibitory concentration (MIC) to imipenem (up to 16 mg/L) showed disruptions in the carO gene by various insertion elements and thus loss of expression (129, 130). Alteration of the expression of CarO in the OM reduces the penetration of imipenem into the cell, therefore contributing to drug resistance (131). However, given the absence of a meropenem binding site on CarO, meropenem resistance may be mediated by another porin-mediated pathway (131), as is Omp33-36 (a 33–36 kDa protein) (132). 2. A. baumannii virulence factors. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 55 Most infections and deaths associated with A. baumannii occur, as described before, in patients who are already seriously ill from another cause, have received antibiotic therapy and have acquired this bacterium in the hospital. These data contribute to the previous consideration of A. baumannii as a low-virulence pathogen in comparison with other GNB such as P. aeruginosa or K. pneumoniae (52, 94, 102). However, the number of studies reporting the importance of A. baumannii intrinsic virulence is increasing significantly (94, 133). The pathogenic capacity of A. baumannii consists of multiple virulence factors, necessary for this bacterium to colonise and then infect the host (134). Nevertheless, only a relatively low number of virulence factors have been identified compared to other GNB (1). This trend is changing, thanks to the availability of genomic, transcriptomic and proteomic techniques that help to identify virulence factors that participate in A. baumannii pathogenesis (7, 113). Furthermore, the increasing antimicrobial resistance rates together with the lack of treatments options to combat infections, make necessary identify new virulence factors to characterize the pathogenesis and determine new therapeutic targets that allow the control and/or prevent these kinds of infections. The major virulence factors identified in A. baumannii are illustrated in Figure 2 and the functional aspects of these factors are described below. Figure 2. Main virulence factors involved in A. baumannii (135). Outer membrane protein / porin Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 56 2.1. OMPs. A. baumannii, like other GNB, contain a double membrane (OM and inner membrane) which serves as protection and provide nutrients for viability. The OM, besides being the first line of contact between the bacteria and its external environment, it acts as a protection mechanism against the entry of many toxic molecules into the cell (including many antibiotics) and allows the entry of nutrients required for cell survival (136). The OM has a unique composition and asymmetrical distribution of lipids, with the inner leaflet containing phospholipids, whereas the outer leaflet is composed of LPS (137). This membrane is also mainly composed of proteins, called OMPs, which have essential functions for the cell, including nutrient uptake, cell adhesion, cell signaling and waste export (138). The OMPs of Gram-negative bacteria are structured in the OM in a closed toroidal structure formed by antiparallel β-barrel sheets spanning the lipid bilayer in which the first strand is connected to the last by hydrogen bonding. The number of transmembrane β-strands range from 8 to 24 depending on the OMP, and are connected by exposed loops of a length that also depends on the OMP and the species considered. In the case of pathogenic strains, many of these OMPs are involved in antimicrobial resistance as described before, but also serve as virulence factors for nutrient scavenging, induction of the expression of other virulence factors, cell adhesion and invasion, and evasion of host defense mechanisms by mutation, among others (137). One of the main OMPs that has been characterized is OmpA, also called Omp38. OmpA is a 8-stranded β-barrel porin highly conserved among bacterial species and one of the most abundant porins in A. baumannii OM (139). It plays a considerable role in biofilm formation (140), adherence and invasion of epithelial cells (140-142), translocation into the epithelial cell nucleus (143), induction of epithelial cell apoptosis (144, 145), and binding to factor H, which may allow A. baumannii to develop serum resistance (146). Moreover, a recent study on patient cohorts suggested that ompA overexpression was an associated factor for pneumonia, bacteraemia, and death due to A. baumannii (147). OmpW is another 8-stranded β-barrel OMP that is widespread in many GNB, such as Vibrio cholerae, Escherichia coli, and A. baumannii (148). OmpW protein is believed to be involved in the transport of hydrophobic or aromatic molecules across the OM (149- 151), and it is implicated in iron homeostasis (152). Moreover, mutant strains of V. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 57 cholerae, which expressed no OmpW, were shown to have reduced colonisation in the intestine of mice relative to those that expressed it (153). Another important OMP is Omp33-36, which induces apoptosis and modulates autophagy in human cells (154). In addition, an isogenic knockout strain deficient in the omp33 gene showed a reduction both in adherence and invasion of human lung epithelial cells, as in cytotoxicity of these cells and macrophages, and exhibited higher lethal doses (LD) LD0, LD50, and LD100, and lesser dissemination in a murine peritoneal sepsis model (155). Furthermore, it has been demonstrated that the lower expression of the porins CarO and OprD-like attenuates the virulence of a PDR A. baumannii strain (156). CarO is another 8-stranded β-barrel OMP and it is the most characterized porin in A. baumannii, together with OmpA, and it has been previously related to antimicrobial resistance, but its virulence role has not entirely being stated. 2.2. Capsular polysaccharides and LPS. Capsular polysaccharides are involved in antimicrobial resistance and referred as target for defensive passive immunization in A. baumannii. It is known that mutants deficient in capsular polysaccharides have lower intrinsic resistance to peptide antibiotics, and that the presence of antibiotics induces hyperproduction of capsular polysaccharides (157). Moreover, it was observed that increased production of capsular polysaccharides causes an increase in virulence in a murine model (157). Hyperproduction of capsular polysaccharides depended on transcriptional increase in the K-locus gene where the expression of the gene is regulated mainly by the two-component system, such as BfmRS (158, 159). bfmR is important for persistence in the lung in a murine pneumonia model (160) and bfmS is involved in biofilm formation, adherence to eukaryotic cells, and resistance to human serum (158). As previously mentioned, the major component of the outer leaflet of the OM in A. baumannii is LPS. Although historically the LPS was believed to be essential for OM stability and survival (161), A. baumannii strains lacking LPS have been isolated (162). Despite this, defects in the lpxABCD cluster (responsible for LPS biosynthesis) have been shown to clearly affect the ability of the organism to grow, thereby diminishing virulence Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 64 caused by CRAB strains with high susceptibility to colistin (106). Therefore, further investigations using higher CMS doses must be performed in critically ill patients to determine whether there is improved efficacy without increased toxicity. 3.1.4. Tetracyclines. Minocycline and doxycycline exhibit in vitro and in vivo activity against A. baumannii (including CRAB, CRAB/sulbactam-resistant, and MDR strains), as well as synergistic effects when combined with different antimicrobials (239-241). Furthermore, the existing minocycline intravenous indication for treatment of A. baumannii infections has provided high rates of clinical success or improvement and, in addition, it was generally well tolerated by patients with MDR or CRAB infections (242, 243). Similarly, doxycycline has been successfully used to treat patients with VAP caused by MDR A. baumannii (244). 3.1.5. Tigecycline. Tigecycline has activity against most of the XDR A. baumannii isolates, including those resistant to carbapenems. Based on clinical trials, its use is approved for skin and soft tissue infections, intra-abdominal infections and community-acquired pneumonia (245). However, when it has been used to treat other infections, therapeutic success has been inconstant (246, 247). Treatment of intravascular/bacteraemic infections by A. baumannii with tigecycline seems impossible with the approved regimen (100-mg loading dose followed by a 50-mg dose bid) because of the low maximum concentration (Cmax) achieved in serum (248). Similarly, tigecycline concentrations in pulmonary endothelial lining fluid with conventional dosing are insufficient to treat A. baumannii VAP (249). A matched cohort analysis concluded that the tigecycline-based therapy resulted in higher in-hospital mortality than the colistin-based therapy (61 vs. 44%, respectively) in critically ill patients with pneumonia caused by MDR A. baumannii (250). Two metaanalyses discourage the use of a tigecycline for the treatment of MDR-A. baumannii infections because, compared with other active antimicrobials, the use of tigecycline was associated with higher in-hospital mortality, lower microbial eradication rate and longer length of stay (251, 252). Nevertheless, a high-dose regimen (200 mg/day), usually in Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 65 combination with another antimicrobial, may be an effective and well-tolerated alternative for severe A. baumannii infections including HAP (253). 3.1.6. Combined therapy. The use of combination therapy is an attractive approach justified by the high mortality rates associated to these infections, the lack of proven valid therapeutic options, and the rapid development of antimicrobial-resistance (254). Notwithstanding, most data regarding combination of antimicrobials rely on in vitro or animal studies, and its translation into the clinical practice is doubtful because even the same antimicrobial combinations have been reported to have different results (255, 256). Furthermore, most observational studies, randomized clinical trials, and meta-analyses coincide in the lack of clinical efficacy (cure rate or mortality) using combination therapy instead of monotherapy for A. baumannii severe infections (257, 258), although microbiological eradication rates are significantly higher with the use of two active antimicrobials in some cases (259-262). For example, a prospective observational study, conducted in 28 Spanish hospitals, that assessed the clinical efficacies of monotherapy (mainly colistin and carbapenems) and combination therapy (colistin/carbapenem plus tigecycline were the most used) in MDR A. baumannii sepsis concluded that there was no association of combination therapy with reduced mortality in this type of infection (257). A randomized open-label trial evaluated colistin monotherapy compared with the combination of colistin and fosfomycin for 7–14 days in patients infected with carbapenem-resistant A. baumannii. Microbiological response at the first 72 h and at the end of treatment was significantly higher in the combination group, but no differences in clinical cure rate or 28-day mortality were found (260). Similar results were obtained from another randomized open-label trial performed to compare colistin-rifampicin vs. colistin monotherapy groups in serious MDR-A. baumannii infections (262). Furthermore, a recent randomized controlled superiority trial conducted with 406 patients with severe infections caused by carbapenem-resistant Gram-negative bacteria (mostly A. baumannii) concluded that the treatment based on the combination of colistin plus meropenem did not result in better outcomes compared with colistin monotherapy (263). A systematic review and meta-analysis that included 12 controlled studies concluded that there was no strong evidence that combination regimen of polymyxins was superior to monotherapy Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 66 regimen (258). Therefore, most experts concluded that further studies were needed to better define the potential advantages and disadvantages of combination therapy for A. baumannii infections. Meanwhile, it seems reasonable to use monotherapy, at least in patients with less severe infections (257). 3.2. Novel and future treatment options. 3.2.1. New antibiotics. Since 2017 eight new antibiotics have been approved (264). However, most of them are derivatives of known classes, such as the two tetracycline derivatives eravacycline and omadacycline, and furthermore, none of them is active against carbapenem-resistant A. baumannii (264). Alternatively, there are currently 32 antibacterial agents in clinical development Phases 1-3 targeting WHO priority pathogens (Table 2), being only four of these agents (cefiderocol, durlobactam [ETX-2514] + sulbactam, SPR-206, and TP-6076) active against MDR A. baumannii (264). Moreover, despite being promising options for the treatment of different infectious pathologies caused by MDR A. baumannii, these new antibiotics are also based on modifications of traditional antibiotic structures, leading to a possible cross-resistance to currently used antibiotics and therefore, challenging their longevity as therapeutic options (265). Thus, more investment is needed for the discovery, research and development of truly innovative and effective antibiotics. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 67 Table 2. Antibiotics that are being developed against World Health Organization (WHO) priority pathogens (modified from (264). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 68 Continuation of Table 2. Antibiotics that are being developed against World Health Organization (WHO) priority pathogens (modified from (264)). 3.2.2. Anti-virulence drugs. As detailed above (section 2), recent whole-genome sequencing (WGS) studies involving A. baumannii have demonstrated not only a vast array of antibiotic drug resistance determinants but also many virulence factors (266). These studies demonstrate the contribution of a few factors in the pathogenesis of A. baumannii, suggesting that these mechanisms would be potential candidates for targets of novel antimicrobial agents. Thus, we could fight A. baumannii by blocking its virulence factors, relegating this bacterium to its prior role as opportunistic and rarely pathogenic bacteria. Moreover, as this strategy is not based on a bactericidal approach, the emergence of new resistant phenotypes may not be a limitation (267). In addition, this action would be improved by CRAB: carbapenem-resistant A. baumannii; CRPA: carbapenem-resistant P. aeruginosa; CRE: carbapenem-resistant Enterobacterales; OPP: “high” and “medium” WHO priority pathogens. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 69 combining this strategy with the classical antimicrobial agent approach, allowing us a potent defence–attack combination. The experimental results demonstrating in vitro and in vivo efficacy of drugs able to block virulence factors (called “anti-virulence drugs”) are hopeful, and the apparent advantages of the non-antimicrobial approaches described below are promising. However, caution is needed and further extensive studies have to be performed to elucidate the potential use of these new molecules as therapeutic alternatives (268). 3.2.2.1. Inhibition of OMPs. Many Gram-negative pathogens, including A. baumannii, use the externally exposed loops of a number of OMPs to interact with their hosts to induce the expression of virulence factors, to invade tissues, and by mutation to escape the immune system (269- 271). Thus, inhibitors of OMPs constitutes a recent and promising treatment alternative to fight against this pathogen. Until now, two OMPs have been chosen as drug targets for the development of such inhibitors, OmpA and OmpW. A series of OmpA inhibitors were designed by virtual screening and tested in vitro and in vivo by Vila-Farrés X et al. (272). In this study, they reported that one of these inhibitors, the cyclic hexapeptide AOA-2, was able to inhibit the GNB adherence to host cells, reducing host cell death, and inhibit biofilm formation by these pathogens. Moreover, AOA-2 in vivo administration shows a large decrease in the bacterial concentration in spleen and lungs, together with a significant decrease in mouse mortality, especially in A. baumannii infections. Later, the synergistic activity of AOA-2 and colistin against colistin-resistant A. baumannii was described in vitro and in vivo (273). Similarly, Soojhawon et al. used another in silico screening for the development of novel inhibitors for A. baumannii OmpW (148), reporting good results regarding antibacterial activity against a panel of clinical isolates of A. baumannii strains, for three of the tested compounds (D5, D12 and D6). 3.2.2.2. Inhibition of LPS synthesis. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 70 The inhibition of the bacterial synthesis of LPS through the blocking of lpx genes could be another potential treatment approach (7). LpxC inhibition by LpxC-1 blocks LPS biosynthesis, blocking the ability of A. baumannii to activate the sepsis cascade and enhancing opsonophagocytic killing of the bacteria, resulting in the completely protection of mice from lethal infection (166). Moreover, no cross-resistance to the LpxC-1 was reported in this study. Advancement of novel classes of LpxC inhibitors has been performed, identifying a lead compound, LpxC-4, which is a potent broad-spectrum inhibitor against which spontaneous resistance arises fairly infrequently (274). In a similar strategy, the LpxA and LpxD structures have been recently crystallized and they will be tested as targets for new antibacterial agents (275, 276). 3.2.2.3. Inhibition of biofilm formation. Several studies have focused on the inhibition of biofilm formation by different approaches, such as the use of garlic ointment (277, 278) or gaseous nitric oxide (278) to prevent biofilm formation in wounds or dressings. Another approach is DispersinB, an antibiofilm enzyme that alone or in a synergistic combination with the KSL-W antimicrobial peptide is able to disperse preformed biofilm and inhibit biofilm formation in chronic wound infection caused by A. baumannii without affecting bacterial growth (279). In addition, it has been developed a 2-aminoimidazole compound (2-AI) that inhibits and controls the biofilm development by targeting BfmR, a response regulator involved in biofilm development (280), or even a potent anti-biofilm peptide (1018) that inhibits biofilm formation and eradicates preformed biofilms formed by A. baumannii among others MDR Gram-negative pathogens by blocking (p)ppGpp, an important signal in biofilm development (281). Besides, four chimeric peptides have been reported to prevent biofilm formation by A. baumannii clinical isolates, in addition to its significant antibacterial effects, better than ampicillin, cefotaxime, ciprofloxacin, tobramycin, and erythromycin (282). 3.2.2.4. Inhibition of QS. As many bacterial pathogens use QS to control virulence, the development of methods to intercept QS has attracted significant interest as a potential anti-infective therapy (187). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 71 As previously described, A. baumannii uses AHLs as signal molecules and AbaR as the putative cognate receptor for QS, so that most novel anti-infective strategies are based on blocking this AbaR receptor with different compounds (268). Several non-native AHL were discovered as potent AbaR antagonists, which strongly inhibited A. baumannii motility and reduced biofilm formation by up to 40% (283). More recently, Nicol et al. demonstrated that unsaturated fatty acids were also able to decrease A. baumannii biofilm formation, presenting a biofilm dispersing effect and drastically reducing motility, by decreasing the expression of the regulator AbaR (284). 3.2.2.5. Iron chelation. As iron is an essential cofactor for many bacterial processes, the use of iron chelators and iron competitors has been studied as an alternative to antibiotics or as a complement to antibiotic treatments. Some of the main iron chelators developed to fight against bacterial pathogens are deferoxamine, deferiprone, Apo6619, VK28 dihydrochloride, and 2,2’- dipyridyl (DIP). However, these iron chelators had only low or modest antibacterial activity in vitro against A. baumannii according, being DIP the one that showed the highest, and in addition, the antibacterial effect appeared to be dependent on the medium (285). Regarding iron competitors, gallium (Ga+3) is the most studied for A. baumannii. It is a transition metal with a similar atomic radius and valence to iron (Fe+3), allowing it to compete with Fe3+ for binding to iron-requiring enzymes, proteins, and microbial siderophores. Consequently, gallium could act as an inhibitor to these bacterial components upon binding because it cannot undergo oxidation–reduction cycles (286). Several in vitro and in vivo studies have reported promising results using gallium treatment alone or in combination with colistin against A. baumannii isolates (287, 288). Nevertheless, similar results to those observed with iron chelators were obtained, depending the effect of gallium nitrate on A. baumannii growth on the growth medium used (287). In summary, iron chelation and gallium-based therapies show good activity in vitro, but still additional work is needed to learn about their in vivo efficacy. 3.2.3. Repurposing drugs. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 72 The repurposing of old U.S. Food and Drug Administration (FDA)-approved drugs as therapeutic alternatives for infections has recently gained interest. The advantages of this strategy are the availability of information about their pharmacological characteristics in preclinical and clinical trials, and consequently, the reduction of time, cost and risk required to evaluate these drugs for other therapeutic applications, such as the treatment of bacterial infections. A variety of drug families have been considered as potential candidates including: anthelmintics (salicylanilides and avermectins) (289, 290); antifungals (ciclopirox) (291), anticancer drugs (gallium nitrate and mitomycin C) (288, 292); anti-inflammatory/immunomodulatory drugs (celecoxib and glatiramer) (293, 294); and statins (simvastatin and atorvastatin) (295). Even though repurposed drugs showed promising preclinical data, its clinical use to combat infections caused by MDR A. baumannii could become a reality after performing further safety testing in a broader human population (296). 3.2.4. Antimicrobial peptides. Antimicrobial peptides are key elements of the immune system of higher organisms, making them potential candidates for use as antibacterial agents (297). Most of these antimicrobial peptides share a cationic character and fold into amphipathic conformations that allow them to disrupt bacterial membranes, acting as direct microbicidal agents (298). Several antibacterial peptides have shown promising results in vitro and in vivo against A. baumannii, such as cecropin A–melittin hybrid peptides (299, 300), peptides derived from frog and toad skin (301, 302), and proline-rich antimicrobial peptides (303, 304). However, the failures of antimicrobial peptides in clinical development are countless, and experts have begun to doubt whether antimicrobial peptides will be viable therapeutic options for systemic infections (in contrast to topical applications (305)) without substantial further scientific advancements (306). Before peptide therapies can be reliably used systemically, they must overcome problematic pharmacology, toxicity, and inactivation in the context of biological matrices such as serum, surfactant, and other biological fluids and tissues (7). Studies aimed at developing peptide analogs through the introduction of structural changes that modify the stability and toxicity profiles of the peptide are addressing these limitations (7). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
INTRODUCTION 73 3.2.5. Phage therapy. Bacteriophages, or phages, are viruses that infect, and in some cases lyse, bacterial cells. Recently, a substantial renewed interest in their potential has being witnessed (307, 308). Moreover, its use is supposed to be advantageous over antibiotics, due to phages are highly specific and have no effect against animal cells, and in addition, their isolation is a relatively rapid process (309). Numerous in vitro and in vivo studies have confirmed the lytic activity of phages against A. baumannii clinical isolates (310-316). While these studies illustrate that a potential limitation of phage therapy is the limited host range of A. baumannii phages, new studies overcome the limitations of each individual phage using a cocktail of multiple phages (317-320). Moreover, of particular relevance is the recent study of Schooley RT et al. (321) reporting the successful use of personalized bacteriophage-based therapeutic cocktails to treat a 68-year-old diabetic patient with necrotizing pancreatitis complicated by an MDR A. baumannii infection. Nevertheless, there are still some issues, such as the potential for secondary effects on human flora, appearance of resistant strains, and the inflammatory response in humans after administration of phage therapy, that need to be addressed (322). 3.2.6. Photodynamic therapy. Phototherapy utilizes the combination of oxygen, infrared light, and a photosensitizer (a nontoxic, photoreactive dye) to generate reactive oxygen species that can damage DNA and disrupt cellular membranes. It was developed a long time ago to be used for other purposes such as cancer or ophthalmology, and for disinfection of clinical products (323). Nowadays, antimicrobial photodynamic therapy is starting to be considered as a promising alternative approach to resistant infections due to its advantages: it has been shown to destroy LPS (324), and it does not result in the selection of resistant strains after repeated cycles of treatment (325). However, potential limitations of photodynamic therapy are that it can only be used topically, and that the reactive oxygen species produced by this technique could potentially damage host as well as target cells; issues that must be taken into account when considering this treatment approach (322). Nonetheless, it appears to be suit for the treatment of superficial skin and soft tissue infections (326). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
81 HYPOTHESES Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
HYPOTHESES 83 The hypotheses of this Doctoral Thesis are: Chapter I. Study of the mechanisms involved in the pathogenesis of colonising and bacteraemic VAP producing A. baumannii clinical isolates. 1. A. baumannii isolates causing bacteraemic VAP (invasive isolates) in ICU ventilated patients present higher in vitro and in vivo virulence than colonising A. baumannii isolates. 2. A. baumannii isolates that cause bacteraemic VAP in ICU ventilated patients have different virulence mechanisms than the isolates that only colonize the respiratory tract of those patients. Chapter II. Identification of potential A. baumannii virulence factors of bacteraemic A. baumannii isolates recovered from clinically homogeneous adult patients with radically different clinical outcomes. 1. A clinically homogeneous group of patients with VAP and secondary bacteraemia caused by A. baumannii have different clinical outcome depending on the differential virulence factors of its bacteraemic isolates. 2. The presence of CarO increase the virulence of A. baumannii. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
85 OBJECTIVES Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
OBJECTIVES 87 The general aim of this Doctoral Thesis is to identify novel therapeutic targets in A. baumannii by finding new factors responsible for its virulence, through omics and bioinformatics tools. The specific objectives of each chapter are the following: Objectives of chapter I. Study of the mechanisms involved in the pathogenesis of colonising and bacteraemic VAP producing A. baumannii clinical isolates. 1. To evaluate the clonal relationship, in vitro and in vivo virulence, and antimicrobial susceptibility patterns of colonising and invasive isolates. 2. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the colonising and invasive isolates previously selected. 3. To find new mechanisms of infection by comparing colonising and invasive isolates. Objectives of chapter II. Identification of potential A. baumannii virulence factors of bacteraemic A. baumannii isolates recovered from clinically homogeneous adult patients with radically different clinical outcomes. 1. To study the clonal relationship and antimicrobial susceptibility patterns in the selected bacteraemic A. baumannii isolates. 2. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the bacteraemic A. baumannii isolates. 3. To find new bacterial virulence mechanisms that may be influencing patient mortality: genomic, transcriptomic, and proteomic approaches. 4. To analyse the virulence role of CarO in A. baumannii using model systems. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
89 MATERIALS AND METHODS Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 96 bacterial cells were collected by centrifugation (15 min at 4,500 × g), rinsed in sterilized phosphate-buffered saline (PBS, Sigma-Aldrich), and resuspended in 10 mL DMEM before use in eukaryotic cell infection assays. A549 cells seeded in 96-well plates, as explained above, were rinsed twice with PBS immediately before infection, and infected with 8 log10 CFU/mL of the overnight culture resuspended in DMEM of each isolate (1 column of wells/isolate). A549 cells from a column of wells per each plate were not infected, serving as control for later analysis (healthy cells with 100% viability). Cell cultures were incubated for 24 h in a humidified incubator at 37 ºC and 5% CO2. After the incubation period, the cells were washed 5 times with PBS, and 100 μl of a 1:10 dilution of MTT 5 mg/mL (final concentration 0.5 mg/mL) were added to each well. Multi-well plates were incubated for 3 h in a humidified incubator at 37 ºC and 5% CO2. Then, the medium was removed from each well and replaced with 100 μl of dimethyl sulfoxide (DMSO, Sigma-Aldrich). Cell cultures were incubated 10 min in a humidified incubator at 37 ºC and 5% CO2, and afterwards, the absorbance of each well was measured using a scanning multi-well spectrophotometer (Multiskan GO, Thermo Fisher Scientific) at 570 nm with a reference wavelength of 620 nm. An average of the absorbances was performed per each column. To calculate the percentage of A549 cell viability after incubation with the clinical isolates, the following formula was used: 𝐴549 𝑐𝑒𝑙𝑙 𝑣𝑖𝑎𝑏𝑖𝑙𝑖𝑡𝑦 (%) = (𝑂𝐷570−𝑂𝐷620)𝐴549 𝑐𝑒𝑙𝑙𝑠 𝑖𝑛𝑓𝑒𝑐𝑡𝑒𝑑 𝑤𝑖𝑡ℎ 𝑎 𝑠𝑝𝑒𝑐𝑖𝑓𝑖𝑐 𝑖𝑠𝑜𝑙𝑎𝑡𝑒 (𝑂𝐷570−𝑂𝐷620)ℎ𝑒𝑎𝑙𝑡ℎ𝑦 𝑐𝑜𝑛𝑡𝑟𝑜𝑙 𝐴549 𝑐𝑒𝑙𝑙𝑠 𝑥 100 Assays were performed by triplicate in different days. The A549 cell viability (%) average of the 3 days for each isolate were represented on a graph, and also the average for colonising and invasive groups after the final selection (colonising isolates with the lowest in vitro virulence and invasive isolates with the highest). Objective 3. To study the in vivo virulence and antimicrobial susceptibility patterns of colonising and invasive isolates. 3.1. In vivo virulence study. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 97 3.1.1. Animals. Immunocompetent adult C57BL/6J female mice (20 g, assessed for genetic authenticity and murine pathogen-free sanitary status) were obtained from the Production and Experimentation Animal Centre, University of Seville, Spain. Mice were housed in ventilated cages under specific pathogen-free conditions with water and food ad libitum. All procedures were performed following the recommendations from the Guide for the Care and Use of Laboratory Animals (377) in strict accordance with Directive 2010/63/EU on the protection of animals used for scientific purposes. Experiments were approved by the Committee on the Ethics of Animal Experiments of the University Hospital of Virgen del Rocío, Seville, Spain, and from the Ministry of Agricultura, Pesca y Desarrollo Rural (2012PI/246). Procedures were performed with all possible efforts made to minimize animal suffering. 3.1.2. Experimental murine model of peritoneal sepsis: determination of LD0, LD50, and LD100. The in vivo virulence of the selected A. baumannii clinical isolates, 5 colonising (C6, C7, C8, C11, and C12) and 6 invasive (IB1, IB2, IB3, IB4, IB7, and IB8), was assessed in a non-discriminative peritoneal sepsis murine model (330) measuring survival and calculating LD0, LD50, and LD100 (378). The LD0 is the highest concentration of bacteria which allows 100% of the animals to survive. The LD50 is the dose of bacteria required to cause 50% mortality in the animals. The lowest concentration of bacteria at which 100% of inoculated animals die is the LD100 or minimal lethal dose (MLD). Briefly, for each isolate, bacterial cultures were serially diluted in MHB to obtain 10-fold decreases in the number of organisms. Groups of 6 animals were inoculated intraperitoneally (i.p.) with 0.5 mL of bacterial dilutions mixed 1:1 with a saline solution of porcine stomach mucin (type II, Sigma-Aldrich) at 10% (w/v), starting from an inoculum of 1.5 log10 CFU/mL approximately and ending with the first inoculum that cause 100% mice mortality (achievement of MLD). The animals were observed for 7 days, and the number of survivors at each dilution was noted. 3.2. Determination of the MIC of different antimicrobials. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 98 The determination of the MIC of amikacin, ceftazidime, ciprofloxacin, colistin, imipenem, meropenem, rifampicin, sulbactam, tigecycline, and tobramycin was performed for the 5 colonising (C6, C7, C8, C11, and C12) and 6 invasive (IB1, IB2, IB3, IB4, IB7, and IB8) A. baumannii isolates by broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) guidelines (379). For this, stock solutions of antimicrobial agents were prepared using the standard laboratory powders (Table 4) and following the CLSI standards. Subsequently, 50 μl of MHB II (cationadjusted, Sigma-Aldrich) were added to 96-well microtitre plates “U” form, and then, 50 μl of each antimicrobial solution were added to the first column of wells. Next, 1:2 serial dilutions were performed starting from the first column. Thus, 10 wells per antimicrobial, containing decreasing antimicrobial concentrations with different ranges of concentrations, were required (Table 4). Finally, 50 μl of each of the selected A. baumannii isolates, obtained from a MHB II culture in exponential growth phase equivalent to 0.5 McFarland standard and diluted 1:100, were added (final concentration of 5 × 105 CFU/mL). A growth control with bacterial inoculum but without antimicrobial agent, and a sterility control without bacterial inoculum or antimicrobial agent, were performed. E. coli ATCC 25922 and P. aeruginosa ATCC 27853 were used as quality control (QC) strains, according to the CLSI guidelines. Microtitre plates were incubated at 37 ºC and aerobic conditions during 20-24 h. After incubation period, the CMI of each antimicrobial agent for each isolate were determined, defining CMI as the lowest concentration of an antimicrobial which prevents visible bacterial growth. MICs results were interpreted according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) (http://www.eucast.org/clinical_breakpoints/) or CLSI (380) breakpoints when available. As tigecycline and rifampicin clinical breakpoints were not defined by EUCAST or CLSI, they were interpreted according to the FDA criteria (381) and PK/PD models with Monte Carlo simulation (382), respectively. Clinical isolates were defined as MDR when they had acquired non-susceptibility to at least one agent in three or more antimicrobial categories according to standard criteria (383). Experiments were performed in triplicate on different days. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 99 Table 4. Antimicrobial brands and their concentration range used for the determination of their minimum inhibitory concentrations by broth microdilution method for colonising and invasive isolates. Antimicrobial brand Antimicrobial concentration range tested (µg/mL) Amikacin Amikacin sulfate salt, Sigma-Aldrich 128-0.25 Ceftazidime Ceftazidime hydrate, Sigma-Aldrich 256-0.5 Ciprofloxacin Ciprofloxacin, Sigma-Aldrich 256-0.06 (2 consecutive microtitre plates) Colistin Colistin sulfate salt, Sigma-Aldrich 16-0.03 Imipenem Imipenem monohydrate, Sigma-Aldrich 256-0.5 Meropenem Meropenem trihydrate, Sigma-Aldrich 16-0.03 Rifampicin Rifampicin, Sigma-Aldrich 256-0.5 Sulbactam Sulbactam, Sigma-Aldrich 256-0.5 Tigecycline Tigecycline, Sequoia Research (Pangbourne, UK) 8-0.016 Tobramycin Tobramycin, Sigma-Aldrich 128-0.25 Objective 4. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the colonising and invasive isolates. 4.1. DNA extraction, WGS and data processing (read preprocessing, assembly, contig filtering, protein-coding gene prediction and annotation). DNA of the 5 colonising (C6, C7, C8, C11, and C12) and 6 invasive (IB1, IB2, IB3, IB4, IB7, and IB8) isolates was extracted using QIAamp® DNA Mini Kit (QIAGEN, Madrid, Spain). Sequencing was performed using MiSeq platform (Illumina, Madrid, Spain), according to the standard protocol for WGS paired-end, producing 2 × 300 base pairs (bp) fragment reads. Regarding the bioinformatics analyses of the WGS data, first, reads were Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 100 preprocessed with Trimmomatic v0.32 (384) and de novo assembled with ABySS assembler v1.5.2 (385). Then, the assemblies were filtered for contigs larger than 500 bp. Gene prediction and annotation were performed utilizing GeneMark v2.5 (386) and RAST server v1.0 (387), respectively. 4.2. MLST typing. MLST was performed by uploading the contig files obtained from the de novo assembly of the WGS data of each of the colonising and invasive isolates to the MLST web server MLST v2.0 from the Center for Genomic Epidemiology (CGE) (388). Both MLST schemes, Bartual/Oxford and Pasteur, were used. 4.3. Identification of antimicrobial resistance mechanisms. The ResFinder v3.2 web server of the CGE (389) was used to identify antimicrobial resistance genes in the assembled WGS data from the colonising and invasive isolates, using a threshold of 100% identity for the genes encoding β-lactamases and 98% identity for all other genes. Mobile IS located upstream the β-lactamase-encoding genes were detected using the Basic Local Alignment Search Tool (BLAST) (390) for nucleotides (BLASTN) from the ISFinder database (https://isfinder.biotoul.fr/blast.php). Furthermore, point mutations in the quinolone resistance determining regions (QRDRs) of the genes associated with quinolone resistance (gyrA and parC) were identified in all the isolates comparing the predicted proteins encoded by gyrA and parC with the deduced amino acid sequences of gyrA (UniProt entry: D0CBH9) and parC (UniProt entry: D0CB90) from A. baumannii ATCC 19606 (ciprofloxacin-susceptible strain), and also with those from E. coli K12 (UniProt entries: P0AES4 and P0AFI2, for the deduced amino acid sequences of gyrA and parC, respectively) in order to define the position of the mutations according to the E. coli protein. The BLASTP (protein BLAST) tool from the National Center for Biotechnology Information (NCBI) was used for the performance of the comparisons. Similarly, point mutations in the conserved regions of rpoB gene, related with rifampicin resistance, was detected following the same procedure described for gyrA and parC, using the deduced amino acid sequences of rpoB (UniProt entry: A3M1G3) from A. baumannii ATCC 17978 (rifampicin-susceptible strain). Identification Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 101 of mutations in pmrAB and lpx genes was not performed due to all isolates were colistinsusceptible. 4.4. Identification of virulence factors. Genes encoding known virulence factors were identified from the WGS data of the colonising and invasive isolates using two different strategies. For both strategies, virulence genes described in the MDR A. baumannii isolate AB0057 were used for the comparison, being the A. baumannii isolate with the higher number of virulence genes contained in the Virulence Factors of Pathogenic Bacteria database (VFDB) (391). The first strategy was based on the VFanalyzer option of the VFDB (http://www.mgc.ac.cn/cgi-bin/VFs/v5/main.cgi?func=VFanalyzer) (392). VFanalyzer is an automatic analysis pipeline for a systematic screen of known/potential virulence factors in given complete/draft bacterial genomes. So, draft genomes (contig files) were uploaded and Option 3 was selected ("Upload private data of raw or annotated genome in FASTA or GenBank format"). VFanalyzer performed an automatic prediction of proteincoding genes using GLIMMER3 and then ran the comparison analysis. For the second strategy, amino acid sequences of all the virulence factors of A. baumannii isolate AB0057 contained in VFDB were downloaded, and the inferred protein sequences from the six bacteraemic isolates were compared to them using the standalone version of BLASTP from the NCBI. A protein was related to a virulence factor present in the database when the BLAST hit indicated an identity ≥ 95% for a query coverage ≥ 95%. Thus, using both strategies, the ability to detect all virulence genes were higher than using one alone. Objective 5. To find new mechanisms of infection by comparing colonising and invasive isolates. 5.1. Comparative genomic study. Several bioinformatics approaches were used with WGS data to find any genomic difference between both groups of sequenced isolates (colonising and invasive). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 102 In the first approach, performed with the nucleotide sequences (gene-level analysis), a multiple alignment with the 11 assembled genomes were performed using Mugsy v1.2.3 (393). Then, from this multiple alignment, genomic regions (contigs) that were presented in all colonising isolates but in none of the invasive isolates, and vice versa, were selected. Afterward, genes contained in those contigs were predicted and annotated with GeneMark v2.5 and RAST server v1.0, respectively. Moreover, the core- (common genes (≥ 90% identity) among all the isolates) and pan-genome (the entire gene set of all isolates: common + non-common genes) were identified from the multiple alignment of all isolates, and an additional analysis of point mutations in the core-genome was carried out comparing colonising vs. invasive isolates, and vice versa. At the same time, a second approach was applied using the predicted amino acid sequences (protein-level analysis). All the predicted proteins, from all isolates, were compared using a global alignment based on the Needleman-Wunsch algorithm (https://www.ebi.ac.uk/Tools/psa/) in order to find the differential ones between both groups of isolates. Then, the predicted core-proteome (predicted proteins presented in all isolates with an identity ≥ 90%) was selected and predicted-protein variants between the colonising and the invasive groups were obtained. 5.2. Determination of ompA expression levels by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). The 5 colonising (C6, C7, C8, C11, and C12) and 6 invasive (IB1, IB2, IB3, IB4, IB7, and IB8) isolates were analysed for the expression of the ompA gene. Cultures were grown to an OD600 of 0.6 in Luria-Bertani (LB) broth (Sigma-Aldrich) and subsequently, the protocol of TRIzol Max Bacterial RNA Isolation Kit (Thermo Fisher Scientific) was followed to extract DNase-treated bacterial RNA from them. qRT-PCR was carried out with an MX3000P system (Stratagene, Barcelona, Spain). A total of 35 ng of RNA was used in the target gene studies. The primers and TaqMan probes (Thermo Fisher Scientific) used were: ompA forward: 5’-AGCTCTTGCTGGCTTAAACG-3’; ompA reverse: 5’-GAGCAACTGGAGTTGGTTCA-3’; ribosomal RNA forward: 5’- GTAGCGGTGAAATGCGTAGA-3’; ribosomal RNA reverse: 5’- CTTTCGTACCTCAGCGTCAG-3’; ompA probe: 5’- [DFAM]CAGCAGGCTTCAAGTGACCACCA[DTAM]-3’; and ribosomal RNA probe: Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 103 5’-[DFAM]CGAAGGCAGCCATCTGGCCT[DTAM]-3’ (147). The experiment was performed in triplicate using independent RNA extractions in every assay, and the absence of contaminating DNA in the samples was confirmed by the use of controls without reverse-transcriptase. Relative gene expression was determined using the 2−ΔΔCt method. The 16S ribosomal RNA gene was used as housekeeping gene for normalization of gene expression (394) and A. baumannii ATCC 17978 was used as calibrator or reference sample (expression set to 1). Statistical analyses of Chapter I Differences in cell viability, LD, and ompA expression levels (Sections 2.2.2, 3.1.2, and 5.2 of Material and Methods from Chapter I, respectively) were determined using GraphPad Prism 6 (GraphPad Software Inc., California, USA). Specifically, Student's ttest and Mann-Whitney test were used when comparing two groups in which the dependent variable was normally and not normally distributed, respectively. A P-value of ≤ 0.05 was considered statistically significant. In addition, LD50 values for the isolates used were determined using the Probit method in IBM SPSS Statistics v17.0 (IBM, Madrid, Spain). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 104 Chapter II. Identification of potential A. baumannii virulence factors of bacteraemic A. baumannii isolates recovered from clinically homogeneous adult patients with radically different clinical outcomes. Objective 1. To select bacteraemic isolates according to specific criteria. 1.1. Selection criteria. The following criteria were used to select bacteraemic A. baumannii isolates from patients from the previous described cohort: i) isolation from patients without comorbidities (Charlson index = 0), with APACHE II score ≥ 15 and similar CPIS in the moment of inclusion, similar ages, and no co-infections during their hospital stay, but with different clinical outcomes; ii) appropriate antimicrobial treatment of the VAP (106), being the isolates extremely susceptible to colistin (MIC range: 0.03-0.125 µg/mL) and lacking colistin-heteroresistance; and iii) same PFGE profile as their corresponding VAP isolates, confirming the source of bacteraemia. Objective 2. To study the clonal relationship and antimicrobial susceptibility patterns in the bacteraemic A. baumannii isolates. 2.1. PFGE typing. Molecular typing of the six bacteraemic isolates, using the PFGE method, was performed following the same protocol previously detailed in Section 2.1 of Materials and Methods (Chapter I). 2.2. Determination of the MIC of different antimicrobials. Identical procedure as detailed before in Section 3.2 of Materials and Methods (Chapter I) was used to determine the MIC of amikacin, ceftazidime, ciprofloxacin, colistin, imipenem, meropenem, rifampicin, sulbactam, tigecycline, and tobramycin for the six bacteraemic isolates. Additionally, doripenem (doripenem hydrate, Sigma-Aldrich; range tested: 8-0.016 µg/mL) and doxycycline (doxycycline hyclate, Sigma-Aldrich; range tested: 128-0.25 µg/mL) susceptibilities were also determined. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 105 Objective 3. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the bacteraemic A. baumannii isolates. 3.1. DNA extraction, WGS and data processing (read preprocessing, assembly, contig filtering, protein-coding gene prediction and annotation). DNA of the six bacteraemic isolates was extracted using QIAamp® DNA Mini Kit (QIAGEN). Sequencing was performed using MiSeq platform (Illumina), according to the standard protocol for WGS paired-end, producing 2 × 300 bp fragment reads. After comparing several bioinformatics tools, newer and more accurate bioinformatics analyses of the WGS data were performed in comparison with those performed with the clinical isolates from Chapter I. After carrying out a result comparison among different types of read trimming and de novo assemblers, such as ABySS, Velvet (395) and SPAdes (396) (results not shown), reads were directly de novo assembled into contigs using SPAdes v3.5, without preprocessing (raw reads), as it was the combination that resulted in the highest genome size assembled and the least number of contigs. In a similar way, different programs to predict genes (Prodigal (397) vs. GeneMark) and to annotate them (Sma3s (398) vs. RAST) were compared to choose the best in terms of highest number of protein-coding genes inferred and annotation accuracy (results not shown). As a result, protein-coding genes were finally predicted by Prodigal v2.6.3, an accurate and widely used bacterial gene finder, and the derived amino acid sequences were obtained. Moreover, the predicted proteins were functionally annotated by Sma3s v2 using the bacterial taxonomic division of UniProt database to improve the procedure specificity. 3.2. MLST typing. MLST typing of the six bacteraemic clinical isolates from WGS data was performed following the same procedure as in Section 4.2 of Materials and Methods (Chapter I). 3.3. Identification of antimicrobial resistance mechanisms. For the identification of the antimicrobial resistance genes contained in each of the six entirely-sequenced genomes, besides using ResFinder web server of the CGE and Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 112 Same animals (immunocompetent adult C57BL/6J female mice, 20g), and nondiscriminative murine model of peritoneal sepsis, detailed in Section 1.5 of Materials and Methods (Chapter I) were used. 5.5.2. Determination of MLD and survival analysis. Same protocol as that explained in 1.5.2 of Materials and Methods (Chapter I) was used for the determination of the MLD of the strains 17978 wt and ΔcarO. With the ΔcarO/pWH1266-carO complemented strain, only the inoculum that would be used for the in vivo dissemination study (3.2 log10 CFU/mL) was tested, following the 3Rs principles (https://www.nc3rs.org.uk/the-3rs). Survival curves were represented graphically with mice infected with an inoculum of 3.2 log10 CFU/mL of 17978 wt, ΔcarO, and ΔcarO/pWH1266-carO strains. 5.5.3. In vivo dissemination. Three groups of 14 mice each were inoculated i.p. with 0.5 mL of 3.2 log10 CFU/mL of 17978 wt, ΔcarO, or ΔcarO/pWH1266-carO strains. Eight and twenty-four hours postinoculation, 7 animals of each group were randomly selected and sacrificed (200 µL sodium thiopental, i.p.). Then, bacterial loads were quantified in spleen, lungs, kidneys, liver, peritoneal fluid, and blood. For this purpose, immediately after the sacrifice the indicated organs were aseptically removed and homogenized (Stomacher 80; Tekmar Co., Newton Aycliffe, England) in 2 mL of sterile 0.9% NaCl solution. Quantitative and qualitative bacterial determinations of homogenized tissues (log10 CFU/g) and blood (log10 CFU/mL) were performed. To calculate the bacterial burden in peritoneal fluid (log10 CFU/mL), 2 mL of sterile 0.9% NaCl was injected i.p. in the sacrificed mice followed by 2-min abdominal massage. This fluid was then collected, serially diluted and plated. Statistical analyses of Chapter II Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
MATERIALS AND METHODS 113 Differences in ompA expression levels, bacterial adherence and invasion, mice survival, and bacterial load in mice tissues and fluids (Sections 3.1, 4.4.2, 4.5.2, and 4.5.3 of Material and Methods from Chapter II, respectively) were determined using GraphPad Prism 6 (GraphPad Software Inc., California, USA). Specifically, Student's t-test and Mann-Whitney test were used when comparing two groups in which the dependent variable was normally and not normally distributed, respectively. Survival curves and log-rank test were used to compare the survival distributions of mice. Statistical significance was established at a P-value of ≤ 0.05. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
115 RESULTS Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 117 Chapter I. Study of the mechanisms involved in the pathogenesis of colonising and bacteraemic VAP producing A. baumannii clinical isolates. Objective 1. To select colonising and invasive isolates according to specific criteria. Sixteen colonising and seven invasive (bacteraemic VAP-producing) A. baumannii isolates, obtained from TBA samples of 23 different patients from the previous described cohort, were used (Table 5 and Table 6, respectively). These isolates were the only ones that fulfilled all the criteria set out in Section 1.2 of Materials and Methods from Chapter I. Also, the seven bacteraemic A. baumannii isolates recovered in the group of patients with bacteraemic VAP were used for the PFGE studies. Table 5. Colonising clinical isolates selected. Colonising isolates C1 (8.18 log10 CFU/mL) C9 (7.48 log10 CFU/mL) C2 (8.81 log10 CFU/mL) C10 (8.45 log10 CFU/mL) C3 (8.54 log10 CFU/mL) C11 (8.56 log10 CFU/mL) C4 (7.02 log10 CFU/mL) C12 (6.62 log10 CFU/mL) C5 (7.04 log10 CFU/mL) C13 (9.13 log10 CFU/mL) C6 (9.19 log10 CFU/mL) C14 (6.66 log10 CFU/mL) C7 (6.85 log10 CFU/mL) C15 (7.48 log10 CFU/mL) C8 (9.17 log10 CFU/mL) C16 (7.95 log10 CFU/mL) C: colonising isolate. In brackets: inoculum contained in the tracheobronchial aspirate sample from which each isolate was obtained. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 118 Table 6. Invasive clinical isolates selected. Invasive isolates IB1 (8.62 log10 CFU/mL) IB2 (6.32 log10 CFU/mL) IB3 (8.75 log10 CFU/mL) IB4 (9.22 log10 CFU/mL) IB6 (8.32 log10 CFU/mL) IB7 (8.59 log10 CFU/mL) IB8 (8.75 log10 CFU/mL) IB: invasive isolate. In brackets: inoculum contained in the tracheobronchial aspirate sample from which each isolate was obtained. Objective 2. To evaluate the clonal relationship and in vitro virulence of colonising and invasive isolates. Selection of isolates for further studies. 2.1. Molecular typing of the isolates by PFGE. Selection of "true" bacteraemic VAP- producing isolates. Applying the criterion of 85% similarity to the PFGE profiles of the first selected isolates obtained from TBA samples (16 colonising and 7 invasive isolates), we found that isolates from the colonising group belonged to 4 different pulsotypes (A-D), while invasive isolates belonged to two of these pulsotypes (B and C) (Figure 4 and Table 7). Otherwise, when the criterion of 100% similarity was applied to the PFGE profiles of the 7 invasive isolates recovered from TBA samples and the 7 isolates obtained from blood cultures of the same bacteraemic VAP patients, we found that the invasive isolates IB1, IB2, IB3, IB4, IB7, and IB8 obtained from TBA had exactly the same PFGE profiles as Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 119 their corresponding A. baumannii isolates recovered from blood cultures (HC1, HC2, HC3, HC4, HC7, and HC8) (Figure 4). Therefore, once confirmed that these patients had a high probability of bacteraemia derived from VAP, we selected these 6 invasive isolates for the next experiments. However, the invasive isolate IB6 was discarded from the study for not having exactly the same PFGE profile as its corresponding bacteraemic isolate (Figure 4). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 120 Dice (Opt:0.50%) (Tol 1.0%-1.0%) (H>0.0% S>0.0%) [0.0%-100.0%] RAFA 100 95 90 85 80 75 70 65 60 55 50 45 RAFA C7 C9 C11 C13 IBN2 IBN8 C1 C10 C3 HC7 HC8 IB7 IB8 IBN4 IBN5 IBN6 IBN3 HC3 IB3 C2 C6 C8 HC4 IB4 IB6 HC6 C14 C15 C16 IBN7 C12 C5 HC2 IB2 HC1 IB1 C4 IBN1 Figure 4. Dendrogram of pulsed-field gel electrophoresis (PFGE) patterns of the first selected colonising (C-number) and invasive isolates (IB-number) obtained from tracheobronchial aspirate samples. PFGE patterns of the bacteraemic isolates (HC- number) from the same patients as invasive isolates were also presented. Green and red lines indicate 85% and 100% similarity among PFGE profiles, respectively. Pairs of invasive isolates from TBA and blood samples from the same patient are highlighted in coloured boxes when they presented exactly the same PFGE pattern, if not, these were marked with a cross. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 121 Table 7. Distribution of the first selected colonising and invasive isolates according to pulsotypes. 2.2. In vitro virulence of the colonising and invasive isolates. Selection of the colonising and invasive isolates with the lowest and highest in vitro virulence, respectively. At the beginning of the present work, it was proposed to assess the in vitro virulence of each isolate by the viability assay in A549 cell cultures, and based on the results, select the 5 colonising isolates with the lowest in vitro virulence and the 5 invasive isolates with the highest, in order to find more differences between them in further analyses. In the case of colonising isolates, 16 isolates met all the criteria specified previously (Section 1.2 of Materials and Methods, Chapter I). However, this number was lower than expected in the case of invasive isolates, 6 isolates only. Therefore, we decided to study the in vitro virulence of all isolates, 16 colonising and 6 invasive, but as a result select the 5 colonising isolates with the lowest in vitro virulence and the 6 invasive isolates directly for next experiments. Results of the in vitro virulence of each isolate assessed are shown in Figure 5. Similar ranges of viability cell reduction were found when infected with colonising or invasive isolates: 59.82%-78.58% and 54.46%-73.82% of cell viability after infection with colonising and invasive isolates, respectively (Figure 5). Thus, when in vitro virulence was compared between groups of colonising and invasive isolates, no significant Pulsotypes Colonising isolates Invasive isolates A C7, C9, C11, C13 - B C1, C2, C3, C6, C8, C10, C14, C15, C16 IB3, IB4, IB6, IB7, IB8 C C5, C12 IB1, IB2 D C4 - Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 128 Table 11. Comparison of the general features of the 5 colonising and 6 invasive isolates after whole-genome sequencing data processing. 4.2. Molecular typing of the isolates by MLST. Two different STs were found among colonising and invasive isolates according to the Bartual/Oxford MLST scheme: most isolates belong to ST208, except C12, IB1, and IB2 that belong to ST218 (Table 12). ST208 and ST218 share 6 out of 7 alleles with ST92 (CC92) differing both only at the gpi allele with ST92 (https://pubmlst.org/abaumannii/). Following the current definition of CC (47), all isolates were thus assigned to CC92 in the Bartual/Oxford scheme. According to the Pasteur MLST scheme, isolates C12, IB1, and IB2 belong to ST2 (CC2), isolates C7 and C11 belong to ST745, and the rest of the Isolates Mean coverage (fold) No. contigsa Contig N50 (bp)a No. contigsb Contig N50 (bp)b Contig total length (bp)c G+C (%) No. proteincoding genes C6 21 343 55,866 175 55,866 3,892,724 39.0 3,728 C7 22 374 46,492 207 46,492 4,143,108 39.2 3,970 C8 27 317 47,748 180 47,748 3,949,375 39.1 3,788 C11 31 363 43,355 215 43,355 4,139,387 39.2 3,988 C12 18 443 48,899 223 48,899 4,128,796 39.2 3,996 IB1 32 368 58,150 196 58,150 4,122,522 39.2 3,972 IB2 11 809 18,541 463 18,541 3,974,939 39.3 3,765 IB3 25 459 30,711 276 30,711 3,876,316 39.1 3,692 IB4 22 741 18,979 456 18,979 3,820,049 39.3 3,631 IB7 21 603 23,292 358 23,292 3,886,324 39.2 3,715 IB8 22 572 26,333 347 26,333 3,920,594 39.2 3,761 C: colonising isolate; IB: invasive isolate. aBefore filtering contigs > 500 bp. bAfter filtering contigs > 500 bp. cTotal genome assembled with ABySS. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 129 isolates belong to ST187 (Table 12).. ST187 and ST745 share 6 out of 7 alleles with ST2 differing both only at the rpoB allele with ST2 (https://pubmlst.org/abaumannii/). All isolates were thus assigned to CC2 in the Pasteur scheme. It follows that all isolates belong to CC92 (Bartual/Oxford)/CC2 (Pasteur), the most widely disseminated A. baumannii clonal complex worldwide (47). Besides, when these results were compared with PFGE results, Pasteur MLST scheme was the one that exactly matched the PFGE results, having both in addition a greater discriminatory power than the Bartual/Oxford MLST scheme (Table 12). Thus, taking into account the MLST and PFGE results, there was no relationship between the ability to cause or not infection and the clone they belonged to. Table 12. Summary of the multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) typing results for colonising and invasive isolates. C: colonising isolate; IB: invasive isolate. Isolates MLST Bartual/Oxford scheme MLST Pasteur scheme PFGE C6 ST208 ST187 Pulsotype B C7 ST208 ST745 Pulsotype A C8 ST208 ST187 Pulsotype B C11 ST208 ST745 Pulsotype A C12 ST218 ST2 Pulsotype C IB1 ST218 ST2 Pulsotype C IB2 ST218 ST2 Pulsotype C IB3 ST208 ST187 Pulsotype B IB4 ST208 ST187 Pulsotype B IB7 ST208 ST187 Pulsotype B IB8 ST208 ST187 Pulsotype B Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 130 4.3. Antimicrobial resistance mechanisms. A wide variety of genes associated with resistance to β-lactams, aminoglycosides, sulfonamides, and tetracyclines, as well as point mutations in genes associated with quinolones and rifampicin resistance, were detected in most colonising and invasive isolates when WGS data was analysed with several bioinformatics approaches and tools (Table 13), explaining most of the antimicrobial susceptibility profiles. However, clear distinctions in the composition of antimicrobial resistance mechanisms among ST/PFGE types were observed, while no association with the colonising/invasive phenotypes was detected. With respect to β-lactam resistance genes, both cephalosporinase- (class C β-lactamase) and OXA-type carbapenemase (class D β-lactamase or CHDLs)-encoding genes were identified in all isolates. Specifically, all isolates possessed the blaADC-25 gene, which is intrinsic to Acinetobacter spp. and encodes an AmpC-type cephalosporinase. This enzyme is constitutively expressed at low levels, but may be responsible for clinically significant resistance to third-generation cephalosporins, such as ceftazidime and cefotaxime, when expressed from the promotor provided by ISAba1 (406). Thus, ISAba1 was detected upstream of the blaADC-25 gene in all the isolates from ST745, 1 isolate from ST178 (C8), and 2 isolates from ST2 (C12 and IB1), mechanism that has been also associated with sulbactam resistance (218). Regarding the OXA-type carbapenemases, all isolates had a gene coding for a naturally occurring OXA-51-like β-lactamase: isolates from ST745 and ST187 possessed blaOXA-66, while isolates belonging to ST2 had blaOXA- 109. Both OXA-51-like enzymes show weak carbapenemase activity, although the presence of ISAba1 upstream the blaOXA-51-like gene may provide a promoter that leads to overproduction, thus generating resistance to carbapenems (407, 408). Therefore, only in 2 of these isolates (C12 and IB1), the blaOXA-51-like gene was overexpressed due to the presence of an ISAba1 upstream, but the rest of the isolates had an additional acquired carbapenemase. Isolates from ST745 and ST187 carried blaOXA-58 with ISAba3 located upstream and in the opposite orientation to this gene (associated with resistance to penicillins and carbapenems), and only the isolate IB2 from ST2 harboured blaOXA-24/40 (associated with resistance to penicillins, cephalosporins, and carbapenems) (409). None of these isolates had any other β-lactamase-encoding genes registered at ResFinder database. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 131 With respect to aminoglycoside resistance genes, all isolates possessed several AMEs. Isolates belonging to ST745 and ST2 had the acetyltransferase-encoding gene aac(6')-Ip (encodes resistance to amikacin and tobramycin, among others), and two phosphotransferase-encoding genes, strA and strB (both encodes resistance to streptomycin) (410). Moreover, isolates from ST2 has an extra acetyltransferaseencoding gene, aac(3)-IIa, which encodes resistance to gentamicin and tobramycin (410). On the other hand, isolates from ST187 harboured the acetyltransferase-encoding gene aac(3)-Ia (encodes resistance to gentamicin), the adenylyltransferase-encoding gene aadA1 (encodes resistance to streptomycin and spectinomycin), strA and strB (410). None of the isolates had the 16S rRNA methylase-encoding gene armA. Regarding the quinolone resistance mechanisms, all isolates had point mutations in the QRDRs of gyrA and parC, genes coding for the quinolone target enzymes DNA gyrase (GyrA subunit) and topoisomerase IV (ParC subunit), respectively. In particular, these identified mutations caused amino acid substitution in GyrA (Ser83Leu) and ParC (Ser80Leu). This combination of mutations has been previously associated with high level resistance to quinolones in A baumannii (411, 412). Moreover, none of the isolates possessed qnr genes. Likewise, point mutations in the conserved regions of rpoB gene (encodes the β-subunit of the rifampicin target enzyme RNA polymerase) that resulted in the substitution of a single amino acid in the conserved domain II of the RNA polymerase β-subunit RpoB were found in isolates belonging to ST745 (mutation I581M) and ST187 (mutation S583L). In this case, only the mutation I581M has been previously described and associated with high resistance to rifampicin (413). No mutation was found in rpoB gene of the isolates from ST2. Moreover, none of the isolates had the arr-2 gene. Furthermore, the sulfonamide resistance genes sul1 and sul2 (encode forms of the target enzyme dihydropteroate synthase that are not inhibited by sulfonamides (414)) was found in isolates belonging to ST745 and ST187, while isolates from ST2 only harboured sul1. Finally, all isolates possessed the tet(B) gene, which codes for an efflux protein that confers resistance to tetracycline, minocycline, and doxycycline, but not glycylciclines (tigecycline) (415, 416); and none of the isolates had mcr genes, associated with colistin resistance, as expected Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 132 Table 13. Antimicrobial resistance mechanisms found with ResFinder and BLASTP in the colonising and invasive isolates. C: colonising isolate; IB: invasive isolate. aAmino acid position equivalent to Ser-83 of E. coli. bAmino acid positions equivalent to Ser-80 and Ser-463 of E. coli. Isolates β-lactams Aminoglycosides Quinolones Rifampicin Sulfonamides Tetracyclines ST745 (C7 and C11) blaADC-25, blaOXA-66, blaOXA-58 aac(6')-Ip, strA, strB S83L mutation in gyrAa, S80L mutation in parCb I581M mutation in rpoB sul1, sul2 tet(B) ST187 (C6, C8, IB3, IB4, IB7, and IB8) blaADC-25, blaOXA-66, blaOXA-58 aac(3)-Ia, aadA1, strA, strB S83L mutation in gyrAa, S80L mutation in parCb S583L mutation in rpoB sul1, sul2 tet(B) ST2 (C12, IB1, and IB2) blaADC-25, blaOXA-109 blaOXA-24/40 (only in IB2) aac(6')-Ip, aac(3)-IIa, strA, strB S83L mutation in gyrAa, S80L mutation in parCb - sul1 tet(B) Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 133 4.4. Virulence factors. Most of the virulence genes searched were found in all colonising and invasive isolates (64 out of the 82 genes contained in the reference A. baumannii isolate AB0057) (Table 14). It is worth noting that those genes found belonged to all virulence factor classes studied in this analysis: adherence, biofilm formation, phospholipase enzymes, immune evasion, iron uptake, regulation, and serum resistance. On the other hand, only two genes involved in heme utilization were identified in all isolates, in comparison with the ten genes found in AB0057. Moreover, the number of genes related to capsule formation were variable among isolates, but it was associated with the ST type, possessing isolates from ST2 the least number. Thus, the composition of known virulence genes had no association with the isolate phenotype (colonising/invasive). Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 134 Table 14. Virulence genes found in the colonising and invasive isolates. Virulence factor class Virulence factorsa Related genesa Isolates presenting the corresponding gene Adherence Outer membrane protein ompA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Biofilm formation AdeFGH efflux pump/transport autoinducer adeF C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 adeG C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 adeH C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Biofilm associated protein bap C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Csu pili csuA/B C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 csuA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 csuB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 csuC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 csuD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 csuE C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 PNAG pgaA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 pgaB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 pgaC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 pgaD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Enzyme Phospholipase C plC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Phospholipase D plD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Immune evasion LPS lpsB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 lpxA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 lpxB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 lpxC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 lpxD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 135 lpxL C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 lpxM C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Capsule AB57_0091 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0092 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0093 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0094 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0095 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0096 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0097 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0098 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0099 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0100 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0101 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0102 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0103 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0104 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0105 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0106 C6 C7 C8 C11 C12 IB1 - IB3 IB4 IB7 IB8 AB57_0107 C6 C7 C8 C11 C12 IB1 - IB3 IB4 IB7 IB8 AB57_0108 C6 C7 C8 C11 - - - IB3 IB4 IB7 IB8 AB57_0109 C6 C7 C8 C11 - - - IB3 IB4 IB7 - AB57_0110 C6 C7 C8 C11 - - - IB3 IB4 - - AB57_0111 C6 - C8 C11 - - - - - - - AB57_0112 - - - - - - - - - - - AB57_0113 - - - - - - - - - - - AB57_0114 - - - - - - - - - - - Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 136 AB57_0115 - - - - - - - - - - - Iron uptake Acinetobactin barA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 barB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basF C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basG C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basH C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basI C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 basJ C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauA C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauB C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauC C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauD C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauE C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bauF C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 entE C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Heme utilization hemO - - - - - - - - - - - AB57_0984 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 AB57_0985 - - - - - - - - - - - AB57_0986 - - - - - - - - - - - AB57_0987 - - - - - - - - - - - AB57_0988 - - - - - - - - - - - AB57_0989 - - - - - - - - - - - Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 137 AB57_0990 - - - - - - - - - - - AB57_0992 - - - - - - - - - - - AB57_0993 C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Regulation Quorum sensing abaI C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 abaR C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Two component system bfmR C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 bfmS C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 Serum resistance Polysaccharide polymer pbpG C6 C7 C8 C11 C12 IB1 IB2 IB3 IB4 IB7 IB8 C: colonising isolate; IB: invasive isolate. aVirulence factors/genes described in the A. baumannii isolate AB0057. PNAG: polysaccharide poly-N-acetylglucosamine; LPS: lipopolysaccharide. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 144 Objective 3. To perform WGS and data analysis (MLST, antimicrobial resistance and virulence determinants) of the bacteraemic A. baumannii isolates. 3.1. WGS data processing. WGS data-processing results of the 6 bacteraemic isolates are shown in Table 19. The mean coverage of the WGS was 92 ± 6-fold (mean ± SEM of the 6 isolates). De novo assembly of the raw reads resulted in 173 ± 6 contigs (mean ± SEM of the 6 isolates), with an N50 of 101,802 ± 5,110 bp (mean ± SEM of the 6 isolates). The contig total length was 3,984,000 ± 29,848 bp (mean ± SEM of the 6 isolates), covering the total A. baumannii genome size (266, 404). The G+C content was 39.08% ± 0.02% (mean ± SEM of the 6 isolates), similar to the value usually reported for A. baumannii strains (376). Furthermore, the number of protein-coding genes predicted and annotated was 3,909 ± 35 (mean ± SEM of the 6 isolates), in range with the number of protein-coding genes usually reported for A. baumannii (405). Table 19. Comparison of the general features of the bacteraemic isolates after wholegenome sequencing data processing. Isolates Mean coverage (X) No. contigs Contig N50 (bp) Contig total length (bp)a G+C (%) No. predicted proteins B1 109 187 121,094 4,079,150 39.13 4,038 B4 102 167 110,911 4,033,331 39.12 3,943 B7 88 197 91,138 3,938,157 39.03 3,890 B8 74 163 94,216 3,894,247 39.04 3,796 B9 80 168 103,992 4,029,100 39.12 3,940 B11 102 160 89,463 3,928,781 39.02 3,847 aTotal genome assembled with SPAdes. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 145 3.2. Molecular typing of the clinical isolates by MLST. Bartual/Oxford MLST scheme assigned ST218 for B1 and ST208 for the other five isolates (Table 20). Therefore, all isolates were thus assigned to CC92 in the Bartual/Oxford scheme according to the current definition of CC, as explained in Section 2.2 of Results (Chapter I). Pasteur MLST scheme, assigned ST2 for B1, ST745 for B4 and B9, and ST187 for B7, B8, and B11 isolates. All isolates were thus assigned to CC2 in the Pasteur scheme (Section 2.2 of Results, Chapter I). So, these six isolates belong to CC92 (Bartual/Oxford)/CC2 (Pasteur), the largest and most widely distributed A. baumannii global clone (47), as isolates from Chapter I. PFGE profiles were better accordance with the Pasteur MLST scheme, indicating also in this case a slightly better discriminatory power for these two methodologies as compared to the MLST Oxford scheme. Nevertheless, there was no association between the bacterial clonality and the clinical outcomes of the patients. Table 20. Summary of the multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE) typing results for the six bacteraemic isolates. 3.3. Antimicrobial resistance mechanisms. Isolates MLST Bartual/Oxford scheme MLST Pasteur scheme PFGE B1 ST218 ST2 Pulsotype C B4 ST208 ST745 Pulsotype A B7 ST208 ST187 Pulsotype B B8 ST208 ST187 Pulsotype B B9 ST208 ST745 Pulsotype A B11 ST208 ST187 Pulsotype B Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 146 Several genes related to resistance to β-lactams, aminoglycosides, sulfonamides, and tetracyclines, in addition to point mutations in target genes associated with resistance to quinolones and rifampicin, were detected in most isolates by WGS data analysis using ResFinder and BLASTP (Table 21), explaining most of the antimicrobial susceptibility profiles. In fact, these antimicrobial resistance mechanisms were exactly the same as those found in isolates from Chapter I, existing again an association between their composition of antimicrobial resistance mechanisms and the clone they belonged to, but no with the clinical outcomes of the CRAB bacteraemia. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 147 Table 21. Antimicrobial resistance mechanisms found with ResFinder and BLASTP in the bacteraemic isolates. aAmino acid position equivalent to Ser-83 of E. coli. bAmino acid positions equivalent to Ser-80 and Ser-463 of E. coli. Isolates β-lactams Aminoglycosides Quinolones Rifampicin Sulfonamides Tetracyclines ST745 (B4 and B9) blaADC-25, blaOXA-66 blaOXA- 58 aac(6')-Ip, strA, strB S83L mutation in gyrAa, S80L mutation in parCb I581M mutation in rpoB sul1, sul2 tet(B) ST187 (B7, B8, and B11) blaADC-25, blaOXA-66 blaOXA- 58 aac(3)-Ia, aadA1, strA, strB S83L mutation in gyrAa, S80Lmutation in parCb S583L mutation in rpoB sul1, sul2 tet(B) ST2 (B1) blaADC-25, blaOXA-109 blaOXA-24/40 aac(6')-Ip, aac(3)-IIa, strA, strB S83L mutation in gyrAa, S80L mutation in parCb - sul1 tet(B) Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 148 On the other hand, with the additional bioinformatics analysis, in which genes with functional annotations including either the term "resistance" or "antibiotic" were considered as resistance genes, a more extensive list of resistance genes were obtained from the six bacteraemic isolates (Table 22), although there were still no differences between isolates from surviving and non-surviving patients. Most genes detected with ResFinder appeared in this list, although some genes did not. On the other hand, genes not considered by ResFinder, but identified within this analysis, were genes encoding multidrug efflux pumps, genes conferring resistance to antiseptics (acriflavine, for example) and antimicrobials not considered in this study (such as bicyclomycin or fosmidomycin), and heavy metal resistance genes. In addition, it is worth noting that isolate B1 contained a higher number of these resistance genes in comparison with the other bacteraemic isolates. Table 22. Genes with "resistance" or "antibiotic" functional annotations found in the bacteraemic isolates. Gene name Description Isolates presenting the corresponding gene mexB Multidrug resistance protein MexB B1 B4 B7 B8 B9 B11 nolG Acriflavine resistance protein B1 B4 B7 B8 B9 B11 yhcA Putative multidrug resistance protein B1 B4 B7 B8 B9 B11 emrY Drug resistance transporter EmrB/QacA suBfamily B1 B4 B7 B8 B9 B11 emrB Multidrug resistance protein B B1 B4 B7 B8 B9 B11 smvA Major facilitator superfamily methyl viologen resistance protein B1 B4 B7 B8 B9 B11 czcC Cobalt-zinc-cadmium resistance protein CzcC B1 B4 B7 B8 B9 B11 farB MFS transporter, DHA2 family, multidrug resistance protein B B1 B4 B7 B8 B9 B11 ypnP Multidrug resistance protein, MATE family B1 B4 B7 B8 B9 B11 norM Multidrug resistance protein, MATE family B1 B4 B7 B8 B9 B11 acrA Acriflavine resistance protein A B1 B4 B7 B8 B9 B11 fsr Fosmidomycin resistance protein B1 B4 B7 B8 B9 B11 mexB Resistance-nodulation-cell division (RND) multidrug efflux transporter MexB B1 B4 B7 B8 B9 B11 merA Mercuric reductase B1 - - - - - tetB Tetracycline resistance protein, class B B1 B4 B7 B8 B9 B11 bcr Bicyclomycin resistance protein B1 B4 B7 B8 B9 B11 ABSDF2 341 Putative multidrug resistance protein B1 B4 B7 B8 B9 B11 ABAYE2 235 Putative tetracycline resistance protein B1 B4 B7 B8 B9 B11 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 149 emrA Membrane fusion component of tripartite multidrug resistance system B1 B4 B7 B8 B9 B11 ampC Beta-lactamase B1 B4 B7 B8 B9 B11 M3Q_pA BCC8 Toxic anion resistance protein TelA B1 - B7 B8 - B11 yBhR Antibiotic transport system permease protein B1 B4 B7 B8 B9 B11 emrA Multidrug resistance protein A B1 B4 B7 B8 B9 B11 pac Penicillin amidase B1 B4 B7 B8 B9 B11 emrA Putative multidrug resistance efflux pump B1 B4 B7 B8 B9 B11 arsB Arsenical-resistance protein B1 B4 - - B9 - cacD Cobalt-zinc-cadmium resistance protein CzcD B1 B4 B7 B8 B9 B11 ABAYE0 009 Putative RND type efflux pump involved in aminoglycoside resistance (AdeT) B1 B4 B7 B8 B9 B11 ABAYE0 008 Putative RND type efflux pump involved in aminoglycoside resistance (AdeT) B1 B4 B7 B8 B9 B11 adeT RND efflux pump involved in aminoglycoside resistance B1 B4 B7 B8 B9 B11 ydhJ Multidrug resistance protein A B1 B4 B7 B8 B9 B11 adeT RND type efflux pump involved in aminoglycoside resistance B1 B4 B7 B8 B9 B11 folP Dihydropteroate synthase - B4 B7 B8 B9 B11 aac(3)II Aminoglycoside N(3)-acetyltransferase III B1 - - - - - mrcB Penicillin-binding protein 1B B1 B4 B7 B8 B9 B11 sul1 Dihydropteroate synthase B1 B4 B7 B8 B9 B11 strB Streptomycin resistance protein B1 B4 B7 B8 B9 B11 cpo Chloride peroxidase B1 B4 B7 B8 B9 B11 uppP Undecaprenyl-diphosphatase B1 B4 B7 B8 B9 B11 blaoxa58 Beta-lactamase - B4 B7 B8 B9 B11 pcoB Copper resistance protein B B1 B4 B7 B8 B9 B11 gacA Response regulator (Global antibiotic and cyanide control protein, LuxR/UhpA family) B1 B4 B7 B8 B9 B11 A1S_031 7 Putative fusaric acid resistance protein B1 B4 B7 B8 B9 B11 yahN Resistance factor to homoserine/threonine, RhtB family B1 B4 B7 B8 B9 B11 yrhP Resistance factor to homoserine/threonine, RhtB family B1 B4 B7 B8 B9 B11 tetR Tetracycline repressor protein B1 B4 B7 B8 B9 B11 aac(6')I Aminoglycoside acetyltransferase (6') type I B1 B4 - - B9 - ABAYE1 699 Putative transcriptional repressor of multidrug resistance pump (MarR family) B1 B4 B7 B8 B9 B11 tmrB Tunicamycin resistance protein B1 - - - - - aac(3)I AAC(3)-Ia aminoglycoside (3) acetyltransferase - - B7 B8 - B11 aadA1 Aminoglycoside-3''-adenylyltransferase ANT(3'')-I B1 B4 B7 B8 B9 B11 ABAYE1 609 Putative transcriptional repressor of multidrug resistance pump (MarR family) B1 B4 B7 B8 B9 B11 macB Macrolide export ATP-binding/permease protein MacB3.6.3 B1 B4 B7 B8 B9 B11 merR MerR regulatory protein B1 B4 B7 B8 B9 B11 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 150 3.4. Virulence factors. Sixty-six out of the 82 known virulence genes contained in the reference A. baumannii isolate AB0057 were found in the six bacteraemic isolates (Table 23), belonging to all virulence factor classes analysed (adherence, biofilm formation, phospholipase enzymes, immune evasion, iron uptake, regulation, and serum resistance). Only two genes involved in heme utilization were detected. Moreover, the number of genes related to capsule formation were variable among isolates, but it was again associated with the ST type, possessing isolate B1, which belonged to ST2, the least number of these genes. Thus, the composition of known virulence genes had no association with the clinical outcomes of the CRAB bacteraemia. ohr Organic hydroperoxide resistance protein B1 B4 B7 B8 B9 B11 carO Carbapenem-associated resistance protein B1 B4 B7 - - - merC Mercuric resistance protein B1 B4 B7 B8 B9 B11 sugE Quaternary ammonium compound-resistance protein B1 B4 B7 B8 B9 B11 merD Mercuric resistance transcriptional repressor protein - B4 - - B9 - AQ481_0 0120 Antibiotic biosynthesis monooxygenase B1 B4 B7 B8 B9 B11 pcoB Copper resistance protein CopB B1 - - - - - pcoA Copper resistance protein A B1 B4 B7 B8 B9 B11 eBr Delta-quaternary ammonium resistance protein B1 - - - - - merA Mercuric reductase B1 B4 B7 B8 B9 B11 emrB Drug resistance transporter EmrB/QacA suBfamily B1 B4 B7 B8 B9 B11 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 151 Table 23. Virulence genes found in the bacteraemic isolates. Virulence factor class Virulence factorsa Related genesa Isolates presenting the corresponding gene Adherence Outer membrane protein ompA B1 B4 B7 B8 B9 B11 Biofilm formation AdeFGH efflux pump/transport autoinducer adeF B1 B4 B7 B8 B9 B11 adeG B1 B4 B7 B8 B9 B11 adeH B1 B4 B7 B8 B9 B11 Biofilm associated protein bap B1 B4 B7 B8 B9 B11 Csu pili csuA/B B1 B4 B7 B8 B9 B11 csuA B1 B4 B7 B8 B9 B11 csuB B1 B4 B7 B8 B9 B11 csuC B1 B4 B7 B8 B9 B11 csuD B1 B4 B7 B8 B9 B11 csuE B1 B4 B7 B8 B9 B11 PNAG pgaA B1 B4 B7 B8 B9 B11 pgaB B1 B4 B7 B8 B9 B11 pgaC B1 B4 B7 B8 B9 B11 pgaD B1 B4 B7 B8 B9 B11 Enzyme Phospholipase C plC B1 B4 B7 B8 B9 B11 Phospholipase D plD B1 B4 B7 B8 B9 B11 Immune evasion LPS lpsB B1 B4 B7 B8 B9 B11 lpxA B1 B4 B7 B8 B9 B11 lpxB B1 B4 B7 B8 B9 B11 lpxC B1 B4 B7 B8 B9 B11 lpxD B1 B4 B7 B8 B9 B11 lpxL B1 B4 B7 B8 B9 B11 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 152 lpxM B1 B4 B7 B8 B9 B11 Capsule AB57_0091 B1 B4 B7 B8 B9 B11 AB57_0092 B1 B4 B7 B8 B9 B11 AB57_0093 B1 B4 B7 B8 B9 B11 AB57_0094 B1 B4 B7 B8 B9 B11 AB57_0095 B1 B4 B7 B8 B9 B11 AB57_0096 B1 B4 B7 B8 B9 B11 AB57_0097 B1 B4 B7 B8 B9 B11 AB57_0098 B1 B4 B7 B8 B9 B11 AB57_0099 B1 B4 B7 B8 B9 B11 AB57_0100 B1 B4 B7 B8 B9 B11 AB57_0101 B1 B4 B7 B8 B9 B11 AB57_0102 B1 B4 B7 B8 B9 B11 AB57_0103 B1 B4 B7 B8 B9 B11 AB57_0104 B1 B4 B7 B8 B9 B11 AB57_0105 B1 B4 B7 B8 B9 B11 AB57_0106 B1 B4 B7 B8 B9 B11 AB57_0107 B1 B4 B7 B8 B9 B11 AB57_0108 - B4 B7 B8 B9 B11 AB57_0109 - B4 B7 B8 B9 B11 AB57_0110 - B4 B7 B8 B9 B11 AB57_0111 - B4 B7 B8 B9 B11 AB57_0112 - - - - - - AB57_0113 - - - - - - AB57_0114 - - - - - - AB57_0115 - - - - - - Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
RESULTS 153 Iron uptake Acinetobactin barA B1 B4 B7 B8 B9 B11 barB B1 B4 B7 B8 B9 B11 basA B1 B4 B7 B8 B9 B11 basB B1 B4 B7 B8 B9 B11 basC B1 B4 B7 B8 B9 B11 basD B1 B4 B7 B8 B9 B11 basF B1 B4 B7 B8 B9 B11 basG B1 B4 B7 B8 B9 B11 basH B1 B4 B7 B8 B9 B11 basI B1 B4 B7 B8 B9 B11 basJ B1 B4 B7 B8 B9 B11 bauA B1 B4 B7 B8 B9 B11 bauB B1 B4 B7 B8 B9 B11 bauC B1 B4 B7 B8 B9 B11 bauD B1 B4 B7 B8 B9 B11 bauE B1 B4 B7 B8 B9 B11 bauF B1 B4 B7 B8 B9 B11 entE B1 B4 B7 B8 B9 B11 Heme utilization hemO - - - - - - AB57_0984 B1 B4 B7 B8 B9 B11 AB57_0985 - - - - - - AB57_0986 - - - - - - AB57_0987 - - - - - - AB57_0988 - - - - - - AB57_0989 - - - - - - AB57_0990 - - - - - - Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 256 Differences in MLD were found between the 17978 wt strain and its isogenic mutant 17978 ΔcarO (3.20 log10 CFU/mL vs. 4.30 log10 CFU/mL, respectively), and also between the CRAB clinical isolate with a functional CarO protein, B4, vs. the one with a truncated CarO, B9 (4.00 log10 CFU/mL vs. 5.18 log10 CFU/mL, respectively). Moreover, survival analyses revealed differences between animals inoculated with the different strains/isolates using the MLD of those with complete carO gene (Fig. 5). These results indicated that CarO plays an important role in the infective capacity and mortality caused by A. baumannii in vivo. Effect of CarO in in vivo dissemination of A. baumannii 17978 cells into mice tissues and fluids We next compared the dissemination of the 17978 wt, mutant, and complemented strains into different organs and fluids in mice inoculated i.p. with 3.2 log10 CFU/mL of each bacterial strain (Fig. 6). Mice infected with the 17978 ΔcarO strain showed at 8 h significant lower bacterial burden in all organs and fluids studied when compared with animals infected with the 17978 wt strain. These differences were even greater 24 h postinfection. Complementation of the ΔcarO mutant restored almost the wt count levels at 8 and 24 h. These results indicate that CarO affects the dissemination of A. baumannii in mice. Discussion In this study, we first investigated the virulence factors of CRAB clinical isolates from six adult patients with BSI secondary to A. baumannii VAP. Despite their demographics and clinical characteristics homogeneity, as well as receiving optimal therapy with colistin, three patients survived while the others three did not. Using a combination of Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 257 experimental approaches, we detected that the OMP CarO was present in the isolates from non-surviving patients, while the isolates from the group of surviving patients lacked it due to the selection of different mutations affecting the carO gene. Then, additional genetic evidence indicating a virulence role in A. baumannii for CarO was obtained by using the model type strains ATCC 17978 and ATCC 19606, their isogenic ΔcarO mutants, and the ΔcarO mutants complemented with a plasmid reinstating CarO expression, as well as two of the CRAB clinical isolates. Significant reductions were observed in adherence and invasion of cultured human lung epithelial cells, as well as higher MLD and lower dissemination into essential organs and fluids in the peritoneal sepsis murine model, in strains/isolate lacking CarO. CarO is the second most abundant protein after OmpA in the A. baumannii OM (20) and it has been previously associated to the acquisition of carbapenem resistance (when it is lost or mutated) due to its participation in the selective permeation of imipenem across the Acinetobacter OM (20, 24, 28, 29). Nevertheless, similarly to OmpA (30), several evidences exist suggesting that this protein could also play role(s) in pathogenesis. First, it has been noted that A. baumannii can catabolise both arginine and ornithine (29), two basic amino acids present in the blood of mammals in which the arginine-to-ornithine conversion is increased after severe skin injury. This, added to the observation that CarO levels in the A. baumannii OM are optimum at 37 ºC and its role as a basic amino acid OM channel, led to suggest that CarO may form part of a fine-tuned mechanism of response to specific signals when confronting a compromised host (29). Second, four well-defined allelic variants of CarO co-exist in the A. baumannii clinical population, and the cognate genes are frequently exchanged between different A. baumannii lineages by horizontal gene transfer and assortative recombination; an exchange that could facilitate, Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 258 among others, A. baumannii persistence by evading the host immune response (20). Third, increased expression of CarO has been described in A. baumannii cells during ironlimiting conditions (31) and biofilm formation (32, 33), also suggesting roles for CarO in pathogenesis. Fourth, we reported previously that reduced expression of CarO and OprD in a clinical PDR A. baumannii isolate was concomitant with lower virulence, thus suggesting also roles for these OMPs in this process (34). Fifth, it has recently been shown using the A. baumannii type strain ATCC 19606 that CarO promotes bacterial adhesion and nasal colonisation in mice mainly through inhibiting host cell inflammatory immunity responses, again indicating roles for this OMP in pathogenesis (35). Thus, different lines of evidence and the results of this work point to CarO as an important factor involved in A. baumannii recognition and attachment to epithelial cells, in reaching the bloodstream with the potentiality of causing BSI, and also in the invasion of different organs in mammals. Further work is certainly needed to clarify the exact role(s) of this small βbarrel OMP in A. baumannii pathogenesis. OMPs functioning at the interface with the environment constitute prime candidates for the design of inhibitors aimed to disturb recognition of target cells by the pathogen (36, 37). Most commonly prescribed antibiotics are either bactericidal or bacteriostatic, and the majority work against a broad spectrum of bacteria. There are key approaches that could help to alleviate the problem of antibiotic resistance: first, the development of therapies focused on the specific treatment of infections caused by a single pathogen highly resistant to antimicrobial agents (38); and second, targeting bacterial virulence factors without inhibiting bacterial growth, which can slow the development of drug resistance by reducing the selective pressure on the bacteria (36, 39). CarO presence is restricted to the OM of Moraxellaceae family members, to which the genus Acinetobacter Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 259 belongs (24). Therefore, an inhibitor targeted towards CarO might provide us with a dedicated therapeutic agent, affecting not only A. baumannii but also other pathogenic species of the Acinetobacter genus and even the Moraxellaceae family. Recently, our group together with Giralt et al., developed a series of OmpA inhibitors and tested their effectiveness in vitro and in vivo in preventing infection by the most prevalent gramnegative bacilli (GNB) in clinical settings including A. baumannii (37). One of these peptides, a cyclic hexapeptide (AOA-2) lacking bactericidal or cytotoxic activities, was able to inhibit GNB adherence to host cells and biofilm formation, thereby preventing the development of infection in vitro and in a murine model of peritoneal sepsis (37). A further study indicated that this OmpA inhibitor was effective in combination with colistin in an experimental model of severe infection with colistin-resistant A. baumannii strains (40). This drug discovery program is considered as an initial stage of the development of a novel class of antimicrobial agents, and in this context CarO emerges as an attractive target for drug design. In summary, the results of the present study, both from the WGS complemented with proteomic and immunoblot analyses of carbapenem-resistant A. baumannii clinical isolates causing bloodstream infections and from in vitro and in vivo model systems, are consistent with the role of the protein CarO in the virulence of A. baumannii. Thus, CarO may be suggested as a new target for the development of inhibitors to deal with infections by carbapenem-resistant A. baumannii. Data availability The sequences reported in this paper have been deposited in the National Center for Biotechnology BioProject database (accession number PRJNA417465): Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 260 PKON00000000 (B1), PKOO00000000 (B4), PKOP00000000 (B7), PKOQ00000000 (B8), PKOS00000000 (B9), and PKOR00000000 (B11). Transparency declaration All authors have no conflicts of interest to declare. Funding This study was supported by the Instituto de Salud Carlos III, Proyectos de Investigación en Salud (PI12/02553); by Plan Nacional de I+D+i 2013‐2016 and Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Ciencia, Innovación y Universidades (grant BFU2016-77297-P); by Plan Nacional de I+D+i 2013‐2016 and Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Ciencia, Innovación y Universidades, Spanish Network for Research in Infectious Diseases (REIPI RD16/0016/0009) ‐ cofinanced by European Development Regional Fund “A way to achieve Europe”, Operative program Intelligent Growth 2014‐2020; and by PICT-2015- 1072 to Alejandro M. Viale, PICT-2017-3536 to Jorgelina Morán-Barrio (Agencia Nacional de Promoción Científica y Tecnológica, ANPCyT, Argentina). G.L.H. is supported by the program i-PFIS (Doctorados IIS-Empresa en Ciencias y Tecnologías de la Salud), Instituto de Salud Carlos III, Subdirección General de Redes y Centros de Investigación Cooperativa, Ministerio de Ciencia, Innovación y Universidades (IFI15/00128). T.C.C. is supported by the V Plan Propio of the University of Seville with a postdoctoral contract. M.E.P.I. is a postdoctoral researcher belonging to the program “Nicolás Monardes” (C1-0038-2019), Servicio Andaluz de Salud, Junta de Andalucía, Spain. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 261 Acknowledgments We would like to thank Dr. Henrik Hasman (Department of Bacteria, Parasites and Fungi, Statens Serum Institut, Copenhagen, Denmark) for the WGS, and C3UPO (Pablo de Olavide University, Seville, Spain) for the high-performance computing (HPC) support. References 1. Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: multidrugresistant Acinetobacter baumannii. Nature reviews Microbiology. 2007;5(12):939-51. 2. Cisneros JM, Rodríguez-Baño J. Nosocomial bacteremia due to Acinetobacter baumannii: epidemiology, clinical features and treatment. Clinical microbiology and infection: the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 2002;8(11):687-93. 3. Ballouz T, Aridi J, Afif C, Irani J, Lakis C, Nasreddine R, et al. Risk factors, clinical presentation, and outcome of Acinetobacter baumannii bacteremia. Frontiers in cellular and infection microbiology. 2017;7:156. 4. García-Quintanilla M, Pulido MR, López-Rojas R, Pachón J, McConnell MJ. Emerging therapies for multidrug resistant Acinetobacter baumannii. Trends in microbiology. 2013;21(3):157-63. 5. McConnell MJ, Actis L, Pachón J. Acinetobacter baumannii: human infections, factors contributing to pathogenesis and animal models. FEMS microbiology reviews. 2013;37(2):130-55. 6. Lee CR, Lee JH, Park M, Park KS, Bae IK, Kim YB, et al. Biology of Acinetobacter baumannii: pathogenesis, antibiotic resistance mechanisms, and Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 262 prospective treatment options. Frontiers in cellular and infection microbiology. 2017;7:55. 7. Dahdouh E, Gomez-Gil R, Pacho S, Mingorance J, Daoud Z, Suarez M. Clonality, virulence determinants, and profiles of resistance of clinical Acinetobacter baumannii isolates obtained from a Spanish hospital. PLOS ONE. 2017;12(4):e0176824. 8. Shirazi AS, Shafiei M, Solgi H, Aslani MM, Azizi O, Badmasti F. Different virulence capabilities and ompA expressions in ST2 and ST513 of multidrugresistant Acinetobacter baumannii. Current microbiology. 2019;76(6):723-31. 9. Sahl JW, Johnson JK, Harris AD, Phillippy AM, Hsiao WW, Thom KA, et al. Genomic comparison of multi-drug resistant invasive and colonizing Acinetobacter baumannii isolated from diverse human body sites reveals genomic plasticity. BMC genomics. 2011;12:291. 10. Álvarez-Marín R, López-Rojas R, Márquez JA, Gómez MJ, Molina J, Cisneros JM, et al. Colistin dosage without loading dose is efficacious when treating carbapenem-resistant Acinetobacter baumannii ventilator-associated pneumonia caused by strains with high susceptibility to colistin. PLOS ONE. 2016;11(12):e0168468. 11. Nurk S, Bankevich A, Antipov D, Gurevich AA, Korobeynikov A, Lapidus A, et al. Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. Journal of computational biology: a journal of computational molecular cell biology. 2013;20(10):714-37. 12. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC bioinformatics. 2010;11:119. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 263 13. Casimiro-Soriguer CS, Muñóz-Mérida A, Pérez-Pulido AJ. Sma3s: A universal tool for easy functional annotation of proteomes and transcriptomes. Proteomics. 2017;17(12). 14. Larsen MV, Cosentino S, Rasmussen S, Friis C, Hasman H, Marvig RL, et al. Multilocus sequence typing of total genome sequenced bacteria. J Clin Microbiol. 2012;50(4):1355-1361. 15. Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, et al. Identification of acquired antimicrobial resistance genes. The Journal of antimicrobial chemotherapy. 2012;67(11):2640-4. 16. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: architecture and applications. BMC bioinformatics. 2009;10:421. 17. Chen L, Yang J, Yu J, Yao Z, Sun L, Shen Y, et al. VFDB: a reference database for bacterial virulence factors. Nucleic acids research. 2005;33(Database issue):D325-8. 18. Huang Y, Niu B, Gao Y, Fu L, Li W. CD-HIT Suite: a web server for clustering and comparing biological sequences. Bioinformatics. 2010;26(5): 680-2. 19. Katoh K, Rozewicki J, Yamada KD. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform 2017;20:1160-1166. 20. Mussi MA, Limansky AS, Relling V, Ravasi P, Arakaki A, Actis LA, et al. Horizontal gene transfer and assortative recombination within the Acinetobacter baumannii clinical population provide genetic diversity at the single carO gene, encoding a major outer membrane protein channel. Journal of bacteriology. 2011;193(18):4736-48. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 264 21. Waterhouse AM, Procter JB, Martin DM, Clamp M, Barton GJ. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics. 2009;25(9):1189-91. 22. Smani Y, McConnell MJ, Pachon J. Role of fibronectin in the adhesion of Acinetobacter baumannii to host cells. PLOS ONE. 2012;7:e33073. 23. Amigo N, Zhang Q, Amadio A, Zhang Q, Silva WM, Cui B, et al. Overexpressed proteins in hypervirulent clade 8 and clade 6 strains of Escherichia coli O157:H7 compared to E. coli O157:H7 EDL933 clade 3 strain. PLOS ONE. 2016;11:e0166883. 24. Mussi MA, Limansky AS, Viale AM. Acquisition of resistance to carbapenems in multidrug-resistant clinical strains of Acinetobacter baumannii: natural insertional inactivation of a gene encoding a member of a novel family of betabarrel outer membrane proteins. Antimicrobial agents and chemotherapy. 2005;49(4):1432-40. 25. Smani Y, Dominguez-Herrera J, Pachón J. Association of the outer membrane protein Omp33 with fitness and virulence of Acinetobacter baumannii. The Journal of infectious diseases. 2013;208(10):1561-70. 26. Gil-Marqués ML, Pachón-Ibáñez ME, Pachón J, Smani Y. Effect of hypoxia on the pathogenesis of Acinetobacter baumannii and Pseudomonas aeruginosa in vitro and in murine experimental models of infection. Infect Immun. 2018;86:e00543-18. 27. Karah N, Sundsfjord A, Towner K, Samuelsen O. Insights into the global molecular epidemiology of carbapenem non-susceptible clones of Acinetobacter baumannii. Drug resistance updates: reviews and commentaries in antimicrobial and anticancer chemotherapy. 2012;15(4):237-47. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 265 28. Zahn M, D'Agostino T, Eren E, Basle A, Ceccarelli M, van den Berg B. Smallmolecule transport by CarO, an abundant eight-stranded beta-barrel outer membrane protein from Acinetobacter baumannii. Journal of molecular biology. 2015;427(14):2329-39. 29. Mussi MA, Relling VM, Limansky AS, Viale AM. CarO, an Acinetobacter baumannii outer membrane protein involved in carbapenem resistance, is essential for L-ornithine uptake. FEBS letters. 2007;581(29):5573-8. 30. Sánchez-Encinales V, Álvarez-Marín R, Pachón-Ibáñez ME, Fernández-Cuenca F, Pascual A, Garnacho-Montero J, et al. Overproduction of outer membrane protein A by Acinetobacter baumannii as a risk factor for nosocomial pneumonia, bacteremia, and mortality rate increase. The Journal of infectious diseases. 2017;215(6):966-74. 31. Nwugo CC, Gaddy JA, Zimbler DL, Actis LA. Deciphering the iron response in Acinetobacter baumannii: A proteomics approach. Journal of proteomics. 2011;74(1):44-58. 32. Cabral MP, Soares NC, Aranda J, Parreira JR, Rumbo C, Poza M, et al. Proteomic and functional analyses reveal a unique lifestyle for Acinetobacter baumannii biofilms and a key role for histidine metabolism. Journal of proteome research. 2011;10(8):3399-417. 33. Marti S, Nait Chabane Y, Alexandre S, Coquet L, Vila J, Jouenne T, et al. Growth of Acinetobacter baumannii in pellicle enhanced the expression of potential virulence factors. PLOS ONE. 2011;6(10):e26030. 34. Fernández-Cuenca F, Smani Y, Gómez-Sánchez MC, Docobo-Pérez F, Caballero-Moyano FJ, Domínguez-Herrera J, et al. Attenuated virulence of a slow-growing pandrug-resistant Acinetobacter baumannii is associated with Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 272 Fig. 5. Analysis of mice survival time in the peritoneal sepsis model by (A) 3.20 log10 CFU/mL of A. baumannii ATCC 17978 wt (17978), its isogenic ΔcarO mutant (17978 ΔcarO), and the complemented strain (17978 ΔcarO/pWH1266-carO) (n = 6 mice/strain); and by (B) 4.00 log10 CFU/mL of the A. baumannii clinical isolates B4 and B9 (n = 4 mice/isolate). Survival curves showed the percentages of mice survival during 7 days. P = 0.03 for 17978 vs. 17978 ΔcarO, and P = 0.04 for B4 vs. B9, log-rank test. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 273 Fig. 6. Bacterial burdens in peritoneal sepsis murine model. Bacterial loads in spleen (A), lungs (B), liver (C), kidneys (D), peritoneal fluid (E), and blood (F), were determined at 8 h and 24 h after intraperitoneal infection with 3.2 log10 CFU/mL of A. baumannii ATCC 17978 wild-type (17978), its isogenic carO deletion mutant (17978 ΔcarO), and the ΔcarO complemented strain (17978 ΔcarO/pWH1266-carO). Data are represented as Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 274 mean ± SEM (n=7 mice/strain for each time point). *P < 0.05, ** P < 0.01, *** P < 0.001, Student's t-test and Mann-Whitney test. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 275 Table 1. Patients' demographics, clinical features and antibiotic therapy. Patient 1 Patient 2 Patient 3 Patient 4 Patient 5 Patient 6 BSI CRAB isolates (codes) B1 B4 B7 B8 B9 B11 Age (years) 34 48 41 35 48 26 Sex Female Male Female Male Male Male Charlson indexa 0 0 0 0 0 0 Diagnosis at ICU admission CAPb Sepsis Stroke Abdominal surgery Fournier's gangrene Cardiovascular surgery APACHE II scorec 23 20 20 15 17 23 CPIS scored 8 6 8 7 6 6 Pitt scoree 6 12 6 7 6 3 Co-infection No No No No No No Septic shock Yes Yes Yes Yes No Yes Acute renal failure Yes No Yes Yes No Yes Multiorgan failure Yes No Yes No No Yes CMSf treatment (MIUg/24 h) 6 8 6 9 9 6 ICU length-of stay (days) 23 18 30 46 31 20 30-days mortality Yes Yes Yes No No No Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 276 aCharlson: comorbidity index; bCAP: community-acquired pneumonia; cAPACHE II: acute physiology and chronic health evaluation II score; dCPIS: clinical pulmonary infection score; ePitt: severity bacteraemia score; fCMS: colistimethate sodium; gMIU: million international units. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 277 Supplementary material Text S1: Materials and methods Identification of known resistance and virulence mechanisms The ResFinder v3.2 web server (https://cge.cbs.dtu.dk/services/ResFinder/) (1) of the CGE was used to identify acquired antimicrobial resistance genes in the assembled WGS data from the six CRAB clinical isolates producing bloodstream infections, using a threshold of 100% identity for the genes encoding β-lactamases and 98% identity for all other genes. Moreover, genes with functional annotations including either the term "resistance" or "antibiotic" were considered as resistance genes. Furthermore, point mutations in the quinolone resistance determining regions (QRDRs) of the genes associated with quinolone resistance (gyrA and parC) were identified in all the isolates comparing the predicted proteins encoded by gyrA and parC with the deduced amino acid sequences of gyrA (UniProt entry: D0CBH9) and parC (UniProt entry: D0CB90) from A. baumannii ATCC 19606 (ciprofloxacin-susceptible strain), and also with those from Escherichia coli K12 (UniProt entries: P0AES4 and P0AFI2, for the deduced amino acid sequences of gyrA and parC, respectively) in order to define the position of the mutations according to the E. coli protein. The BLASTP (protein BLAST, https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins) (2) tool from the National Center for Biotechnology Information (NCBI) was used for the performance of the comparisons. Similarly, point mutations in the conserved regions of rpoB gene, related with rifampicin resistance, was detected following the same procedure described for gyrA and parC, using the deduced amino acid sequences of rpoB (UniProt entry: A3M1G3) from A. baumannii ATCC 17978 (rifampicin-susceptible strain). Identification of Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 278 mutations in pmrAB and lpx genes was not performed due to all isolates were colistinsusceptible. Genes encoding known virulence factors were identified from the WGS data of the clinical isolates using two different strategies. For both strategies, virulence genes described in the MDR A. baumannii isolate AB0057 were used for the comparison, being the A. baumannii isolate with the higher number of virulence genes contained in the Virulence Factors of Pathogenic Bacteria database (VFDB) (http://www.mgc.ac.cn/VFs/) (3). The first strategy was based on the VFanalyzer option of the VFDB (http://www.mgc.ac.cn/cgi-bin/VFs/v5/main.cgi?func=VFanalyzer) (4). VFanalyzer is an automatic analysis pipeline for a systematic screen of known/potential virulence factors in given complete/draft bacterial genomes. So, draft genomes (contig files) were uploaded and Option 3 was selected ("Upload private data of raw or annotated genome in FASTA or GenBank format"). VFanalyzer performed an automatic prediction of proteincoding genes using GLIMMER3 and then ran the comparison analysis. For the second strategy, amino acid sequences of all the virulence factors of A. baumannii isolate AB0057 contained in VFDB were downloaded, and the inferred protein sequences from the six CRAB clinical isolates were compared to them using the standalone version of BLASTP from the NCBI. A protein was related to a virulence factor present in the database when the BLAST hit indicated an identity ≥ 95% for a query coverage ≥ 95%. Thus, using both strategies, the ability to detect all virulence genes were higher than using one alone. Growth curves The growth profiles of all strains and isolates used for in vitro and in vivo studies were compared. Thus, 5 × 105 CFU/mL were grown in 10 mL of MHB (with antibiotic when Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 279 necessary). At 2, 4, 8, and 24 h, the corresponding CFU/mL were determined by plating serial log10 dilutions on the corresponding MH agar plates without or with antibiotic, depending on the strain, and on blood agar plates the clinical isolates. Text S2: Results Other genomic differences between CRAB clinical isolates from non-surviving and surviving patients Despite CarO was the most notable difference between both groups of clinical isolates, other differences between isolates involving loci corresponding to bacteriophage genes, and implying small changes in length either at the N-terminus or C-terminus of the encoded proteins, or disruptions in the case of the B1 isolate, were found. In addition, differences in length were also observed in the gene encoding the giant biofilm-associated protein Bap. However, the multiple arrays featuring immunoglobulin-like motifs common to this protein (5) made difficult the accurate assembly of the sequence data obtained for the different isolates, and whether significant differences exist at these loci between both groups of isolates is uncertain. A similar situation occurred for the locus encoding the pilus assembly protein FilE, which was found in both groups of isolates to encode for a variable number of repeats of the tripeptide TAP in the different isolates (data not shown). References in Texts S1 and S2 1. Zankari E, Hasman H, Cosentino S, Vestergaard M, Rasmussen S, Lund O, et al. Identification of acquired antimicrobial resistance genes. The Journal of antimicrobial chemotherapy. 2012;67(11):2640-4. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 280 2. Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, et al. BLAST+: architecture and applications. BMC bioinformatics. 2009;10:421. 3. Chen L, Yang J, Yu J, Yao Z, Sun L, Shen Y, et al. VFDB: a reference database for bacterial virulence factors. Nucleic acids research. 2005;33(Database issue):D325-8. 4. Liu B, Zheng D, Jin Q, Chen L, Yang J. VFDB 2019: a comparative pathogenomic platform with an interactive web interface. Nucleic acids research. 2019;47(D1):D687-D92. 5. De Gregorio E, Del Franco M, Martinucci M, Roscetto E, Zarrilli R, Di Nocera PP. Biofilm-associated proteins: news from Acinetobacter. BMC Genomics. 2015;16:933. Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
ANNEXES 281 aS: susceptible; I: intermediate; R: resistant. Breakpoints, imipenem (EUCAST): susceptible MIC ≤ 2 µg/mL and resistant MIC ≥ 8 µg/mL; doripenem (CLSI): susceptible MIC ≤ 2 µg/mL, intermediate MIC = 4 µg/mL, and resistant MIC ≥ 8 µg/mL; meropenem (EUCAST): susceptible MIC ≤ 2 µg/mL and resistant MIC ≥ 8 µg/mL; ceftazidime (CLSI): susceptible MIC ≤ 8 µg/mL, intermediate MIC = 16 µg/mL, and resistant MIC ≥ 32 µg/mL; sulbactam (CLSI): susceptible MIC ≤ 4 µg/mL, intermediate MIC = 8 µg/mL, and resistant MIC ≥ 16 µg/mL; amikacin (EUCAST): susceptible MIC ≤ 8 µg/mL and resistant MIC ≥ 16 µg/mL; tobramycin (CLSI): susceptible MIC ≤ 4 µg/mL, intermediate MIC = 8 µg/mL, and resistant MIC ≥ 16 µg/mL; ciprofloxacin (EUCAST): susceptible MIC ≤ 1 µg/mL and resistant MIC > 1 µg/mL; rifampicin (Rev Esp Quimioter 2012;25(2):134-138): susceptible MIC ≤ 4 µg/mL and resistant MIC > 4 µg/mL; doxycycline (CLSI): susceptible MIC ≤ 4 µg/mL, intermediate MIC = 8 µg/mL, and resistant MIC ≥ 16 µg/mL; tigecycline (FDA): susceptible MIC ≤ 2 µg/mL, intermediate MIC = 4 µg/mL, and resistant MIC ≥ 8 µg/mL; colistin (EUCAST): susceptible MIC ≤ 2 µg/mL and resistant MIC ≥ 4 µg/mL. Clinical isolates Imipenem Doripenem Meropenem Ceftazidime Sulbactam Amikacin Tobramycin Ciprofloxacin Rifampicin Doxycycline Tigecycline Colistin B1 64 (R) > 8 (R) > 16 (R) 64 (R) 32 (R) 128 (R) > 128 (R) 256 (R) 4 (S) 16 (R) 0.5 (S) 0.06 (S) B4 32 (R) > 8 (R) 4 (I) 128 (R) 4 (S) 64 (R) 128 (R) 64 (R) 32 (R) 32 (R) 1 (S) 0.03 (S) B7 8 (R) 4 (R) 4 (I) 128 (R) 4 (S) 2 (S) 128 (R) 32 (R) 16 (R) 32 (R) 0.5 (S) 0.06 (S) B8 16 (R) 4 (R) 4 (I) 64 (R) 4 (S) 4 (S) 1 (S) 16 (R) 16 (R) 32 (R) 0.5 (S) 0.03 (S) B9 8 (R) 4 (R) 4 (I) 128 (R) 8 (I) 64 (R) 128 (R) 64 (R) 32 (R) 32 (R) 1 (S) 0.12 (S) B11 16 (R) 4 (R) 4 (I) 64 (R) 8 (I) 2 (S) > 128 (R) 16 (R) 32 (R) 32 (R) 0.5 (S) 0.06 (S) Table S1. Minimum inhibitory concentrations (MICs) of different antimicrobials for the six CRAB clinical isolates. Antimicrobial agent MIC (µg/mL) (SIR)a Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0
288 Código seguro de Verificación : GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 | Puede verificar la integridad de este documento en la siguiente dirección : https://sede.administracionespublicas.gob.es/valida ÁMBITOPREFIJO CSV FECHA Y HORA DEL DOCUMENTO GEISER GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0 08/05/2020 08:02:19 Horario peninsular Nº registro DIRECCIÓN DE VALIDACIÓN O00008744e2000018879 https://sede.administracionespublicas.gob.es/valida GEISER-9893-b4e9-d9c0-4acb-8bbe-cc24-b8bd-d9a0