The NADP+-isocitrate dehydrogenase gene (icd) is nitrogen regulated in cyanobacteria

JOURNAL OF BACTERIOLOGY, July 1996, p. 4070–4076 Vol. 178, No. 14 0021-9193/96/$04.0010 Copyright q1996, American Society for Microbiology The NADP 1 -Isocitrate Dehydrogenase Gene (icd) Is Nitrogen Regulated in Cyanobacteria M. ISABEL MURO-PASTOR,† JOSE C. REYES,‡ AND FRANCISCO J. FLORENCIO* Instituto de Bioquı´mica Vegetal y Fotosı´ntesis, Universidad de Sevilla-Consejo Superior de Investigaciones Cientı´ficas, 41080-Seville, Spain Received 2 February 1996/Accepted 10 May 1996 NADP 1 -isocitrate dehydrogenase (NADP 1 -IDH) activity and protein levels in crude extracts from the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 and the filamentous, dinitrogen-fixing Anabaena sp. strain PCC 7120 were determined under different nitrogen conditions. The highest NADP 1 -IDH activity and protein accumulation were found under dinitrogen-fixing conditions for the Anabaena strain and under nitrogen starvation for Synechocystis sp. PCC 6803. The icd gene that encodes the NADP 1 -IDH from Synechocystis sp. strain PCC 6803 was cloned by heterologous hybridization with the previously isolated icd gene from Anabaena sp. strain PCC 7120. The two cyanobacterial icd genes show 81% sequence identity and share a typical 44-amino-acid region different from all the other icd genes sequenced so far. The icd gene seems to be essential for Synechocystis growth since attempts to generate a completely segregated icd mutant were unsuccessful. Transcripts of 2.0 and 1.6 kb were detected by Northern (RNA) blot analysis, for the Anabaena and Synechocystis icd genes, respectively. Maximal icd mRNA accumulation was reached after5hofnitrogen starvation in Synechocystis cells and under dinitrogen-fixing conditions in Anabaena cells. Primer extension analysis showed that the structure of the Synechocystis icd gene promoter resembles those of the NtcA-regulated promoters. In addition, mobility shift assays demonstrated that purified Synechocystis NtcA protein binds to the promoter of the icd gene. All these data suggest that the expression of the icd gene from Synechocystis sp. strain PCC 6803 may be subjected to nitrogen control mediated by the positively acting regulatory protein NtcA. Cyanobacteria are photosynthetic prokaryotes that have an incomplete tricarboxylic acid cycle, lacking a-ketoglutarate dehydrogenase and succinyl-coenzyme A synthetase activities (46, 54). The NADP 1 -isocitrate dehydrogenase (IDH) (EC 1.1.1.42) reaction represents a terminal step in carbon flow; thus, the role of this enzyme is the provision of biosynthetic precursors rather than energy production. The a-ketoglutarate produced in the NADP 1 -IDH reaction is required for ammonium assimilation through the glutamine synthetase-glutamate synthase (GS-GOGAT) pathway (38) and is a key metabolite in the linking of nitrogen and carbon metabolism. IDHs have been purified and characterized from a variety of sources (8); most bacteria have only an NADP 1 -dependent IDH consisting of two identical subunits with molecular weights of between 40,000 and 57,000 (8). There are other prokaryotic NADP 1 -IDHs that are monomeric enzymes with molecular weights of about 80,000 (13, 33). In some cases, both NADP 1 -IDH types coexist in the same organism, as in Vibrio sp. strain ABE-1 (24). The genes coding for different IDHs have been cloned and sequenced from prokaryotic and eukaryotic sources (10, 11, 13, 19, 20, 22, 25, 26, 37, 41, 45, 53). Comparison of the deduced amino acid sequences revealed conserved regions among dimeric and among monomeric IDHs (45), but no similarity could be detected between both groups of IDHs (13). In cyanobacteria, IDH is strictly dependent on NADP 1 and belongs to the typical dimeric type. The enzyme has been purified and characterized from the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 (44) and the filamentous dinitrogen-fixing Anabaena sp. strain PCC 7120 (45). In both cases, the enzymes show kinetic and physicochemical parameters similar to those of the NADP 1 -IDH from Escherichia coli (44, 45, 48). The Anabaena icd gene has been cloned by complementation of an E. coli icd mutant (45). The deduced sequence of Anabaena NADP 1 -IDH is similar to those of other prokaryotic NADP 1 -IDHs but presents an extra region which seems to be specific for the cyanobacteria (45). In bacteria that have a complete Krebs cycle, like E. coli, the a-ketoglutarate produced through the IDH reaction can be further oxidized within the cycle or reductively aminated to glutamate. Thus, this metabolite may be implicated in energy production or in biosynthetic reactions, depending on cellular needs. On the other hand, in organisms able to use acetate as sole carbon source, the IDH has an important role in controlling the carbon flow at the branch point of the glyoxylate bypass and the Krebs cycle. In E. coli, NADP 1 -IDH activity is regulated by phosphorylation of the enzyme when cells are growing with acetate, which partially inactivates the NADP 1 - IDH and allows the cell to maintain the supply of carbon compounds required for the synthesis of cellular constituents (32). In cyanobacteria, as the a-ketoglutarate produced in the IDH reaction cannot be further oxidized, it directly enters the GS-GOGAT cycle and has a clearly biosynthetic role related to nitrogen assimilation (46). Little is known about the transcriptional regulation of prokaryotic icd genes. In Bacillus subtilis, in which the IDH gene (citC) is in a single transcription unit together with one of the citrate synthase genes (citZ), the expression of the operon is maximal at the end of the exponential growth phase, being repressed by the presence of glutamate and/or glucose (26, 27). * Corresponding author. Mailing address: Instituto de Bioquı´mica Vegetal y Fotosı´ntesis, Universidad de Sevilla-Consejo Superior de Investigaciones Cientı´ficas, Apdo 1113, 41080-Seville, Spain. Fax: 34- 5-4620154. Electronic mail address: [email protected]. † Present address: Institut de Ge´ne´tique et Microbiologie, Universite´ Paris-Sud URA 1354, 91405 Orsay cedex, France. ‡ Present address: Unite´ des Virus Oncoge`nes, Departement des Biotechnologies, Institut Pasteur, 75724 Paris cedex 15, France. 4070 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from In Vibrio sp. strain ABE-1, icdI and icdII genes, coding for a dimeric and a monomeric IDH, respectively, are regulated differently at the transcriptional level. The icdII mRNA level is increased by lowering the growth temperature while icdI mRNA is affected by the carbon source (25, 55). In this work, we report that expression of the icd gene is subjected to nitrogen control in the cyanobacteria Synechocystis sp. strain PCC 6803 and Anabaena sp. strain PCC 7120. We have also cloned and sequenced the Synechocystis icd gene, and the 59region of this gene has been studied. Primer extension and band shift experiments suggest that the Synechocystis icd promoter is an NtcA-regulated promoter. The transcriptional activator NtcA has been identified as a regulatory element of the nitrogen control mechanism in cyanobacteria (34, 57). Thus, expression of the icd gene and that of nitrogen assimilation are coordinated. MATERIALS AND METHODS Bacterial strains and growth conditions. Synechocystis sp. strain PCC 6803 was grown at 308C with shaking in BG11 medium (50) supplemented with 12 mM NaHCO 3 (BG11C). BG11 contains 18 mM NO 3 Na as nitrogen source. For nitrogen starvation conditions, nitrate was not added to the medium (named BG11 0 C or BG11 0 medium, depending on the addition or not of NaHCO 3 , respectively). For plate cultures, BG11C liquid medium was supplemented with 1% (wt/vol) agar. Chloramphenicol was added to a final concentration of 20 mg/ml when required. For induction experiments, cultures were bubbled with 1.5% (vol/vol) CO 2 in air; when they reached a chlorophyll concentration of 10 mg/ml, cells were harvested, washed twice with BG11 0 C, and further incubated in this medium. Chlorophyll was measured in methanolic extracts (35). Synechocystis sp. strain PCC 6803, harboring the pFCV5Sm r plasmid (SFCV5), was used in transformation with the disrupted icd gene (7). Anabaena sp. strain PCC 7120 was grown at 308C with shaking, with BG11 0 , BG11, or BG11 0 plus NH 41 . For RNA extraction purposes, the cultures were grown in the same medium but bubbled with air. In all the cases when ammonium was used as the nitrogen source, nitrate was replaced by 10 mM NH 4 Cl and the medium was buffered with 20 mM N-tris(hydroxymethyl) methyl-2-aminoethanesulfonic acid (TES) buffer, pH 7.0. E. coli DH5a(Bethesda Research Laboratories), used for all plasmid constructions, and E. coli MC1061 (39), used for gene library construction, were grown in Luria broth as described elsewhere (51). The medium was supplemented with ampicillin at 100 mg/ml when required. Cell extracts, enzyme assay, and protein determination. Cells were harvested by centrifugation at 5,000 3gfor 10 min, resuspended in 30 mM Tris-HCl (pH 7.5), and broken by crushing them in a mortar containing liquid nitrogen. The lysate was centrifuged at 12,000 3gfor 15 min, and the resulting supernatant constituted the cell extract. NADP 1 -specific IDH activity was measured as previously described (44). Units are expressed as micromoles of NADPH produced per minute. Protein concentrations were determined by the method of Bradford (3), with bovine serum albumin as standard. DNA manipulation and gene sequence. Total DNA from cyanobacteria was isolated as described by Cai and Wolk (4). Plasmid isolation from E. coli, transformation of E. coli, restriction, and ligation with T4 ligase were performed by standard procedures (1, 51). DNA fragments were purified from agarose gels with the Gene-Clean Kit (Bio 101, Inc.). For Southern hybridizations, DNA was digested and fragments were electrophoresed in 0.7% agarose gels in a Trisborate-EDTA buffer system (51). Transfer of DNA to Z-Probe membranes (Bio-Rad Laboratories) was done under vacuum, and Southern blot hybridizations were performed as described previously (1). DNA probes were 32 P labeled by the random primer technique with [a- 32 P]dCTP. For heterologous Southern hybridizations, low-stringency conditions (558C, 53SSC [13SSC is 0.15 M NaCl plus 0.015 M sodium citrate]) were used and the filters were washed at room temperature. Sequencing of both strands of the DNA fragments containing the icd gene was carried out by the dideoxy-chain termination method (52), with Sequenase version 2.0 (U.S. Biochemical Corp.). Nested unidirectional deletions of pMS1 and pMS3 (an EcoRI subclone of pMS2) were generated with the double-stranded Nested Deletion Kit from Pharmacia LKB. The sequence of the 59region upstream of the icd gene and the nucleotides coding for the first four amino acids of the IDH protein were determined by extension of the primer: 59ATCGTT GGGTACTACGGGCT 39(from nucleotides 78 to 59 of the coding region). This primer was also used for the mapping of the transcriptional start site (see below). The junction between the adjacent icd fragments of the plasmids pMS1 and pMS3 was sequenced with the plasmid pMS4 and appropriate oligonucleotides. Computer searches for homologies were done by using the FASTA program, and alignments were produced with the Pileup program with default parameters (12) and improved by manual alignment. Western blot (immunoblot) analysis. Crude extracts from Synechocystis or Anabaena cells, grown under different conditions, were subjected to denaturing electrophoresis on 12% (mass/vol) polyacrylamide gels (30). Western blot procedures were carried out as previously described (44). In all cases, the same amount of total protein was loaded. Insertional mutagenesis of the Synechocystis icd gene. A 1.9-kb DNA fragment, containing a chloramphenicol resistance gene from RSF1010 (14), was cloned into the ApaI internal site of the icd gene (see Fig. 3) in both orientations. The resulting plasmids, derived from pMS3 (pMS3CmA and pMS3CmB) (see Fig. 3), were used to transform Synechocystis SFCV5 (7) as previously described (6). RNA isolation and Northern (RNA) blot analysis. Total RNA from Synechocystis sp. strain PCC 6803 was isolated by the method of hot phenol as described by Mohamed and Jansson (42) with the modifications described in reference 49. RNA from Anabaena sp. strain PCC 7120 was isolated as described in reference 17. Separation of RNA on formaldehyde gels, transfer to nylon membranes (Hybond N-plus; Amersham), prehybridization, and hybridization conditions were according to the instruction manual from Amersham. A 15-mg sample of total RNA was loaded per lane. Relative transcript levels were quantified with a scanning densitometer (Bio Image; Millipore Corporation) from at least two different autoradiographs. In all the cases, the upper band containing the nondegraded transcript was quantified. Primer extension analysis. The oligonucleotide used for primer extension was 59ATCGTTGGGTACTACGGGCT 39(from nucleotide 78 to 59 of the coding region). After end labeling with T4 polynucleotide kinase (Boehringer) and [g- 32 P]dATP as described elsewhere (51), 50 ng of labeled oligonucleotide (about 10 6 cpm) was annealed to 50 mg of total RNA from Synechocystis sp. strain PCC 6803, grown under different nitrogen conditions, in 15 ml of hybridization buffer (10 mM Tris HCl [pH 8.3], 0.15 M KCl, and 1 mM of EDTA). Mixtures were incubated first at 858C for 5 min and then at 508Cfor3h.The extension reactions were carried out at 448Cfor1hasdescribed previously (1), with 10 U of avian myeloblastosis virus reverse transcriptase (Promega). Reaction mixtures were then treated with RNase A (DNase-free; Boehringer) and extracted with phenol. DNA was precipitated with ethanol, resuspended in formamide-loading dye, and then analyzed on a sequencing gel (6% polyacrylamide). To determine the size of the extension product, nucleotide sequencing of an appropriate plasmid was carried out with the same oligonucleotide as a primer. Cloning of Synechocystis sp. strain PCC 6803 ntcA gene and purification of GST-NtcA fusion protein. The complete ntcA open reading frame was cloned from Synechocystis sp. strain PCC 6803 genomic DNA after PCR amplification with the oligonucleotides M1 (59ATACTCGAGATGGATCAGTCCCTAACC 39) (from nucleotide 1 to 18 of the ntcA coding region) and M2 (59TCACTC GAGGGCACTGGTCATAGAGG 39) (from nucleotide 694 to 682 of the ntcA coding region). The resulting 715-bp DNA fragment was restricted with XhoI and cloned into the XhoI site of pGEX-4T-1 plasmid in phase with the glutathione S-transferase (GST) gene to create pGEX-NtcA. The complete ntcA gene and the reading frame of the fusion protein were checked by DNA sequencing. GST-NtcA fusion protein and GST were expressed in E. coli LC137 from plasmids pGEX-NtcA and pGEX-4T-1, respectively. One liter of culture was grown in Luria broth medium to an optical density at 600 nm of 0.6, induced with 0.5 mM isopropyl-b-D-thiogalactopyranoside for 2.5 h, harvested by centrifugation, and resuspended in 5 ml of PBS buffer (150 mM NaCl, 16 mM Na 2 HPO 4 , 4mMNaH 2 PO 4 ,4mM phenylmethylsulfonyl fluoride, 7 mM b-mercaptoetha- nol) supplemented with 1% Triton X-100. Cells were broken by sonication on ice, and insoluble debris was pelleted by centrifugation. Extracts were mixed with 1 ml of glutathione agarose beads (Pharmacia) and incubated for2hat48C with gentle agitation. Then beads were transferred to a column and washed extensively with PBS buffer until no more protein was eluted from the column. GST or GST fusion proteins were eluted with 3 ml of 50 mM Tris HCl (pH 8) containing 10 mM reduced glutathione. Gel retardation assays. Probe was isolated from agarose gels after digestion of pMS4 plasmid with XmnI and SpeI. The 128-bp fragment was end labeled with [a- 32 P]dCTP with Sequenase version 2.0 enzyme. The binding reaction was carried out in a final volume of 30 ml containing 4 ng of labeled DNA and 2 mg of poly(dI-dC) in 25 mM Tris HCl (pH 8.0)–50 mM KCl–4 mM spermidine–10% glycerol. To this mixture, 0.2 or 0.4 mg of purified NtcA-thrombin-cleaved protein was added. One microgram of GST-NtcA fusion protein was cleaved by incubation in PBS buffer supplemented with1Uofthrombin and 2.5 mM CaCl 2 for 15 min at 308C. Binding reactions with 4 mg of GST protein, treated with thrombin under the same conditions, were also performed. For competition experiments, a 30-fold excess of unlabeled probe was added to the binding reaction mixture. As an unrelated competitor DNA, a fragment of pBluescript II SK plasmid was used. The mixtures were incubated at 258C for 15 min and loaded into a nondenaturing 6% polyacrylamide gel. Electrophoresis was carried out at 48C and 280 V, and then gels were placed over Whatman 3MM paper, dried, and autoradiographed. Nucleotide sequence accession number. The EMBL-GenBank accession number for the Synechocystis icd sequence described here is X83563. VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4071 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from RESULTS Effect of nitrogen feeding on IDH activity and protein levels. Since IDH is the enzyme responsible for the a-ketoglutarate supply for ammonium assimilation, through the GS-GOGAT pathway (38), we determined if the levels of IDH activity and the amount of IDH protein were modulated in response to changes in nitrogen availability. Figure 1 shows that the IDH activity of crude extracts from Synechocystis sp. strain PCC 6803 cells subjected to nitrogen starvation for 10 h was between three- and fivefold higher than that from nitrate-grown cells. In order to test the amount of IDH protein, crude extracts from different conditions were subjected to Western blot analysis, with polyclonal antibodies against Synechocystis sp. strain PCC 6803 IDH (44). The amount of IDH protein increased after 5 or 10 h of nitrate removal from a Synechocystis sp. strain PCC 6803 culture (Fig. 2A), indicating that the increase observed in the level of IDH activity corresponded to a higher amount of IDH protein. Similar results were obtained when cells were grown in ammonium-containing medium and then transferred to nitrogen-free medium (not shown). As a control, the activity of another enzyme of carbon metabolism, glucose-6-phosphate dehydrogenase, was tested in crude extracts from Synechocystis nitrogen-starved cells. In this case, no significant differences were observed between nitrate-growing cells (55 mU/mg of protein) and nitrogen-deficient cells (60 mU/mg of protein). In the case of Anabaena sp. strain PCC 7120, we had previously reported that the NADP 1 -IDH activity was higher when the cells were grown under dinitrogen-fixing conditions (44). The activity of crude extracts from ammonium- or nitrategrown cells represented between 60 and 70% of that from dinitrogen-fixing cells. As shown in Fig. 2B, the higher IDH activity of dinitrogen-fixing cultures corresponded to an increase in the amount of IDH protein. Western blot analysis of Anabaena samples was carried out with polyclonal antibodies raised against purified Synechocystis NADP 1 -IDH, reported previously to cross-react with purified Anabaena NADP 1 -IDH (45). Cloning and sequence of the Synechocystis icd gene. To investigate whether the regulation of Synechocystis IDH activity, in response to nitrogen starvation, correlated with higher gene expression under these conditions, we isolated the icd gene from this cyanobacterium. For this purpose, the previously cloned icd gene from Anabaena sp. strain PCC 7120 (45) was used as a probe to identify bands hybridizing with digested genomic DNA from Synechocystis sp. strain PCC 6803. Several restriction fragments of Synechocystis DNA hybridized to the Anabaena icd gene. The strategy of constructing a partial genomic library in the pBluescript II SK vector from sizefractionated DNA fragments around a hybridizing band was used, and by this approach, two XmnI-XmnI fragments of 2.4 and 0.5 kb were cloned by colony hybridization. These fragments correspond to the inserts of pMS1 and pMS2, respectively (Fig. 3). However, when we tried to clone the complete icd gene from Synechocystis sp. by a DNA digestion that gave rise to a single, high-molecular-weight band hybridizing with the Anabaena probe, all the attempts were unsuccessful. These results suggested that the cloning in E. coli of the Synechocystis icd region into a high-copy-number plasmid like pBluescript might be impossible. In fact, the cloning of the HincII-HincII, 3.4-kb fragment containing the complete icd gene from Synechocystis sp. was straightforward, with the low-copy-number pRL500 plasmid (14) as a vector and the same cloning strategy described above (pMS4; Fig. 3). After sequencing of the appropriate plasmids (see Materials and Methods), one open reading frame of 1,425 bp was found. The coding region ends with a TAA stop codon and predicts a polypeptide of 475 amino acid residues with a calculated molecular mass of 52,241 Da, which is similar to the molecular mass determined for the purified Synechocystis NADP 1 -IDH subunit (44). Comparison of the deduced amino acid sequence of the Synechocystis icd gene with available databases by using the FASTA program revealed that Synechocystis NADP 1 -IDH is homologous to other IDHs and isopropylmalate dehydrogenases sequenced, having the highest level of amino acid identity with the Anabaena NADP 1 -IDH (81% identity). The most significant difference between the bacterial NADP 1 -IDH sequences is the presence of a 44-amino-acid-residue insertion in the cyanobacterial proteins. This extra stretch (amino acid residues 286 to 329) is conserved in the two cyanobacterial sequences available and seems to be an exclusive characteristic of NADP 1 -IDHs from cyanobacteria. The predicted secondary structure for this region is an a-helix, located within the small a/bdomain described for the E. coli enzyme (23), but its function in the cyanobacterial enzymes is unknown. Disruption of the icd gene. In order to further investigate the role of NADP 1 -IDH in Synechocystis sp. strain PCC 6803, we FIG. 1. Effect of nitrogen deficiency on the NADP 1 -IDH specific activity from Synechocystis sp. strain PCC 6803. Nitrate-grown Synechocystis cells were washed with nitrogen-free medium and transferred, at time zero, either to nitrogen-free medium (nitrogen starvation) or to nitrate-containing medium (control). Samples were taken at the indicated time, and NADP 1 -IDH was determined in cell extracts as described in Materials and Methods. Data are the means of three independent experiments, and standard errors are represented by bars. FIG. 2. Effect of nitrogen availability on the amount of NADP 1 -IDH protein of Synechocystis sp. strain PCC 6803 and Anabaena sp. strain PCC 7120 cells. (A) Nitrate-grown Synechocystis cells were washed and transferred to nitrogen-free medium. At the indicated times, samples were taken for crude extract preparation. A total of 85 mg of protein of each extract or 2 mg of purified NADP 1 -IDH protein was subjected to Western blot analysis, with polyclonal antibodies against Synechocystis IDH. (B) Crude extracts from Anabaena sp. strain PCC 7120 cells grown with different nitrogen sources were subjected to Western blot analysis with polyclonal antibodies against Synechocystis IDH. A total of 180 mgof protein was loaded per lane. Numbers to the right of each panel show molecular mass in kilodaltons. 4072 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from tried to obtain an icd mutant strain. An inactivated version of the cloned gene was constructed by insertion of a chloramphenicol resistance (Cm r ) cassette. The plasmids containing the interrupted gene were introduced by transformation into Synechocystis sp. strain SFCV5, and Cm r colonies were obtained in BG11C medium. Since a Synechocystis icd mutant was expected to be a glutamate auxotroph, like icd mutants in other bacteria (i.e., E. coli and Rhizobium sp.) (31, 37), Cm r colonies were cultured for several rounds of segregation in the same medium supplemented with glutamate (5 mM). Analysis by Southern hybridization of Cm r strains showed two hybridization bands: one corresponding to the wild-type fragment and another corresponding to the insertion of the 1.3-kb Cm r cassette (data not shown). This result indicated that the gene replacement had taken place but that only some of the chromosomes contained the mutation (Synechocystis sp. strain PCC 6803 is a polyploid bacterium containing about 12 chromosomes per cell [29]). Addition of a-ketoglutarate to the culture medium did not increase chromosomal segregation (data not shown). These results suggested that completely segregated Synechocystis icd mutants were not viable, as we had previously reported for Anabaena sp. strain PCC 7120 icd mutants (45). Modulation of icd transcript levels in response to nitrogen starvation. In order to determine if the increase of IDH activity and protein observed in Synechocystis cells under nitrogen deficiency corresponded to higher icd gene expression, levels of icd mRNA under different conditions were determined by Northern blot analysis. Total RNA from mid-exponential- phase Synechocystis cultures grown either with nitrate or with ammonium or after 15 h of nitrogen starvation was isolated as described in Materials and Methods and probed with a 536-bp XmnI-XmnI internal icd fragment (Fig. 3). Northern hybridization experiments revealed a smeared hybridization pattern indicating that a heterogeneous population of RNA molecules contained icd sequences, the largest of which was about 1.6 kb (Fig. 4A). This result suggests that icd transcript is monocistronic. The presence of excess 16S rRNA was probably responsible for depleting the signal in the 1.5-kb region (Fig. 4A). The level of the icd transcript of nitrogen-starved cells was about sevenfold higher than that of nitrate- or ammonium-growing cells (Fig. 4A). To more precisely determine the time course of icd transcript accumulation, nitrate-grown Synechocystis cells were transferred to nitrogen-free medium and samples were taken at different times for total RNA isolation. Northern blot analysis and further densitometric quantification of the autoradiograms showed that induction was observed after1hof nitrogen deprivation and that maximal induction was obtained after 5 h under these conditions (Fig. 5). In addition, Northern blotting was carried out to determine the level of the icd gene transcript from Anabaena sp. strain PCC 7120 cells grown with different nitrogen sources. As shown in Fig. 4B, the level of Anabaena icd mRNA from dinitrogen-fixing cells was about twofold higher than that of the nitrate- or ammonium-growing cells. These results suggest that icd gene expression was regulated by nitrogen availability in both cyanobacteria studied. On the other hand, the size of the transcript detected for Anabaena icd gene was about 2.0 kb (Fig. 4B). Since the size expected for a monocistronic icd transcript is about 1.4 kb, we cannot rule out that the icd gene from Anabaena sp. is included in a dicistronic messenger. In addition, upstream of the Anabaena icd gene, there are six imperfect copies of a 7-bp repeating sequence that has the consensus sequence CCCCAAT (45). Heptanucleotides with different consensus sequences have been detected near other genes in heterocystous cyanobacteria (2, 15, 21, 43, 58). The fact that these heptamer repeats are in some cases transcribed and translated, along with the lack of clear promoter sequences in the icd 59 flanking region and the size of the transcript detected, could indicate that these repeats are also transcribed, the promoter of icd being far away from this region. Therefore, we focused on the study of the promoter of the Synechocystis icd gene. Transcriptional start site mapping of the Synechocystis sp. strain PCC 6803 icd gene. Primer extension analysis was carried out to determine the transcription start point (tsp)ofthe Synechocystis sp. strain PCC 6803 icd gene. A single extension FIG. 3. Restriction map of the isolated plasmids that contain the Synechocystis sp. strain PCC 6803 icd gene. The arrow represents the predicted icd coding region. FIG. 4. Levels of icd transcript in Synechocystis sp. strain PCC 6803 and Anabaena sp. strain PCC 7120 cells under different nitrogen conditions. (A) Total RNA was isolated from mid-log-phase Synechocystis cells that used nitrate or ammonium as nitrogen source or from cells subjected to nitrogen deficiency for 15 h. RNA was denatured, electrophoresed in a 1% agarose gel, blotted, and hybridized with a 536-bp XmnI-XmnISynechocystis icd fragment. (B) Total RNA was isolated from mid-log-phase Anabaena cultures that used nitrate, ammonium, or dinitrogen as nitrogen source. RNA was processed as described for panel A and probed with a 1.4-kb ScaI-AccIAnabaena icd fragment. A total of 15 mg of total RNA was loaded per lane. Transcript sizes were estimated by comparison with 23S, 16S, and 5S rRNAs (42). VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4073 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from product was detected in extension experiments using total RNA from either ammonium-grown or nitrogen-starved Synechocystis cells (Fig. 6). The transcription start point was localized to nucleotide 227 with respect to the first translated nucleotide. The product of the extension reaction was much more abundant with RNA from nitrogen-starved cells than with RNA isolated from ammonium-grown cells (Fig. 6A). A sequence with five of six matching the 210 s 70 -dependent E. coli-like promoter-consensus sequence occurred upstream of the icd tsp (TATGAT). However, no obvious 235 consensus sequence was observed. The DNA sequence that precedes the tsp of the icd gene was compared with those of previously known nitrogen-regulated promoters from cyanobacteria. A sequence (GTAN 8 TGC) exhibiting near-perfect identity with the consensus binding site of the transcription factor NtcA (GTAN 8 TAC) (34) was detected 22 bases upstream of the 210 sequence (Fig. 6B). It has been proposed that nitrogen- and NtcA-regulated promoters consist of a 210 sequence similar to the E. coli consensus and an NtcA-binding site, at position 239.5 or 240.5 with respect to the tsp, that substitutes for the typical 235 hexamer (Fig. 6B) (34). Therefore, the structure of the icd gene promoter is very similar to those of the NtcA- regulated promoters. Binding of NtcA to the promoter of the Synechocystis sp. strain PCC 6803 icd gene. In order to test whether the transcription activator NtcA binds to the promoter of the Synechocystis icd gene, we have performed mobility shift experiments with the purified Synechocystis NtcA protein. The ntcA gene from Synechocystis strain PCC 6803 was cloned by means of standard PCR techniques and introduced in the pGEX-4T-1 expression vector. The GST-NtcA fusion protein was purified by affinity chromatography on glutathione agarose. One single band of about 50 kDa (fusion protein between GST [27.5 kDa] and NtcA [25.0 kDa]) and no degradation products were visible after sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Coomassie blue staining. As shown in Fig. 7, purified NtcA retarded a SpeI-XmnI 128-bp fragment that contains the icd promoter (from 2100 to 128 with respect to the tsp). A 30-fold excess of unlabeled fragment significantly reduced the amount of labeled NtcA-icd promoter complex. As a control, GST protein expressed with the same vector and purified by the same protocol was unable to retard the fragment containing the icd gene promoter (Fig. 7). These data FIG. 5. Kinetics of Synechocystis icd transcript accumulation under nitrogen starvation. Nitrate-grown Synechocystis cells were harvested, washed, and transferred to nitrogen-free medium. Samples for total RNA isolation were taken at the indicated times. RNA was processed and hybridized as described for Fig. 4A. (B) The mRNA levels were quantified by densitometry, and plots were drawn of relative mRNA levels versus time. Values are averages of two hybridization experiments and are expressed as a percentage of the higher value. FIG. 6. (A) Primer extension analysis of the Synechocystis icd transcript. Total RNA (50 mg) from ammonium-grown or nitrogen-starved cells was annealed to an oligonucleotide of the icd gene and extended with avian myeloblastosis virus reverse transcriptase as described in Materials and Methods. Lanes T, C, G, and A contain a dideoxy sequencing ladder carried out with the same primer. The transcription start nucleotide is indicated by an asterisk. (B) Alignment of Synechocystis icd promoter region with several NtcA-regulated promoters from different cyanobacteria. The NtcA binding site, the 210 box, and transcription start points are in boldface. FIG. 7. Gel retardation analysis of the binding of NtcA to a Synechocystis icd promoter fragment. A 128-bp DNA fragment encompassing the icd promoter was incubated in the presence of various concentrations of purified NtcA or GST protein. Lane 1, no protein; lane 2, 5 mM GST; lane 3, 0.25 mM NtcA; lane 4, 0.5 mM NtcA; lane 5, 0.5 mM NtcA plus a 30-fold excess of unlabeled probe. 4074 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from indicate that the NtcA protein specifically binds to the Synechocystis sp. strain PCC 6803 icd regulatory region. DISCUSSION In cyanobacteria, NADP 1 -IDH is generally considered to be the enzyme responsible for supplying the carbon skeletons (a-ketoglutarate) needed for ammonium assimilation; therefore, regulation of NADP 1 -IDH in response to changes in nitrogen availability could be expected. In fact, in Synechocystis sp. strain PCC 6803, the level of NADP 1 -IDH enzyme activity and the amount of NADP 1 -IDH protein and the icd transcript increase between five- and sevenfold during nitrogen starvation (Fig. 1, 2, 4, and 5). This fact agrees with the strong increase in the intracellular concentration of a-ketoglutarate detected 4 h after transferring nitrate-grown Synechocystis cells to nitrogen-free medium (sevenfold) (40). However, in nitrogen-starved cells the action of transaminases may also account for a considerable fraction of the a-ketoglutarate increase. In the case of Anabaena sp., expression of the icd gene was maximal under dinitrogen-fixing conditions (Fig. 2 and 4), correlating with the higher icd expression in Synechocystis sp. under nitrogen starvation, since dinitrogen fixation is the most nitrogen-limiting condition for Anabaena sp. We have previously reported that a partially segregated icd mutant from Anabaena sp. is unable to grow on nitrogen-free medium without a-ketoglutarate added (45). These results are in concordance with the hypothesis that the requirement of a-ketoglut- arate must be higher in this medium, probably because ammonium assimilation is restricted to heterocysts under these conditions. Since a-ketoglutarate is the substrate for glutamate synthesis, regulation of NADP 1 -IDH must be coordinated with that of the GS-GOGAT pathway. In fact, expression of the glnA gene (structural gene for glutamine synthetase type I) has been also shown to be regulated in response to nitrogen starvation in several cyanobacteria. Transcript from the Synechococcus sp. strain PCC 7002 glnA gene increases three- to fivefold when the cells are starved of nitrogen (59) while, in strain PCC 7942, a strong increase in the amount of glnA mRNA has been described after transferring ammonium-grown cells to nitratecontaining or nitrogen-free medium (9, 34). In Anabaena sp. strain PCC 7120, glnA is transcribed from multiple promoters that are differentially expressed in response to changes in the nitrogen source, the highest expression being under dinitrogen-fixing conditions (56). The amount of glnA transcript from Synechocystis sp. strain PCC 6803 also increases (two- to fourfold) under nitrogen deficiency (49a). The increase of a-keto- glutarate mediated by the induction of NADP 1 -IDH during nitrogen starvation, together with the induction of GS expression, may correspond to a metabolic mechanism to guarantee the immediate assimilation of the available nitrogen through the GS-GOGAT pathway. In addition, a-ketoglutarate is not only the substrate for ammonium assimilation but also a very important regulatory metabolite involved in the regulation of nitrogen assimilation pathways in cyanobacteria (16, 40) and other prokaryotes (36). This regulatory role could explain why it was impossible to obtain an icd null mutant in Synechocystis strain PCC 6803 as well as in Anabaena strain PCC 7120 (45). The NtcA protein is a positive regulator of genes subjected to nitrogen control in cyanobacteria. NtcA belongs to the family of bacterial DNA-binding proteins of which cyclic AMP receptor protein is the prototype (28, 57). It has been demonstrated that NtcA (BifA) binds directly to the promoter regions of glnA,rbcL,xisA, and nifH genes in Anabaena sp. strain PCC 7120 (47, 60) and to the promoter regions of glnA,ntcA, and the nirAnrtABCDnarB operon in Synechococcus sp. strain PCC 7942 (34). Primer extension experiments showed that the structure of the Synechocystis sp. strain PCC 6803 icd gene promoter agrees with that of an NtcA-regulated promoter (Fig. 6B). The putative NtcA binding sequence from the Synechocystis icd promoter (GTAN 8 TGC) contains only one mismatch with respect to the defined consensus (GTAN 8 TAC) and presents also the A:T-rich region found upstream of all the NtcA binding sites so far described (Fig. 6B). In fact, purified Synechocystis strain PCC 6803 NtcA protein is able to bind specifically to a short DNA fragment containing the icd promoter (Fig. 7). All these data together with the expression pattern of the icd gene strongly suggest that transcription of the Synechocystis icd gene is positively regulated by NtcA. NtcA induces transcription from several promoters in the absence of ammonium, under conditions of nitrate utilization (34). All these promoters (pglnA,pntcA, and pnirA from Synechocystis sp. strain PCC 7942) contain an NtcA binding site that matches exactly the consensus sequence GTAN 8 TAC. The fact that the NtcA binding site of the icd promoter does not exactly fit the consensus motif could explain why transcription of the icd gene does not increase in nitrate-grown cells compared with ammonium-grown cells. Since nitrogen starvation is a more ammonium-deficient condition than nitrate utilization, and since ntcA gene transcription is autoregulated (34), levels of NtcA protein may be higher under nitrogen deficiency than under nitrogen assimilation. Activation of the icd promoter, with a low-affinity binding site, would require a higher concentration of NtcA protein that would be reached in nitrogen-starved cells but not in nitrate-growing cells. A similar situation is found in the promoter of the Anabaena sp. strain PCC 7120 xisA gene, which contains three nonconsensus NtcA binding sites. xisA encodes a site-specific recombinase required for the rearrangement of nif genes and is induced only under nitrogen starvation, not under nitrate assimilation (47, 60). In summary, the regulation of the cyanobacterial icd gene in response to nitrogen availability indicates a coordinate expression of the genes involved in carbon skeleton supply and those of nitrogen assimilation. ACKNOWLEDGMENTS This work was supported by grants from DGICYT (PB91-0127 and PB94-1444) and by Junta de Andalucia (group no. 3247). M. I. Muro- Pastor and J. C. Reyes were receipts of a fellowship from the MEC, Spain. REFERENCES 1. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1992. Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York. 2. Bauer, C. C., L. Scappino, and R. Haselkorn. 1993. Growth of the cyanobacterium Anabaena on molecular nitrogen: nifJ is required when iron is limited. Proc. Natl. Acad. Sci. USA 90:8812–8816. 3. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254. 4. Cai, Y., and C. P. Wolk. 1990. Use of a conditionally lethal gene in Anabaena sp. strain PCC 7120 to select for double recombinants and to entrap insertion sequences. J. Bacteriol. 172:3138–3145. 5. Chastain, C. J., J. S. Brusca, T. S. Ramasubramanian, T.-F. Wei, and J. W. Golden. 1990. A sequence-specific DNA-binding factor (VF1) from Anabaena sp. strain PCC 7120 vegetative cells binds to three adjacent sites in the xisA upstream region. J. Bacteriol. 172:5044–5051. 6. Chauvat, F., L. De Vries, A. Van der Ende, and G. A. Van Arkel. 1986. A host-vector system for gene cloning in the cyanobacterium Synechocystis PCC 6803. Mol. Gen. Genet. 204:165–191. 7. Chauvat, F., J. Labarre, and F. Ferino. 1988. Development of genes transfer system for the cyanobacterium Synechocystis PCC 6803. Plant Physiol. Biochem. 26:629–637. 8. Chen, R. D., and P. Gadal. 1990. Structure, function and regulation of NAD VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4075 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from and NADP dependent isocitrate dehydrogenase in higher plants and in other organisms. Plant Physiol. Biochem. 28:411–427. 9. Cohen-Kupiec, R., M. Gurevitz, and A. Zilberstein. 1993. Expression of glnA in the cyanobacterium Synechococcus sp. strain PCC 7942 is initiated from a single nif-like promoter under various nitrogen conditions. J. Bacteriol. 175: 7727–7731. 10. Cupp, J. R., and L. McAlister-Henn. 1991. NADP 1 -dependent isocitrate dehydrogenase. Cloning, nucleotide sequence, and disruption of the IDH2 gene from Saccharomyces cerevisiae. J. Biol. Chem. 266:22199–22205. 11. Cupp, J. R., and L. McAlister-Henn. 1992. Cloning and characterization of the gene encoding the IDH1 subunit of NADP 1 -dependent isocitrate dehydrogenase from Saccharomyces cerevisiae. J. Biol. Chem. 267:16417–16423. 12. Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387–395. 13. Eikmanns, B. J., D. Rittmann, and H. Sahm. 1995. Cloning, sequence analysis, expression, and inactivation of the Corynebacterium glutamicum icd gene encoding isocitrate dehydrogenase and biochemical characterization of the enzyme. J. Bacteriol. 177:774–782. 14. Elhai, J., and C. P. Wolk. 1988. A versatile class of positive-selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68:119–138. 15. Floriano, B., A. Herrero, and E. Flores. 1992. Isolation of arginine auxotrophs, cloning by mutant complementation and sequence analysis of the argC gene from the cyanobacterium Anabaena species PCC 7120. Mol. Microbiol. 6:2085–2094. 16. Forchhammer, K., and N. Tandeau de Marsac. 1995. Phosphorylation of the PII protein (glnB gene product) in the cyanobacterium Synechococcus sp. strain PCC 7942: analysis of in vitro kinase activity. J. Bacteriol. 177:5812– 5817. 17. Frı´as, J. E., E. Flores, and A. Herrero. 1994. Requirement of the regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium Anabaena sp. PCC 7120. Mol. Microbiol. 14:823–832. 18. Frı´as, J. E., A. Me´rida, A. Herrero, J. Martı´n-Nieto, and E. Flores. 1993. General distribution of the nitrogen control gene ntcA in cyanobacteria. J. Bacteriol. 175:5710–5713. 19. Haselbeck, R. J., R. F. Colman, and L. McAlister-Henn. 1992. Isolation and sequence of a cDNA encoding porcine mitochondrial NADP-specific isocitrate dehydrogenase. Biochemistry 31:6219–6223. 20. Haselbeck, R. J., and L. McAlister-Henn. 1991. Isolation, nucleotide sequence and disruption of the Saccharomyces cerevisiae encoding mitochondrial NADP(H)-specific isolation and sequence of a cDNA encoding porcine mitochondrial NADP-specific isocitrate dehydrogenase. J. Biol. Chem. 266: 2339–2345. 21. Holland, D., and C. P. Wolk. 1990. Identification and characterization of hetA, a gene that acts early in the process of morphological differentiation of heterocysts. J. Bacteriol. 172:3131–3137. 22. Huh, T.-L., J.-H. Ryu, J.-W. Huh, H.-C. Sung, I.-U. Oh, B. J. Song, and R. L. Veech. 1993. Cloning of a cDNA encoding bovine mitochondrial NADP 1 - specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species. Biochem. J. 292:705–710. 23. Hurley, J. H., P. E. Thorsness, V. Ramalingam, N. H. Helmers, D. E. Koshland, Jr., and R. M. Stroud. 1989. Structure of a bacterial enzyme regulated by phosphorylation, isocitrate dehydrogenase. Proc. Natl. Acad. Sci. USA 86:8635–8639. 24. Ishii, A., T. Ochiai, S. Imagawa, N. Fukunaga, S. Sasaki, O. Minowa, Y. Mizuno, and H. Shiokawa. 1987. Isozymes of isocitrate dehydrogenase from a obligately psychrophilic bacterium, Vibrio sp. strain ABE-1: purification, and modulation of activities by growth conditions. J. Biochem. 102:1489–1498. 25. Ishii, A., M. Suzuki, T. Sahara, Y. Takada, S. Sasaki, and N. Fukunaga. 1993. Genes encoding two isocitrate dehydrogenase isozymes of a psychrophilic bacterium, Vibrio sp. strain ABE-1. J. Bacteriol. 175:6873–6890. 26. Jin, S., and A. L. Sonenshein. 1994. Identification of two distinct Bacillus subtilis citrate synthase genes. J. Bacteriol. 176:4669–4679. 27. Jin, S., and A. L. Sonenshein. 1994. Transcriptional regulation of Bacillus subtilis citrate synthase genes. J. Bacteriol. 176:4680–4690. 28. Kolb, A., S. Busby, H. Buc, S. Garges, and S. Adhya. 1993. Transcriptional regulation by cAMP and its receptor protein. Annu. Rev. Biochem.62:749–795. 29. Labarre, J., F. Chauvat, and P. Thuriaux. 1989. Insertional mutagenesis by random cloning of antibiotic resistance genes into the genome of the cyanobacterium Synechocystis strain PCC 6803. J. Bacteriol. 171:3449–3457. 30. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680–685. 31. Lakshmi, T. M., and R. B. Helling. 1976. Selection of citrate synthase deficiency in icd mutants of Escherichia coli. J. Bacteriol. 127:76–83. 32. Laporte, D. C., P. E. Thorsness, and D. E. Koshland, Jr. 1985. Compensatory phosphorylation of isocitrate dehydrogenase. A mechanism for adaptation to the intracellular environment. J. Biol. Chem. 260:10563–10568. 33. Leyland, M. L., and D. J. Kelly. 1991. Purification and characterization of a monomeric isocitrate dehydrogenase with dual coenzyme from the photosynthetic bacterium Rhodomicrobium vannielii. Eur. J. Biochem. 202:85–93. 34. Luque, I., E. Flores, and A. Herrero. 1994. Molecular mechanism for the operation of nitrogen control in cyanobacteria. EMBO J. 13:2862–2869. 35. MacKinney, G. 1941. Absorption of light by chlorophyll solution. J. Biol. Chem. 140:315–322. 36. Magasanik, B., and F. C. Neidhardt. 1987. Regulation of carbon and nitrogen utilization, p. 1318–1325. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology. American Society for Microbiology, Washington, D.C. 37. McDermott, T. R., and M. L. Kahn. 1992. Cloning and mutagenesis of the Rhizobium meliloti isocitrate dehydrogenase gene. J. Bacteriol. 174:4790–4797. 38. Meeks, J. C., C. P. Wolk, W. Lockau, N. Schilling, P. W. Shaffer, and W. S. Chien. 1978. Pathways of assimilation of [ 13 N]N 2 and 13 NH 4 by cyanobacteria with and without heterocysts. J. Bacteriol. 134:125–130. 39. Meissner, P. S., W. P. Sisk, and M. L. Berman. 1987. Bacteriophage 1 cloning system for the construction of directional cDNA libraries. Proc. Natl. Acad. Sci. USA 84:4171. 40. Me´rida, A., P. Candau, and F. J. Florencio. 1991. Regulation of glutamine synthetase activity in the unicellular cyanobacterium Synechocystis sp. strain PCC 6803 by the nitrogen source: effect of ammonium. J. Bacteriol. 173: 4095–4100. 41. Miyazaki, K., H. Eguchi, A. Yamagishi, T. Wakagi, and T. Oshima. 1992. Molecular cloning of the isocitrate dehydrogenase gene of an extreme thermophile, Thermus thermophilus HB8. Appl. Environ. Microbiol. 58:93–98. 42. Mohamed, A., and C. Jansson. 1989. Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803. Plant Mol. Biol. 13:693–700. 43. Mulligan, M. E., and R. Haselkorn. 1989. Nitrogen fixation (nif) genes of the cyanobacterium Anabaena species strain PCC 7120. J. Biol. Chem. 264: 19200–19207. 44. Muro-Pastor, M. I., and F. J. Florencio. 1992. Purification and properties of NADP-isocitrate dehydrogenase from the unicellular cyanobacterium Synechocystis sp. PCC 6803. Eur. J. Biochem. 203:99–105. 45. Muro-Pastor, M. I., and F. J. Florencio. 1994. NADP 1 -isocitrate dehydrogenase from the cyanobacterium Anabaena sp. strain PCC 7120: purification and characterization of the enzyme and cloning, sequencing, and disruption of the icd gene. J. Bacteriol. 176:2718–2726. 46. Pearce, J., C. K. Leach, and N. G. Carr. 1969. The incomplete tricarboxylic acid cycle in the blue-green alga Anabaena variabilis. J. Gen. Microbiol. 55:371–378. 47. Ramasubramanian, T. S., T.-F. Wei, and J. W. Golden. 1994. Two Anabaena sp. strain PCC 7120 DNA-binding factors interact with vegetative cell- and heterocyst-specific genes. J. Bacteriol. 176:1214–1223. 48. Reeves, H. C., G. O. Danmy, C. L. Chen, and M. Houston. 1972. NADP- specific isocitrate dehydrogenase of Escherichia coli. Purification and characterization. Biochim. Biophys. Acta 258:27–39. 49. Reyes, J. C., and F. J. Florencio. 1995. Electron transport control transcription of the glutamine synthetase gene (glnA) from the cyanobacterium Synechocystis sp. PCC 6803. Plant Mol. Biol. 27:789–799. 49a.Reyes, J. C., and F. J. Florencio. Unpublished results. 50. Rippka, R., J. Deruelles, J. B. Waterbury, M. Herman, and R. Y. Stanier. 1979. Generic assignment, strain histories and properties of pure cultures of cyanobacteria. J. Gen. Microbiol. 111:1–61. 51. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 52. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467. 53. Shorrosh, B. S., and R. A. Dixon. 1992. Molecular characterization and expression of an isocitrate dehydrogenase from alfalfa (Medicago sativa L.). Plant Mol. Biol. 20:801–807. 54. Stanier, R. Y., and G. Cohen-Bazire. 1977. Phototrophic prokaryotes: the cyanobacteria. Annu. Rev. Microbiol. 31:225–274. 55. Suzuki, M., T. Sahara, J.-I. Tsuruha, Y. Takada, and N. Fukunaga. 1995. Differential expression in Escherichia coli of the Vibrio sp. strain ABE-1 icdI and icdII genes encoding structurally different isocitrate dehydrogenase isozymes. J. Bacteriol. 177:2138–2142. 56. Tumer, N. E., S. J. Robinson, and R. Haselkorn. 1983. Different promoters for the Anabaena glutamine synthetase gene during growth using molecular or fixed nitrogen. Nature (London) 306:337–342. 57. Vega-Palas, M. A., E. Flores, and A. Herrero. 1992. NtcA, a global nitrogen regulator from the cyanobacterium Synechococcus that belongs to the Crp family of bacterial regulators. Mol. Microbiol. 6:1853–1859. 58. Vioque, A. 1992. Analysis of the gene encoding the RNA subunit of ribonuclease P from cyanobacteria. Nucleic Acids Res. 20:6331–6337. 59. Wagner, S. J., S. P. Thomas, R. I. Kaufman, B. T. Nixon, and S. E. Stevens, Jr. 1993. The glnA gene of the cyanobacterium Agmenellum quadruplicatum PR-6 is nonessential for ammonium assimilation. J. Bacteriol. 175:604–612. 60. Wei, T.-F., T. S. Ramasubramanian, F. Pu, and J. W. Golden. 1993. Anabaena sp. strain PCC 7120 bifA gene encoding a sequence-specific DNA- binding protein cloned by in vivo transcriptional interference selection. J. Bacteriol. 175:4025–4035. 4076 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Sevillahttp://jb.asm.org/Downloaded from