The NADP+-isocitrate dehydrogenase gene (icd) is nitrogen regulated in cyanobacteria

JOURNAL OF BACTERIOLOGY, July 1996, p. 4070–4076 Vol. 178, No. 14 0021-9193/96/$04.0010 Copy igh q1996, Ame ican Socie y o Mic obiology The NADP 1 -Isoci a e Dehyd ogenase Gene (icd) Is Ni ogen Regula ed in Cyanobac e ia M. ISABEL MURO-PASTOR,† JOSE C. REYES,‡ AND FRANCISCO J. FLORENCIO* Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Uni e sidad de Se illa-Consejo Supe io de In es igaciones Cien ı´ icas, 41080-Se ille, Spain Recei ed 2 Feb ua y 1996/Accep ed 10 May 1996 NADP 1 -isoci a e dehyd ogenase (NADP 1 -IDH) ac i i y and p o ein le els in c ude ex ac s om he unicellula cyanobac e ium Synechocys is sp. s ain PCC 6803 and he ilamen ous, dini ogen- ixing Anabaena sp. s ain PCC 7120 we e de e mined unde di e en ni ogen condi ions. The highes NADP 1 -IDH ac i i y and p o ein accumula ion we e ound unde dini ogen- ixing condi ions o he Anabaena s ain and unde ni ogen s a a ion o Synechocys is sp. PCC 6803. The icd gene ha encodes he NADP 1 -IDH om Synecho- cys is sp. s ain PCC 6803 was cloned by he e ologous hyb idiza ion wi h he p e iously isola ed icd gene om Anabaena sp. s ain PCC 7120. The wo cyanobac e ial icd genes show 81% sequence iden i y and sha e a ypical 44-amino-acid egion di e en om all he o he icd genes sequenced so a . The icd gene seems o be essen ial o Synechocys is g ow h since a emp s o gene a e a comple ely seg ega ed icd mu an we e unsuccess ul. T ansc ip s o 2.0 and 1.6 kb we e de ec ed by No he n (RNA) blo analysis, o he Anabaena and Synecho- cys is icd genes, espec i ely. Maximal icd mRNA accumula ion was eached a e 5ho ni ogen s a a ion in Synechocys is cells and unde dini ogen- ixing condi ions in Anabaena cells. P ime ex ension analysis showed ha he s uc u e o he Synechocys is icd gene p omo e esembles hose o he N cA- egula ed p omo e s. In addi ion, mobili y shi assays demons a ed ha pu i ied Synechocys is N cA p o ein binds o he p omo e o he icd gene. All hese da a sugges ha he exp ession o he icd gene om Synechocys is sp. s ain PCC 6803 may be subjec ed o ni ogen con ol media ed by he posi i ely ac ing egula o y p o ein N cA. Cyanobac e ia a e pho osyn he ic p oka yo es ha ha e an incomple e ica boxylic acid cycle, lacking a-ke oglu a a e de- hyd ogenase and succinyl-coenzyme A syn he ase ac i i ies (46, 54). The NADP 1 -isoci a e dehyd ogenase (IDH) (EC 1.1.1.42) eac ion ep esen s a e minal s ep in ca bon low; hus, he ole o his enzyme is he p o ision o biosyn he ic p ecu so s a he han ene gy p oduc ion. The a-ke oglu a a e p oduced in he NADP 1 -IDH eac ion is equi ed o ammo- nium assimila ion h ough he glu amine syn he ase-glu ama e syn hase (GS-GOGAT) pa hway (38) and is a key me aboli e in he linking o ni ogen and ca bon me abolism. IDHs ha e been pu i ied and cha ac e ized om a a ie y o sou ces (8); mos bac e ia ha e only an NADP 1 -dependen IDH consis ing o wo iden ical subuni s wi h molecula weigh s o be ween 40,000 and 57,000 (8). The e a e o he p oka yo ic NADP 1 -IDHs ha a e monome ic enzymes wi h molecula weigh s o abou 80,000 (13, 33). In some cases, bo h NADP 1 -IDH ypes coexis in he same o ganism, as in Vib io sp. s ain ABE-1 (24). The genes coding o di e en IDHs ha e been cloned and sequenced om p oka yo ic and euka yo ic sou ces (10, 11, 13, 19, 20, 22, 25, 26, 37, 41, 45, 53). Compa ison o he deduced amino acid sequences e ealed conse ed egions among dime ic and among monome ic IDHs (45), bu no simila i y could be de ec ed be ween bo h g oups o IDHs (13). In cyanobac e ia, IDH is s ic ly dependen on NADP 1 and belongs o he ypical dime ic ype. The enzyme has been pu i ied and cha ac e ized om he unicellula cyanobac e- ium Synechocys is sp. s ain PCC 6803 (44) and he ilamen- ous dini ogen- ixing Anabaena sp. s ain PCC 7120 (45). In bo h cases, he enzymes show kine ic and physicochemical pa ame e s simila o hose o he NADP 1 -IDH om Esche- ichia coli (44, 45, 48). The Anabaena icd gene has been cloned by complemen a ion o an E. coli icd mu an (45). The deduced sequence o Anabaena NADP 1 -IDH is simila o hose o o he p oka yo ic NADP 1 -IDHs bu p esen s an ex a egion which seems o be speci ic o he cyanobac e ia (45). In bac e ia ha ha e a comple e K ebs cycle, like E. coli, he a-ke oglu a a e p oduced h ough he IDH eac ion can be u he oxidized wi hin he cycle o educ i ely amina ed o glu ama e. Thus, his me aboli e may be implica ed in ene gy p oduc ion o in biosyn he ic eac ions, depending on cellula needs. On he o he hand, in o ganisms able o use ace a e as sole ca bon sou ce, he IDH has an impo an ole in con ol- ling he ca bon low a he b anch poin o he glyoxyla e bypass and he K ebs cycle. In E. coli, NADP 1 -IDH ac i i y is egula ed by phospho yla ion o he enzyme when cells a e g owing wi h ace a e, which pa ially inac i a es he NADP 1 - IDH and allows he cell o main ain he supply o ca bon compounds equi ed o he syn hesis o cellula cons i uen s (32). In cyanobac e ia, as he a-ke oglu a a e p oduced in he IDH eac ion canno be u he oxidized, i di ec ly en e s he GS-GOGAT cycle and has a clea ly biosyn he ic ole ela ed o ni ogen assimila ion (46). Li le is known abou he ansc ip ional egula ion o p o- ka yo ic icd genes. In Bacillus sub ilis, in which he IDH gene (ci C) is in a single ansc ip ion uni oge he wi h one o he ci a e syn hase genes (ci Z), he exp ession o he ope on is maximal a he end o he exponen ial g ow h phase, being ep essed by he p esence o glu ama e and/o glucose (26, 27). * Co esponding au ho . Mailing add ess: Ins i u o de Bioquı´mica Vege al y Fo osı´n esis, Uni e sidad de Se illa-Consejo Supe io de In es igaciones Cien ı´ icas, Apdo 1113, 41080-Se ille, Spain. Fax: 34- 5-4620154. Elec onic mail add ess: [email p o ec ed]. † P esen add ess: Ins i u de Ge´ne´ ique e Mic obiologie, Uni e - si e´ Pa is-Sud URA 1354, 91405 O say cedex, F ance. ‡ P esen add ess: Uni e´ des Vi us Oncoge`nes, Depa emen des Bio echnologies, Ins i u Pas eu , 75724 Pa is cedex 15, F ance. 4070 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om In Vib io sp. s ain ABE-1, icdI and icdII genes, coding o a dime ic and a monome ic IDH, espec i ely, a e egula ed di e en ly a he ansc ip ional le el. The icdII mRNA le el is inc eased by lowe ing he g ow h empe a u e while icdI mRNA is a ec ed by he ca bon sou ce (25, 55). In his wo k, we epo ha exp ession o he icd gene is subjec ed o ni ogen con ol in he cyanobac e ia Synechocys- is sp. s ain PCC 6803 and Anabaena sp. s ain PCC 7120. We ha e also cloned and sequenced he Synechocys is icd gene, and he 59 egion o his gene has been s udied. P ime ex ension and band shi expe imen s sugges ha he Synechocys is icd p omo e is an N cA- egula ed p omo e . The ansc ip ional ac i a o N cA has been iden i ied as a egula o y elemen o he ni ogen con ol mechanism in cyanobac e ia (34, 57). Thus, exp ession o he icd gene and ha o ni ogen assimi- la ion a e coo dina ed. MATERIALS AND METHODS Bac e ial s ains and g ow h condi ions. Synechocys is sp. s ain PCC 6803 was g own a 308C wi h shaking in BG11 medium (50) supplemen ed wi h 12 mM NaHCO 3 (BG11C). BG11 con ains 18 mM NO 3 Na as ni ogen sou ce. Fo ni ogen s a a ion condi ions, ni a e was no added o he medium (named BG11 0 C o BG11 0 medium, depending on he addi ion o no o NaHCO 3 , espec i ely). Fo pla e cul u es, BG11C liquid medium was supplemen ed wi h 1% (w / ol) aga . Chlo amphenicol was added o a inal concen a ion o 20 mg/ml when equi ed. Fo induc ion expe imen s, cul u es we e bubbled wi h 1.5% ( ol/ ol) CO 2 in ai ; when hey eached a chlo ophyll concen a ion o 10 mg/ml, cells we e ha es ed, washed wice wi h BG11 0 C, and u he incuba ed in his medium. Chlo ophyll was measu ed in me hanolic ex ac s (35). Synechocys is sp. s ain PCC 6803, ha bo ing he pFCV5Sm plasmid (SFCV5), was used in ans o ma ion wi h he dis up ed icd gene (7). Anabaena sp. s ain PCC 7120 was g own a 308C wi h shaking, wi h BG11 0 , BG11, o BG11 0 plus NH 41 . Fo RNA ex ac ion pu poses, he cul u es we e g own in he same medium bu bubbled wi h ai . In all he cases when ammonium was used as he ni ogen sou ce, ni a e was eplaced by 10 mM NH 4 Cl and he medium was bu e ed wi h 20 mM N- is(hyd oxyme hyl) me hyl-2-aminoe hanesul onic acid (TES) bu e , pH 7.0. E. coli DH5a(Be hesda Resea ch Labo a o ies), used o all plasmid con- s uc ions, and E. coli MC1061 (39), used o gene lib a y cons uc ion, we e g own in Lu ia b o h as desc ibed elsewhe e (51). The medium was supple- men ed wi h ampicillin a 100 mg/ml when equi ed. Cell ex ac s, enzyme assay, and p o ein de e mina ion. Cells we e ha es ed by cen i uga ion a 5,000 3g o 10 min, esuspended in 30 mM T is-HCl (pH 7.5), and b oken by c ushing hem in a mo a con aining liquid ni ogen. The lysa e was cen i uged a 12,000 3g o 15 min, and he esul ing supe na an cons i u ed he cell ex ac . NADP 1 -speci ic IDH ac i i y was measu ed as p e iously desc ibed (44). Uni s a e exp essed as mic omoles o NADPH p oduced pe minu e. P o ein concen a ions we e de e mined by he me hod o B ad o d (3), wi h bo ine se um albumin as s anda d. DNA manipula ion and gene sequence. To al DNA om cyanobac e ia was isola ed as desc ibed by Cai and Wolk (4). Plasmid isola ion om E. coli, ans o ma ion o E. coli, es ic ion, and liga ion wi h T4 ligase we e pe o med by s anda d p ocedu es (1, 51). DNA agmen s we e pu i ied om aga ose gels wi h he Gene-Clean Ki (Bio 101, Inc.). Fo Sou he n hyb idiza ions, DNA was diges ed and agmen s we e elec opho esed in 0.7% aga ose gels in a T is- bo a e-EDTA bu e sys em (51). T ans e o DNA o Z-P obe memb anes (Bio-Rad Labo a o ies) was done unde acuum, and Sou he n blo hyb idiza- ions we e pe o med as desc ibed p e iously (1). DNA p obes we e 32 P labeled by he andom p ime echnique wi h [a- 32 P]dCTP. Fo he e ologous Sou he n hyb idiza ions, low-s ingency condi ions (558C, 53SSC [13SSC is 0.15 M NaCl plus 0.015 M sodium ci a e]) we e used and he il e s we e washed a oom empe a u e. Sequencing o bo h s ands o he DNA agmen s con aining he icd gene was ca ied ou by he dideoxy-chain e mina ion me hod (52), wi h Sequenase e - sion 2.0 (U.S. Biochemical Co p.). Nes ed unidi ec ional dele ions o pMS1 and pMS3 (an EcoRI subclone o pMS2) we e gene a ed wi h he double-s anded Nes ed Dele ion Ki om Pha macia LKB. The sequence o he 59 egion ups eam o he icd gene and he nucleo ides coding o he i s ou amino acids o he IDH p o ein we e de e mined by ex ension o he p ime : 59ATCGTT GGGTACTACGGGCT 39( om nucleo ides 78 o 59 o he coding egion). This p ime was also used o he mapping o he ansc ip ional s a si e (see below). The junc ion be ween he adjacen icd agmen s o he plasmids pMS1 and pMS3 was sequenced wi h he plasmid pMS4 and app op ia e oligonucleo ides. Compu e sea ches o homologies we e done by using he FASTA p og am, and alignmen s we e p oduced wi h he Pileup p og am wi h de aul pa ame e s (12) and imp o ed by manual alignmen . Wes e n blo (immunoblo ) analysis. C ude ex ac s om Synechocys is o Anabaena cells, g own unde di e en condi ions, we e subjec ed o dena u ing elec opho esis on 12% (mass/ ol) polyac ylamide gels (30). Wes e n blo p o- cedu es we e ca ied ou as p e iously desc ibed (44). In all cases, he same amoun o o al p o ein was loaded. Inse ional mu agenesis o he Synechocys is icd gene. A 1.9-kb DNA agmen , con aining a chlo amphenicol esis ance gene om RSF1010 (14), was cloned in o he ApaI in e nal si e o he icd gene (see Fig. 3) in bo h o ien a ions. The esul ing plasmids, de i ed om pMS3 (pMS3CmA and pMS3CmB) (see Fig. 3), we e used o ans o m Synechocys is SFCV5 (7) as p e iously desc ibed (6). RNA isola ion and No he n (RNA) blo analysis. To al RNA om Synecho- cys is sp. s ain PCC 6803 was isola ed by he me hod o ho phenol as desc ibed by Mohamed and Jansson (42) wi h he modi ica ions desc ibed in e e ence 49. RNA om Anabaena sp. s ain PCC 7120 was isola ed as desc ibed in e e ence 17. Sepa a ion o RNA on o maldehyde gels, ans e o nylon memb anes (Hybond N-plus; Ame sham), p ehyb idiza ion, and hyb idiza ion condi ions we e acco ding o he ins uc ion manual om Ame sham. A 15-mg sample o o al RNA was loaded pe lane. Rela i e ansc ip le els we e quan i ied wi h a scanning densi ome e (Bio Image; Millipo e Co po a ion) om a leas wo di e en au o adiog aphs. In all he cases, he uppe band con aining he non- deg aded ansc ip was quan i ied. P ime ex ension analysis. The oligonucleo ide used o p ime ex ension was 59ATCGTTGGGTACTACGGGCT 39( om nucleo ide 78 o 59 o he coding egion). A e end labeling wi h T4 polynucleo ide kinase (Boeh inge ) and [g- 32 P]dATP as desc ibed elsewhe e (51), 50 ng o labeled oligonucleo ide (abou 10 6 cpm) was annealed o 50 mg o o al RNA om Synechocys is sp. s ain PCC 6803, g own unde di e en ni ogen condi ions, in 15 ml o hyb id- iza ion bu e (10 mM T is HCl [pH 8.3], 0.15 M KCl, and 1 mM o EDTA). Mix u es we e incuba ed i s a 858C o 5 min and hen a 508C o 3h.The ex ension eac ions we e ca ied ou a 448C o 1hasdesc ibed p e iously (1), wi h 10 U o a ian myeloblas osis i us e e se ansc ip ase (P omega). Reac- ion mix u es we e hen ea ed wi h RNase A (DNase- ee; Boeh inge ) and ex ac ed wi h phenol. DNA was p ecipi a ed wi h e hanol, esuspended in o - mamide-loading dye, and hen analyzed on a sequencing gel (6% polyac yl- amide). To de e mine he size o he ex ension p oduc , nucleo ide sequencing o an app op ia e plasmid was ca ied ou wi h he same oligonucleo ide as a p ime . Cloning o Synechocys is sp. s ain PCC 6803 n cA gene and pu i ica ion o GST-N cA usion p o ein. The comple e n cA open eading ame was cloned om Synechocys is sp. s ain PCC 6803 genomic DNA a e PCR ampli ica ion wi h he oligonucleo ides M1 (59ATACTCGAGATGGATCAGTCCCTAACC 39) ( om nucleo ide 1 o 18 o he n cA coding egion) and M2 (59TCACTC GAGGGCACTGGTCATAGAGG 39) ( om nucleo ide 694 o 682 o he n cA coding egion). The esul ing 715-bp DNA agmen was es ic ed wi h XhoI and cloned in o he XhoI si e o pGEX-4T-1 plasmid in phase wi h he glu a hi- one S- ans e ase (GST) gene o c ea e pGEX-N cA. The comple e n cA gene and he eading ame o he usion p o ein we e checked by DNA sequencing. GST-N cA usion p o ein and GST we e exp essed in E. coli LC137 om plasmids pGEX-N cA and pGEX-4T-1, espec i ely. One li e o cul u e was g own in Lu ia b o h medium o an op ical densi y a 600 nm o 0.6, induced wi h 0.5 mM isop opyl-b-D- hiogalac opy anoside o 2.5 h, ha es ed by cen i uga- ion, and esuspended in 5 ml o PBS bu e (150 mM NaCl, 16 mM Na 2 HPO 4 , 4mMNaH 2 PO 4 ,4mM phenylme hylsul onyl luo ide, 7 mM b-me cap oe ha- nol) supplemen ed wi h 1% T i on X-100. Cells we e b oken by sonica ion on ice, and insoluble deb is was pelle ed by cen i uga ion. Ex ac s we e mixed wi h 1 ml o glu a hione aga ose beads (Pha macia) and incuba ed o 2ha 48C wi h gen le agi a ion. Then beads we e ans e ed o a column and washed ex en- si ely wi h PBS bu e un il no mo e p o ein was elu ed om he column. GST o GST usion p o eins we e elu ed wi h 3 ml o 50 mM T is HCl (pH 8) con aining 10 mM educed glu a hione. Gel e a da ion assays. P obe was isola ed om aga ose gels a e diges ion o pMS4 plasmid wi h XmnI and SpeI. The 128-bp agmen was end labeled wi h [a- 32 P]dCTP wi h Sequenase e sion 2.0 enzyme. The binding eac ion was ca ied ou in a inal olume o 30 ml con aining 4 ng o labeled DNA and 2 mg o poly(dI-dC) in 25 mM T is HCl (pH 8.0)–50 mM KCl–4 mM spe midine–10% glyce ol. To his mix u e, 0.2 o 0.4 mg o pu i ied N cA- h ombin-clea ed p o- ein was added. One mic og am o GST-N cA usion p o ein was clea ed by incuba ion in PBS bu e supplemen ed wi h1Uo h ombin and 2.5 mM CaCl 2 o 15 min a 308C. Binding eac ions wi h 4 mg o GST p o ein, ea ed wi h h ombin unde he same condi ions, we e also pe o med. Fo compe i ion expe imen s, a 30- old excess o unlabeled p obe was added o he binding eac ion mix u e. As an un ela ed compe i o DNA, a agmen o pBluesc ip II SK plasmid was used. The mix u es we e incuba ed a 258C o 15 min and loaded in o a nondena u ing 6% polyac ylamide gel. Elec opho esis was ca ied ou a 48C and 280 V, and hen gels we e placed o e Wha man 3MM pape , d ied, and au o adiog aphed. Nucleo ide sequence accession numbe . The EMBL-GenBank accession num- be o he Synechocys is icd sequence desc ibed he e is X83563. VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4071 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om RESULTS E ec o ni ogen eeding on IDH ac i i y and p o ein le els. Since IDH is he enzyme esponsible o he a-ke oglu a a e supply o ammonium assimila ion, h ough he GS-GOGAT pa hway (38), we de e mined i he le els o IDH ac i i y and he amoun o IDH p o ein we e modula ed in esponse o changes in ni ogen a ailabili y. Figu e 1 shows ha he IDH ac i i y o c ude ex ac s om Synechocys is sp. s ain PCC 6803 cells subjec ed o ni ogen s a a ion o 10 h was be- ween h ee- and i e old highe han ha om ni a e-g own cells. In o de o es he amoun o IDH p o ein, c ude ex- ac s om di e en condi ions we e subjec ed o Wes e n blo analysis, wi h polyclonal an ibodies agains Synechocys is sp. s ain PCC 6803 IDH (44). The amoun o IDH p o ein in- c eased a e 5 o 10 h o ni a e emo al om a Synechocys is sp. s ain PCC 6803 cul u e (Fig. 2A), indica ing ha he in- c ease obse ed in he le el o IDH ac i i y co esponded o a highe amoun o IDH p o ein. Simila esul s we e ob ained when cells we e g own in ammonium-con aining medium and hen ans e ed o ni ogen- ee medium (no shown). As a con ol, he ac i i y o ano he enzyme o ca bon me abolism, glucose-6-phospha e dehyd ogenase, was es ed in c ude ex- ac s om Synechocys is ni ogen-s a ed cells. In his case, no signi ican di e ences we e obse ed be ween ni a e-g owing cells (55 mU/mg o p o ein) and ni ogen-de icien cells (60 mU/mg o p o ein). In he case o Anabaena sp. s ain PCC 7120, we had p e i- ously epo ed ha he NADP 1 -IDH ac i i y was highe when he cells we e g own unde dini ogen- ixing condi ions (44). The ac i i y o c ude ex ac s om ammonium- o ni a e- g own cells ep esen ed be ween 60 and 70% o ha om dini ogen- ixing cells. As shown in Fig. 2B, he highe IDH ac i i y o dini ogen- ixing cul u es co esponded o an in- c ease in he amoun o IDH p o ein. Wes e n blo analysis o Anabaena samples was ca ied ou wi h polyclonal an ibodies aised agains pu i ied Synechocys is NADP 1 -IDH, epo ed p e iously o c oss- eac wi h pu i ied Anabaena NADP 1 -IDH (45). Cloning and sequence o he Synechocys is icd gene. To in- es iga e whe he he egula ion o Synechocys is IDH ac i i y, in esponse o ni ogen s a a ion, co ela ed wi h highe gene exp ession unde hese condi ions, we isola ed he icd gene om his cyanobac e ium. Fo his pu pose, he p e iously cloned icd gene om Anabaena sp. s ain PCC 7120 (45) was used as a p obe o iden i y bands hyb idizing wi h diges ed genomic DNA om Synechocys is sp. s ain PCC 6803. Se e al es ic ion agmen s o Synechocys is DNA hyb idized o he Anabaena icd gene. The s a egy o cons uc ing a pa ial genomic lib a y in he pBluesc ip II SK ec o om size- ac iona ed DNA agmen s a ound a hyb idizing band was used, and by his app oach, wo XmnI-XmnI agmen s o 2.4 and 0.5 kb we e cloned by colony hyb idiza ion. These ag- men s co espond o he inse s o pMS1 and pMS2, espec- i ely (Fig. 3). Howe e , when we ied o clone he comple e icd gene om Synechocys is sp. by a DNA diges ion ha ga e ise o a single, high-molecula -weigh band hyb idizing wi h he Anabaena p obe, all he a emp s we e unsuccess ul. These esul s sugges ed ha he cloning in E. coli o he Synechocys is icd egion in o a high-copy-numbe plasmid like pBluesc ip migh be impossible. In ac , he cloning o he HincII-HincII, 3.4-kb agmen con aining he comple e icd gene om Syn- echocys is sp. was s aigh o wa d, wi h he low-copy-numbe pRL500 plasmid (14) as a ec o and he same cloning s a egy desc ibed abo e (pMS4; Fig. 3). A e sequencing o he app op ia e plasmids (see Ma e ials and Me hods), one open eading ame o 1,425 bp was ound. The coding egion ends wi h a TAA s op codon and p edic s a polypep ide o 475 amino acid esidues wi h a calcula ed mo- lecula mass o 52,241 Da, which is simila o he molecula mass de e mined o he pu i ied Synechocys is NADP 1 -IDH subuni (44). Compa ison o he deduced amino acid sequence o he Synechocys is icd gene wi h a ailable da abases by using he FASTA p og am e ealed ha Synechocys is NADP 1 -IDH is homologous o o he IDHs and isop opylmala e dehyd oge- nases sequenced, ha ing he highes le el o amino acid iden- i y wi h he Anabaena NADP 1 -IDH (81% iden i y). The mos signi ican di e ence be ween he bac e ial NADP 1 -IDH se- quences is he p esence o a 44-amino-acid- esidue inse ion in he cyanobac e ial p o eins. This ex a s e ch (amino acid esidues 286 o 329) is conse ed in he wo cyanobac e ial sequences a ailable and seems o be an exclusi e cha ac e is ic o NADP 1 -IDHs om cyanobac e ia. The p edic ed second- a y s uc u e o his egion is an a-helix, loca ed wi hin he small a/bdomain desc ibed o he E. coli enzyme (23), bu i s unc ion in he cyanobac e ial enzymes is unknown. Dis up ion o he icd gene. In o de o u he in es iga e he ole o NADP 1 -IDH in Synechocys is sp. s ain PCC 6803, we FIG. 1. E ec o ni ogen de iciency on he NADP 1 -IDH speci ic ac i i y om Synechocys is sp. s ain PCC 6803. Ni a e-g own Synechocys is cells we e washed wi h ni ogen- ee medium and ans e ed, a ime ze o, ei he o ni- ogen- ee medium (ni ogen s a a ion) o o ni a e-con aining medium (con- ol). Samples we e aken a he indica ed ime, and NADP 1 -IDH was de e - mined in cell ex ac s as desc ibed in Ma e ials and Me hods. Da a a e he means o h ee independen expe imen s, and s anda d e o s a e ep esen ed by ba s. FIG. 2. E ec o ni ogen a ailabili y on he amoun o NADP 1 -IDH p o ein o Synechocys is sp. s ain PCC 6803 and Anabaena sp. s ain PCC 7120 cells. (A) Ni a e-g own Synechocys is cells we e washed and ans e ed o ni ogen- ee medium. A he indica ed imes, samples we e aken o c ude ex ac p epa a- ion. A o al o 85 mg o p o ein o each ex ac o 2 mg o pu i ied NADP 1 -IDH p o ein was subjec ed o Wes e n blo analysis, wi h polyclonal an ibodies agains Synechocys is IDH. (B) C ude ex ac s om Anabaena sp. s ain PCC 7120 cells g own wi h di e en ni ogen sou ces we e subjec ed o Wes e n blo analysis wi h polyclonal an ibodies agains Synechocys is IDH. A o al o 180 mgo p o ein was loaded pe lane. Numbe s o he igh o each panel show molecula mass in kilodal ons. 4072 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om ied o ob ain an icd mu an s ain. An inac i a ed e sion o he cloned gene was cons uc ed by inse ion o a chlo am- phenicol esis ance (Cm ) casse e. The plasmids con aining he in e up ed gene we e in oduced by ans o ma ion in o Synechocys is sp. s ain SFCV5, and Cm colonies we e ob- ained in BG11C medium. Since a Synechocys is icd mu an was expec ed o be a glu ama e auxo oph, like icd mu an s in o he bac e ia (i.e., E. coli and Rhizobium sp.) (31, 37), Cm colonies we e cul u ed o se e al ounds o seg ega ion in he same medium supplemen ed wi h glu ama e (5 mM). Analysis by Sou he n hyb idiza ion o Cm s ains showed wo hyb idiza- ion bands: one co esponding o he wild- ype agmen and ano he co esponding o he inse ion o he 1.3-kb Cm cas- se e (da a no shown). This esul indica ed ha he gene eplacemen had aken place bu ha only some o he ch o- mosomes con ained he mu a ion (Synechocys is sp. s ain PCC 6803 is a polyploid bac e ium con aining abou 12 ch omo- somes pe cell [29]). Addi ion o a-ke oglu a a e o he cul u e medium did no inc ease ch omosomal seg ega ion (da a no shown). These esul s sugges ed ha comple ely seg ega ed Synechocys is icd mu an s we e no iable, as we had p e iously epo ed o Anabaena sp. s ain PCC 7120 icd mu an s (45). Modula ion o icd ansc ip le els in esponse o ni ogen s a a ion. In o de o de e mine i he inc ease o IDH ac i - i y and p o ein obse ed in Synechocys is cells unde ni ogen de iciency co esponded o highe icd gene exp ession, le els o icd mRNA unde di e en condi ions we e de e mined by No he n blo analysis. To al RNA om mid-exponen ial- phase Synechocys is cul u es g own ei he wi h ni a e o wi h ammonium o a e 15 h o ni ogen s a a ion was isola ed as desc ibed in Ma e ials and Me hods and p obed wi h a 536-bp XmnI-XmnI in e nal icd agmen (Fig. 3). No he n hyb id- iza ion expe imen s e ealed a smea ed hyb idiza ion pa e n indica ing ha a he e ogeneous popula ion o RNA molecules con ained icd sequences, he la ges o which was abou 1.6 kb (Fig. 4A). This esul sugges s ha icd ansc ip is monocis- onic. The p esence o excess 16S RNA was p obably espon- sible o deple ing he signal in he 1.5-kb egion (Fig. 4A). The le el o he icd ansc ip o ni ogen-s a ed cells was abou se en old highe han ha o ni a e- o ammonium-g owing cells (Fig. 4A). To mo e p ecisely de e mine he ime cou se o icd ansc ip accumula ion, ni a e-g own Synechocys is cells we e ans e ed o ni ogen- ee medium and samples we e aken a di e en imes o o al RNA isola ion. No he n blo analysis and u he densi ome ic quan i ica ion o he au o- adiog ams showed ha induc ion was obse ed a e 1ho ni ogen dep i a ion and ha maximal induc ion was ob ained a e 5 h unde hese condi ions (Fig. 5). In addi ion, No he n blo ing was ca ied ou o de e mine he le el o he icd gene ansc ip om Anabaena sp. s ain PCC 7120 cells g own wi h di e en ni ogen sou ces. As shown in Fig. 4B, he le el o Anabaena icd mRNA om dini ogen- ixing cells was abou wo old highe han ha o he ni a e- o ammonium-g owing cells. These esul s sugges ha icd gene exp ession was egu- la ed by ni ogen a ailabili y in bo h cyanobac e ia s udied. On he o he hand, he size o he ansc ip de ec ed o Anabaena icd gene was abou 2.0 kb (Fig. 4B). Since he size expec ed o a monocis onic icd ansc ip is abou 1.4 kb, we canno ule ou ha he icd gene om Anabaena sp. is included in a dicis onic messenge . In addi ion, ups eam o he Anabaena icd gene, he e a e six impe ec copies o a 7-bp epea ing sequence ha has he consensus sequence CCCCAAT (45). Hep anucleo ides wi h di e en consensus sequences ha e been de ec ed nea o he genes in he e ocys- ous cyanobac e ia (2, 15, 21, 43, 58). The ac ha hese hep ame epea s a e in some cases ansc ibed and ansla ed, along wi h he lack o clea p omo e sequences in he icd 59 lanking egion and he size o he ansc ip de ec ed, could indica e ha hese epea s a e also ansc ibed, he p omo e o icd being a away om his egion. The e o e, we ocused on he s udy o he p omo e o he Synechocys is icd gene. T ansc ip ional s a si e mapping o he Synechocys is sp. s ain PCC 6803 icd gene. P ime ex ension analysis was ca - ied ou o de e mine he ansc ip ion s a poin ( sp)o he Synechocys is sp. s ain PCC 6803 icd gene. A single ex ension FIG. 3. Res ic ion map o he isola ed plasmids ha con ain he Synechocys is sp. s ain PCC 6803 icd gene. The a ow ep esen s he p edic ed icd coding egion. FIG. 4. Le els o icd ansc ip in Synechocys is sp. s ain PCC 6803 and Anabaena sp. s ain PCC 7120 cells unde di e en ni ogen condi ions. (A) To al RNA was isola ed om mid-log-phase Synechocys is cells ha used ni a e o ammonium as ni ogen sou ce o om cells subjec ed o ni ogen de iciency o 15 h. RNA was dena u ed, elec opho esed in a 1% aga ose gel, blo ed, and hyb idized wi h a 536-bp XmnI-XmnISynechocys is icd agmen . (B) To al RNA was isola ed om mid-log-phase Anabaena cul u es ha used ni a e, ammo- nium, o dini ogen as ni ogen sou ce. RNA was p ocessed as desc ibed o panel A and p obed wi h a 1.4-kb ScaI-AccIAnabaena icd agmen . A o al o 15 mg o o al RNA was loaded pe lane. T ansc ip sizes we e es ima ed by compa ison wi h 23S, 16S, and 5S RNAs (42). VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4073 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om p oduc was de ec ed in ex ension expe imen s using o al RNA om ei he ammonium-g own o ni ogen-s a ed Syn- echocys is cells (Fig. 6). The ansc ip ion s a poin was lo- calized o nucleo ide 227 wi h espec o he i s ansla ed nucleo ide. The p oduc o he ex ension eac ion was much mo e abundan wi h RNA om ni ogen-s a ed cells han wi h RNA isola ed om ammonium-g own cells (Fig. 6A). A sequence wi h i e o six ma ching he 210 s 70 -dependen E. coli-like p omo e -consensus sequence occu ed ups eam o he icd sp (TATGAT). Howe e , no ob ious 235 consensus sequence was obse ed. The DNA sequence ha p ecedes he sp o he icd gene was compa ed wi h hose o p e iously known ni ogen- egula ed p omo e s om cyanobac e ia. A sequence (GTAN 8 TGC) exhibi ing nea -pe ec iden i y wi h he consensus binding si e o he ansc ip ion ac o N cA (GTAN 8 TAC) (34) was de ec ed 22 bases ups eam o he 210 sequence (Fig. 6B). I has been p oposed ha ni ogen- and N cA- egula ed p omo e s consis o a 210 sequence simila o he E. coli consensus and an N cA-binding si e, a posi ion 239.5 o 240.5 wi h espec o he sp, ha subs i u es o he ypical 235 hexame (Fig. 6B) (34). The e o e, he s uc u e o he icd gene p omo e is e y simila o hose o he N cA- egula ed p omo e s. Binding o N cA o he p omo e o he Synechocys is sp. s ain PCC 6803 icd gene. In o de o es whe he he an- sc ip ion ac i a o N cA binds o he p omo e o he Synecho- cys is icd gene, we ha e pe o med mobili y shi expe imen s wi h he pu i ied Synechocys is N cA p o ein. The n cA gene om Synechocys is s ain PCC 6803 was cloned by means o s anda d PCR echniques and in oduced in he pGEX-4T-1 exp ession ec o . The GST-N cA usion p o ein was pu i ied by a ini y ch oma og aphy on glu a hione aga ose. One single band o abou 50 kDa ( usion p o ein be ween GST [27.5 kDa] and N cA [25.0 kDa]) and no deg ada ion p oduc s we e isi- ble a e sodium dodecyl sul a e-polyac ylamide gel elec o- pho esis and Coomassie blue s aining. As shown in Fig. 7, pu i ied N cA e a ded a SpeI-XmnI 128-bp agmen ha con- ains he icd p omo e ( om 2100 o 128 wi h espec o he sp). A 30- old excess o unlabeled agmen signi ican ly e- duced he amoun o labeled N cA-icd p omo e complex. As a con ol, GST p o ein exp essed wi h he same ec o and pu i ied by he same p o ocol was unable o e a d he ag- men con aining he icd gene p omo e (Fig. 7). These da a FIG. 5. Kine ics o Synechocys is icd ansc ip accumula ion unde ni ogen s a a ion. Ni a e-g own Synechocys is cells we e ha es ed, washed, and ans- e ed o ni ogen- ee medium. Samples o o al RNA isola ion we e aken a he indica ed imes. RNA was p ocessed and hyb idized as desc ibed o Fig. 4A. (B) The mRNA le els we e quan i ied by densi ome y, and plo s we e d awn o ela i e mRNA le els e sus ime. Values a e a e ages o wo hyb idiza ion expe imen s and a e exp essed as a pe cen age o he highe alue. FIG. 6. (A) P ime ex ension analysis o he Synechocys is icd ansc ip . To al RNA (50 mg) om ammonium-g own o ni ogen-s a ed cells was an- nealed o an oligonucleo ide o he icd gene and ex ended wi h a ian myeloblas- osis i us e e se ansc ip ase as desc ibed in Ma e ials and Me hods. Lanes T, C, G, and A con ain a dideoxy sequencing ladde ca ied ou wi h he same p ime . The ansc ip ion s a nucleo ide is indica ed by an as e isk. (B) Align- men o Synechocys is icd p omo e egion wi h se e al N cA- egula ed p omo - e s om di e en cyanobac e ia. The N cA binding si e, he 210 box, and ansc ip ion s a poin s a e in bold ace. FIG. 7. Gel e a da ion analysis o he binding o N cA o a Synechocys is icd p omo e agmen . A 128-bp DNA agmen encompassing he icd p omo e was incuba ed in he p esence o a ious concen a ions o pu i ied N cA o GST p o ein. Lane 1, no p o ein; lane 2, 5 mM GST; lane 3, 0.25 mM N cA; lane 4, 0.5 mM N cA; lane 5, 0.5 mM N cA plus a 30- old excess o unlabeled p obe. 4074 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om indica e ha he N cA p o ein speci ically binds o he Syn- echocys is sp. s ain PCC 6803 icd egula o y egion. DISCUSSION In cyanobac e ia, NADP 1 -IDH is gene ally conside ed o be he enzyme esponsible o supplying he ca bon skele ons (a-ke oglu a a e) needed o ammonium assimila ion; he e- o e, egula ion o NADP 1 -IDH in esponse o changes in ni ogen a ailabili y could be expec ed. In ac , in Synechocys is sp. s ain PCC 6803, he le el o NADP 1 -IDH enzyme ac i i y and he amoun o NADP 1 -IDH p o ein and he icd ansc ip inc ease be ween i e- and se en old du ing ni ogen s a a- ion (Fig. 1, 2, 4, and 5). This ac ag ees wi h he s ong inc ease in he in acellula concen a ion o a-ke oglu a a e de ec ed 4 h a e ans e ing ni a e-g own Synechocys is cells o ni ogen- ee medium (se en old) (40). Howe e , in ni o- gen-s a ed cells he ac ion o ansaminases may also accoun o a conside able ac ion o he a-ke oglu a a e inc ease. In he case o Anabaena sp., exp ession o he icd gene was maximal unde dini ogen- ixing condi ions (Fig. 2 and 4), co - ela ing wi h he highe icd exp ession in Synechocys is sp. unde ni ogen s a a ion, since dini ogen ixa ion is he mos ni ogen-limi ing condi ion o Anabaena sp. We ha e p e i- ously epo ed ha a pa ially seg ega ed icd mu an om Anabaena sp. is unable o g ow on ni ogen- ee medium wi h- ou a-ke oglu a a e added (45). These esul s a e in conco - dance wi h he hypo hesis ha he equi emen o a-ke oglu - a a e mus be highe in his medium, p obably because ammonium assimila ion is es ic ed o he e ocys s unde hese condi ions. Since a-ke oglu a a e is he subs a e o glu ama e syn he- sis, egula ion o NADP 1 -IDH mus be coo dina ed wi h ha o he GS-GOGAT pa hway. In ac , exp ession o he glnA gene (s uc u al gene o glu amine syn he ase ype I) has been also shown o be egula ed in esponse o ni ogen s a a ion in se e al cyanobac e ia. T ansc ip om he Synechococcus sp. s ain PCC 7002 glnA gene inc eases h ee- o i e old when he cells a e s a ed o ni ogen (59) while, in s ain PCC 7942, a s ong inc ease in he amoun o glnA mRNA has been desc ibed a e ans e ing ammonium-g own cells o ni a e- con aining o ni ogen- ee medium (9, 34). In Anabaena sp. s ain PCC 7120, glnA is ansc ibed om mul iple p omo e s ha a e di e en ially exp essed in esponse o changes in he ni ogen sou ce, he highes exp ession being unde dini o- gen- ixing condi ions (56). The amoun o glnA ansc ip om Synechocys is sp. s ain PCC 6803 also inc eases ( wo- o ou - old) unde ni ogen de iciency (49a). The inc ease o a-ke o- glu a a e media ed by he induc ion o NADP 1 -IDH du ing ni ogen s a a ion, oge he wi h he induc ion o GS exp es- sion, may co espond o a me abolic mechanism o gua an ee he immedia e assimila ion o he a ailable ni ogen h ough he GS-GOGAT pa hway. In addi ion, a-ke oglu a a e is no only he subs a e o ammonium assimila ion bu also a e y impo an egula o y me aboli e in ol ed in he egula ion o ni ogen assimila ion pa hways in cyanobac e ia (16, 40) and o he p oka yo es (36). This egula o y ole could explain why i was impossible o ob ain an icd null mu an in Synechocys is s ain PCC 6803 as well as in Anabaena s ain PCC 7120 (45). The N cA p o ein is a posi i e egula o o genes subjec ed o ni ogen con ol in cyanobac e ia. N cA belongs o he am- ily o bac e ial DNA-binding p o eins o which cyclic AMP ecep o p o ein is he p o o ype (28, 57). I has been demon- s a ed ha N cA (Bi A) binds di ec ly o he p omo e egions o glnA, bcL,xisA, and ni H genes in Anabaena sp. s ain PCC 7120 (47, 60) and o he p omo e egions o glnA,n cA, and he ni An ABCDna B ope on in Synechococcus sp. s ain PCC 7942 (34). P ime ex ension expe imen s showed ha he s uc- u e o he Synechocys is sp. s ain PCC 6803 icd gene p omo e ag ees wi h ha o an N cA- egula ed p omo e (Fig. 6B). The pu a i e N cA binding sequence om he Synechocys is icd p omo e (GTAN 8 TGC) con ains only one misma ch wi h e- spec o he de ined consensus (GTAN 8 TAC) and p esen s also he A:T- ich egion ound ups eam o all he N cA bind- ing si es so a desc ibed (Fig. 6B). In ac , pu i ied Synecho- cys is s ain PCC 6803 N cA p o ein is able o bind speci ically o a sho DNA agmen con aining he icd p omo e (Fig. 7). All hese da a oge he wi h he exp ession pa e n o he icd gene s ongly sugges ha ansc ip ion o he Synechocys is icd gene is posi i ely egula ed by N cA. N cA induces ansc ip ion om se e al p omo e s in he absence o ammonium, unde condi ions o ni a e u iliza ion (34). All hese p omo e s (pglnA,pn cA, and pni A om Syn- echocys is sp. s ain PCC 7942) con ain an N cA binding si e ha ma ches exac ly he consensus sequence GTAN 8 TAC. The ac ha he N cA binding si e o he icd p omo e does no exac ly i he consensus mo i could explain why ansc ip- ion o he icd gene does no inc ease in ni a e-g own cells compa ed wi h ammonium-g own cells. Since ni ogen s a a- ion is a mo e ammonium-de icien condi ion han ni a e u i- liza ion, and since n cA gene ansc ip ion is au o egula ed (34), le els o N cA p o ein may be highe unde ni ogen de iciency han unde ni ogen assimila ion. Ac i a ion o he icd p omo e , wi h a low-a ini y binding si e, would equi e a highe concen a ion o N cA p o ein ha would be eached in ni ogen-s a ed cells bu no in ni a e-g owing cells. A simila si ua ion is ound in he p omo e o he Anabaena sp. s ain PCC 7120 xisA gene, which con ains h ee nonconsensus N cA binding si es. xisA encodes a si e-speci ic ecombinase equi ed o he ea angemen o ni genes and is induced only unde ni ogen s a a ion, no unde ni a e assimila ion (47, 60). In summa y, he egula ion o he cyanobac e ial icd gene in esponse o ni ogen a ailabili y indica es a coo dina e exp es- sion o he genes in ol ed in ca bon skele on supply and hose o ni ogen assimila ion. ACKNOWLEDGMENTS This wo k was suppo ed by g an s om DGICYT (PB91-0127 and PB94-1444) and by Jun a de Andalucia (g oup no. 3247). M. I. Mu o- Pas o and J. C. Reyes we e eceip s o a ellowship om he MEC, Spain. REFERENCES 1. Ausubel, F. M., R. B en , R. E. Kings on, D. D. Moo e, J. G. Seidman, J. A. Smi h, and K. S uhl (ed.). 1992. Cu en p o ocols in molecula biology. G eene Publishing and Wiley-In e science, New Yo k. 2. Baue , C. C., L. Scappino, and R. Haselko n. 1993. G ow h o he cyanobac- e ium Anabaena on molecula ni ogen: ni J is equi ed when i on is limi ed. P oc. Na l. Acad. Sci. USA 90:8812–8816. 3. B ad o d, M. M. 1976. A apid and sensi i e me hod o he quan i a ion o mic og am quan i ies o p o ein u ilizing he p inciple o p o ein-dye bind- ing. Anal. Biochem. 72:248–254. 4. Cai, Y., and C. P. Wolk. 1990. Use o a condi ionally le hal gene in Anabaena sp. s ain PCC 7120 o selec o double ecombinan s and o en ap inse ion sequences. J. Bac e iol. 172:3138–3145. 5. Chas ain, C. J., J. S. B usca, T. S. Ramasub amanian, T.-F. Wei, and J. W. Golden. 1990. A sequence-speci ic DNA-binding ac o (VF1) om Anabaena sp. s ain PCC 7120 ege a i e cells binds o h ee adjacen si es in he xisA ups eam egion. J. Bac e iol. 172:5044–5051. 6. Chau a , F., L. De V ies, A. Van de Ende, and G. A. Van A kel. 1986. A hos - ec o sys em o gene cloning in he cyanobac e ium Synechocys is PCC 6803. Mol. Gen. Gene . 204:165–191. 7. Chau a , F., J. Laba e, and F. Fe ino. 1988. De elopmen o genes ans e sys em o he cyanobac e ium Synechocys is PCC 6803. Plan Physiol. Bio- chem. 26:629–637. 8. Chen, R. D., and P. Gadal. 1990. S uc u e, unc ion and egula ion o NAD VOL. 178, 1996 NADP 1 -IDH GENE IS NITROGEN REGULATED IN CYANOBACTERIA 4075 on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om and NADP dependen isoci a e dehyd ogenase in highe plan s and in o he o ganisms. Plan Physiol. Biochem. 28:411–427. 9. Cohen-Kupiec, R., M. Gu e i z, and A. Zilbe s ein. 1993. Exp ession o glnA in he cyanobac e ium Synechococcus sp. s ain PCC 7942 is ini ia ed om a single ni -like p omo e unde a ious ni ogen condi ions. J. Bac e iol. 175: 7727–7731. 10. Cupp, J. R., and L. McAlis e -Henn. 1991. NADP 1 -dependen isoci a e dehyd ogenase. Cloning, nucleo ide sequence, and dis up ion o he IDH2 gene om Saccha omyces ce e isiae. J. Biol. Chem. 266:22199–22205. 11. Cupp, J. R., and L. McAlis e -Henn. 1992. Cloning and cha ac e iza ion o he gene encoding he IDH1 subuni o NADP 1 -dependen isoci a e dehy- d ogenase om Saccha omyces ce e isiae. J. Biol. Chem. 267:16417–16423. 12. De e eux, J., P. Haebe li, and O. Smi hies. 1984. A comp ehensi e se o sequence analysis p og ams o he VAX. Nucleic Acids Res. 12:387–395. 13. Eikmanns, B. J., D. Ri mann, and H. Sahm. 1995. Cloning, sequence anal- ysis, exp ession, and inac i a ion o he Co ynebac e ium glu amicum icd gene encoding isoci a e dehyd ogenase and biochemical cha ac e iza ion o he enzyme. J. Bac e iol. 177:774–782. 14. Elhai, J., and C. P. Wolk. 1988. A e sa ile class o posi i e-selec ion ec o s based on he non iabili y o palind ome-con aining plasmids ha allows cloning in o long polylinke s. Gene 68:119–138. 15. Flo iano, B., A. He e o, and E. Flo es. 1992. Isola ion o a ginine auxo- ophs, cloning by mu an complemen a ion and sequence analysis o he a gC gene om he cyanobac e ium Anabaena species PCC 7120. Mol. Mic obiol. 6:2085–2094. 16. Fo chhamme , K., and N. Tandeau de Ma sac. 1995. Phospho yla ion o he PII p o ein (glnB gene p oduc ) in he cyanobac e ium Synechococcus sp. s ain PCC 7942: analysis o in i o kinase ac i i y. J. Bac e iol. 177:5812– 5817. 17. F ı´as, J. E., E. Flo es, and A. He e o. 1994. Requi emen o he egula o y p o ein N cA o he exp ession o ni ogen assimila ion and he e ocys de elopmen genes in he cyanobac e ium Anabaena sp. PCC 7120. Mol. Mic obiol. 14:823–832. 18. F ı´as, J. E., A. Me´ ida, A. He e o, J. Ma ı´n-Nie o, and E. Flo es. 1993. Gene al dis ibu ion o he ni ogen con ol gene n cA in cyanobac e ia. J. Bac e iol. 175:5710–5713. 19. Haselbeck, R. J., R. F. Colman, and L. McAlis e -Henn. 1992. Isola ion and sequence o a cDNA encoding po cine mi ochond ial NADP-speci ic isoci- a e dehyd ogenase. Biochemis y 31:6219–6223. 20. Haselbeck, R. J., and L. McAlis e -Henn. 1991. Isola ion, nucleo ide se- quence and dis up ion o he Saccha omyces ce e isiae encoding mi ochon- d ial NADP(H)-speci ic isola ion and sequence o a cDNA encoding po cine mi ochond ial NADP-speci ic isoci a e dehyd ogenase. J. Biol. Chem. 266: 2339–2345. 21. Holland, D., and C. P. Wolk. 1990. Iden i ica ion and cha ac e iza ion o he A, a gene ha ac s ea ly in he p ocess o mo phological di e en ia ion o he e ocys s. J. Bac e iol. 172:3131–3137. 22. Huh, T.-L., J.-H. Ryu, J.-W. Huh, H.-C. Sung, I.-U. Oh, B. J. Song, and R. L. Veech. 1993. Cloning o a cDNA encoding bo ine mi ochond ial NADP 1 - speci ic isoci a e dehyd ogenase and s uc u al compa ison wi h i s isoen- zymes om di e en species. Biochem. J. 292:705–710. 23. Hu ley, J. H., P. E. Tho sness, V. Ramalingam, N. H. Helme s, D. E. Koshland, J ., and R. M. S oud. 1989. S uc u e o a bac e ial enzyme egula ed by phospho yla ion, isoci a e dehyd ogenase. P oc. Na l. Acad. Sci. USA 86:8635–8639. 24. Ishii, A., T. Ochiai, S. Imagawa, N. Fukunaga, S. Sasaki, O. Minowa, Y. Mizuno, and H. Shiokawa. 1987. Isozymes o isoci a e dehyd ogenase om a obliga ely psych ophilic bac e ium, Vib io sp. s ain ABE-1: pu i ica ion, and modula ion o ac i i ies by g ow h condi ions. J. Biochem. 102:1489–1498. 25. Ishii, A., M. Suzuki, T. Saha a, Y. Takada, S. Sasaki, and N. Fukunaga. 1993. Genes encoding wo isoci a e dehyd ogenase isozymes o a psych o- philic bac e ium, Vib io sp. s ain ABE-1. J. Bac e iol. 175:6873–6890. 26. Jin, S., and A. L. Sonenshein. 1994. Iden i ica ion o wo dis inc Bacillus sub ilis ci a e syn hase genes. J. Bac e iol. 176:4669–4679. 27. Jin, S., and A. L. Sonenshein. 1994. T ansc ip ional egula ion o Bacillus sub ilis ci a e syn hase genes. J. Bac e iol. 176:4680–4690. 28. Kolb, A., S. Busby, H. Buc, S. Ga ges, and S. Adhya. 1993. T ansc ip ional egula ion by cAMP and i s ecep o p o ein. Annu. Re . Biochem.62:749–795. 29. Laba e, J., F. Chau a , and P. Thu iaux. 1989. Inse ional mu agenesis by andom cloning o an ibio ic esis ance genes in o he genome o he cya- nobac e ium Synechocys is s ain PCC 6803. J. Bac e iol. 171:3449–3457. 30. Laemmli, U. K. 1970. Clea age o s uc u al p o eins du ing he assembly o he head o bac e iophage T4. Na u e (London) 227:680–685. 31. Lakshmi, T. M., and R. B. Helling. 1976. Selec ion o ci a e syn hase de iciency in icd mu an s o Esche ichia coli. J. Bac e iol. 127:76–83. 32. Lapo e, D. C., P. E. Tho sness, and D. E. Koshland, J . 1985. Compensa- o y phospho yla ion o isoci a e dehyd ogenase. A mechanism o adap a- ion o he in acellula en i onmen . J. Biol. Chem. 260:10563–10568. 33. Leyland, M. L., and D. J. Kelly. 1991. Pu i ica ion and cha ac e iza ion o a monome ic isoci a e dehyd ogenase wi h dual coenzyme om he pho o- syn he ic bac e ium Rhodomic obium annielii. Eu . J. Biochem. 202:85–93. 34. Luque, I., E. Flo es, and A. He e o. 1994. Molecula mechanism o he ope a ion o ni ogen con ol in cyanobac e ia. EMBO J. 13:2862–2869. 35. MacKinney, G. 1941. Abso p ion o ligh by chlo ophyll solu ion. J. Biol. Chem. 140:315–322. 36. Magasanik, B., and F. C. Neidha d . 1987. Regula ion o ca bon and ni o- gen u iliza ion, p. 1318–1325. In F. C. Neidha d , J. L. Ing aham, K. B. Low, B. Magasanik, M. Schaech e , and H. E. Umba ge (ed.), Esche ichia coli and Salmonella yphimu ium: cellula and molecula biology. Ame ican So- cie y o Mic obiology, Washing on, D.C. 37. McDe mo , T. R., and M. L. Kahn. 1992. Cloning and mu agenesis o he Rhizobium melilo i isoci a e dehyd ogenase gene. J. Bac e iol. 174:4790–4797. 38. Meeks, J. C., C. P. Wolk, W. Lockau, N. Schilling, P. W. Sha e , and W. S. Chien. 1978. Pa hways o assimila ion o [ 13 N]N 2 and 13 NH 4 by cyanobac- e ia wi h and wi hou he e ocys s. J. Bac e iol. 134:125–130. 39. Meissne , P. S., W. P. Sisk, and M. L. Be man. 1987. Bac e iophage 1 cloning sys em o he cons uc ion o di ec ional cDNA lib a ies. P oc. Na l. Acad. Sci. USA 84:4171. 40. Me´ ida, A., P. Candau, and F. J. Flo encio. 1991. Regula ion o glu amine syn he ase ac i i y in he unicellula cyanobac e ium Synechocys is sp. s ain PCC 6803 by he ni ogen sou ce: e ec o ammonium. J. Bac e iol. 173: 4095–4100. 41. Miyazaki, K., H. Eguchi, A. Yamagishi, T. Wakagi, and T. Oshima. 1992. Molecula cloning o he isoci a e dehyd ogenase gene o an ex eme he - mophile, The mus he mophilus HB8. Appl. En i on. Mic obiol. 58:93–98. 42. Mohamed, A., and C. Jansson. 1989. In luence o ligh on accumula ion o pho osyn hesis-speci ic ansc ip s in he cyanobac e ium Synechocys is 6803. Plan Mol. Biol. 13:693–700. 43. Mulligan, M. E., and R. Haselko n. 1989. Ni ogen ixa ion (ni ) genes o he cyanobac e ium Anabaena species s ain PCC 7120. J. Biol. Chem. 264: 19200–19207. 44. Mu o-Pas o , M. I., and F. J. Flo encio. 1992. Pu i ica ion and p ope ies o NADP-isoci a e dehyd ogenase om he unicellula cyanobac e ium Syn- echocys is sp. PCC 6803. Eu . J. Biochem. 203:99–105. 45. Mu o-Pas o , M. I., and F. J. Flo encio. 1994. NADP 1 -isoci a e dehyd o- genase om he cyanobac e ium Anabaena sp. s ain PCC 7120: pu i ica ion and cha ac e iza ion o he enzyme and cloning, sequencing, and dis up ion o he icd gene. J. Bac e iol. 176:2718–2726. 46. Pea ce, J., C. K. Leach, and N. G. Ca . 1969. The incomple e ica boxylic acid cycle in he blue-g een alga Anabaena a iabilis. J. Gen. Mic obiol. 55:371–378. 47. Ramasub amanian, T. S., T.-F. Wei, and J. W. Golden. 1994. Two Anabaena sp. s ain PCC 7120 DNA-binding ac o s in e ac wi h ege a i e cell- and he e ocys -speci ic genes. J. Bac e iol. 176:1214–1223. 48. Ree es, H. C., G. O. Danmy, C. L. Chen, and M. Hous on. 1972. NADP- speci ic isoci a e dehyd ogenase o Esche ichia coli. Pu i ica ion and cha - ac e iza ion. Biochim. Biophys. Ac a 258:27–39. 49. Reyes, J. C., and F. J. Flo encio. 1995. Elec on anspo con ol ansc ip- ion o he glu amine syn he ase gene (glnA) om he cyanobac e ium Syn- echocys is sp. PCC 6803. Plan Mol. Biol. 27:789–799. 49a.Reyes, J. C., and F. J. Flo encio. Unpublished esul s. 50. Rippka, R., J. De uelles, J. B. Wa e bu y, M. He man, and R. Y. S anie . 1979. Gene ic assignmen , s ain his o ies and p ope ies o pu e cul u es o cyanobac e ia. J. Gen. Mic obiol. 111:1–61. 51. Samb ook, J., E. F. F i sch, and T. Mania is. 1989. Molecula cloning: a labo a o y manual, 2nd ed. Cold Sp ing Ha bo Labo a o y P ess, Cold Sp ing Ha bo , N.Y. 52. Sange , F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing wi h chain- e mina ing inhibi o s. P oc. Na l. Acad. Sci. USA 74:5463–5467. 53. Sho osh, B. S., and R. A. Dixon. 1992. Molecula cha ac e iza ion and exp ession o an isoci a e dehyd ogenase om al al a (Medicago sa i a L.). Plan Mol. Biol. 20:801–807. 54. S anie , R. Y., and G. Cohen-Bazi e. 1977. Pho o ophic p oka yo es: he cyanobac e ia. Annu. Re . Mic obiol. 31:225–274. 55. Suzuki, M., T. Saha a, J.-I. Tsu uha, Y. Takada, and N. Fukunaga. 1995. Di e en ial exp ession in Esche ichia coli o he Vib io sp. s ain ABE-1 icdI and icdII genes encoding s uc u ally di e en isoci a e dehyd ogenase isozymes. J. Bac e iol. 177:2138–2142. 56. Tume , N. E., S. J. Robinson, and R. Haselko n. 1983. Di e en p omo e s o he Anabaena glu amine syn he ase gene du ing g ow h using molecula o ixed ni ogen. Na u e (London) 306:337–342. 57. Vega-Palas, M. A., E. Flo es, and A. He e o. 1992. N cA, a global ni ogen egula o om he cyanobac e ium Synechococcus ha belongs o he C p amily o bac e ial egula o s. Mol. Mic obiol. 6:1853–1859. 58. Vioque, A. 1992. Analysis o he gene encoding he RNA subuni o ibonu- clease P om cyanobac e ia. Nucleic Acids Res. 20:6331–6337. 59. Wagne , S. J., S. P. Thomas, R. I. Kau man, B. T. Nixon, and S. E. S e ens, J . 1993. The glnA gene o he cyanobac e ium Agmenellum quad uplica um PR-6 is nonessen ial o ammonium assimila ion. J. Bac e iol. 175:604–612. 60. Wei, T.-F., T. S. Ramasub amanian, F. Pu, and J. W. Golden. 1993. Anabaena sp. s ain PCC 7120 bi A gene encoding a sequence-speci ic DNA- binding p o ein cloned by in i o ansc ip ional in e e ence selec ion. J. Bac e iol. 175:4025–4035. 4076 MURO-PASTOR ET AL. J. BACTERIOL. on July 25, 2017 by USE/BTCA.GENERAL UNIVERSITARIA Se illah p://jb.asm.o g/Downloaded om