A dual tool. The role of the ripoptosome in phagocytic cell activation and differentiation

A DUAL TOOL THE ROLE OF THE RIPOPTOSOME IN PHAGOCYTIC CELL ACTIVATION AND DIFFERENTIATION María José Oliva Martín A DUAL TOOL María José Oliva Martín 2 “El árbol del estudio es amargo pero sus frutos son dulces.” Aristóteles A DUAL TOOL María José Oliva Martín 3 A mi familia, quien me ha impulsado siempre a superarme a mí misma, y a Josh, quien me ayuda, cada día, a conseguirlo. A DUAL TOOL María José Oliva Martín 4 ABSTRACT The term ripoptosome refers to the molecular platform containing, amongst others, two proteins involved in cell death: Caspase 8, involved in apoptotic cell death, and Receptor interacting protein 1 (RIP-1) kinase, involved in necroptotic cell death. The ripoptosome is thus a switch that regulates both types of cell death. However, it is not its only function, as it has recently been associated to cell activation and differentiation. In this thesis we attempt to further understand the role of the ripoptosome in the activation and differentiation of monocytes and macrophages. Both of these cell types are important mediators of the innate immune response, and therefore an impairment of their differentiation or their overactivation have been shown to be a contributing factor in the development of inflammatory diseases, cancer and neurodegeneration. We have found that Caspase 8 mediates monocyte activation and could therefore be a potential therapeutic target in diseases such as the systemic inflammatory response syndrome. We have also shown that RIP-1 kinase regulates macrophage differentiation. Finally, we have observed that the employment of RIP-1 inhibitors may have deleterious effects in the central nervous system. Together, these results point out the relevance of the ripoptosome in therapeutics and the need for further investigation into its mechanisms of action and related pathways. RESUMEN El término ripoptosoma hace referencia a la plataforma molecular que contiene, entre otras, dos proteínas implicadas en muerte celular: caspasa 8, implicada en apoptosis, y RIP-1 kinasa, implicada en necroptosis. El ripoptosoma puede por tanto entenderse como un switch entre ambos tipos de muerte celular. Sin embargo, ésta no es su única función, ya que recientemente se ha asociado a esta plataforma molecular con procesos de activación y diferenciación celular. En esta tesis se ha tratado de profundizar en el papel del ripoptosoma en la activación y diferenciación de monocitos y macrófagos. Ambos tipos celulares son importantes mediadores de la respuesta inmune innata, y por tanto alteraciones en sus procesos de activación y diferenciación han resultado ser un factor contribuyente en el desarrollo de enfermedades inflamatorias, cáncer y neurodegeneración. Hemos encontrado que caspasa 8 media la activación de monocitos y podría por tanto ser una diana terapéutica potencial en enfermedades como el síndrome de respuesta inflamatoria sistémica. También hemos mostrado que RIP-1 kinasa regula la diferenciación de monocitos a macrófagos. Finalmente, hemos observado que el uso de inhibidores de RIP-1 kinasa puede resultar en efectos perjudiciales para el sistema nervioso central. En conjunto, estos resultados ponen de manifiesto la relevancia del ripoptosoma en terapéutica y la necesidad de continuar investigando sobre su mecanismo de acción y rutas de señalización asociadas. A DUAL TOOL María José Oliva Martín 5 ABBREVIATED INDEX A DUAL TOOL María José Oliva Martín 6 ABSTRACT/RESUMEN (both English and Spanish) INDEX AGRADECIMIENTOS/ACKNOWLEDGEMENTS (both English and Spanish) ABBREVIATIONS INTRODUCTION (English) AIMS/OBJETIVOS (both English and Spanish) MATERIALS AND METHODS (English) RESULTS (English) PART I. CASPASE 8: A POTENTIAL TARGET IN THE TREATMENT OF SIRS PART II. RIPK1: A DOUBLE BRAKE IN THE CONTROL OF MACROPHAGE DIFFERENTIATION PART III. A SIDE EFFECT OF NECROSTATIN-1 AS A NEURODEGENERATIVE AGENT CONCLUDING REMARKS/CONCLUSIONES GENERALES (both English and Spanish) REFERENCES APPENDIX I: PUBLISHED ARTICLES DURING THE ONGOING OF THIS PhD APPENDIX II (Spanish). AVENZOAR RESEARCH AWARDS WINNER 2015. CASPASA 8: UNA HERRAMIENTA TERAPÉUTICA POTENCIAL EN EL TRATAMIENTO DEL SHOCK SÉPTICO (TRABAJO GANADOR DEL PREMIO AVENZOAR 2015) A DUAL TOOL María José Oliva Martín 13 It’s taken me a long time to write these acknowledgements. I guess it is the same for everyone. In my case, I sat in front of a blank computer, wondering how many names I had to write – and how many I was scared to forget – and I finally came to the conclusion that either I am a very grateful person or I have been surrounded by very good people. I want to think it’s been a mixture of both. The next thing that went through my mind was in which order I would thank all these people. One tends to think that the order correlates with how grateful you are, but the truth is that, at the end of the day, you cannot write everyone’s name in the same line. Therefore, if you are one of those that will appear below, remember that I am equally grateful to you no matter where you appear in this endless list of acknowledgements. I want to thank my PhD supervisor, Prof. Jose Luis Venero, for being much more than a mere boss. He has given me the freedom to think and drive my own PhD and so grow both as a scientist and a person. I also thank him for his scientific advice and for bestowing me the passion he lives science with, as well as for always having time for our long scientific discussions. It is always easier for one to give orders – and the other to follow them. What is hard is to have discussions and reach a consensus, and he has taught me to think through my results and to draw my own conclusions but also to consider other people’s hypotheses. Moreover, I am incredibly grateful that he has always helped me combine work with an unusual personal situation. Without his sympathy and trust I could not have managed, so I really hope he thinks I have made a good use of it. Special thanks go to the two people who drew me into science. Prof. Alberto Machado de la Quintana, who since I was just an undergrad saw something in me (though I haven’t yet found what it is), brought me into the lab and made me feel included but also supported me to go abroad and do my masters in Cambridge. Also Prof. Guy Brown, as he was the first one who encouraged me to think past my experiments and results. I learnt more than just techniques during my masters, and I really believe that those skills have truly helped me during my PhD. I am also very grateful that we continued our collaboration after I left, that he welcomed me back in his lab for the three-month period for an International PhD, and that, to date, we are still working together. I would like to thank my co-supervisor, Dr. Miguel Ángel Burguillos, for his teaching of techniques and for making me part of his work. I would have loved to work in the same lab for longer! A DUAL TOOL María José Oliva Martín 14 I have to (and really want to) thank Prof. Bertrand Joseph for driving forward the final part of my PhD. His belief in my projects, replying to my unearthly ‘I found a new hypothesis’ emails and the way he made me part of his lab during my short stays, supporting me both in terms of work and economically, really gave me the confidence and the push I needed. I also want to thank him for helping me see experiments in a different way and combat my perfectionism and the stressful way I would look at them. I promise I will ‘take it easy’ from now on! I also want to thank Dr. José Antonio Pérez Simón for hosting me in his lab during the first part of my thesis, and giving me the opportunity to work freely as just another lab member. If it weren’t for this, I would not have acquired the insight into clinical and translational research that has provided so much to this thesis. I also want to thank him for his willingness and efficiency in sorting all the matters concerning my work in his lab and the hospital, which means a lot knowing how many responsibilities he has. I would also like to thank Dr. Luis Ignacio Sánchez-Abarca for his full-time dedication to my projects during the first years of my thesis. It’s been a long time since those long evenings and bank holidays at the cytometer, but I still have a good memory of them. I also want to thank him for being, really, a co-supervisor, patiently teaching me many of the techniques I have used in this thesis, as well as giving me useful advice on so many matters, even when I didn’t know I was searching for it. I cannot finish without thanking all my lab mates, from every single lab I have been to. From the lab at the Biochemistry Department, I want to thank all my present colleagues and friends, Ana, Elena, Mario, Albert, Juan, Rocío R. and those who are now gone, Rianne, Afrah, Edel and Nikenza, for being almost like a family to me, putting up with stressed MJ running around in more than one occasion. To Rocío M., I have to thank her for being a great ‘mum’ also in the lab, and caring so much for my career by pushing me to take courses, present at conferences and apply to the award I eventually got. If there was a valuable thing I learnt from her it is that the best team is that in which everyone helps each member to develop their maximum potential. To Antonio J., I need to thank him for listening to me – sometimes for so long – about scientific and personal topics, and for always giving me advice based on what I really needed. To Alejandro, my friend and ‘tandem in science’, for all his dedication and for backing me up so many times. The Spanish saying states “Who tries to do everything can’t finish anything”; but he has been, and still is, helping me prove it wrong. To Isabel, for her teachings about life, because not A DUAL TOOL María José Oliva Martín 15 everything you can learn from someone is related to science. And finally, to ‘my’ Carmen, for all her help and support with that obscure science that is bureaucracy. I also want to thank all the lecturers of the Department for their help and advice on teaching, as well as all the members from Lab 111 in the IBiS, especially Seba, for always treating me as if I was just one of them. From the Lab 202 at the IBiS, I want to thank all my lab mates for having taught me the meaning of a job. I have acquired great experience and skills for life and I really am very grateful for that. I would also like to thank Teresa for her teachings on flow cytometry as well as Cuca and Ivan for always having time to give me scientific advice and teaching me. Finally, I want to thank Paco de Paula for his constant availability to perform the blood extractions, and for teaching me that professionalism and flair can go together. I also want to thank all the lab members from the Biochemistry Department in Cambridge, for making me feel at home during my stay, and, of course, I want to thank my friend and lab mate Anna for her patient teaching of techniques and for that calmness and good mood she irradiates, which can make anyone feel better. As for the lab members from Bertrand Joseph’s lab and CCK, I would like to thank them all for being an amazing gang and for making me feel part of it in such a short time. They are the paradigm of fun science in all aspects, and I learnt a lot from their interest and curiosity for everyone’s projects and results without stopping having fun. I specially want to thank Johanna and Poppi for drowning themselves into my projects and help me as much as they are doing. I really hope I can pay you back with some good publications! And I know I am extending these acknowledgements too much, but I also have to thank the technicians from the University of Seville who have invested time in solving problems or doing things for me, Modesto, Laura and Juanlu, sometimes even out of their working hours, which is a clear example of their professionalism. And obviously, I cannot but thank my family. My dad, who wrote on my first ever book the sentence at the beginning of this thesis: ‘The tree of knowledge is bitter, but the fruit is sweet’. My mum, whose support and trust in me goes far from beyond, and who has always been there, in the shadow, even when I didn’t deserve it. They both have made in me a huge investment, and sacrificed a great part of their life income and time to make of me what I am today. Maybe in a few years this thesis won’t be such a big part of my life as it is now but at least, today, it symbolises the effort they have put on one of their dreams, A DUAL TOOL María José Oliva Martín 16 which is me. My brother, to whom I have always been so close. We have learnt a lot from these years living together, and what is more, we have learnt it together. I could thank him for so many little things, but what I really thank him for is for being my brother and for always being there when I really need him. I’m so proud of you! I also want to thank my new family, the Longs, for the support they have given us and the happiness they have provided me through these years. My aunt and uncle, for their support throughout my life, and my ‘little’ cousins, for always getting a smile out of me and help me disconnect. My friends, from Écija, Jerez, Sevilla and England, because life would be so much boring without them! I have to specially thank those who have been with me and Josh through these last four years, because without them it would have been much tougher for us. My TM colleagues for being an absolute self-esteem pump and help me develop in other areas outside the lab and grow as a person in so many ways… And Josh, my partner in science and life. I want to thank you for your patience, for your unconditional trust, help and support in all dimensions of my life. I thank life every day for having next to me someone like you. Science and life are not so different, there are ups… and very low downs, and it’s all about choices. We made a big call together, and we have gone all the way through it; now it is time to enjoy the reward. A DUAL TOOL María José Oliva Martín 17 He tardado mucho en escribir estos agradecimientos, imagino que lo mismo que muchos otros. En mi caso, permanecí un largo rato sentada frente a la pantalla en blanco, preguntándome cuántos nombres tenía que escribir – y cuantos me aterrorizaba olvidar – y finalmente llegué a la conclusión de que o bien soy una persona muy agradecida, o he estado rodeada de muy buenas personas. Quiero pensar que ha sido una combinación de ambas. Lo siguiente que se me pasó por la cabeza fue en qué orden agradecer a todas esas personas. Uno tiende a pensar que el orden se correlaciona con el grado de agradecimiento, pero la verdad es que, al fin y al cabo, todos los nombres no caben en la misma línea. Así pues, si eres alguno de quienes aparecerán a continuación, recuerda que te estoy igualmente agradecido, sin importar dónde aparezcas en esta interminable lista de agradecimientos. Quiero agradecer a mi director de tesis, el Prof. José Luis Venero, por ser mucho más que un mero jefe. Me ha dado la libertad de pensar y conducir mi doctorado, lo que me ha permitido crecer como científica y como persona. También le agradezco sus consejos científicos y que me haya regalado la pasión con la que vive la ciencia, así como que siempre haya tenido tiempo para nuestras discusiones científicas. Siempre es más fácil dar órdenes… y recibirlas. Lo que es realmente difícil es debatir y alcanzar un consenso, y él me ha enseñado a pensar sobre mis resultados y sacar mis conclusiones sin dejar de considerar las hipótesis de otros. Por último, le agradezco de corazón que siempre me haya ayudado a compaginar el trabajo con una situación personal algo inusual. Sin su comprensión y su confianza no habría podido lograrlo, así que espero que piense que he hecho un buen uso de ellas. Me gustaría dar las gracias a las dos personas que me iniciaron en ciencia. El Prof. Alberto Machado de la Quintana, quien desde que era una simple estudiante de licenciatura vio algo en mí que todavía no he encontrado lo que es, me trajo al laboratorio y me hizo sentirme incluida, pero quien también me apoyó para que saliera al extranjero e hiciera el máster en Cambridge. Y el Prof. Guy Brown, ya que fue él el primero que me animó a pensar más allá de mis experimentos y resultados. Aprendí más que sólo técnicas durante mi máster, y creo fervientemente que esas habilidades me han ayudado durante mi doctorado. También le estoy agradecida por continuar nuestra colaboración tras marcharme, que me acogiera en su laboratorio durante los tres meses del doctorado internacional y que, a día de hoy, aún sigamos trabajando juntos. A DUAL TOOL María José Oliva Martín 18 También me gustaría agradecer a mi codirector de tesis, el Dr. Miguel Ángel Burguillos, por enseñarme técnicas en el laboratorio y, sobre todo, por hacerme parte en sus proyectos. ¡Me habría encantado que hubiéramos podido trabajar en el mismo laboratorio durante más tiempo! Por supuesto tengo que, y quiero agradecer al Prof. Bertrand Joseph por impulsar la última etapa de mi doctorado. Su convicción en mis proyectos, respondiendo a mis intempestivos emails de “Tengo una nueva hipótesis”, y el modo en que me hizo parte de su laboratorio durante mis cortas estancias, apoyándome tanto laboral como económicamente, me dieron la confianza y el empuje que necesitaba. También quiero agradecerle que me haya ayudado a ver los experimentos de un modo distinto, y combatir así mi perfeccionismo y el estrés con los que los afrontaba. También quiero agradecer al Dr. José Antonio Pérez Simón por acogerme en su laboratorio durante la primera parte de mi tesis y por permitirme trabajar libremente como uno más. Sin la experiencia en su laboratorio no habría adquirido los conocimientos sobre investigación clínica y traslacional que tanto han aportado a esta tesis. También me gustaría agradecerle su disposición y premura en solucionar aquellos asuntos relacionados con mi trabajo en su laboratorio y el hospital, especialmente considerando el alto número de responsabilidades que tiene. También me gustaría agradecer al Dr. Luis Ignacio Sánchez-Abarca por su dedicación casi completa a mis proyectos durante los primeros años de mi tesis. Ha pasado mucho tiempo desde aquellas largas noches y días de fiesta frente al citómetro, pero aún conservo buenos recuerdos de ellas. También me gustaría agradecerle que haya sido prácticamente un codirector, habiéndome enseñado pacientemente muchas de las técnicas que he empleado en esta tesis, así como por sus útiles consejos incluso cuando no sabía que los necesitaba. No puedo terminar sin dar las gracias a todos mis compañeros de cada uno de los laboratorios en los que he estado. Del Departamento de Bioquímica y Biología Molecular, quiero agradecer a todos mis compañeros y amigos actuales, Ana, Elena, Mario, Albert, Juan y aquellos que ya se han ido, Rianne, Afrah, Edel y Nikenza, por ser como una familia para mí, y soportar en más de una ocasión a la agobiada MJ corriendo de un lado para otro. A Rocío M. me gustaría darle las gracias por ser una gran “mamá” también en el laboratorio, y preocuparse tanto por mi carrera profesional empujándome a A DUAL TOOL María José Oliva Martín 19 hacer cursos, presentar en congresos y solicitar el premio que finalmente he obtenido. Si hay algo que he aprendido de ella es que el mejor equipo es aquel en el que todos ayudan a cada uno de sus miembros a alcanzar su máximo potencial. A Antonio J. quiero agradecerle que me haya escuchado en tantas ocasiones, y durante largo tiempo, sobre temas científicos y personales, y por darme siempre el consejo que realmente necesitaba. A Alejandro, mi amigo y “tándem científico”, por su dedicación y por relevarme en tantas muchas ocasiones. “Quien mucho abarca, poco aprieta” se suele decir, pero él me ha ayudado a desmentirlo. A Isabel, por sus enseñanzas sobre la vida, porque ciencia no es todo lo que se puede aprender de una persona. Y finalmente a “mi” Carmen, por toda su ayuda con las “ciencias ocultas” de la burocracia. También me gustaría agradecer a todos los profesores del departamento por su ayuda y consejos en docencia, así como a los componentes del laboratorio 111 en el IBiS, especialmente Seba, por tratarme siempre como si fuera uno más de ellos. Del laboratorio 202 en el IBiS, me gustaría agradecer a Teresa por sus enseñanzas sobre citometría, así como a Cuca e Iván por darme siempre consejos científicos y estar siempre dispuestos a enseñarme. Finalmente le quiero agradecer a Paco de Paula su constante disponibilidad para extraer las muestras de sangre y por enseñarme que la gracia y la profesionalidad pueden ir perfectamente de la mano. También quiero agradecer a todos los miembros del laboratorio del Dr. Guy Brown por hacerme sentir como en casa durante mi estancia y, por supuesto, querría agradecer a mi amiga y compañera de laboratorio Anna por su paciencia en la enseñanza de técnicas y por esa calma y buen humor que irradia y que hace sentirse bien a cualquiera. En cuanto a los miembros del laboratorio del Dr. Bertrand Joseph y de CCK, me gustaría darles a todos las gracias por ser una “pandilla” alucinante y hacerme parte de ella en tan poco tiempo. Son el paradigma de una ciencia divertida en todos los aspectos, y he aprendido mucho de su interés y curiosidad por los proyectos y resultados de todos sin dejar de pasarlo bien. Querría agradecer especialmente a Johanna y Poppi que se hayan lanzado de cabeza en mis proyectos y que me estén ayudando tanto. ¡Espero poder devolvéroslo pronto con un par de buenos artículos! Y sé que me estoy extendiendo demasiado, pero también tengo que agradecer a los técnicos de la Universidad de Sevilla Modesto, Laura y Juanlu, que han invertido su tiempo en A DUAL TOOL María José Oliva Martín 20 solucionar problemas o en hacer cosas para mí incluso fuera de sus horas de trabajo, lo cual es muestra de su gran profesionalidad. Y por supuesto, no puedo dejar de agradecer a mi familia. A mi padre, que escribió en el primer libro que me regaló la frase al comienzo de esta tesis: “El árbol del estudio es amargo, pero sus frutos son dulces”, y cuya gran visión me ha traído hasta aquí. Mi madre, cuyo apoyo y confianza en mí van más allá de lo imaginable, y que siempre ha estado ahí, en la sombra, incluso cuando menos lo merecía. Ambos han realizado en mí una gran inversión, y sacrificado una gran parte del tiempo y los ingresos de su vida en hacer de mí lo que soy hoy. Quizás en unos años esta tesis no será tan importante como lo es ahora, pero al menos, hoy, simboliza el esfuerzo que ellos han puesto en uno de sus sueños: yo. Y mi hermano, con el que siempre he estado tan unida. Hemos aprendido mucho viviendo juntos estos años, pero lo que es aún mejor, lo hemos aprendido juntos. Puedo agradecerle muchas pequeñas cosas, pero lo que realmente le agradezco es que sea mi hermano y que siempre está ahí cuando realmente lo necesito. Estoy muy orgullosa de ti. También quiero agradecer a mi nueva familia, los Long, el apoyo que nos han otorgado y la felicidad que me han dado a lo largo de estos años. A mis tíos, su apoyo a lo largo de mi vida, y a mis primos “pequeños”, por sacarme siempre una sonrisa y ayudarme a desconectar. A mis amigos de Écija, Jerez, Sevilla e Inglaterra porque la vida sería mucho más aburrida sin ellos. Tengo que agradecer especialmente a aquellos que han estado conmigo y con Josh estos últimos años, ya que sin ellos todo habría sido mucho más difícil para nosotros. Mis compañeros de TM Sevilla por ser una absoluta inyección de autoestima y por haberme ayudado a desarrollarme en otros aspectos fuera del laboratorio y crecer como persona… Y a Josh, mi compañero en la ciencia y en la vida. Quiero agradecerte tu paciencia, tu confianza, ayuda y apoyo incondicionales en todas las facetas de mi vida. Todos los días doy gracias por tener a mi lado a alguien como tú. La ciencia y la vida no son tan diferentes, hay muchas subidas… y muy profundas bajadas, y todo se basa en decisiones. Tomamos juntos una difícil decisión y hemos andado juntos todo el camino; ahora ha llegado el momento de disfrutar nuestra recompensa. A DUAL TOOL María José Oliva Martín 21 ABBREVIATIONS A DUAL TOOL María José Oliva Martín 22 AD Alzheimer’s disease ALPS Acute lymphoproliferative syndrome ANOVA Analysis of variance APC Alophycocyanine APC-H7 Alophycocyanine-cyanine. BBB Blood brain barrier BM Bone marrow Casp3 Caspase 3 Casp8 Caspase 8 Casp9 Caspase 9 CGC Cerebella Granular Neuronal Cultures CLP Caecal ligation and puncture CNS Central nervous system CRT Calreticulin Cyt-c Cytochrome c DAMPs Damage-associated molecular patterns DC Dendritic cell DEVD-fmk Z-Asp(O-Me)-Glu(O-Me)-Val-Asp(O-Me) fluoromethyl ketone DMEM Dulbecco's modified Eagle's medium DMSO Dimethyl sulfoxide DPX Distyrene Plasticizer Xylene ELISA Enzyme-linked immunosorbent assay ERK Extracellular-signal-regulated kinase FACS Fluorescence-activated cell sorting FBS Phoetal bovine serum FITC Fluorescein isothiocyanate FLIP FLICE-like inhibitory protein FSC Forward scatter GM-CSF Granulocyte-macrophage colony stimulating factor HBSS Hank's Balanced Salt Solution HS Horse serum HSP Heat-shock protein A DUAL TOOL María José Oliva Martín 29  The cellular components of the innate immune system, which include phagocytes and lymphoid natural killer cells (Vivier et al., 2008). Phagocytes are the major effectors of the innate immune system, recognising and phagocytosing pathogens as well as releasing cytotoxic compounds, such as reactive oxygen species (ROS) (Underhill and Ozinsky, 2002, Bedard and Krause, 2007) . They are A DUAL TOOL María José Oliva Martín 30 divided into three distinct groups: mononuclear phagocytes, polymorphonuclear phagocytes and dendritic cells (DCs). Whilst both mononuclear and polymorphonuclear phagocytes are derived from the myeloid cell line, DCs differentiate from both myeloid and lymphoid progenitors. They are in turn divided into two categories: conventional DCs, mainly involved in antigen presentation and activation of the adaptive immune response (Schnorrer et al., 2006, Shortman and Liu, 2002), and plasmacytoid DCs, which are the major producers of antiviral interferons (Colonna et al., 2004, Chan et al., 2006). Polymorphonuclear phagocytes represent the second major family of phagocytes. They comprise eosinophils, basophils and neutrophils. The latter possess the highest phagocytic capacity and are, together with monocytes, the fastest responsive cells against infection (Nathan, 2006). They are localised in the bloodstream and are able to rapidly migrate to infected tissues via a complex process known as extravasation (Ley et al., 2007). Once neutrophils arrive to the infection site, they phagocytose pathogens directly or after opsonisation by the complement system. The importance of neutrophils in the innate immune response is such that neutropaenia, a decrease in their numbers, is a medical condition that confers susceptibility to deadly infections from both pathogen and commensal organisms (Bodey et al., 1966). The last group of phagocytes contains monocytes and macrophages. Macrophages are formed upon the differentiation of blood monocytes which have undergone the same extravasation process described above for neutrophils (Ginhoux and Jung, 2014). Despite having similar functions, monocytes are slower than neutrophils in their response against infection; however, unlike neutrophils, activated monocytes are also able to modulate immune responses via the secretion of a wide range of prostaglandins and cytokines (Janeway et al., 2008). A prolonged activation of blood monocytes has detrimental effects to the organism and, accordingly, monocytes have been reported to play a role in several A DUAL TOOL María José Oliva Martín 31 inflammatory diseases, such as rheumatoid arthritis and liver fibrosis (Karlmark et al., 2012, Auffray et al., 2009b). Modulating monocyte activation thus represents an attractive target in the control of innate immunity. 2.2. THE MONONUCLEAR PHAGOCYTE SYSTEM: MONOCYTES AND MACROPHAGES. Monocytes and macrophages are mononuclear phagocytes which, despite having different functions, are closely related. Traditionally, they have been included, together with dendritic cells, in the so-called mononuclear phagocyte system (MPS). This term, coined by van Furth’s in 1968, comprises a family of cells derived from the same BM precursors. Despite the fact that all cells from this family possess phagocytic capacity, they differ highly in many ways. For example, in their gene expression patterns, which are frequently used to classify them according to their expression of surface markers (Gutknecht and Bouton, 2014, Jenkins and Hume, 2014). Monocytes have been generally postulated to be the precursors of both macrophages and DCs, and thus represent a ‘blood reservoir’ for these cells (Schraml et al., 2013). However, recent evidence has shown that DCs may derive from a distinct precursor (Gutknecht and Bouton, 2014). Furthermore, there is controversy as to whether monocytes are the only precursor of tissue macrophages (Italiani and Boraschi, 2014, Gutknecht and Bouton, 2014). Ginhoux et al. (2010) showed that microglial cells in the brain have their origin in the embryonic yolk-sac (Ginhoux et al., 2010), a hypothesis that has been further supported by others (Epelman et al., 2014). Other authors have revealed that in certain tissues where their turnover is not so high, such as the liver, peritoneum, lung and spleen, macrophages are capable of self-replicating to maintain their numbers (Yona et al., 2013). On the other hand, in organs that are constantly exposed to microorganisms, such as the heart, intestine and uterus, macrophages seem to A DUAL TOOL María José Oliva Martín 32 be replenished by blood monocytes (Ginhoux and Jung, 2014, Italiani and Boraschi, 2014). These differences point out the need to further characterise the MPS and its components. 2.2.1. MONOCYTES Monocytes are haematopoietic cells that represent 10% of total leukocytes in humans and 4% in mice (Italiani and Boraschi, 2014, Auffray et al., 2009b). They are recognisable by their irregular cell shape, oval or kidney-shaped nucleus and vesiculated cytoplasm. They originate from the bone marrow (BM) and are indirectly derived from the BM stem cells via an extended series of differentiation intermediates (Figure 3) (Geissmann, 2010). BM monocytes egression into the bloodstream is regulated by the CCR2 receptor, and so an impairment in the expression of this receptor on BM monocytes leads to low numbers of circulating monocytes (Gautier et al., 2009). Once in circulation, blood monocytes can be identified by their expression of CD115, and are then further characterised into subtypes via their expression of other biomarkers, namely the CD14++CD16− and CD14+CD16+ subtypes in humans, and Ly6Chigh and Ly6Clow subtypes in mice (Italiani and Boraschi, 2014, Auffray et al., 2009b, Strauss-Ayali et al., 2007). It has been reported that in the presence of a pathogen or an inflammatory environment, Ly6Chigh and CD14++CD16- monocytes activate and express biomarkers such as CD80 or CD86. Those Ly6Chigh circulating monocytes which are not activated or differentiated eventually were believed to return to the BM and then turn into Ly6Clow monocytes (Shi and Pamer, 2011). A recent study, however, has shown that in mice shortlived Ly6Chigh monocytes are the precursor of blood-resident Ly6Clow monocytes, which are unable to differentiate into macrophages (Yona et al., 2013). These mature, Ly6Clow, monocytes can patrol the blood circulation for some 5 days, promoting endothelial integrity, after which they return to the BM (Ginhoux and Jung, 2014, Dey et al., 2014) (Fig. 2). As a consequence, monocytes can be potentially isolated from both blood and BM. A DUAL TOOL María José Oliva Martín 33 Monocytes are of great importance in development and homeostasis, mainly by removing apoptotic corpses, scavenging toxic compounds and by triggering, together with neutrophils, the innate immune response to infection and injury (Auffray et al., 2009b). Nevertheless, despite the more rapid response of neutrophils, monocytes have been shown to play a major role in modulating inflammation via the production of different cytokines which control the different phases of the inflammatory response. In fact, recent studies A DUAL TOOL María José Oliva Martín 34 using monocyte deficient mice have demonstrated that monocytes, but not neutrophils, are the main mediators in the control of infections (Karlmark et al., 2012). However despite the fact that strong evolutionary pressure from pathogens has led to monocytes being highly effective at protecting the host from the short term dangers of infection, there appears to have been weaker selection pressure against the long term detrimental consequences of monocyte activation (Auffray et al., 2009b). Due to this, long-term monocyte activation can cause a number of human pathologies which will be discussed further in section 1.4. Understanding the activation mechanisms of monocytes is therefore of great importance to deal with both infections and deleterious effects of inflammation. Monocytes not only exert their activities in the event of infection, but also perform pleiotropic functions in other inflammation-induced pathologies. In the event of muscle injury, after the clearance of apoptotic cells, pro-inflammatory monocytes are able to switch to an anti-inflammatory phenotype and so contribute to tissue regeneration. Unfortunately, this tissue regeneration capacity can also be detrimental to the host, as recent data has shown the involvement of monocytes in carcinogenesis as well as lung and mammary cancer metastasis (Karlmark et al., 2012). This evidence denotes once more the need for a thorough understanding of the biology of monocytes. To allow them to be studied, monocytes need to be separated from other immune cells. However, this is still a difficult task, due to the ability of monocytes to swiftly react to alterations in their environment. This can lead to the purification technique priming monocytes to differentiate into other cell types, compromising the purity of the preparation. For example, gradient purification or in vitro culturing can alter their phenotype and behaviour (Auffray et al., 2009b). Two commonly used techniques are FACS cell sorting and immune-magnetic cell sorting (MACS). Both of them consist of the addition of antibodies against specific antigens on the surface membrane of the cells. In FACS cell A DUAL TOOL María José Oliva Martín 35 sorting the antibodies are conjugated to a fluorophore which allows the detection of the cells by a cell sorter linked flow cytometer, whilst with immune-magnetic separation, the antibodies are bound to magnetic beads which are subsequently retained on a magnetic column. In humans, monocytes can be isolated from human blood and BM using anti-CD14 antibodies. In mice, however, the targeting of monocytic cell surface markers during the separation process leads to cellular activation (Auffray et al., 2009a). Recently, a novel method consisting of the depletion of all non-monocytic blood cells has been developed. As monocyte cell surface markers are not targeted during the purification process, the yielded monocytes are fully functional. However, this technique requires the use of high numbers of mice due to low yields (Houthuys et al., 2010). 2.2.2. MACROPHAGES Macrophages are heterogeneous cells that reside in all tissues of adult mammals, comprising up to 10-15% of the total cell number in quiescent conditions (Italiani and Boraschi, 2014, Ginhoux and Jung, 2014). The resident macrophages of different tissues have different transcriptional profiles and, accordingly, their nomenclature varies between organs (i.e. osteoclasts in the bone, Kuppfer cells in the liver, alveolar macrophages in the lung, etc.). Despite phenotypic differences, all macrophages have similar functions, playing important roles in tissue development, immune responses to pathogens, surveillance of tissue damage and maintenance of tissue homeostasis (Epelman et al., 2014). Although the traditional dogma stated that resident macrophages derived solely from blood monocytes, it has been shown that some types of resident macrophages originate early in development, via migration of cells from the yolk-sac. Once in the tissues, they are capable of self-renewal by local proliferation and thus maintain local numbers under normal conditions or minor injury (Yona et al., 2013, Ginhoux et al., 2010). Certain organs, however, require a constant input of blood monocytes to maintain their macrophage A DUAL TOOL María José Oliva Martín 36 numbers. This homeostasis in the steady-state is mediated by the cytokine macrophage colony-stimulating factor (M-CSF), also named CSF-1 (Ginhoux and Jung, 2014). In contrast, in the event of serious injury or infection, when the demand for immune cells in the affected area increases as the number of resident macrophages decreases, there is an influx of BM derived monocytes which differentiate into macrophages to tackle the infection. This response is triggered by the expression of cytokine granulocyte-macrophage colony stimulating factor (GM-CSF) (Italiani and Boraschi, 2014). Macrophages can be divided into two different subtypes, named M1 and M2, based on the manner in which they metabolise arginine. M1 macrophages, which are pro-inflammatory in nature, divert increasing levels of arginine into the production of nitric oxide (NO) and citruline (Mills, 2012). NO is a powerful microbicidal and inhibitor of cell proliferation and is thus used for pathogen eradication and the clearance of infection. In contrast, M2 macrophages shift arginine metabolism to increase the production of polyamines and ornithine, which are involved in cell proliferation and tissue repair (Mills, 2012). Thus, recent evidence has shown that M2 macrophages are associated with tumour growth (Italiani and Boraschi, 2014). This M1/M2 classification derives from the concept that macrophages could be activated to one or another phenotype via the different cytokines present in the environment, which are released by T4 lymphocytes. Therefore, pro-inflammatory, Th1 cytokines would lead to polarisation towards an inflammatory, M1, macrophage subtype, whereas antiinflammatory, Th2 cytokines would drive polarization towards the M2 phenotype. However, this misconception has been severely criticised, as innate immune activation occurs prior to the activation of the adaptive immune system (Hamilton et al., 2014). In fact, mice with T-cell deficiency do not present alterations in macrophage polarisation (Mills, 2012). Furthermore, there is evidence that, in vivo, macrophages can shift from one A DUAL TOOL María José Oliva Martín 37 to another polarisation state according to the environment, and so M1 and M2 represent the two extremes of a wide range of undefined ontogenical subsets (Italiani and Boraschi, 2014, Wang et al., 2014). Nevertheless, for practical purposes, we will apply the nomenclature M1/M2 to distinguish between pro-inflammatory and anti-inflammatory macrophages. In vitro, M2 macrophages can be obtained by culturing monocytes with M-CSF, whilst culturing with GM-CSF provides M1 macrophages (Geissmann, 2010). Importantly, these macrophages do not release cytokines unless they are further polarised with lipopolysaccharide (LPS), although the priming with either type of CSF is important for their proper differentiation and polarisation (Hamilton et al., 2014). It is of note that the distribution of Toll-like receptors (TLRs), which will be further discussed in section 2.3., varies between the two phenotypes and could shed light on their different responses to LPS. Several pathways are involved in controlling macrophage polarisation, including IRF/STAT, HIF-1α/HIF-2α and NOD-like receptors. Interestingly, hypoxia, in which HIF- 1α/HIF-2α are involved, has been shown to cause a shift from pro-inflammatory to antiinflammatory macrophages, driving, for example, the course of cancer (Wang et al., 2014). We previously mentioned that macrophages exert important functions in development and tissue modelling. Examples of this are angiogenesis (Rao et al., 2007) and the formation of the mammary glands (Pollard, 2009). But macrophages also contribute to maintaining metabolic homeostasis, preserving adipose tissue health as well as regulating the fat intake of hepatocytes. This has been proved in models of obesity-induced inflammation (Olefsky and Glass, 2010). Finally, due to their dual role in promoting inflammation and tissue healing, macrophages are also linked to several diseases, including cancer, inflammatory diseases and fibrosis (Wynn et al., 2013). A DUAL TOOL María José Oliva Martín 38 Independently of the final phenotype, macrophages can be obtained, both from humans and mice, by culturing peripheral blood or BM isolates for 7 days in the presence of either M- CSF or GM-CSF (Manzanero, 2012). Under these conditions, monocyte/macrophage precursors differentiate into macrophages, which then phagocytose non-monocytic cells and non-differentiated macrophages. However, it is important to note that to study monocyte differentiation into macrophages, it is essential to start from a pure monocytic population, rather than a complex mixture of BM cells. Purification techniques such as those described in section 1.2.1. would be required under these circumstances. As for monocytic cell lines, such as the THP-1 or U937 cell lines, differentiation can be achieved by culturing the cells with tetradecanoylphorbol-13-Acetate (TPA or PMA) over 72 hours (Auwerx, 1991). 2.2.3. MICROGLIA AS A SPECIFIC TYPE OF MACROPHAGE Microglia are commonly referred to as the macrophages of the brain and, in fact, they possess similarities with other components of the MPS (Dey et al., 2014, Fernandes et al., 2014). However, as mentioned in section 1.2.2., the origin of microglial cells lies far from the traditional bone-marrow derived monocytic cell differentiation. Ginhoux et al. (2010) showed that microglial precursors migrate from the yolk-sac into the central nervous system (CNS), where they locally proliferate to maintain their numbers (Ginhoux et al., 2010). Recently, several studies have seen that bone-marrow progenitors can reach the brain and differentiate into microglial-like cells, exerting identical functions to bonafide microglia despite maintaining their transcriptional signature (Ajami et al., 2007, Prinz et al., 2014). These bone-marrow derived microglia are of great interest in therapeutics, as they can reconstitute microglial numbers in the CNS as well as constituting potential Trojan horses to deliver drugs into the brain (Prinz et al., 2014). However, other studies relating to the use of BM-derived microglia in therapeutics have demonstrated that a disrupted A DUAL TOOL María José Oliva Martín 45 3. CELL DEATH PATHWAYS: THE RIPOPTOSOME When it comes to single entities, such as cells, death is absolutely necessary. Approximately one million cells die every second within our bodies, a process required for development and tissue homeostasis. Our fingers are but the result of cell death in our hands during development. In the same way, after an infectious process, the body needs to clear the remaining excess of immune cells that were generated in order to overcome the infection. Taking this into account, it becomes evident that a failure in programmed cell death can promote tumour formation and cancer development. Yet an increased cell death rate is also associated with multiple diseases, such as degeneration, chronic inflammatory diseases or even heart attack (Green, 2010). It is little wonder, therefore, that understanding cell death pathways has acquired great importance over the last years. If we consider that cell death is necessary, then cells must be able to control or regulate their fate. An example of this occurs when a cell is infected by a virus, where the presence of the ‘parasite’ leads the cell to ‘commit suicide’ to prevent the replication of the virus and the spread of the infection (Allsopp and Fazakerley, 2000). Currently, cell death mechanisms have been divided into three major types. The first type is termed apoptosis or type I cell death and involves chromatin condensation and cytoplasm shrinkage (Krysko et al., 2008). Autophagy or type II cell death has always been associated with caspase inhibition (Vandenabeele et al., 2006), although recent studies show a refined nuclear control of this process (Fullgrabe et al., 2014). Whether autophagy is actually a type of cell death or a last ditch attempt to keep the cell alive remains unknown (Kaushal et al., 2008). Lastly, type III cell death or necrosis entails swelling and membrane rupture, with the subsequent release of cytoplasmic material into the extracellular fluid (Krysko et al., 2008). Although cells undergo necrosis as a result of physical damage or energy failure, there is A DUAL TOOL María José Oliva Martín 46 growing evidence that necrosis can also occur as a result of a programmed pathway (Vandenabeele et al., 2010). Independent of the mechanism, dying cells are capable of signalling to the immune system and hence ‘warning’ the body of the localised cell death by exposing signals or releasing chemo-attractants. These signals promote either the clearance of the cell debris or an immune response if required (Lauber et al., 2004). 3.1. APOPTOSIS AND CASPASES Although the initial discovery of apoptosis was made by Carl Vogt in 1842, it was not until 1972 that Kerr, Wyllie and Currie coined the term apoptosis based on their findings on the nematode C. elegans (Peter et al., 1997). Since then, research has focused on elucidating the mechanisms of apoptosis, its repercussions in tissue homeostasis and its potential applications in clinical practice. In this thesis, we will aim to provide a brief insight into this cellular pathway, focusing specially at the molecular level and the platforms implicated in the process. 3.1.1. CASPASES: KILLER PROTEASES The term caspase derives from the acronym cysteine-aspartic protease. Indeed, caspases are a big family of cytosolic proteases with a conserved cysteine containing active site which cuts specific sequences ending in aspartic acid residues (Nicholson and Thornberry, 1997). The sequence of amino acids that each caspase is able to recognise determines the specificity of each caspase. Thus, caspase-3 substrates contain the sequence DEVD (Aspartate-Glutamate-Valine-Aspartate), whilst Casp8 substrates contain the sequence IETD (Leucine-Glutamate-Threonine-Aspartate) (Timmer and Salvesen, 2007). The addition of radicals such as fluoromethylketone to caspase target peptides has generated a range of suicide inhibitors of caspases allowing the modulation of apoptosis and other A DUAL TOOL María José Oliva Martín 47 processes in which caspases are involved (Villa et al, 1997). However, it has been reported not all target peptides are cleaved by only a single caspase, therefore meaning that certain inhibitors could inhibit other caspases beyond those they were designed to target (McStay et al., 2008). Interestingly, the cell possesses endogenous inhibitors of apoptosis, named IAPs. Whilst some of them, i.e. XIAPs, are direct inhibitors of caspases, others perform their functions by interacting with the molecular platform in which Casp8 is activated (Srinivasula and Ashwell, 2008). As expected, caspases are not always active in the cell. In resting cells they are present as pro-forms or zymogens that require cleavage to become active. All procaspases have three regions called prodomain, small subunit and large subunit. This attribute allows us to classify caspases into two different categories: initiator caspases and executioner caspases. The former are able to self-activate by dimerization, triggering the apoptotic cascade by cleaving and activating the latter. On the contrary, executioner caspases, such as caspase 3 and 7, are the direct effectors of the apoptotic process, cleaving substrates other than caspases which lead to the apoptotic ‘symptoms’ previously described (Nicholson and Thornberry, 1997). How caspases exert their functions in the cell remains under study, as not all of their substrates have been yet identified. Caspases have so far been found to act upon a wide range of targets including nuclear proteins (e.g. histones), cytoplasmic proteins (e.g. nucleases, kinases involved in blebbing) and mitochondrial proteins (e.g. complex I of the electron transport chain) (Green, 2010). One interesting point is how apoptotic cells are able to warn other cells of their death. Amongst the activities of executioner caspases is the cleavage of the flippase which maintains phosphatidylserine (PS) on the internal side of the plasma membrane, thus allowing its translocation to the outer membrane where it acts an ‘eat me’ signal that facilitates the phagocytosis and clearance of apoptotic cells by A DUAL TOOL María José Oliva Martín 48 surrounding phagocytes (Segawa et al., 2014). Consequently, the detection of PS using antibodies such as Annexin V constitutes a routine technique in the detection of apoptosis (Fadok et al., 1998). Not all caspases are related to cell death. Caspase 1, an initiator caspase, associates with inflammasomes, which are cytosolic protein complexes that activate inflammatory caspases for the processing of IL-1β and IL-18 precursor proteins (Lamkanfi and Dixit, 2014). The role of inflammasomes in inflammation will be discussed further in section 4. 3.1.2. APOPTOTIC PATHWAYS Apoptosis can be triggered in two main different ways, which despite activating two distinct signalling pathways eventually lead to the activation of the same executioner caspases. The first of these pathways, known as the intrinsic pathway, occurs as the result of alterations in the normal functioning of cells; on the other hand, the extrinsic pathway is the consequence of environmental stimuli (Green, 2010). 3.1.2.1. THE MITOCHONDRIA AND THE INTRINSIC PATHWAY The intrinsic pathway represents the major cause of apoptosis in vertebrates. It is essential during development and alterations in this pathway lead to accumulation of DNA mutations and brain dysfunction due to neuronal accumulation, which results in inviability (Nikolic et al., 2013). We mentioned before that initiator caspases need to dimerise to self-activate. This is only possible via adaptor proteins which bring caspases together allowing them to dimerise. In the intrinsic pathway, the adaptor protein involved is the cytosolic protein Apaf-1. In order for Apaf-1 to catalyse initiator caspase dimerisation it needs to undergo a conformational change resulting in the exposure of its CARD domain which is then available to interact with the CARD domains of both further A DUAL TOOL María José Oliva Martín 49 apaf-1 molecules alongside those of the initiator caspase of the intrinsic pathway: caspase 9. The complex formed by the aggregation of multiple single entities of these two proteins has been named the apoptosome, and ultimately allows the dimerisation and activation of caspase 9 (Zou et al., 1999) (Fig. 3). In order to avoid the inappropriate induction of apoptosis this pathway is tightly regulated. This occurs by sequestering the protein which triggers the conformational change in Apaf-1, cytochrome c, in the mitochondrial intermembrane space. Only when the cell experiences irreversible damage is there a persistent mitochondrial outer membrane permeabilisation (MOMP) which can allow cytochrome c to escape into the cytosol where it is able to bind Apaf-1 and drive the formation of the apoptosome. The regulation of MOMP is thus also key to the induction of intrinsic apoptosis and many different cellular stimuli feed into this point by affecting the levels of the proapoptotic bax/bak and the anti-apoptotic bcl-2 molecules (Tait and Green, 2010). The cell encodes other proteins which act to stop inappropriate activation of apoptosis by the intrinsic pathway such as the previously alluded to inhibitors of apoptosis, XIAP. These proteins have a higher affinity for caspase 9 than APAF-1 does, and thus prevent its dimerization unless another protein, smac, is present to bind and sequester XIAPs (Srinivasula and Ashwell, 2008). Synthetic molecules resembling smac, named smac mimetics, are thus powerful apoptosis inducers and have been used in clinical cancer (Zobel et al., 2006). A DUAL TOOL María José Oliva Martín 50 3.1.2.2. DEATH RECEPTORS AND THE EXTRINSIC PATHWAY In section 2, we described how the cells of the immune system need to proliferate in order to contain an infection. However, once the infection is resolved, the cell numbers of immune cells need to be reduced to maintain homeostasis. Moreover, the removal of the excess cells must be done without triggering another immune response (Vukmanovic-Stejic et al., 2001). In other situations, such as cancer, immune cells must recognise and induce the death of the tumoural cells. All these events are mediated by the activation of the extrinsic apoptosis pathway and, in fact, alterations on this pathway result in tumoural growth as well as lympho and myeloproliferative syndromes (Mahmood and Shukla, 2010). A DUAL TOOL María José Oliva Martín 51 Extrinsic apoptosis commences when certain death ligands present in the environment interact with their corresponding cell surface death receptors. Upon binding, these receptors become activated and recruit several proteins, including the initiator Casp8, allowing the latter to dimerise and self-activate (Green, 2010). The main death receptors are tumour necrosis factor receptor-1 (TNFR1), Fas/CD95 receptor and the TRAIL receptors, which were believed to dimerise upon ligand binding, however they have been shown to be present as trimers in the plasma membrane (Fig. 4) (Chan, 2007). They all contain intracellular death domains (DDs) which, following receptor-ligand binding (TNF, Fas/CD95 ligand and TRAIL, respectively), become exposed and recruit Casp8 via DD-adapter proteins. Despite their similarities, these receptors differ in their adaptor proteins and activation pathways. Fas/CD95 and the TRAIL receptors follow a similar mechanism. The conformational change resulting from their interaction with death ligands leads to the recruitment and binding of the cytosolic protein FADD. When FADD interacts with the DDs in the death receptors, it subsequently exposes the death fold DED, which in turn recognises and binds the prodomain of Casp8 (Wajant, 2002, Thorburn, 2004) (Fig. 4). Since death receptors oligomerise when they become activated, this increases the proximity of Casp8 zymogens leading to dimerisation and activation of the apoptotic protein (Wajant, 2002, Thorburn, 2004). The TNFR1 pathway is slightly more complex. The binding of the ligand causes this receptor to expose both DDs and an interaction site for the signalling molecule TRAF-2. Unlike CD95 and TRAIL receptors, the DD of TNFR1 does not bind FADD but another adaptor protein named TRADD, which stabilises the binding of TRAF-2 as well as recruiting the protein RIPK1 (Fig. 4). TRAF-2 then A DUAL TOOL María José Oliva Martín 52 polyubiquitinates RIPK1 and this polyubiquitin recruits NEMO which then activates IKK, ultimately leading to activation of the NF-kB transcription factor as described on section 1.3 (Walczak, 2011). NF-kB activation induces cell survival via the transcription of several proteins including FLICE-like inhibitory protein (FLIP), whose role in cell survival will be described in sections 3.2. and 4. However, when NF-kB is not functional or if survival genes are not active, the TRAF-TRADD-RIPK1 complex (TNFR1 complex I) detaches from TNFR1 and is released into the cytosol, where it recruits FADD and, subsequently Casp8, forming the TNFR1 complex II and thus sets off the apoptosis response (Walczak, 2011, Oberst and Green, 2011) (Fig. 4). A DUAL TOOL María José Oliva Martín 53 3.1.3. APOPTOSIS IN CLINICAL PRACTICE For quite some time, apoptosis has been believed to be immunologically silent. Interestingly, however, some forms of apoptosis have been recently described to generate an immune response. This depends on the 'eat-me' signals exposed on the surface of the apoptotic cell. Whilst PS is able to induce phagocytosis without inducing an immune response (Fadok et al., 1998), other molecules such as heat shock proteins (HSPs) (Hickman-Miller and Hildebrand, 2004) or calreticulin (CRT) (Panaretakis et al., 2009, A DUAL TOOL María José Oliva Martín 54 Fricker et al., 2012) are capable of activating phagocytes, leading to inflammation. This becomes important in diseases where the treatment involves the induction of apoptosis. In the case of cancer, for example, it is beneficial not only to induce death of tumoural cells but also enhance the immune response of the body against them. It is not then surprising that treatment with anthracyclins, which induce CRT-mediated apoptosis, have so far shown positive results in the treatment of cancer (Obeid et al., 2007). But apoptosis is not always a tool. In fact, certain conditions, such as neurodegenerative diseases, are due to an increase in cell death rate (Lyros et al., 2014). In the case of SIRS, the extensive apoptosis of lymphocytes and DCs contributes to the immunosuppression and, consequently, the severity of the disease (Ward and Bosmann, 2012). Inhibition of apoptosis could prove to be an effective treatment in these situations, although we will thoroughly discuss this in section 4. 3.2. PROGRAMMED NECROSIS AND THE RIPOPTOSOME: A DUAL MOLECULAR PLATFORM Another type of cell death we have previously discussed is necrotic cell death. Cells undergoing necrosis experience a lack of ATP, which causes them to be incapable of retaining their membrane potential and so experience swelling, membrane disruption and cytoplasmic content release (Krysko et al., 2008). This state can be reached if nutrient and oxygen delivery are compromised (e.g. ischemia) or as a consequence of apoptosis if the cell fails to be engulfed by phagocytes. This last type of necrosis is generally referred to as secondary necrosis, and can sometimes mask apoptotic cell death when the latter is measured at longer timepoints (Krysko et al., 2008, Green, 2010). In recent times, however, another cause of necrosis has been discovered which requires the formation of TNFR1 complex. This type of cell death, which has become one of the main A DUAL TOOL María José Oliva Martín 61 inflammasome components pro-IL-1β and NLRP3. The second, called signal 2 or activation, leads to complex oligomerisation and activation of caspase 1, which in turn cleaves pro-IL-1β producing IL-1β (Sutterwala et al., 2014). It was therefore plausible that apoptotic caspases could be executing other non-apoptotic roles and, in fact, within this context, Sordet et al. (2002) demonstrated the requirement of apoptotic caspases for the differentiation of human monocytes into macrophages but not into dendritic cells. Significant activation of caspases-3 and -9 in these cells was observed without the presence of apoptotic features (Sordet et al., 2002). Later studies by Kang et al. (2004), implicated Casp8 in this process. Using knock-out mice lacking Casp8 in the monocytic cell line, they showed that only those expressing Casp8 were able to differentiate. Interestingly, rather than remaining undifferentiated, the knock-out monocytes would die during the differentiation process, although the reason for this increase in cell death was not further investigated (Kang et al., 2004). Additional studies established that Casp8 was the upstream enzyme responsible for the activation of Casp3 and Casp9, to further control the differentiation of peripheral blood monocytes into macrophages. Interestingly, the authors reported the assembly of Casp8 into the ripoptosome described in section 3.2.1. (Rebe et al., 2007). In the case of M-CSF stimulation, however, an increase in proteins associated to cell death (Fas, TRAF2 and TRADD) is missing, suggesting that the formation of the ripoptosome is independent of the engagement of TNFR1. They hypothesised that Casp8 was the central protein of this complex, cleaving RIPK1 which then would downregulate NF-kB at the latest stages of differentiation (Rebe et al., 2007). Supporting the central role of Casp8 in regulating myeloid cell death, activation and differentiation, our group described an unexpected novel function for Casp8/caspase-3 in the control of microglia pro-inflammatory activation and associated neurotoxicity A DUAL TOOL María José Oliva Martín 62 (Burguillos et al., 2011, Kavanagh et al., 2014). We found that stimulation of microglia with various inflammogens activates Casp8 and Casp3/7 in the absence of cell death. Interestingly, this activation was subsequent to TLR-4 and independent from TNF-α signalling, supporting the idea from Rebe et al. that the ripoptosome assembly can occur by signals other than those derived from TNFR1 binding (Burguillos et al., 2011). This was further confirmed in primary microglial cultures (Fricker et al., 2013), where, surprisingly, it was also observed that Casp8 inhibition was able to induce necroptosis of LPS-activated microglia (Fricker et al., 2013, Kim and Li, 2013). Taken together, this data suggest TLR activation triggers ripoptosome formation in microglia, a feature shared by peripheral macrophages (Schworer et al., 2014, McComb et al., 2014). It seems that RIPK1 and Casp8 are mutually-interacting partners whose true functions are just emerging. In fact, RIPK1 is emerging as a protein involved in the regulation of key processes, especially in the immune system. Thus, ubiquitinated RIPK1 is a platform for the recruitment of downstream components of the NF-κB and MAPK signalling pathways such as LUBAC (linear ubiquitin chain assembly complex), TAB2/3-TAK1, NEMO and IKK (Walczak, 2011). Mice lacking RIPK1 display extensive apoptosis in lymphoid tissue, thus supporting a significant role of RIPK1 in cell survival mechanisms (Zhang et al., 2010). In contrast, and depending on the context, RIPK1 plays significant roles in TNFR and TLR- induced apoptosis and necrosis (de Almagro and Vucic, 2015, Weinlich and Green, 2014), as RIPK1 can modulate the levels of FLIP and so regulate apoptosis. Lastly, RIPK1 has been shown to participate in inflammation, by promoting the release of IL-1β release via the activation of MLKL (Weinlich and Green, 2014). RIPK1 can signal both via oligomerisation with RIPK3 and via its kinase activity, with these distinct activities appearing to have varying importance in the different functions of RIPK. It is therefore A DUAL TOOL María José Oliva Martín 63 possible that the mode of activation of RIPK may determine the mode of action and thus the biological effects of RIPK (Cook et al., 2014). Most studies on the ripoptosome have focused on the mechanisms leading to necrosome formation, MLKL activation, membrane rupture (Sun et al., 2012, Murphy et al., 2013) and more recently the role of the ripoptosome in regulating canonical and non-cannonical IL- 1β release (Vince et al., 2012, Lawlor et al., 2015) It could be interesting to analyse the role of RIPK1 in other processes during which ripoptosome assembly is seen, such as cell differentiation. Considering that the ripoptosome is involved in both cell death and differentiation pathways, a thorough understanding of its functioning could shed light on developmental pathologies and carcinogenesis. A DUAL TOOL María José Oliva Martín 64 5. INFLAMMATORY DISEASES 5.1. SEPSIS AND SIRS The Systemic Inflammatory Response Syndrome (SIRS) is defined as ‘an inflammatory state which affects the whole body, frequently as a response of the immune system to infection, but not necessarily so’ (Goldman and Schafer, 2011). It is the consequence of the cytokine storm unleashed by neutrophils and monocytes due to a release of PAMPs and DAMPs into the bloodstream (Kang et al., 2015). Although it has generally been associated with sepsis, a state where infection reaches the bloodstream, it can continue even after clearance of the pathogen, or also occur upon non-infectious conditions such as trauma, burns or severe injuries. Sepsis has historically represented one the major causes of death until the discovery of antibiotics in the early 20th century (Tallia and Kunicka, 2009). However, emerging diseases such as those caused by ebola virus, H5N1 highly pathogenic avian influenza viruses or SARS-corona virus, together with an increase in antibiotic resistance in previously controllable pathogens such as Mycobacterium tuberculosis or Staphilococcus aureus (of note MRSA) have led to septicaemia once again having the highest global mortality rate, above myocardial infarction and common cancers (Esteban et al., 2007, Uppu et al., 2015). Some 50.000 cases are reported annually in Spain, and an alarming 18 million cases around the world which, due to a case fatality rate of between 30 and 50%, comprise 1.400 fatalities per day globally. But the incidence and mortality rates are not the only burden; the annual costs of sepsis in Spain fluctuate around 500 million euros (Esteban et al., 2007). With a growing incidence per year, research into sepsis is becoming increasingly important in terms of public health. A DUAL TOOL María José Oliva Martín 65 In the pathogenesis of SIRS the cytokine storm triggered by the overactivation of monocytes and neutrophils leads to fibrin deposition, coagulopathies due to platelet aggregation, and leukocyte liposomal release, which together ultimately lead to fluid extravasation and hypotensive shock. Other complications derived from this condition are acute lung and kidney injury, which in turn cause multiple organ dysfunction syndrome (Goldman and Schafer, 2011). The death rate increases from sepsis (40%) to severe sepsis and septic shock (80%) (Tallia and Kunicka, 2009). Moreover, survivors generally experience long-term side effects, including skeletal muscle dysfunction, cognitive impairment, changes in affective behaviour and persistent immunosuppression (Ward and Bosmann, 2012). At a cellular and molecular level, the onset of SIRS occurs upon the release of DAMPs or PAMPs into the bloodstream (Fig. 6). The detection of these molecules by TLR receptors on phagocytes causes their activation and secretion of pro-inflammatory cytokines, ROS and reactive nitrogen species (RNS) (Ward and Bosmann, 2012, Chong and Sriskandan, 2011). The free radical storm leads to widespread apoptosis of T and B lymphocytes, which normally modulate the immune response and prevent further infections from occurring. Furthermore, the persistent pro-inflammatory state leads to a deterioration of phagocytes, which are therefore unable to exert beneficial functions such as phagocytosis and antigen presentation. DCs, whose protective effects in polymicrobial infections have been reported, also undergo extensive apoptosis and deficiencies in functionality (Ward and Bosmann, 2012). This combined depletion and impaired activation of immune cells ultimately leads to a state of immunosuppression (Fig. 6), which is a cause of both the mortality and the long-term side effects of sepsis. In fact, the anti-inflammatory state that follows the initial pro-inflammatory state is the reason why certain treatments, such as corticosteroids, have A DUAL TOOL María José Oliva Martín 66 proven to be ineffective, as they can contribute to enhancement of the immunosuppressive phase. (Ward and Bosmann, 2012). Other factors are also important contributors to the development of sepsis. Imbalances in nuclear hormone receptors and antioxidant enzymes, activation of the complement system and the anaphylatoxin C5a, or impairment of the parasympathetic and sympathetic systems are triggers of many of the deadly symptoms of sepsis (Bosmann and Ward, 2013). A DUAL TOOL María José Oliva Martín 67 To date, there are no drugs approved specifically for the treatment of SIRS in humans (Sharawy and Lehmann, 2015, Dellinger et al., 2013). Care is focused mainly in relieving symptoms by intrafluid resuscitation (Seymour et al., 2014) and on eradicating the pathogen, the latter becoming a challenge itself due to antibiotic resistance (Uppu et al., 2015). Clinical trials have mostly been based around decreasing the pro-inflammatory response, developing strategies to neutralise cytokines by means of neutralising antibodies or thrombogenic products. Although they provided to be useful in mice, in human clinical trials these approaches were found to be ineffective (Ward and Bosmann, 2012). Drotrecogin α showed certain efficacy in clinical trials, but the drug was removed from the market after an increase in episodes of intracranial haemorrhage in paediatric patients. Current research is also focusing on apoptosis inhibitors to prevent lymphocyte and DC depletion, as well as infusion of these cells from healthy donors (Sharawy and Lehmann, 2015, Ward and Bosmann, 2012). The lack of a specific treatment for sepsis has concentrated efforts on the early detection of SIRS. For this purpose, more than 170 biomarkers have been assessed, mainly for prognosis. Pro-inflammatory cytokines such as IL-1β or TNF-α, anti-inflammatory cytokines such as IL-10, or activation markers such as CD40 are just some of them (Pierrakos and Vincent, 2010). However, since none of these biomarkers have provided sufficient specificity or sensitivity, combinations of different biomarkers might be required in clinic. Since so many interacting factors are involved in the progression of sepsis, the in vitro study of separate cellular components is often not sufficient to come to conclusions. The use of in vivo models is unfortunately indispensable as an intermediate step prior to clinical trials. It is important to point out that no animal model can totally replicate the clinical sepsis syndrome. Caecal ligation and puncture (CLP) is considered the gold standard in the A DUAL TOOL María José Oliva Martín 68 study of sepsis. However, this model excludes SIRS stemming from sterile inflammation (Lilley et al., 2015). On the other hand, the intraperitoneal injection of LPS, which is not representative as a sepsis model, constitutes an alternative in the study of septic shock that presents lower variability between individuals and is more recommended for an initial screening (Remick and Ward, 2005) 5.2. NEUROINFLAMMATION IN NEURODEGENERATIVE DISEASES: AN INSIGHT ON PARKINSON’S DISEASE Neurodegenerative diseases are a group of chronic and progressive disorders that currently have no effective treatments. Since the cause of these diseases is unknown, it is important to determine the risk factors involved in their aetiology and progression. As a common feature shared by neurodegenerative diseases, neuroinflammation is becoming a highly researched topic, with many important advances occurring over the last years (Daulatzai, 2014, Spielman et al., 2014). PD is the second most prevalent neurodegenerative disease and affects approximately 1- 3% of the population (Obeso et al., 2000). It is characterised by a slow and progressive degeneration of dopaminergic neurons in the substantia nigra (SN) (Obeso et al., 2000). The aetiology of idiopathic PD, which accounts for more than 90% of cases, is still not fully understood (Obeso et al., 2000). The most distinctive feature is the presence of Lewy Bodies in the ventral mesencephalon of PD patients, whose main component is αsynuclein. The first evidence supporting a role of neuroinflammation in PD came from studies demonstrating the presence of cytotoxic T lymphocytes and reactive microglia in the parkinsonian brain (Langston et al., 1999, McGeer et al., 1988). Multiple cytokines including IL-1β, IFN-γ and TNF-α have been found elevated in postmortem PD brains. Further evidence has come from recent epidemiological studies revealing an association A DUAL TOOL María José Oliva Martín 69 between the long-term use of non-steroid anti-inflammatory drugs and reduced risk of PD (Gao et al., 2011). In fact, PD can be induced in animal models by a single intranigral injection of LPS (Castano et al., 1998, Herrera et al., 2000). Evidence sustains that, regardless of the proinflammatory stimuli, the microglial pro-inflammatory response to neuron damage can drive a self-perpetuating cycle of microglia activation and neurodegeneration (see section 2.2.3.), which may play an important role in the progression of the disease (Langston et al., 1999, Herrera et al., 2005). Recent studies have shown that peripheral inflammation can in turn trigger neuroinflammation and consequent neurodegeneration (Daulatzai, 2014, Spielman et al., 2014). Two routes for the spread of inflammation have been hypothesised, which include a humoral pathway (Licinio and Frost, 2000) and the terminals of the vagus nerve (Mayer, 2011). The former, also referred to as the neuroendocrine immune system, is triggered by inflammatory cells and cytokines from peripheral blood that enter the brain by different mechanisms. Several studies have shown that peripheral cytokines (IL-1β, TNF-α and IL- 6) can initiate the synthesis of cytokines in the CNS (Beyer et al., 2011). Moreover, they can interact with endothelial cells of the BBB, causing its rupture and leading to peripheral cytokine and immune cell extravasations, thus enhancing neuroinflammation (Proescholdt et al., 2002). The second route of neuroimmune communication, known as the neural pathway or gut-brain axis, is related to the transmission of peripheral inflammatory signals through the autonomic nervous system and concretely, through the vagus nerve. The gutbrain axis can thus be considered a communication pathway between the gut and the brain, enabling the bidirectional control of gastrointestinal and neural functions (Berthoud, 2008). It is therefore concerning that peripheral inflammation, which is more difficult to prevent than bad dietary habits or smoking, may be a risk factor of neurodegenerative diseases. A DUAL TOOL María José Oliva Martín 70 Thus, targeting inflammation in the CNS could potentially be a therapeutic target for these diseases. In line with this facts, some authors have shown that that Casp8 inhibition decreased microglial activation and neurotoxicity (Burguillos et al., 2011), but also the specific necroptosis of microglia can rescue neuronal loss (Fricker et al., 2013). Given the generally acknowledged effects of pro-inflammatory microglia in the brain, targeting their activation may potentially improve the progression of neurodegenerative diseases. A DUAL TOOL María José Oliva Martín 77 1. BIOLOGICAL MATERIAL 1.1. HUMAN BLOOD SAMPLES Human monocytes were isolated from buffy-coats; the concentrated leukocyte suspensions obtained by centrifugation of peripheral blood in a LQT 6280 bag (Macopharma). Buffy coats were kindly donated by the Regional Centre for Blood Transfusions at Hospital Universitario Virgen del Rocio, Seville (Spain). Blood samples were obtained from healthy donors, whose prior consent was signed as stated by the Declaration of Helsinki. Buffy-coats were processed in the Laboratorio de Terapia Celular y Oncohematología at the Instituto de Biomedicina, Seville (Spain), under strictly sterile conditions. All procedures were performed based on the regulations established by the Ethical Committee of the Hospital Universitario Virgen del Rocío, Seville (Spain). 1.2. ANIMALS Animal experimentation was carried out at the Departamento de Bioquímica y Biología Molecular at the Facultad de Farmacia (Universidad de Sevilla, Seville, Spain) and the Department of Biochemistry at the University of Cambridge (Cambridge, United Kingdom). All procedures were performed in accordance with the regulations established by the Ethical Committees of the respective animal units. Animals were kept in specific pathogen-free conditions and had free access to food and water, following both the national (RD 1201/2005) and European (609/CEE) legislation regarding the protection of animals used for experimentation and other scientific aims. For the sepsis model and the optimisation of murine monocyte isolation, C57BL/6 mice were obtained from the Universidad de Sevilla (Spain). Experiments were performed A DUAL TOOL María José Oliva Martín 78 in accordance with the Guidelines of the European Union directive 2010/63/EU, following Spanish regulations for the use of laboratory animals and approved by the Scientific Committee of the Universidad de Sevilla. For the studies on caspase 8 involvement in monocyte activation, knock-out mice unable to express caspase 8 in the monocytic cell line were generated by recombination using the Cre/loxP technology. This system is based on a recombinase, Cre, which recognises two identical sequences, called lox P sites, which flank the gene to be deleted. When Cre is expressed, it cuts both lox P sequences and splices the extremes together, therefore removing the gene from the genome and preventing its transcription. In our case, B6.129P2-Lyzstm1(cre)Ifo/J mice were purchased from Jackson Laboratories. These mice encode the Cre recombinase gene under the control of the lysozyme M promoter, which is only active in the myeloid lineage. These mice were bred with another CB57BL/6 strain containing the loxP sequences in both alleles of caspase 8, which were kindly donated by Professor Stephen M. Hedrick (University of California, San Diego, La Jolla, CA, USA). The breeding provided both knock-out (casp8 Flox/Cre+) and wild-type (casp8 Flox/Cre-) mice (Kang et al., 2004). Genotyping was performed by PCR analysis of the DNA extracted from the mice fingers, following standard protocols. For the studies in the central nervous system, both in vitro and in vivo, male adult Wistar rats and litters between two and seven days old were obtained from both the University of Seville and the University of Cambridge. 1.3. CELL LINES THP-1 cells were kindly donated by Birgitta Henriques Normark (MTC, Karolinska Institute). All experimentation using these cells was carried out at Cancer Centrum A DUAL TOOL María José Oliva Martín 79 Karolinska (CCK), Stockholm (Sweden), in accordance with national and European regulations. 2. NON-BIOLOGICAL MATERIAL 2.1. GENERAL CHEMICAL MATERIAL LPS from Escherichia coli 0111:B4 (Cat. No. L5293) , IETD-fmk, LEHD-fmk, Nec-1 and 1-methyl-tryptophan, were purchased from Sigma-Aldrich (St Louis, MO, USA). Z- VAD-fmk was purchased from Promega (Madison, USA). DEVD-fmk was obtained from Becton Dickinson Bioscience (San Jose, CA, USA). Phosphate buffered saline (PBS), Roswell Park Memorial Institute medium (RPMI-1640), Dulbecco's modified Eagle's medium (DMEM), phoetal bovine serum (FBS), horse serum (HS) and antibiotics were purchased from GIBCO (InvitrogenTM, Paisely, UK). AB serum was purchased from Sigma-Aldrich, St Louis, MO, USA. MACS running buffer, columns and MACS separators were from Miltenyi Biotec S.L. (Bergisch Gladbach, Germany). All tissue culture plates were purchased from Thermo Fischer Scientific Nunc A/S, (Kamstrupvej, Roskilde, Denmark). DMSO, L-glutamine, Poly-L-lysine, KCl, Glucose and HEPES were acquired from Sigma-Aldrich (St Louis, MO, USA). Trypsin and Versene were purchased from GIBCO (InvitrogenTM, Paisely, UK). β-mercaptoethanol and sodium pyruvate were purchased from Sigma-Aldrich (St Louis, MO, USA). Both 100 µm and 40 µm nylon mesh filters were purchased from Becton Dickinson Bioscience (San Jose, CA, USA). Paraformaldehyde (PFA) was obtained from Carlo Erba®. Bovine albumin (BSA) was purchased from Sigma-Aldrich (St Louis, MO, USA). A DUAL TOOL María José Oliva Martín 80 2.2. ANTIBODIES 2.2.1. ANTIBODIES FOR FLOW CYTOMETRY In every case, an excess of antibody dilution was added. FITC: Fluorescein isothiocyanate; PE: Phycoerythrin; PerCP: Peridinin Chlorophyll Protein APC: Alophycocyanine: APC-H7: Alophycocyanine-cyanine. The antibodies used for murine monocyte isolation (Table 1), murine monocyte activation studies (Table 2), monocyte activation studies (Table 3), measuring caspase-8 expression (Table 4) and human macrophage differentiation studies (Table 5) are shown below. Table 1. Antibodies used in the optimisation of murine monocyte isolation Antibody Fluorochrome Isotype Specificity Company CD45 APC Rat IgG2b Mouse monocyte isolation optimisation Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD40 PE Rat IgG2a Mouse monocyte isolation optimisation Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD11b FITC Rat IgG2b Mouse monocyte isolation optimisation Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD11b PE Rat IgG2b Mouse monocyte isolation optimisation Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD45 VioBlue Rat IgG2bκ Haematopoietic cells Miltenyi Biotec S.L. Bergisch Gladbach, Germany Ly6G FITC Rat IgG2aκ Neutrophils Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD4 FITC Rat IgG2bκ T4 Lymphocytes Miltenyi Biotec S.L. Bergisch Gladbach, Germany A DUAL TOOL María José Oliva Martín 81 CD115 PE Rat IgG2aκ Monocytes/Macrophages Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD8 PE Rat IgG2aκ T8 Lymphocytes Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD80 PE Hamster IgG2 Activated monocytes and B cells Miltenyi Biotec S.L. Bergisch Gladbach, Germany CCR3 PerCP-Vio550 Recombinant human IgG1 Eosinophils Miltenyi Biotec S.L. Bergisch Gladbach, Germany F4/80 PerCP-Vio550 Recombinant human IgG1 Monocytes/Macrophages Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD11b APC Rat IgG2bκ Monocytes/Neutrophils/Some lymphocytes Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD3 APC Rat IgG2bκ T Lymphocytes Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD19 APC-Vio770 Rat IgG2aκ B Lymphocytes Miltenyi Biotec S.L. Bergisch Gladbach, Germany Table 2. Antibodies used in murine monocyte activation studies Antibody Fluorochrome Isotype Specificity Company CD11b FITC Rat IgG2b Mouse monocyte isolation optimisation Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD45 VioBlue Rat IgG2bκ Haematopoietic cells Miltenyi Biotec S.L. Bergisch Gladbach, Germany CD80 PE Hámster IgG2 Activated monocytes and B cells Miltenyi Biotec S.L. Bergisch Gladbach, Germany Table 3. Antibodies for human monocyte activation studies Antibody Fluorochrome Isotype Specificity Company A DUAL TOOL María José Oliva Martín 82 HLA-DR APC Mouse IgG1κ Monocyte activation Becton Dickinson Bioscience San Jose CA USA CD45 FITC Mouse IgG1κ Haematopoietic cells Becton Dickinson Bioscience San Jose CA USA CD40 PE Mouse IgG1 Activation Beckman Coulter Company Marselle France CD26 PE Mouse IgG1κ Macrophages BD Pharmingen San Jose, CA USA CD16 PE Mouse IgG1κ Macrophages BD Pharmingen San Jose, CA USA CD14 APC-H7 Mouse IgG2a κ Human monocyte activation Becton Dickinson Bioscience San Jose CA USA Table 4. Antibodies used for the measurement of Casp8 expression Antibody Fluorochrome Isotype Specificity Company Anti-cleaved Casp8 antibody (Asp387) (D5B2) Biotin Rabbit Casp8 protein detection Life TechnologiesTM Carlsbad, CA, US Table 5. Antibodies used for human macrophage differentiation studies Antibody Fluorochrome Isotype Specificity Company CD169 PE IgG1 Human macrophage differentiation eBiosciences San Diego, CA USA HLA-DR APC Mouse IgG1κ Activation Becton Dickinson Bioscience San Jose CA USA CD45 FITC Mouse IgG1κ Haematopoietic cells Becton Dickinson Bioscience San Jose CA USA CD36 PE Mouse IgG1 THP-1 differentiation BD Pharmingen San Jose, CA USA CD14 APC-H7 Mouse IgG2a κ Human monocyte activation Becton Dickinson Bioscience San Jose CA USA CD16 PE Mouse IgG1κ Macrophages BD Pharmingen San Jose, CA USA A DUAL TOOL María José Oliva Martín 83 2.2.2. ANTIBODIES USED FOR IMMUNOHISTOCHEMISTRY Table 6. Antibodies used for rat brain immunohistochemistry Antibody Isotype Dilution Specificity Company Anti-Casp8 (Asp387) (D5B2 Rabbit 1:500 Casp8 protein detection Life TechnologiesTM Carlsbad, CA, US Anti-Iba-1 Rabbit 1:500 Microglia Wako (Osaka, Japan) Anti-NeuN Rabbit 1:500 Neurons Milipore (Billerica, MA, USA) 2.2.3. ANTIBODIES USED FOR WESTERN BLOTTING Table 7. Antibodies used for Western Blotting Antibody Cat. Number Usage Company Casp8 Caspase-8 #4790 Pro-Casp8 and p10 fragments Cell Signaling, Beverly, MA, USA Cleaved Casp8 Cleaved Caspase- 8 #9496 P43/41 fragments and p18 fragment Cell Signaling, Beverly, MA, USA RIPK1 RIP #3493 RIPK1 Cell Signaling, Beverly, MA, USA Cleaved PARP Cleaved PARP #9544 Apoptosis Cell Signaling, Beverly, MA, USA GADPH G3PDH/GAPDH #2275-PC-100 Loading control Trevigen β-Actin Actin #A3853 Loading control Sigma-Aldrich (St Louis, MO, USA) 3. CELL CULTURE 3.1. MONOCYTE PURIFICATION FROM HUMAN BLOOD SAMPLES Buffy coats were diluted 1:8 in Viaflo saline solution Bartex Laboratories S.L. (Valencia, Spain) and laid slowly on top of a Ficoll-Paque layer (GE-Healthcare Bio- Sciences AB, Uppsala, EEUU). After centrifuging at 400xg for 30 minutes, the mononucleate cell layer, found between the Ficoll and the serum layer, was extracted and washed twice with RPMI-1640 to eliminate traces of Ficoll. A DUAL TOOL María José Oliva Martín 84 Monocytes were then isolated from the mononucleate cell fraction by immunomagnetic separation using CD14 microbeads (Miltenyi Biotec S.L. Bergisch Gladbach, Germany), following manufacturer’s instructions. After the second wash with RPMI-1640, the supernatant was removed and the cells were resuspended in running buffer. The CD14 microbeads suspension was then added at a ratio of 20 µl per 107 cells and incubated for 15 minutes at 4ºC. The remaining non-bound microbeads were subsequently washed with 10 ml of running buffer and the cells were resuspended in 500 µl of the same solution. The immunomagnetic separation was then performed in an AutoMACS separator using the ‘Possel’ programme, and the positive fraction containing the monocytes was collected, spun down and resuspended in cell culture media (the cell culture media used for each study will be specified in the corresponding section). Cells were maintained at 37°C in 5% CO2-balanced air. 3.2. MONOCYTE PURIFICATION FROM MOUSE BONE MARROW For this purpose, mice were sacrificed by cervical dislocation and BM was harvested by standard techniques (Manzanero, 2012). The BM was obtained by flushing warm PBS through the medullar cavity of femurs and tibias, which was exposed after cutting the top edges of the bones, using a 27G needle (0.4 x 25mm) (B. Braun, Melsungen, Germany) and 20 mL syringes (NIPRO EUROPE NV, Weihoek, Zaventem, Belgium). The cell suspension was subsequently filtered with a 100 µm nylon mesh filter to remove debris, washed twice in PBS and centrifuged for 10 min at 300xg. Monocytes were purified by negative selection using the BM Monocyte Isolation Kit (Miltenyi Biotec S.L., Bergisch Gladbach, Germany) (Oliva-Martin et al., 2015). Nontarget cells are indirectly labelled with a cocktail of biotin-conjugated monoclonal antibodies, which are then bound to magnetic beads. After obtaining the bone-marrow cell suspension, the cells were counted and an aliquot containing 50 x 106 cells was further A DUAL TOOL María José Oliva Martín 85 centrifuged (300xg, 10 minutes) and resuspended in 175 µl of MACS Running Buffer, followed by the addition of 25 µl of FcR Blocking Reagent and, immediately, 50 µl of the Monocyte Biotin-Antibody Cocktail, both contained in the Miltenyi BM Monocyte Isolation Kit (Cat. no. 130-100-629). The cell suspension was then incubated for five minutes at 4ºC, followed by the addition of 10 ml of Running Buffer. After centrifuging for 10 minutes at 300xg at 4ºC, the pellet was resuspended in 400 µl of Running Buffer and 100 µl of Anti-Biotin MicroBeads were added. This suspension was then incubated for 10 minutes at 4ºC, after which the negative fraction was collected in a MACS separator using LS columns (see Table 8 for a detailed stepwise protocol). When purifying from more than 50 x 106 cells, the volume of kit reagents used was scaled accordingly. The isolated monocytes were then cultured in RPMI supplemented with 10% FBS and penicillin 100 U/mL, streptomycin 100 µg/mL (GIBCO, InvitrogenTM, Paisely, UK). A DUAL TOOL María José Oliva Martín 86 Table 8. Protocol for monocyte isolation from bone marrow Bone marrow extraction (30 minutes) 1. Sacrifice mice by approved methods and disjoint legs by cutting above on the pelvis. 2. Tear skin and muscle until bones are totally exposed. 3. Wipe the rests of tissue. 4. Separate femurs from tibias. Discard the knees. 5. Cut on both edges with scissors. The bone marrow should be exposed on both sides. 6. Using a 27G needle, insert 10 ml of PBS through the medullary cavity of each bone and collect it on a Petri dish. Disaggregate the clumps by passing the suspension through the same needle until complete disaggregation. 7. Filter the suspension using 60 µm filters and centrifuge 300 g, 10 minutes. Immuno-magnetic separation (45 minutes) 1. Count cells and take an aliquot containing 50x106 cells. Note increasing cell numbers require adjusting the volumes of the reagents used, as maintaining the volumes may result in a decrease in the purity of the isolated fraction. 2. Centrifuge at 300 g, 10 minutes. 3. Resuspend in 175 µl of running buffer. 4. Add 25 µl of FcR Blocking Reagent 5. Add 50 µl of Monocyte Biotin-Antibody Cocktail. 6. Incubate 5 minutes at 4ºC. 7. Add 10 ml of running buffer and centrifuge for 10 minutes at 300 g. 8. Resuspend pellet in 400 µl of running buffer. 9. Add 100 µl of Anti-Biotin Microbeads. 10. Incubate 10 minutes at 4ºC. Wash the LS column in the MACS separator. 11. Collect the negative fraction in the MACS separator. 3.3. THP-1 CULTURING THP-1 cells were cultured in RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, 0.05 mM β-mercaptoethanol, 100 U/ml penicillin and 100 µg/ml streptomycin. When the cells, grown in suspension, reached a concentration of 106 cells/ml, they were split or fresh media was added to give a final concentration of 100,000 cells/ml In order to freeze the cells, aliquots containing 106 cells were frozen down in 4 ml of FBS containing 10% DMSO. After defrosting, the DMSO-containing FBS was removed A DUAL TOOL María José Oliva Martín 93 6.2. INTRACELLULAR MARKER IMMUNOSTAINING: DETERMINATION OF CASP8 EXPRESSION BY FLOW CYTOMETRY. Monocytes isolated from BM were washed with PBS and fixed with PFA for 10 minutes at 37ºC, followed by permeabilisation with 90% methanol. The cells were then incubated on ice for 30 minutes and washed twice with incubation buffer (IB) (0.5% BSA in PBS). After blocking for 10 minutes with IB, anti-cleaved caspase-8 antibody (Asp387) (D5B2) was added to a 1:800 dilution. Monocytes were then incubated for one hour at room temperature and subsequently washed with IB prior to a 30 minute incubation with an anti-rabbit fluorescein conjugated secondary antibody (Vector). After washing with IB, the cells were acquired in a CYTOMICS FC500-MPL (Beckman Coulter Company. Marselle France) and the percentage of fluorescein-positive cells was gated for further analysis. 6.3. ASSESSMENT OF CELL VIABILITY AND QUANTIFICATION OF APOPTOSIS VS. NECROSIS For cell death studies, an assay combining Annexin V and 7-AAD was performed generally 12 and 24 hours after treatment. The cells were placed on ice for 20 minutes and subsequently detached by gentle pipetting, followed by washing with PBS, and centrifugation for 10 minutes at 300xg. The supernatant was then discarded and the pellet resuspended in 100 µL of PBS in order to label surface markers with antibodies as explained in section 4.1. Immediately after, the cells were washed with PBS and resuspended in 1x binding buffer (Becton Dickinson Bioscience. San Jose CA USA) and 5 µL of both Annexin V (Becton Dickinson Bioscience. San Jose CA USA) and 7-AAD were added. Following a 15 minute incubation in the dark, 400 µL of 1x binding buffer was added and 50,000 events were acquired in a FACS Canto II equipped with the FACSDivaTM software programme. The percentage of apoptosis/necrosis was A DUAL TOOL María José Oliva Martín 94 subsequently determined using the Flow Jo software programme, where cells were gated as shown below: - Viable cells: Annexin V negative; 7-AAD negative. - Apoptotic cells: Annexin V positive; 7-AAD negative. - Necrotic cells: Annexin V positive; 7-AAD positive. 7. ASSESSMENT OF CELL VIABILITY BY FLUORESCENCE MICROSCOPY Cell viability was assessed in both primary microglia and CG cultures. Following their corresponding treatments, cells were incubated for 15 minutes with 100-500 ng/ml Hoechst 33342 (Sigma-Aldrich, St Louis, MO, USA) and 0.02-0.1 μg/ml Propidium Iodide (PI) (Sigma-Aldrich, St Louis, MO, USA). Hoechst 33342 is an intercalating agent which incorporates into the nuclei of healthy, apoptotic and necrotic cells. On the other hand, PI is non-membrane permeable and thus only stains the DNA of cells which have a disrupted plasma membrane. Therefore, the nuclei of both healthy and early apoptotic cells, which have intact plasma membranes, appear only Hoechst-positive whilst necrotic nuclei are also PI-positive. Apoptotic cells can be differentiated from healthy cells by their fragmented or condensed nuclei. Cells were examined with a Zeiss LSM 7 Duo confocal microscope equipped with the software ZEN2011. To distinguish microglia from other cells, this was labelled with IB4-Alexa Fluor 488 (InvitrogenTM, Paisely, UK). A DUAL TOOL María José Oliva Martín 95 8. QUANTIFICATION OF MRNA EXPRESSION LEVELS BY RT-Q- PCR Primary human monocytes were harvested 12 and 36 hours after treatment and total RNA was isolated with the RNeasy Mini Kit (Qiagen, Venlo, Holland) according to manufacturer's instructions. cDNA was synthesized from up to 1 μg of total RNA using the QuantiTect Reverse Transcription Kit (Qiagen, Venlo, Holland). The cDNA concentration was measured with a Nanodrop 1000 (Thermo Fischer Scientific, Nunc A/S, Kamstrupvej, Roskilde, Denmark) and 750 ng of cDNA was added to each qPCR reaction. The qPCR was performed using SensiMixPlus SYBR (Quantace, Bioline, Taunton, MA, USA) on a Mastercycler ep gradient S realplex2 (Eppendorf, Hamburg, Germany). All primer sets had similar Tm values and amplified short fragments, spanning an intron and recognising all or most of the cDNA splicing variants described (Table 10). All primers were designed with the Universal ProbeFinder v2.44 software (Roche Applied Science; Roche Farma, S.A., Madrid, Spain) and verified by Oligo Analyzer 3.1 (Integrated DNA Technologies, Coralville, IA, USA). The amplification program was 10 minutes at 95ºC followed by 45 cycles of 15 s at 95ºC, 30 s at 60ºC, 8 s at 72ºC, and a final extension step of 5 minutes at 72ºC. A melting curve from 50ºC to 95ºC in 30 minutes was used to verify specificity. Relative expression levels were calculated in triplicate using the comparative CT method with β-actin as a housekeeping gene. A DUAL TOOL María José Oliva Martín 96 Table 10. Primers used in RT-q-PCR. PRIMER SEQUENCE (5'- 3') Tm (ºC) IL-10 F AAGACCCAGACATCAAGGCG 66.4 IL-10 R CAGGGAAGAAATCGATGACAGC 66.9 IL-1β F AAAGCTTGGTGATGTCTGGTC 63.1 IL-1β R GGACATGGAGAACACCACTTG 64.4 TGFβ1 F ACTACTACGCCAAGGAGGTCAC 63.3 TGFβ1 R TGCTTGAACTTGTCATAGATTTCG 64.1 VEGFα F CTCCACCATGCCAAGTGGTC 68.0 VEGFα R GCAGTAGCTGCGCTGATAGA 63.4 TNFα F TGTTGTAGCAAACCCTCAAGC 64.0 TNFα R TATCTCTCAGCTCCACGCCA 66.1 βACT F GGCCAGGTCATCACCATTG 66.2 βACT R CACAGGACTCCATGCCCAG 66.4 9. MEASUREMENT OF CYTOKINE CONCENTRATION BY ENZYMELINKED IMMUNOSORBENT ASSAY (ELISA) In order to quantify the cytokine release by monocytes, ELISAs were performed on cell culture supernatants. The kits used were IL-1β (human) ELISA kit (Enzo Life Sciences) for the determination of IL-1β and IL-10 (human) ELISA kit (Enzo Life Sciences) for IL- 10. Two different cell concentrations (5 x 105 cells/well and 1 x 106 cells/well) were included in the assay and the supernatant was collected, in both cases, 48 hours posttreatment. All the experiments were performed following manufacturer's procedures. The absorbance was read at 450 nm, in a Synergy HT plate reader (BioTek) using the Microwin software programme. The standard curve was plotted using the Sigma Plot software programme. A DUAL TOOL María José Oliva Martín 97 10. GENE SILENCING All silencing experiments were performed on the THP-1 cell line. For the silencing protocol: Lipofectamine 2000 (Life TechnologiesTM. Carlsbad, CA, US) was used. The siRNA scramble was purchased from Dharmacon (SMARTpool: ON-TARGETplus Control siRNA nr: D-001810-10-05), as were the siRNA for caspase 8 silencing (SMARTpool: ON-TARGETplus Caspase-8 (Human) siRNA nr: L-003466-00-0005) and the siRNA for RIP-1 kinase silencing (SMARTpool: ON-TARGETplus RIPK1 (Human) siRNA nr: L-004445-00-0005). For the optimised protocol, 400,000 cells were plated per well on a 12-well plate in 1 mL THP-1 medium without antibiotic. Lipofectamine was incubated in OptiMEM (GIBCO. InvitrogenTM, Paisely, UK) for 5 minutes, after which the corresponding siRNA or scrambled control siRNA (diluted in OptiMEM) was added. The ratios of siRNA/Lipofectamine are stated in table 11. The mixture was then incubated for 20 minutes at room temperature and subsequently added to the cells, which were then incubated for 24 hours. Knock-down was assessed by Western Blotting. Table 11. Amounts of Lipofectamine 2000 and siRNAs used in transfections per well Lipofectamine 2000 siRNA Casp8 3 µL 150 pmol RIPK1 2 µL 100 pmol A DUAL TOOL María José Oliva Martín 98 11. WESTERN BLOTTING Western Blotting was used to quantify knock-down efficiency (for which cells were harvested 24 and 48 hours after treatment), as well as to quantify RIPK1 expression during differentiation. Once the cells were harvested, they were lysed in lysis buffer (20 mM Tris-HCl pH 8, 10mM EDTA, 140 mM NaCl, 1% NP-40 and 10% Glicerol, 1mM PMSF), sonicated and boiled for 5 minutes. SDS-PAGE gels were prepared following standard protocols. The percentage of polyacrylamide varied according to the molecular weight of the protein of interest. Electrophoresis was conducted at a constant voltage of 100 during the first 5 min and then increased to 150 V. Gels were transferred to PDVF membranes by wet transfer, using a transfer buffer consisting of 5 mM Sodium tetraborate in distilled water. The transfer was performed at a constant amperage of 200 mA for 2 hours. Membranes were blocked in 5% milk and incubated with antibodies overnight at 4°C, followed by incubation with the appropriate horseradish peroxidase conjugated secondary antibody (Pierce, Rockford, IL, USA, 1:10 000) for 1 h at room temperature. Immunoblot with anti-β-actin antibody (Sigma) was used for standardisation of protein loading. Bands were visualized by enhanced chemiluminescence (ECL-Plus, Pierce) following the manufacturer’s protocol. Densitometry was done using ImageJ software (NIH, USA; http.//imagej.nih.gov/ij) 12. INTRANIGRAL INJECTIONS Male Wistar rats (200 - 250 g) were anaesthetised with 400 mg/kg i.p. chloral hydrate and positioned in a stereotaxic apparatus (Kopf Instruments, Tujunga, CA, USA) to conform with the brain atlas of Paxinos and Watson (1986). LPS, IETD-fmk and Nec-1 A DUAL TOOL María José Oliva Martín 99 were all diluted in saline solution to a final concentration of 1% DMSO. Injections were performed using a Hamilton syringe and the injection needle was lowered through a drill hole 5.5 mm posterior, 1.5 mm lateral and 8.3 mm ventral to the bregma. A volume of 2 µl was delivered over a period of about 2 min, after which the needle was left in situ for an additional 5 min to avoid reflux along the injection track. Animals were divided into six different groups based on the content of the injection: - Vehicle, which consisted of 1% DMSO in saline solution. Monastral blue inert tracer [Sigma, St. Louis, MO, USA; 1% in phosphate-buffered saline (PBS)] was added at 1% concentration for an appropriate tracking of the injection. - LPS (4 µg per animal), which consisted of a 1:1 mixture of stock LPS and vehicle. The stock LPS was made by dissolving powdered LPS in vehicle to a concentration of 4 mg/mL. - Nec-1 (8 mmols per animal) was prepared by diluting stock Nec-1 1:100 with vehicle for a final concentration of 4 mM (1% DMSO). Since Nec-1 precipitates after the addition of vehicle, it is necessary to sonicate the samples before injection. Stock Nec-1 was diluted in 96 µL of DMSO for a concentration of 400 mM. - IETD-fmk (l.5 mmols per animal) was prepared by diluting stock IETD-fmk 1:100 in vehicle. Stock IETD-fmk was diluted in 20 µL of DMSO for a concentration of 75 mM. - LPS + IETD-fmk, prepared by mixing 1:1 stock LPS and stock IETD-fmk in vehicle (1:50). - LPS + Nec-1, prepared by mixing stock LPS and stock Nec-1 in vehicle (1:50). 13. PARAFORMALDEHYDE PERFUSION For immunohistochemistry, intranigrally injected rats were intracardiacally perfused with a fixing solution containing 4% PFA in PBS, pH = 7.4. Perfusions were always A DUAL TOOL María José Oliva Martín 100 conducted under deep anaesthesia induced by isoflurane. Once the animal was anaesthetised, a saline solution (0.9% NaCl in distilled water) was perfused prior to the fixing solution to avoid blood clotting. The brains were then removed and sequentially transferred into increasingly concentrated sucrose solutions in PBS (pH =7.4) until they sank. The tissues were then frozen in isopentane at -15°C and 20 µm sections were cut on a cryostat and mounted on gelatine-coated slides. 14. IMMUNOHISTOCHEMISTRY Primary antibodies used were a mouse-derived, anti-Iba1, anti-NeuN, and anti-Casp8 (see table 6, section 2.2.2.). NeuN binds the vast majority of neurons and thus is used to measure neuronal density as well as the neuron/glia ratio in the brain. Finally, Iba1 is expressed by microglial cells, monocytes and macrophages. Washes were generally done in Tris saline buffer (TBS, pH 7.4). Unless otherwise stated, all work was done at room temperature. Once washed, the tissue was permeabilised by double heating with a citrate solution for 5 minutes. Following another wash, the slides were immersed in 0.3% hydrogen peroxide in methanol for 15 minutes. The tissue was then washed and blocked with 1% serum in TBS in a humid chamber for 1 hour, followed by overnight incubation at 4˚C with the required primary antibody in 1% serum and 0.25% Triton-X-100 in TBS. After three consecutive washes, the slides were incubated for 2 hours with the specific biotinylated IgG secondary antibody in TBS followed by a second 1 h incubation with 1% ExtrAvidin®-Peroxidase solution (Sigma, 1:100) in 0.125% Triton-X-100 in TBS. Finally, slides were developed with a standard diaminobenzidine/hydrogen peroxide solution for five minutes. In order to dehydrate the sections, they were immersed in a series of ethanol solutions of increasing concentration (50, 70, 80, 90%) for five minutes each and 100% ethanol for A DUAL TOOL María José Oliva Martín 101 ten minutes, followed by a 15 minute immersion in histolemon. The mounting of the dehydrated sections was done in DPX. 15. STATISTICAL ANALYSIS All data are presented as mean ± standard deviation/range of either absolute values or percentages. Statistical analyses were performed using IBM SPSS Statistics 19 software. Statistical significance was assessed by Student’s t-test or multifactor ANOVA followed by the Bonferroni test. In all the tests, P values were P < 0.05 (*), P < 0.01 (**) and P < 0.001 (***). A DUAL TOOL María José Oliva Martín 102 RESULTS A DUAL TOOL María José Oliva Martín 109 A DUAL TOOL María José Oliva Martín 110 4. OPTIMISING THE INDUCTION AND DETECTION OF HUMAN MONOCYTE ACTIVATION The immunomagnetic separation of human monocytes provided a single monocytic population which was subsequently treated with LPS for 48 hours. When observed under the microscope, the cells did not present a macrophage-like morphology, suggesting that differentiation had not taken place (data not shown). Nevertheless, flow cytometry was conducted to measure the expression of several activation/differentiation biomarkers. The expression of CD16, a biomarker characteristic of macrophages, was not significantly altered by LPS stimulation (Fig. 10A.), which confirms the presence of non-differentiated monocytes. In order to test for the activation of monocytes, cells were probed with anti- CD26 and CD40. Whilst CD26 did not increase significantly under LPS treatment (Fig. 10B), there was a clear shift in the mean fluorescence channel for CD40 (Fig. 10C and D). The percentage of CD40 positive cells was quantified at different timepoints and was seen to peak at 48 hours post treatment (data not shown). Therefore, to quantify activation in future experiments, CD40 expression was measured at 48 hours post-treatment. A DUAL TOOL María José Oliva Martín 111 A DUAL TOOL María José Oliva Martín 112 5. CASPASE 8 ACTIVITY INCREASES UNDER LPS-TREATMENT IN THE ABSENCE OF CELL DEATH IN PRIMARY HUMAN MONOCYTES In line with the findings in the THP-1 cell line, we decided to confirm whether an increase in Casp8 activity took place during the activation process. Thus, we measured the activity of Casp8 at two different timepoints (12 and 24 hours) before the expression of activation biomarkers. Of note, we chose a 12-hour timepoint based on the timing in which SIRS-related cytokines are released. The results showed a mild increase in Casp8 activity which was similar to that observed in the THP-1 cell line and typical of the non-apoptotic activity of Casp8 (Fig. 11 A). As seen with THP-1 cells, the increase in caspase activity was not associated to a significant increase in apoptosis as evaluated by flow cytometry (Fig. 11 B). A DUAL TOOL María José Oliva Martín 113 A DUAL TOOL María José Oliva Martín 114 6. THE CHEMICAL INHIBITION OF CASPASE 8 DECREASES HUMAN PRIMARY MONOCYTE ACTIVATION Considering the previous results, it was possible that targeting Casp8 could modulate human monocyte activation. Based on our data obtained with THP-1 cells with the Casp8 inhibitor IETD-fmk, we proceeded to test the effect of the chemical inhibition of Casp8 on primary human monocytes. We found that a 70% inhibition in Casp8 (Fig. 12A) was sufficient to decrease monocyte activation by a 30% (Fig. 12B), suggesting that Casp8 inhibition could potentially be a tool to modulate monocyte activation and its consequences. A DUAL TOOL María José Oliva Martín 115 A DUAL TOOL María José Oliva Martín 116 7. CASPASE 8 INHIBITION TRIGGERS NECROPTOSIS OF PRIMARY HUMAN MONOCYTES Surprisingly, we noticed that the chemical inhibition of Casp8 triggered high levels of cell death in LPS-treated primary human monocytes (Fig. 13A), an effect that we had not seen in THP-1 cells (data not shown). In order to determine which cell death pathway was involved, we measured the percentage of apoptotic (Fig. 13B) and necrotic cells at shorter timepoints (Fig. 13C). We found that there was not apoptosis prior to the induction of necrosis, meaning that the increase in necrotic cell death at 48 hours was not due to secondary necrosis. In fact, although LPS alone triggered a low percentage of apoptotic cell death, the death caused by the combination of LPS and IETD-fmk was almost entirely necrotic. We also observed that cells treated with IETD-fmk alone also experience a certain amount of cell death, which we attributed to a basal level of activation after immunemagnetic separation. A DUAL TOOL María José Oliva Martín 117 A DUAL TOOL María José Oliva Martín 118 Since the formation of the ripoptosome is required for non-apoptotic caspase activation, it was plausible that Casp8 inhibition could lead to RIPK1 activation, which could then trigger death by necroptosis. In order to assess whether activated monocytes were undergoing necroptosis, we pre-treated the cells with the RIPK1 inhibitor Nec-1. The ability of Nec-1 to inhibit cell death is generally acknowledged to confirm that the mode of cell death is necroptosis. We found that the addition of Nec-1 was able to reverse the necrosis induced by Casp8 inhibition, therefore confirming that the increase in cell death was due to the activation of the necroptosis pathway (Fig. 14A/B). Interestingly, we observed that the addition of Nec-1 also reversed the death induced by the addition of IETD-fmk alone, suggesting that this was due to necroptosis caused by a partial activation of the monocytes post-isolation (data not shown). A DUAL TOOL María José Oliva Martín 125 10. DEVELOPMENT OF AN IN VIVO MODEL FOR THE STUDY OF CASPASE 8 INHIBITION AS A TREATMENT FOR SIRS In order to study monocytic activation and differentiation using our mouse model, monocytes needed to be separated from other immune cells. Traditionally, macrophages have been obtained by culturing BM isolates for seven days in the presence of the growth factor M-CSF (Manzanero, 2012). Under these conditions, monocyte/macrophage precursors differentiate into macrophages, which then phagocytose non-monocytic cells and non-differentiated macrophages. However, to study monocyte activation and differentiation, it is necessary to start from a pure monocytic population, rather than a complex mixture of BM cells. Therefore, we aimed to find a procedure that provided high yields of a pure monocyte population. Since purity was our main concern, immunomagnetic separation was chosen amongst other techniques involving culturing (Francke et al., 2011), as the strong antigen-antibody interactions used allow a more specific separation. A DUAL TOOL María José Oliva Martín 126 10.1. MONOCYTIC CELL LEVELS IN THE BONE MARROW Flow cytometry was used to firstly analyse the average yield of different cell types from a mouse BM extraction. The extracted BM cell suspension corresponded to a yield of 50 x 106 ± 10 x 106 cells per mouse and was made up of a heterogeneous population of cells including neutrophils, B and T lymphocytes, eosinophils and monocytes (Fig. 18A). The percentages of the different non-monocytic cell populations were assessed based on the expression of several biomarkers, including CD11b, F4/80, LY6G, CCR3, CD3, CD4, CD8 and CD11b (Fig. 18 B, C and D). Neutrophils accounted for the vast majority of the extract, constituting over 70% of all CD11b positive cells (data not shown). The monocytic population was then selected based on the expression of both CD11b and F4/80 (CD11b+, F4/80+), and was shown to comprise 11.03 ± 2.03% of the total BM cells (Fig. 18B/E). Considering that 50x106 BM cells can be obtained per mouse, the hypothetical optimum isolation yield was therefore estimated to be around 5.5 x 106 monocytes per mouse. A DUAL TOOL María José Oliva Martín 127 A DUAL TOOL María José Oliva Martín 128 10.2. IMMUNOMAGNETIC SEPARATION OF CD11B POSITIVE CELLS PROVIDES A NON-FUNCTIONAL CELL POPULATION Initially, a similar protocol to that for human monocyte isolation was designed, which consisted of adding microbeads targeting specific mouse monocyte receptors. The positive fraction (i.e. the one that is retained on the column) will thus contain almost exclusively monocytes. The microbeads chosen were bound to CD11b antibodies, as these are commonly used in the immunomagnetic separation of microglia (Marek et al., 2008) and detection of monocytic cells by flow cytometry. 9.2.1. POSITIVE SELECTION OF CD11B POSITIVE CELLS FROM THE BONE MARROW Since we had characterised a monocytic population in the BM that made up approximately 10% of the total cell numbers, we firstly tried to purify monocytes from BM cell suspensions. This allowed the use of a simpler cell extraction technique than cardiac puncture, which requires not only more materials but also a further Ficoll separation procedure to remove red blood cells. After the immunomagnetic separation step, the yield obtained varied between 10 and 20 x 106 cells per mouse which was far over the calculated amount. When the cells were analysed, we observed a single population which was positive for CD11b however negative for CD11c, a biomarker typical of DCs (Fig19. A and B). The cells were then treated with LPS for 24 hours and activation was quantified by flow cytometry based on the expression of CD40 as previously described (van Kooten and Banchereau, 2000). No increase in the percentage of CD40 positive cells was observed under these conditions (Fig. 19C). Furthermore, different LPS batches and brands were assessed, however they all provided the same result. A DUAL TOOL María José Oliva Martín 129 9.2.2. THE USE OF OTHER BIOMARKERS TO ASSESS ACTIVATION Considering that LPS did cause activation of human monocytes, we wondered if a different biomarker should be used to quantify activation. After researching the literature, CD80 was chosen, as this has been used in other studies involving LPS-mediated activation of monocytes (Houthuys et al., 2010). Once again, LPS treatment caused only a very slight increase in CD80 expression, which was not accompanied by a significant increase in forward and side scatters (Fig. 20 A and B). A DUAL TOOL María José Oliva Martín 130 10.2.3. POSITIVE SELECTION OF CD11B POSITIVE CELLS FROM PERIPHERAL BLOOD A DUAL TOOL María José Oliva Martín 131 None of the common biomarkers used for monocyte activation proved to increase under LPS stimulation. Taking into account that the BM contains cells in different stages of differentiation, we concluded that the purified population may include a high percentage of non-differentiated cells, which are therefore non-responsive to activation stimuli. Therefore, we aimed to purify monocytes using the same procedure, but from peripheral blood, as this contains a higher proportion of mature monocytes. The isolated cells were treated with LPS for 24 hours and activation was quantified by flow cytometry based on the expression of both CD40 and CD80. Once more, no shift in the mean fluorescence channel was observed for any of the biomarkers (Fig. 21). 10.3. NEGATIVE SELECTION FROM THE BONE MARROW: AN EVALUATION OF A NEW COMMERCIAL PROCEDURE. It has been described that the binding of surface markers in innate immune cells can lead to their activation (Auffray et al., 2009a, Landsman et al., 2007). This could bias studies aimed to elucidate the molecular mechanisms involved in monocyte activation. Recently, a novel method consisting of the depletion of all non-monocytic blood cells has been developed. As monocyte cell surface markers are not targeted during this purification the yielded monocytes are fully functional, however, the technique requires the use of high numbers of mice due to low yields (Houthuys et al., 2010) Based on this premise, we evaluated the efficacy and efficiency of a new method developed by Miltenyi Biotec for monocyte isolation from BM. At the time, there were no reports analysing the advantages and disadvantages of this new approach. A DUAL TOOL María José Oliva Martín 132 Furthermore, since the cells are isolated from the BM, which contains high levels of immature monocytes, it was important to check that the purified cells are both mature and functional. These studies have already been published (doi: 10.1016/j.ab.2015.04.012). A DUAL TOOL María José Oliva Martín 133 10.3.1. ASSESSMENT OF YIELD AND PURITY We observed that the immunomagnetic depletion from BM isolates reduced neutrophil levels by ten-fold, as well as decreasing levels of T and B lymphocytes to between 5.5 and 2% of that found in the BM suspensions (Fig. 22 and Table 12). The obtained yield of monocytes was 3.5 ± 0.3 x 106 per mouse, which represents a greater than 80% purification efficiency of monocytes from the BM suspension and is approximately forty times higher than that achieved by depletion from peripheral blood (Francke et al., 2011). This technique therefore allows the use of fewer mice per experiment which has both obvious economic and ethical advantages. Moreover, since the protocol involves only one stage of immunomagnetic separation, the cell viability was higher than 95% (data not shown). Table 12. Percentage of different cell types in cell suspension before and after immuno-magnetic separation Population Biomarkers used for gating Percentage over total BM Before isolation After isolation Neutrophils CD11b and LY6G 27.24±7.51 2.96±2.80 Eosinophils CD11b and CCR3 4.97±0.4 1.56±1.43 T lymphocytes T CD8+ CD3, CD4 and CD8 0.8±0.19 0.02±0.02 T CD4+ 0.73±0.22 0.04±0.05 B lymphocytes CD19 9.04±1.44 0.36±0.13 Monocytes CD11b and F4/80 11.03 ± 2.03 92.98±2.31 A DUAL TOOL María José Oliva Martín 134 When the isolated monocytes were analysed by flow cytometry, we observed a single population which maintained the main receptors for monocyte activation but did not express any of the biomarkers characteristic of granulocytes (Ly6G and CCR3) and lymphocytes (CD3, CD4, CD8 and CD19) (Figs. 23A and B, and Table 12). With 92.8 ± 2.3% purity, the cells obtained were CD11b+ and F4/80+, therefore confirming the presence of high levels of non-differentiated monocytes. At the time of the isolation, the A DUAL TOOL María José Oliva Martín 141 A DUAL TOOL María José Oliva Martín 142 Since the deletion of the Casp8 gene did not seem to replicate the effect of the chemical inhibition achieved in humans, we decided to assess the effect of IETD-fmk on monocyte activation and necroptosis. Strikingly, despite achieving a 90% decrease in caspase activity (Fig. 27A), the chemical inhibition of Casp8 did not result in necroptosis or a decrease in the activation of LPS-treated monocytes (Figs. 27B and C). A DUAL TOOL María José Oliva Martín 143 These unexpected results led us to think that Casp8 may have not been involved in murine monocyte activation. In order to confirm our hypothesis, we resolved to measure the variances in Casp8 activity upon LPS-mediated activation, and found the complete opposite trend to the one observed with human monocytes (i.e. Casp8 activity decreased on activation) (Fig. 28). Considering this data, it seemed that the activation pathways differed between humans and mice. On the other hand, it is also possible that other caspases may be involved in the process. Therefore, we assessed the effects of other caspase inhibitors on activation and necroptosis. We found that neither the specific caspase 9 inhibitor, LEHD-fmk, nor the specific caspase 3 inhibitor, DEVD-fmk, had any effect on activation or cell death (Fig. 29). A DUAL TOOL María José Oliva Martín 144 A DUAL TOOL María José Oliva Martín 145 To test whether any caspases were involved in the processes of activation and necroptosis, we decided to use the pan caspase inhibitor z-VAD-fmk, which has been successfully used to induce caspase-8-dependent necroptosis (Fricker et al., 2013, Yamanaka et al., 2014, Liu et al., 2014). When we pre-treated monocytes with the pan-caspase inhibitor z-VAD-fmk, we fully reproduced the trend seen with human monocytes in terms of both activation and cell death. The co-treatment of monocytes with LPS and z-VAD-fmk reduced LPS-induced activation by 20% (Fig. 30A), as well as inducing almost 60% of necroptotic cell death which was partially blocked by Nec-1 (Fig. 30B) A DUAL TOOL María José Oliva Martín 146 A DUAL TOOL María José Oliva Martín 147 12. OPTIMISATION OF A HUMANISED MOUSE MODEL FOR THE IN VIVO STUDY OF CASP8 AS A TARGET FOR SIRS TREATMENT Far from being a disadvantage, the different mechanisms for monocyte activation between humans and mice may be beneficial for drug development. This is as in humans a specific caspase inhibitor could be used in place of a pan-caspase inhibitor, which would likely have had more undesired consequences and thus side-effects. Nevertheless, for practical issues, the differences between humans and mice require the development of alternatives for the study of Casp8 inhibition in the treatment of SIRS. We are currently optimising a humanised mouse model, which would allow us to mimic the human environment in the mouse blood. For this purpose NOD/SCID/IL2Rγ−/− mice will be irradiated to deplete all the BM cells and subsequently transplanted with CD34+ cells, which have already been purified from leukapheresis, to induce human haematopoiesis. Once haematopoiesis takes place, monocytes from the same donor will be infused to assess the relevance of these cells in the outcome of SIRS. Mice will then be challenged with a lethal dose of 25 mg/kg LPS. Survival studies to assess the efficiency of Casp8 inhibition as well as flow cytometry studies to determine the degree of activation and the necroptosis of monocytes will be performed. A DUAL TOOL María José Oliva Martín 148 13. DISCUSSION Even without considering the increasing antibiotic resistance, sepsis continues to be a leading cause of death worldwide (Esteban et al., 2007, Tallia and Kunicka, 2009, Ward and Bosmann, 2012). This is due to the fact that, upon progression to severe sepsis and SIRS, the deadly symptoms are not caused by the pathogens per se, but by an exacerbated immune response towards them (Bosmann and Ward, 2013, Chong and Sriskandan, 2011, Ward and Bosmann, 2012). In particular, the engagement of TLR receptors on the surface of innate immune cells triggers their activation and the release of a cytokine cascade, which in turn initiates the onset of SIRS (Bosmann and Ward, 2013). Amongst innate immune cells, monocytes have been described to play an essential role in the development of SIRS, since they are capable of modulating the innate immune response (Janeway et al., 2008). In line with these facts, we hypothesised that the inhibition of monocyte activation could potentially diminish the cytokine release and ameliorate the innate immune response (Matsuda et al., 2012). With this in mind, we initially attempted to elucidate the mechanism that underlies monocyte activation. Firstly, we characterised a model that would allow us to study human monocytes in an inflammatory environment comparable to that induced during SIRS. We chose the treatment with LPS, as this is injected in a well-established endotoxin model for septic shock in vivo (Remick and Ward, 2005, Lilley et al., 2015). Several studies have demonstrated that Casp8 is involved in activation and differentiation of innate immune cells (Kang et al., 2004, Burguillos et al., 2011, Rebe et al., 2007). Burguillos et al. (2011) showed that Casp8 controls microglial activation and consequent neurotoxicity. They observed that LPS triggered a mild increase of Casp8 activity in microglia which was not associated to cell death (Burguillos et al., 2011). Based on this premise, we measured Casp8 activity in the monocytic cell line THP-1 after treatment with LPS, finding a similar increase that did not correlate to cell death and was much lower than A DUAL TOOL María José Oliva Martín 149 that caused by the apoptosis inducer staurosporine. The general consensus is that the heterodimerisation of Casp8 with FLIP leads to a less intense Casp8 activity than that occurring under Casp8 homodimerisation and consequent apoptosis (Pop et al., 2011). This heterodimerisation leads to moderate Casp8 activities such as the one observed by us, as well as promoting survival, which could explain the absence of cell death upon Casp8 activation. In line with our interest in modulating monocyte activation, we assessed the effects of Casp8 inhibition in monocyte activation by pre-treating THP-1 cells with the Casp8 inhibitor IETD-fmk. We found that this prevented LPS-mediated activation by 50%, suggesting that Casp8 activity can be required for monocyte activation. A further confirmation from a molecular perspective was also attempted by using siRNAs. However, the low transfection efficiency observed in the cells led to inconsistent and low levels of knock-down, and so prevented the drawing of conclusions. Nevertheless, since the treatment with the drug, which is more applicable to clinic, had provided positive results, we proceeded to extrapolate these results to human primary monocytes. Prior to analysing the effects of Casp8 inhibition in human primary cells, we characterised a model that allowed us the study of Casp8 role in monocyte activation. We purified monocytes by immunomagnetic separation, so to remove the complicating factor introduced by the presence other types of immune cells, and confirmed that we had obtained a pure, resting monocytic population. Then, we treated the cells with LPS for short timepoints similar to those we had chosen for THP-1 cells. However, given that monocyte activation ultimately leads to differentiation, it was important to confirm that LPS-treated monocytes had not differentiated into macrophages within that time period. Thus, we assessed the expression of the macrophage biomarker CD16, as well as activation biomarkers such as CD40 and CD26. We found that LPS-treated monocytes still possessed A DUAL TOOL María José Oliva Martín 150 monocyte features and biomarkers at 48 hours-post treatment, as well as consistently expressing high levels of CD40. Subsequently, we quantified the changes in Casp8 activity upon LPS stimulation, finding a moderate increase identical to that observed in THP-1 cells. As observed with THP-1 cells, the chemical inhibition of Casp8 caused a 30% decrease in activation in terms of CD40. Interestingly, however, we noticed that the percentage of dead cells rose to 40% when Casp8 was inhibited in activated cells, an effect that we could not see in the THP-1 cell line. Since cell death had been quantified at 48 hours post-treatment, it could likely be secondary necrosis (Krysko et al., 2008). However, when we measured the levels of apoptotic (Annexin V positive) and necrotic (7-AAD positive) cells at shorter timepoints, we found that the trends observed for apoptosis did not correlate to the trends observed for necrosis. Furthermore, the death induced by the combination of LPS and IETD-fmk treatments was exclusively necrotic, a feature which had already been described in monocytic cells under caspase inhibition (Sordet et al., 2002). Rebe et al. (2007) showed that Casp8 regulates monocyte differentiation into macrophage, associating with FADD and RIPK1 independently of TNF signalling into a complex named ripoptosome (Rebe et al., 2007). Consequently, ripoptosome formation has been shown to determine the cell fate between differentiation, apoptosis or necroptosis (Oberst and Green, 2011). Considering that our results pointed at a possible role of Casp8 in monocyte activation, it was likely that this was mediated by ripoptosome formation and so, under conditions of Casp8 inhibition, RIPK1 could not be cleaved and therefore activate and trigger necroptosis. This hypothesis was supported by studies in which necroptosis occurs downstream of TLR4 activation (Fricker et al., 2013), and could also explain the absence of cell death in THP-1 cells, given that several cell lines have been shown to have alterations in the necroptosis pathway (de Almagro and Vucic, 2015). Thus, to confirm the 20 nucleus of the vagus, the dorsomedial nucleus of thalamus, the facial nucleus, the lateral hypothalamic area, the periaqueductal gray, the parabrachial nucleus, the paraventricular nucleus of hypothalamus, the rostroventrolateral medulla, the SN, the trigeminal nucleus and the ventral posteriomedial nucleus of thalamus [232]. The gut-brain axis can thus be considered a communication pathway between the gut and the brain, enabling the bidirectional control of gastrointestinal and neural functions. It is also a route by which gut microbiota metabolites can physically reach the brain [233]. Despite the importance of the vagus nerve in the connection between the intestine and the brain, it is not the only route between both systems. Hormonal signals originated in the gut affect the brain, influencing high cognitive functions that can determine food intake (for review, see [232]). Among them, ghrelin is a signal produced by the empty gastrointestinal tract; ghrelin acts on hippocampal neurons, pushing the brain to engage in a food-ingestion mode [234]. On the contrary, a number of substances produced by different cells in the intestinal epithelium interact with a number of receptors located in enterocytes and enteroendocrine cells, or taken up by capillaries and moved through the general circulation to reach the brain and other organs to depress the food-ingestion mode [235]. Clear evidence establishes a relationship between gut microbiota and behaviour, even showing biochemical alterations of BDNF levels in hippocampus, for example; since some of the changes observed are independent on the vagus nerve, this seems to indicate that they might be mediated by microbial compounds acting on the brain [236]. Results obtained in some studies seem to suggest that vagal pathway might mediate the behavioural changes associated with acute infection whereas chronic inflammatory conditions would not require the vagus nerve to alter normal behaviour and brain neurochemistry. It is therefore not surprising that some intestinal disorders (as IBD, UC and CD) are associated with behavioural changes and psychiatric disease, especially in the elderly [203, 237, 238]. The gut-brain axis influence on the brain may go beyond modification of the functions related to food intake or the impairment of higher functions that are reflected in changes in behaviour and psychiatric diseases. Strikingly, recent evidence suggests that alterations in the enteric nervous system could contribute to neurodegeneration in the brain, as in the case of PD, a synucleinopathy characterized by the presence of a class of proteinaceus cytoplasmic aggregates called Lewy bodies that have the presynaptic terminal protein α-syn as main component [239]. Animal models of PD are focussed on producing dopaminergic lesions within the brain [240]. However, several studies show a pathological expression of 21 α-syn in the intestine of patients with PD and increased colonic permeability [241-248]. The description of Lewy bodies in the enteric nervous system was first made in 1984 [249]. Since then, there have been an increasing number of reports on the presence of α-syn in the enteric nervous system, although there is no complete agreement in the scientific community about its usefulness as early biomarker of PD [250, 251]. In an interesting work published recently, Kelly and colleagues have shown that a single dose of 2.5 mg/kg of LPS administered intraperitoneally to mice produced intestinal permeability in the large intestine, followed by α-syn phosphorylation in some colonic myenteric neurons [252]. The intestinal barrier has an increased permeability under physiological circumstances to facilitate the contact of small amounts of antigen with the immune system [253] This permeability breach is transient in healthy conditions, but in pathological conditions such as IBD, altered permeability can last over time leading to chronic inflammation and neuronal damage [254]. As was mentioned before, our group has used and described the intranigral injection of LPS as inflammatory model of dopaminergic cell death resembling PD (for a review see ref. [127]). It has been argued that physiological and LPS-induced triggering of inflammation in PD models would probably follow different pathways, and that the intranigral injection of LPS could be a model of nigral dopaminergic neurodegeneration under conditions of systemic infection [255]. Interestingly, they describe that systemic injection of LPS enhances the weak inflammatory response to α-syn delivered in the SN, making it similar to that described after the intranigral injection of LPS. Couch and colleagues [255] indicate that the inflammatory response to α-syn is context sensitive. Considering all the evidence discussed above, it is perfectly conceivable that intestinal inflammatory processes may induce a general inflammatory state that would facilitate the arrival of α-syn from the enteric to the CNS, which in this inflammatory context could result in death of dopaminergic neurons. All these works support Braak’s postulate that PD pathogenesis can have an origin on the enteric nervous system, then propagating to the brain by a chain of α-syn neurons spread through the entire gastroinstestinal tract, which could let pathogens and/or sensitizing substances to reach the CNS through unmyelinated axons [256]. It has been suggested that α-syn, following a prion-like mechanism, could induce the pathological progression of PD [257]. Similar prion-like mechanisms could be involved in other neurodegenerative disorders, such as AD, Huntington’s disease or amyotrophic lateral sclerosis [258-260]. Compelling evidence supports the cell-to-cell transmission of pathogenic proteins as a mechanism shared for several neurodegenerative disorders. The excellent review by Guo and Lee 2014 [261] summarizes the potential mechanisms 22 allowing cytosolic proteinaceous aggregates to reach other cells. Basically, it includes the release of a small amount of misfolded protein seeds in a ‘naked’ form that can then penetrate into a recipient neuron directly through the plasma membrane, by fluid-phase endocytosis or by receptor-mediated endocytosis. Misfolded protein seeds can also be released within exosomes that may fuse with the membrane of a recipient neuron. The transfer of seeds can also be done through nanotubes connecting the cytoplasm of two cells directly. In the context of PD, Visanji et al. 2013 [257] defines (literal quote) […a prion-like mechanism of disease propagation as a mechanism by which native protein with rich α-helical structure is refolded into a toxic form with high β-sheet structure triggering the misfolding of further native protein in a self-perpetuating process]. It has been shown that protein seeds made from the mutant A30P -syn are able to induce the formation of fibrils of wild type -syn with the same structure that the mutant protein [262]. This process is similar to the conversion of PrPc to PrPsc, the endogenous and misfolded forms of the prion protein encoded by the PRNP gene, respectively. Misfolded proteins are important for the immune response leading to neuroinflammation. This has been recently reviewed by Heneka et al. 2014 [263]. Microglial cells (and other brain cell types) have pattern recognition receptors (PRRs) that can respond to damage-associated or pathogen-associated molecular patterns (DAMPs and PAMPs, respectively); PRRs include the family of Toll-like receptors (TLRs) and correceptors as CD14, CD36 and CD47 among others [264-269]. Microglial responses to misfolded proteins and invading pathogens can be mixed up, since signalling pathways induced by DAMPs and PAMPs overlap downstream. Examples of misfolded or aggregated proteins able to activate these receptors include A, -syn and mutant huntingtin among others [263]. Immune response associated to microglial activation include production and release of pro-inflammatory cytokines such us IL-1for example; active form of IL-1is produced after cleavage of an inactive pro-form by caspase-1, the activation of which is controlled by multi-molecular signalling platforms called inflammosomes [266]. Interestingly, accumulation of misfolded proteins causes inflammasome activation, providing a link between altered proteostasis and inflammation [270]. CONCLUSIONS Taken together, the data discussed in this review suggest that peripheral chronic inflammation that accompanies many fairly common diseases such as gastrointestinal disorders is able to exert influence on the CNS in several ways, modulating glial activity and protein aggregation in the brain, and can therefore 23 be considered a risk factor for developing neurodegenerative diseases, especially PD and AD. Furthermore, these data raise the possibility of using new therapies to improve the course of neurodegenerative diseases, including those aimed directly to fortify the integrity of the intestinal barrier and to modulate the deleterious activity of pro-inflammatory microglia. Using nutraceuticals and functional foods, such as vitamin D and polyphenols, emerges as a promising new therapy. A recent work by He et al. 2014 [271] documents that daily consumption of ibuprofen increases the lifespan of various species. Much work is still needed to determine the mechanisms by which peripheral inflammation affects the CNS, but we believe it is not risky to suggest that understanding and controlling inflammation might be one of the great battlefields of medicine in the forthcoming years. LIST OF ABBREVIATIONS 6-OHDA, 6-hydroxydopamine; A,  amyloid; AD, Alzheimer’s disease; ALCAM, activated leukocyte cell adhesion molecule; APP, amyloid precursor protein; -syn, -synuclein; BBB, blood-brain barrier; CCR2, C-C chemokine receptor 2; CD, Crohn’s disease; CNS, central nervous system; CSF, cerebrospinal fluid; CVD, cardiovascular disease; CX3CL1, chemokine (C-X3-C motif) ligand 1 (fractalkine); CX3CR1, CX3C chemokine receptor 1 (fractalkine receptor); CXCR2, Interleukin 8 receptor, beta (also IL8RB); DAMP, damage-associate molecular pattern; DM, diabetes mellitus; EP4, Prostaglandin E receptor 4; GFP, green fluorescent protein; GWAS, genome-wide association study; IBD, inflammatory bowel disease; ICAM-1, intercellular adhesion molecule 1; IFN, interferon; IKK, inhibitor of nuclear factor kappa-B kinase subunit beta; IL, interleukin; iNOS, inducible nitric oxide synthase; LDL, low density lipoprotein; LPS, lipopolysaccharide; LRRK2, leucine-rich repeat kinase 2; MCAM, melanoma cell adhesion molecule; MCP-1, monocyte chemoattractant protein-1; MHC, major histocompatibility complex; MPTP, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; Myd88, myeloid differentiation primary response gene 88; NFAT1, nuclear factor of activated T-cells 1; NLR, NOD-like receptor; NLRP3; NOD-like receptor family, pyrin domain containing 3; NOX2, NADPH oxidase 2; NSAID, nonsteorideal anti-inflammatory drug; PAMP, pathogen-associated molecular pattern; PD, Parkinson’s disease; PRR, pattern recognition receptor; PS1, presenilin 1; RA, rheumatoid arthritis; SN, substantia nigra; T2DM, type 2 Diabetes mellitus; TH, tyrosine hydroxylase; TLR, Toll-like receptor; TNF, tumour necrosis factor; UC, ulcerative collitis. 24 FIGURE LEGEND Schematic diagram of the main concepts discussed in the review. (A) Acute inflammatory processes initiate as defense and repairing mechanism and finish upon elimination of pathogens and completion of their tasks. For reasons not fully understood, acute inflammation becomes an endlessly self-sustained process leading to tissue damage. (B) In the CNS, a number of neurodegenerative pathologies share common features as the accumulation of misfolded/damaged (oxidized) proteins into aggregates and the activation of glial cells. Protein aggregates (extraneuronal amyloid plaques and intraneuronal Lewy bodies mainly consisting of A and -syn, respectively) may induce neuronal damage and death, which in turn activates glial cells in a self-sustained process in which ROS and pro-inflammatory have an important role. Hyperphosphorylated tau protein also plays a role in protein aggregation and synaptic dysfunction (not shown). As part of its repairing role, glial cells try to eliminate non-functional proteins using different clearance mechanisms but are overwhelmed by the amount of damaged proteins to be removed. Pro-inflammatory cytokines released by glial cells contribute to the toxic environment observed in many brain pathologies. Outside the CNS, chronic inflammatory processes linked to several disorders (IBD, RA, AE…) contribute to the CNS pathologies through a weakened BBB that let circulating leukocytes and pro-inflammatory cytokines to reach the brain parenchyma. In addition, proteins in the enteric nervous system as -syn outflank the BBB reaching the brain through the vagus nerve. Once inside the brain, aggregation seeds of -syn spread by a prion-like mechanism (Braak’s hypothesis). A, amyloid ; AD, Alzheimer’s disease; AE, arteriosclerosis; BBB, blood-brain barrier; CNS, central nervous system; Cytk, pro-inflammatory cytokines; IBD, inflammatory bowel disease; PD, Parkinson’s disease; RA, rheumatoid arthritis; ROS, radical oxygen species. CONFLICT OF INTEREST The authors declare that they have no conflict of interest. ACKNOWLEDGEMENTS This work was supported by grants of Junta de Andalucía P10-CTS-6494 and Ministerio de Economía y Competitividad SAF2012-39029. 25 REFERENCES 1. Daulatzai, M. A. Non-Celiac Gluten Sensitivity Triggers Gut Dysbiosis, Neuroinflammation, Gut- Brain Axis Dysfunction, and Vulnerability for Dementia. CNS Neurol. Disord. Drug Targets 2015. 2. Daulatzai, M. A. Role of stress, depression, and aging in cognitive decline and Alzheimer's disease. Curr. Top. Behav. Neurosci. 2014, 18, 265-296. 3. Daulatzai, M. A. Chronic functional bowel syndrome enhances gut-brain axis dysfunction, neuroinflammation, cognitive impairment, and vulnerability to dementia. Neurochem. Res. 2014, 39, 624-644. 4. Daulatzai, M. A. Pathogenesis of cognitive dysfunction in patients with obstructive sleep apnea: a hypothesis with emphasis on the nucleus tractus solitarius. Sleep Disord. 2012, 2012, 251096. 5. Daulatzai, M. A. Neurotoxic saboteurs: straws that break the hippo's (hippocampus) back drive cognitive impairment and Alzheimer's Disease. Neurotox Res. 2013, 24, 407-459. 6. Spielman, L. J.; Little, J. P.; Klegeris, A. Inflammation and insulin/IGF-1 resistance as the possible link between obesity and neurodegeneration. J. Neuroimmunol. 2014, 273, 8-21. 7. Smith, J. A.; Das, A.; Ray, S. K.; Banik, N. L. Role of pro-inflammatory cytokines released from microglia in neurodegenerative diseases. Brain Res. Bull. 2012, 87, 10-20. 8. Soczynska, J. K.; Kennedy, S. H.; Woldeyohannes, H. O.; Liauw, S. S.; Alsuwaidan, M.; Yim, C. Y.; McIntyre, R. S. Mood disorders and obesity: understanding inflammation as a pathophysiological nexus. Neuromolecular Med. 2011, 13, 93-116. 9. Simard, A. R.; Soulet, D.; Gowing, G.; Julien, J. P.; Rivest, S. Bone marrow-derived microglia play a critical role in restricting senile plaque formation in Alzheimer's disease. Neuron 2006, 49, 489-502. 10. Davalos, D.; Grutzendler, J.; Yang, G.; Kim, J. V.; Zuo, Y.; Jung, S.; Littman, D. R.; Dustin, M. L.; Gan, W. B. ATP mediates rapid microglial response to local brain injury in vivo. Nat. Neurosci. 2005, 8, 752-758. 11. Laskin, D. L. Macrophages and inflammatory mediators in chemical toxicity: a battle of forces. Chem. Res. Toxicol. 2009, 22, 1376-1385. 12. Strieter, R. M.; Kasahara, K.; Allen, R.; Showell, H. J.; Standiford, T. J.; Kunkel, S. L. Human neutrophils exhibit disparate chemotactic factor gene expression. Biochem. Biophys. Res. Commun. 1990, 173, 725-730. 13. Bryant, R. E.; DesPrez, R. M.; VanWay, M. H.; Rogers, D. E. Studies on human leukocyte motility. I. Effects of alterations in pH, electrolyte concentration, and phagocytosis on leukocyte migration, adhesiveness, and aggregation. J. Exp. Med. 1966, 124, 483-499. 14. Sahan, M.; Sebe, A.; Acikalin, A.; Akpinar, O.; Koc, F.; Ay, M. O.; Gulen, M.; Topal, M.; Satar, S. Acute-phase reactants and cytokines in ischemic stroke: do they have any relationship with shortterm mortality? Eur. Rev. Med. Pharmacol. Sci. 2013, 17, 2773-2777. 15. Biffl, W. L.; Moore, E. E.; Moore, F. A.; Barnett, C. C.,Jr; Silliman, C. C.; Peterson, V. M. Interleukin-6 stimulates neutrophil production of platelet-activating factor. J. Leukoc. Biol. 1996, 59, 569-574. 26 16. Kopf, M.; Baumann, H.; Freer, G.; Freudenberg, M.; Lamers, M.; Kishimoto, T.; Zinkernagel, R.; Bluethmann, H.; Kohler, G. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 1994, 368, 339-342. 17. Duff, G. W.; Durum, S. K. Fever and immunoregulation: hyperthermia, interleukins 1 and 2, and T- cell proliferation. Yale J. Biol. Med. 1982, 55, 437-442. 18. Spielman, L. J.; Little, J. P.; Klegeris, A. Inflammation and insulin/IGF-1 resistance as the possible link between obesity and neurodegeneration. J. Neuroimmunol. 2014, 273, 8-21. 19. HIRSCH, J. G. Immunity to infectious diseases: review of some concepts of Metchnikoff. Bacteriol. Rev. 1959, 23, 48-60. 20. Rao, X.; Zhong, J.; Sun, Q. The heterogenic properties of monocytes/macrophages and neutrophils in inflammatory response in diabetes. Life Sci. 2014, 116, 59-66. 21. Gordon, S. Alternative activation of macrophages. Nat. Rev. Immunol. 2003, 3, 23-35. 22. Mosser, D. M. The many faces of macrophage activation. J. Leukoc. Biol. 2003, 73, 209-212. 23. Murray, P. J.; Allen, J. E.; Biswas, S. K.; Fisher, E. A.; Gilroy, D. W.; Goerdt, S.; Gordon, S.; Hamilton, J. A.; Ivashkiv, L. B.; Lawrence, T.; Locati, M.; Mantovani, A.; Martinez, F. O.; Mege, J. L.; Mosser, D. M.; Natoli, G.; Saeij, J. P.; Schultze, J. L.; Shirey, K. A.; Sica, A.; Suttles, J.; Udalova, I.; van Ginderachter, J. A.; Vogel, S. N.; Wynn, T. A. Macrophage activation and polarization: nomenclature and experimental guidelines. Immunity 2014, 41, 14-20. 24. Aggarwal, B. B. Nuclear factor-kappaB: the enemy within. Cancer. Cell. 2004, 6, 203-208. 25. Frank-Cannon, T. C.; Alto, L. T.; McAlpine, F. E.; Tansey, M. G. Does neuroinflammation fan the flame in neurodegenerative diseases? Mol. Neurodegener 2009, 4, 47-1326-4-47. 26. Meijer, K.; de Vries, M.; Al-Lahham, S.; Bruinenberg, M.; Weening, D.; Dijkstra, M.; Kloosterhuis, N.; van der Leij, R. J.; van der Want, H.; Kroesen, B. J.; Vonk, R.; Rezaee, F. Human primary adipocytes exhibit immune cell function: adipocytes prime inflammation independent of macrophages. PLoS One 2011, 6, e17154. 27. Bende, R. J.; van Maldegem, F.; van Noesel, C. J. Chronic inflammatory disease, lymphoid tissue neogenesis and extranodal marginal zone B-cell lymphomas. Haematologica 2009, 94, 1109-1123. 28. Naugler, W. E.; Karin, M. The wolf in sheep's clothing: the role of interleukin-6 in immunity, inflammation and cancer. Trends Mol. Med. 2008, 14, 109-119. 29. Vandenbroucke, J. P.; Hazevoet, H. M.; Cats, A. Survival and cause of death in rheumatoid arthritis: a 25-year prospective followup. J. Rheumatol. 1984, 11, 158-161. 30. Zhang, J.; Zhang, Y.; Jin, J.; Li, M.; Xie, K.; Wen, C.; Cheng, R.; Chen, C.; Lu, J. The -1082A/G polymorphism in the Interleukin-10 gene and the risk of rheumatoid arthritis: a meta-analysis. Cytokine 2011, 56, 351-355. 31. Stahl, E. A.; Raychaudhuri, S.; Remmers, E. F.; Xie, G.; Eyre, S.; Thomson, B. P.; Li, Y.; Kurreeman, F. A.; Zhernakova, A.; Hinks, A.; Guiducci, C.; Chen, R.; Alfredsson, L.; Amos, C. I.; Ardlie, K. G.; BIRAC Consortium; Barton, A.; Bowes, J.; Brouwer, E.; Burtt, N. P.; Catanese, J. J.; Coblyn, J.; Coenen, M. J.; Costenbader, K. H.; Criswell, L. A.; Crusius, J. B.; Cui, J.; de Bakker, P. I.; De Jager, P. L.; Ding, B.; Emery, P.; Flynn, E.; Harrison, P.; Hocking, L. J.; Huizinga, T. W.; Kastner, D. L.; Ke, X.; Lee, A. T.; Liu, X.; Martin, P.; Morgan, A. W.; Padyukov, L.; Posthumus, M. D.; Radstake, T. R.; Reid, D. M.; Seielstad, M.; Seldin, M. F.; Shadick, N. A.; Steer, S.; Tak, P. P.; Thomson, W.; van der Helm-van Mil, A. H.; van der Horst-Bruinsma, I. E.; van der Schoot, C. E.; 27 van Riel, P. L.; Weinblatt, M. E.; Wilson, A. G.; Wolbink, G. J.; Wordsworth, B. P.; YEAR Consortium; Wijmenga, C.; Karlson, E. W.; Toes, R. E.; de Vries, N.; Begovich, A. B.; Worthington, J.; Siminovitch, K. A.; Gregersen, P. K.; Klareskog, L.; Plenge, R. M. Genome-wide association study meta-analysis identifies seven new rheumatoid arthritis risk loci. Nat. Genet. 2010, 42, 508-514. 32. Olefsky, J. M.; Glass, C. K. Macrophages, inflammation, and insulin resistance. Annu. Rev. Physiol. 2010, 72, 219-246. 33. Lehrke, M.; Reilly, M. P.; Millington, S. C.; Iqbal, N.; Rader, D. J.; Lazar, M. A. An inflammatory cascade leading to hyperresistinemia in humans. PLoS Med. 2004, 1, e45. 34. Fong, C. H.; Bebien, M.; Didierlaurent, A.; Nebauer, R.; Hussell, T.; Broide, D.; Karin, M.; Lawrence, T. An antiinflammatory role for IKKbeta through the inhibition of "classical" macrophage activation. J. Exp. Med. 2008, 205, 1269-1276. 35. Steinberg, D.; Witztum, J. L. Oxidized low-density lipoprotein and atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2010, 30, 2311-2316. 36. Subramanian, M.; Tabas, I. Dendritic cells in atherosclerosis. Semin. Immunopathol. 2014, 36, 93- 102. 37. Libby, P.; Ridker, P. M.; Hansson, G. K. Progress and challenges in translating the biology of atherosclerosis. Nature 2011, 473, 317-325. 38. Leitinger, N.; Schulman, I. G. Phenotypic polarization of macrophages in atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 1120-1126. 39. Leone, V. A.; Cham, C. M.; Chang, E. B. Diet, gut microbes, and genetics in immune function: can we leverage our current knowledge to achieve better outcomes in inflammatory bowel diseases? Curr. Opin. Immunol. 2014, 31C, 16-23. 40. Montgomery, S. M.; Ekbom, A. Epidemiology of inflammatory bowel disease. Curr. Opin. Gastroenterol. 2002, 18, 416-420. 41. Hisamatsu, T.; Kanai, T.; Mikami, Y.; Yoneno, K.; Matsuoka, K.; Hibi, T. Immune aspects of the pathogenesis of inflammatory bowel disease. Pharmacol. Ther. 2013, 137, 283-297. 42. Baumgart, D. C.; Carding, S. R. Inflammatory bowel disease: cause and immunobiology. Lancet 2007, 369, 1627-1640. 43. Xavier, R. J.; Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature 2007, 448, 427-434. 44. Kucharzik, T.; Maaser, C.; Lugering, A.; Kagnoff, M.; Mayer, L.; Targan, S.; Domschke, W. Recent understanding of IBD pathogenesis: implications for future therapies. Inflamm. Bowel Dis. 2006, 12, 1068-1083. 45. Ahmad, T.; Tamboli, C. P.; Jewell, D.; Colombel, J. F. Clinical relevance of advances in genetics and pharmacogenetics of IBD. Gastroenterology 2004, 126, 1533-1549. 46. Van Assche, G.; Geboes, K.; Rutgeerts, P. Medical therapy for Crohn's disease strictures. Inflamm. Bowel Dis. 2004, 10, 55-60. 47. Longo, W. E.; Virgo, K. S.; Bahadursingh, A. N.; Johnson, F. E. Patterns of disease and surgical treatment among United States veterans more than 50 years of age with ulcerative colitis. Am. J. Surg. 2003, 186, 514-518. 28 48. Cosnes, J.; Cattan, S.; Blain, A.; Beaugerie, L.; Carbonnel, F.; Parc, R.; Gendre, J. P. Long-term evolution of disease behavior of Crohn's disease. Inflamm. Bowel Dis. 2002, 8, 244-250. 49. Lawrance, I. C.; Rogler, G.; Bamias, G.; Breynaert, C.; Florholmen, J.; Pellino, G.; Reif, S.; Speca, S.; Latella, G. Cellular and molecular mediators of intestinal fibrosis. J. Crohns Colitis 2014. 50. Wuwongse, S.; Chang, R. C.; Law, A. C. The putative neurodegenerative links between depression and Alzheimer's disease. Prog. Neurobiol. 2010, 91, 362-375. 51. Wenk, G. L. Neuropathologic changes in Alzheimer's disease. J. Clin. Psychiatry 2003, 64 Suppl 9, 7- 10. 52. Sakono, M.; Zako, T. Amyloid oligomers: formation and toxicity of Abeta oligomers. FEBS J. 2010, 277, 1348-1358. 53. Koffie, R. M.; Hyman, B. T.; Spires-Jones, T. L. Alzheimer's disease: synapses gone cold. Mol. Neurodegener 2011, 6, 63-1326-6-63. 54. Price, K. A.; Varghese, M.; Sowa, A.; Yuk, F.; Brautigam, H.; Ehrlich, M. E.; Dickstein, D. L. Altered synaptic structure in the hippocampus in a mouse model of Alzheimer's disease with soluble amyloid-beta oligomers and no plaque pathology. Mol. Neurodegener 2014, 9, 41-1326-9-41. 55. Jacobsen, J. S.; Wu, C. C.; Redwine, J. M.; Comery, T. A.; Arias, R.; Bowlby, M.; Martone, R.; Morrison, J. H.; Pangalos, M. N.; Reinhart, P. H.; Bloom, F. E. Early-onset behavioral and synaptic deficits in a mouse model of Alzheimer's disease. Proc. Natl. Acad. Sci. U. S. A. 2006, 103, 5161- 5166. 56. Lefterov, I.; Fitz, N. F.; Cronican, A.; Lefterov, P.; Staufenbiel, M.; Koldamova, R. Memory deficits in APP23/Abca1+/- mice correlate with the level of Abeta oligomers. ASN Neuro 2009, 1, 10.1042/AN20090015. 57. Haass, C.; Selkoe, D. J. Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat. Rev. Mol. Cell Biol. 2007, 8, 101-112. 58. Hardy, J.; Selkoe, D. J. The amyloid hypothesis of Alzheimer's disease: progress and problems on the road to therapeutics. Science 2002, 297, 353-356. 59. Ittner, L. M.; Gotz, J. Amyloid-beta and tau--a toxic pas de deux in Alzheimer's disease. Nat. Rev. Neurosci. 2011, 12, 65-72. 60. Gotz, J.; Streffer, J. R.; David, D.; Schild, A.; Hoerndli, F.; Pennanen, L.; Kurosinski, P.; Chen, F. Transgenic animal models of Alzheimer's disease and related disorders: histopathology, behavior and therapy. Mol. Psychiatry 2004, 9, 664-683. 61. Roy, S.; Zhang, B.; Lee, V. M.; Trojanowski, J. Q. Axonal transport defects: a common theme in neurodegenerative diseases. Acta Neuropathol. 2005, 109, 5-13. 62. Trojanowski, J. Q.; Smith, A. B.; Huryn, D.; Lee, V. M. Microtubule-stabilising drugs for therapy of Alzheimer's disease and other neurodegenerative disorders with axonal transport impairments. Expert Opin. Pharmacother. 2005, 6, 683-686. 63. Schenk, D.; Barbour, R.; Dunn, W.; Gordon, G.; Grajeda, H.; Guido, T.; Hu, K.; Huang, J.; Johnson- Wood, K.; Khan, K.; Kholodenko, D.; Lee, M.; Liao, Z.; Lieberburg, I.; Motter, R.; Mutter, L.; Soriano, F.; Shopp, G.; Vasquez, N.; Vandevert, C.; Walker, S.; Wogulis, M.; Yednock, T.; Games, D.; Seubert, P. Immunization with amyloid-beta attenuates Alzheimer-disease-like pathology in the PDAPP mouse. Nature 1999, 400, 173-177. 29 64. Gilman, S.; Koller, M.; Black, R. S.; Jenkins, L.; Griffith, S. G.; Fox, N. C.; Eisner, L.; Kirby, L.; Rovira, M. B.; Forette, F.; Orgogozo, J. M.; AN1792(QS-21)-201 Study Team Clinical effects of Abeta immunization (AN1792) in patients with AD in an interrupted trial. Neurology 2005, 64, 1553-1562. 65. Galimberti, D.; Ghezzi, L.; Scarpini, E. Immunotherapy against amyloid pathology in Alzheimer's disease. J. Neurol. Sci. 2013, 333, 50-54. 66. Spencer, B.; Masliah, E. Immunotherapy for Alzheimer's disease: past, present and future. Front. Aging Neurosci. 2014, 6, 114. 67. Doody, R. S.; Thomas, R. G.; Farlow, M.; Iwatsubo, T.; Vellas, B.; Joffe, S.; Kieburtz, K.; Raman, R.; Sun, X.; Aisen, P. S.; Siemers, E.; Liu-Seifert, H.; Mohs, R.; Alzheimer's Disease Cooperative Study Steering Committee; Solanezumab Study Group Phase 3 trials of solanezumab for mild-to- moderate Alzheimer's disease. N. Engl. J. Med. 2014, 370, 311-321. 68. Salloway, S.; Sperling, R.; Fox, N. C.; Blennow, K.; Klunk, W.; Raskind, M.; Sabbagh, M.; Honig, L. S.; Porsteinsson, A. P.; Ferris, S.; Reichert, M.; Ketter, N.; Nejadnik, B.; Guenzler, V.; Miloslavsky, M.; Wang, D.; Lu, Y.; Lull, J.; Tudor, I. C.; Liu, E.; Grundman, M.; Yuen, E.; Black, R.; Brashear, H. R.; Bapineuzumab 301 and 302 Clinical Trial Investigators Two phase 3 trials of bapineuzumab in mild-to-moderate Alzheimer's disease. N. Engl. J. Med. 2014, 370, 322-333. 69. Yankner, B. A.; Duffy, L. K.; Kirschner, D. A. Neurotrophic and neurotoxic effects of amyloid beta protein: reversal by tachykinin neuropeptides. Science 1990, 250, 279-282. 70. Heneka, M. T.; O'Banion, M. K.; Terwel, D.; Kummer, M. P. Neuroinflammatory processes in Alzheimer's disease. J. Neural Transm. 2010, 117, 919-947. 71. Block, M. L.; Zecca, L.; Hong, J. S. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat. Rev. Neurosci. 2007, 8, 57-69. 72. Glass, C. K.; Saijo, K.; Winner, B.; Marchetto, M. C.; Gage, F. H. Mechanisms underlying inflammation in neurodegeneration. Cell 2010, 140, 918-934. 73. Block, M. L.; Hong, J. S. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Prog. Neurobiol. 2005, 76, 77-98. 74. Frautschy, S. A.; Yang, F.; Irrizarry, M.; Hyman, B.; Saido, T. C.; Hsiao, K.; Cole, G. M. Microglial response to amyloid plaques in APPsw transgenic mice. Am. J. Pathol. 1998, 152, 307-317. 75. Itagaki, S.; McGeer, P. L.; Akiyama, H.; Zhu, S.; Selkoe, D. Relationship of microglia and astrocytes to amyloid deposits of Alzheimer disease. J. Neuroimmunol. 1989, 24, 173-182. 76. Okello, A.; Edison, P.; Archer, H. A.; Turkheimer, F. E.; Kennedy, J.; Bullock, R.; Walker, Z.; Kennedy, A.; Fox, N.; Rossor, M.; Brooks, D. J. Microglial activation and amyloid deposition in mild cognitive impairment: a PET study. Neurology 2009, 72, 56-62. 77. Edison, P.; Archer, H. A.; Gerhard, A.; Hinz, R.; Pavese, N.; Turkheimer, F. E.; Hammers, A.; Tai, Y. F.; Fox, N.; Kennedy, A.; Rossor, M.; Brooks, D. J. Microglia, amyloid, and cognition in Alzheimer's disease: An [11C](R)PK11195-PET and [11C]PIB-PET study. Neurobiol. Dis. 2008, 32, 412-419. 78. Cagnin, A.; Brooks, D. J.; Kennedy, A. M.; Gunn, R. N.; Myers, R.; Turkheimer, F. E.; Jones, T.; Banati, R. B. In-vivo measurement of activated microglia in dementia. Lancet 2001, 358, 461-467. 79. Walker, D. G.; Lue, L. F. Investigations with cultured human microglia on pathogenic mechanisms of Alzheimer's disease and other neurodegenerative diseases. J. Neurosci. Res. 2005, 81, 412-425. 36 166. Laye, S.; Parnet, P.; Goujon, E.; Dantzer, R. Peripheral administration of lipopolysaccharide induces the expression of cytokine transcripts in the brain and pituitary of mice. Brain Res. Mol. Brain Res. 1994, 27, 157-162. 167. Stalder, A. K.; Ermini, F.; Bondolfi, L.; Krenger, W.; Burbach, G. J.; Deller, T.; Coomaraswamy, J.; Staufenbiel, M.; Landmann, R.; Jucker, M. Invasion of hematopoietic cells into the brain of amyloid precursor protein transgenic mice. J. Neurosci. 2005, 25, 11125-11132. 168. Simard, A. R.; Soulet, D.; Gowing, G.; Julien, J. P.; Rivest, S. Bone marrow-derived microglia play a critical role in restricting senile plaque formation in Alzheimer's disease. Neuron 2006, 49, 489- 502. 169. Ferrari, C. C.; Tarelli, R. Parkinson's disease and systemic inflammation. Parkinsons Dis. 2011, 2011, 436813. 170. Machado, A.; Herrera, A. J.; Venero, J. L.; Santiago, M.; De Pablos, R. M.; Villaran, R. F.; Espinosa-Oliva, A. M.; Arguelles, S.; Sarmiento, M.; Delgado-Cortes, M. J.; Maurino, R.; Cano, J. Peripheral inflammation increases the damage in animal models of nigrostriatal dopaminergic neurodegeneration: possible implication in Parkinson's disease incidence. Parkinsons Dis. 2011, 2011, 393769. 171. Pott Godoy, M. C.; Tarelli, R.; Ferrari, C. C.; Sarchi, M. I.; Pitossi, F. J. Central and systemic IL-1 exacerbates neurodegeneration and motor symptoms in a model of Parkinson's disease. Brain 2008, 131, 1880-1894. 172. Villaran, R. F.; Espinosa-Oliva, A. M.; Sarmiento, M.; De Pablos, R. M.; Arguelles, S.; Delgado- Cortes, M. J.; Sobrino, V.; Van Rooijen, N.; Venero, J. L.; Herrera, A. J.; Cano, J.; Machado, A. Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: potential risk factor in Parkinson`s disease. J. Neurochem. 2010, 114, 1687-1700. 173. Block, M. L.; Calderon-Garciduenas, L. Air pollution: mechanisms of neuroinflammation and CNS disease. Trends Neurosci. 2009, 32, 506-516. 174. Qin, L.; Wu, X.; Block, M. L.; Liu, Y.; Breese, G. R.; Hong, J. S.; Knapp, D. J.; Crews, F. T. Systemic LPS causes chronic neuroinflammation and progressive neurodegeneration. Glia 2007, 55, 453-462. 175. Dantzer, R.; O'Connor, J. C.; Freund, G. G.; Johnson, R. W.; Kelley, K. W. From inflammation to sickness and depression: when the immune system subjugates the brain. Nat. Rev. Neurosci. 2008, 9, 46-56. 176. Hernandez-Romero, M. C.; Delgado-Cortes, M. J.; Sarmiento, M.; de Pablos, R. M.; Espinosa-Oliva, A. M.; Arguelles, S.; Bandez, M. J.; Villaran, R. F.; Maurino, R.; Santiago, M.; Venero, J. L.; Herrera, A. J.; Cano, J.; Machado, A. Peripheral inflammation increases the deleterious effect of CNS inflammation on the nigrostriatal dopaminergic system. Neurotoxicology 2012, 33, 347-360. 177. Jang, H.; Boltz, D.; Sturm-Ramirez, K.; Shepherd, K. R.; Jiao, Y.; Webster, R.; Smeyne, R. J. Highly pathogenic H5N1 influenza virus can enter the central nervous system and induce neuroinflammation and neurodegeneration. Proc. Natl. Acad. Sci. U. S. A. 2009, 106, 14063-14068. 178. Shoji, H.; Watanabe, M.; Itoh, S.; Kuwahara, H.; Hattori, F. Japanese encephalitis and parkinsonism. J. Neurol. 1993, 240, 59-60. 179. Dale, R. C.; Church, A. J.; Surtees, R. A.; Lees, A. J.; Adcock, J. E.; Harding, B.; Neville, B. G.; Giovannoni, G. Encephalitis lethargica syndrome: 20 new cases and evidence of basal ganglia autoimmunity. Brain 2004, 127, 21-33. 37 180. Shu, X.; Wang, G.; Lu, X.; Xie, Y. Rheumatoid-like deformities in Parkinson's disease with 1-year follow-up: case report and literature review. Rheumatol. Int. 2010, 30, 1493-1497. 181. Ertan, S.; Fresko, I.; Apaydin, H.; Ozekmekci, S.; Yazici, H. Extrapyramidal type rigidity in rheumatoid arthritis. Rheumatology (Oxford) 1999, 38, 627-630. 182. Biessels, G. J.; Staekenborg, S.; Brunner, E.; Brayne, C.; Scheltens, P. Risk of dementia in diabetes mellitus: a systematic review. Lancet Neurol. 2006, 5, 64-74. 183. Kloppenborg, R. P.; van den Berg, E.; Kappelle, L. J.; Biessels, G. J. Diabetes and other vascular risk factors for dementia: which factor matters most? A systematic review. Eur. J. Pharmacol. 2008, 585, 97-108. 184. Kopf, D.; Frolich, L. Risk of incident Alzheimer's disease in diabetic patients: a systematic review of prospective trials. J. Alzheimers Dis. 2009, 16, 677-685. 185. Xu, W. L.; Qiu, C. X.; Wahlin, A.; Winblad, B.; Fratiglioni, L. Diabetes mellitus and risk of dementia in the Kungsholmen project: a 6-year follow-up study. Neurology 2004, 63, 1181-1186. 186. Jabir, N. R.; Firoz, C. K.; Baeesa, S. S.; Ashraf, G. M.; Akhtar, S.; Kamal, W.; Kamal, M. A.; Tabrez, S. Synopsis on the linkage of Alzheimer's and Parkinson's disease with chronic diseases. CNS Neurosci. Ther. 2015, 21, 1-7. 187. Santiago, J. A.; Potashkin, J. A. System-based approaches to decode the molecular links in Parkinson's disease and diabetes. Neurobiol. Dis. 2014, 72 Pt A, 84-91. 188. Palacios, N.; Gao, X.; McCullough, M. L.; Jacobs, E. J.; Patel, A. V.; Mayo, T.; Schwarzschild, M. A.; Ascherio, A. Obesity, diabetes, and risk of Parkinson's disease. Mov. Disord. 2011, 26, 2253- 2259. 189. Savica, R.; Grossardt, B. R.; Ahlskog, J. E.; Rocca, W. A. Metabolic markers or conditions preceding Parkinson's disease: a case-control study. Mov. Disord. 2012, 27, 974-979. 190. Santiago, J. A.; Potashkin, J. A. Shared dysregulated pathways lead to Parkinson's disease and diabetes. Trends Mol. Med. 2013, 19, 176-186. 191. Hu, G.; Jousilahti, P.; Bidel, S.; Antikainen, R.; Tuomilehto, J. Type 2 diabetes and the risk of Parkinson's disease. Diabetes Care 2007, 30, 842-847. 192. Xu, Q.; Park, Y.; Huang, X.; Hollenbeck, A.; Blair, A.; Schatzkin, A.; Chen, H. Diabetes and risk of Parkinson's disease. Diabetes Care 2011, 34, 910-915. 193. Strand, B. H.; Langballe, E. M.; Hjellvik, V.; Handal, M.; Naess, O.; Knudsen, G. P.; Refsum, H.; Tambs, K.; Nafstad, P.; Schirmer, H.; Bergem, A. L.; Selmer, R.; Engedal, K.; Magnus, P.; Bjertness, E.; GENIDEM-Group Midlife vascular risk factors and their association with dementia deaths: results from a Norwegian prospective study followed up for 35 years. J. Neurol. Sci. 2013, 324, 124-130. 194. Alonso, A.; Jacobs, D. R.,Jr; Menotti, A.; Nissinen, A.; Dontas, A.; Kafatos, A.; Kromhout, D. Cardiovascular risk factors and dementia mortality: 40 years of follow-up in the Seven Countries Study. J. Neurol. Sci. 2009, 280, 79-83. 195. Newman, A. B.; Fitzpatrick, A. L.; Lopez, O.; Jackson, S.; Lyketsos, C.; Jagust, W.; Ives, D.; Dekosky, S. T.; Kuller, L. H. Dementia and Alzheimer's disease incidence in relationship to cardiovascular disease in the Cardiovascular Health Study cohort. J. Am. Geriatr. Soc. 2005, 53, 1101-1107. 38 196. Jabir, N. R.; Kamal, M. A.; Abuzenadah, A. M.; Gan, S. H.; Alama, M. N.; Baeesa, S. S.; Tabrez, S. Alzheimer's and type 2 diabetes treatment via common enzyme targeting. CNS Neurol. Disord. Drug Targets 2014, 13, 299-304. 197. Humpel, C. Chronic mild cerebrovascular dysfunction as a cause for Alzheimer's disease? Exp. Gerontol. 2011, 46, 225-232. 198. STRANG, R. R. The Association of Gastro-Duodenal Ulceration and Parkinson's Disease. Med. J. Aust. 1965, 1, 842-843. 199. Weller, C.; Oxlade, N.; Dobbs, S. M.; Dobbs, R. J.; Charlett, A.; Bjarnason, I. T. Role of inflammation in gastrointestinal tract in aetiology and pathogenesis of idiopathic parkinsonism. FEMS Immunol. Med. Microbiol. 2005, 44, 129-135. 200. Megraud, F. Epidemiology of Helicobacter pylori infection. Gastroenterol. Clin. North Am. 1993, 22, 73-88. 201. M. Johnson, K. Lithgo, T. Price Is there an association between inflammatory bowel disease and Parkinson's disease? 2014.62:A169. 202. Bihari, K.; Lees, A. J. Cigarette smoking, Parkinson's disease and ulcerative colitis. J. Neurol. Neurosurg. Psychiatry. 1987, 50, 635. 203. Mayer, E. A. Gut feelings: the emerging biology of gut-brain communication. Nat. Rev. Neurosci. 2011, 12, 453-466. 204. Devos, D.; Lebouvier, T.; Lardeux, B.; Biraud, M.; Rouaud, T.; Pouclet, H.; Coron, E.; Bruley des Varannes, S.; Naveilhan, P.; Nguyen, J. M.; Neunlist, M.; Derkinderen, P. Colonic inflammation in Parkinson's disease. Neurobiol. Dis. 2013, 50, 42-48. 205. Braak, H.; Rub, U.; Gai, W. P.; Del Tredici, K. Idiopathic Parkinson's disease: possible routes by which vulnerable neuronal types may be subject to neuroinvasion by an unknown pathogen. J. Neural Transm. 2003, 110, 517-536. 206. Barrett, J. C.; Hansoul, S.; Nicolae, D. L.; Cho, J. H.; Duerr, R. H.; Rioux, J. D.; Brant, S. R.; Silverberg, M. S.; Taylor, K. D.; Barmada, M. M.; Bitton, A.; Dassopoulos, T.; Datta, L. W.; Green, T.; Griffiths, A. M.; Kistner, E. O.; Murtha, M. T.; Regueiro, M. D.; Rotter, J. I.; Schumm, L. P.; Steinhart, A. H.; Targan, S. R.; Xavier, R. J.; NIDDK IBD Genetics Consortium; Libioulle, C.; Sandor, C.; Lathrop, M.; Belaiche, J.; Dewit, O.; Gut, I.; Heath, S.; Laukens, D.; Mni, M.; Rutgeerts, P.; Van Gossum, A.; Zelenika, D.; Franchimont, D.; Hugot, J. P.; de Vos, M.; Vermeire, S.; Louis, E.; Belgian-French IBD Consortium; Wellcome Trust Case Control Consortium; Cardon, L. R.; Anderson, C. A.; Drummond, H.; Nimmo, E.; Ahmad, T.; Prescott, N. J.; Onnie, C. M.; Fisher, S. A.; Marchini, J.; Ghori, J.; Bumpstead, S.; Gwilliam, R.; Tremelling, M.; Deloukas, P.; Mansfield, J.; Jewell, D.; Satsangi, J.; Mathew, C. G.; Parkes, M.; Georges, M.; Daly, M. J. Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. Nat. Genet. 2008, 40, 955-962. 207. Kitada, T.; Asakawa, S.; Hattori, N.; Matsumine, H.; Yamamura, Y.; Minoshima, S.; Yokochi, M.; Mizuno, Y.; Shimizu, N. Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 1998, 392, 605-608. 208. Frank-Cannon, T. C.; Tran, T.; Ruhn, K. A.; Martinez, T. N.; Hong, J.; Marvin, M.; Hartley, M.; Trevino, I.; O'Brien, D. E.; Casey, B.; Goldberg, M. S.; Tansey, M. G. Parkin deficiency increases vulnerability to inflammation-related nigral degeneration. J. Neurosci. 2008, 28, 10825-10834. 209. Minghetti, L. Role of inflammation in neurodegenerative diseases. Curr. Opin. Neurol. 2005, 18, 315-321. 39 210. Teeling, J. L.; Cunningham, C.; Newman, T. A.; Perry, V. H. The effect of non-steroidal antiinflammatory agents on behavioural changes and cytokine production following systemic inflammation: Implications for a role of COX-1. Brain Behav. Immun. 2010, 24, 409-419. 211. Qin, L.; He, J.; Hanes, R. N.; Pluzarev, O.; Hong, J. S.; Crews, F. T. Increased systemic and brain cytokine production and neuroinflammation by endotoxin following ethanol treatment. J. Neuroinflammation 2008, 5, 10-2094-5-10. 212. Borges, S.; Gayer-Anderson, C.; Mondelli, V. A systematic review of the activity of the hypothalamic-pituitary-adrenal axis in first episode psychosis. Psychoneuroendocrinology 2013, 38, 603-611. 213. Kessing, L. V.; Willer, I. S.; Knorr, U. Volume of the adrenal and pituitary glands in depression. Psychoneuroendocrinology 2011, 36, 19-27. 214. Kalsbeek, A.; van der Spek, R.; Lei, J.; Endert, E.; Buijs, R. M.; Fliers, E. Circadian rhythms in the hypothalamo-pituitary-adrenal (HPA) axis. Mol. Cell. Endocrinol. 2012, 349, 20-29. 215. Licinio, J.; Frost, P. The neuroimmune-endocrine axis: pathophysiological implications for the central nervous system cytokines and hypothalamus-pituitary-adrenal hormone dynamics. Braz. J. Med. Biol. Res. 2000, 33, 1141-1148. 216. Seifert, G.; Schilling, K.; Steinhauser, C. Astrocyte dysfunction in neurological disorders: a molecular perspective. Nat. Rev. Neurosci. 2006, 7, 194-206. 217. Springer, T. A. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell 1994, 76, 301-314. 218. Kim, M.; Carman, C. V.; Springer, T. A. Bidirectional transmembrane signaling by cytoplasmic domain separation in integrins. Science 2003, 301, 1720-1725. 219. Morita, S.; Miyata, S. Different vascular permeability between the sensory and secretory circumventricular organs of adult mouse brain. Cell Tissue Res. 2012, 349, 589-603. 220. Wertheimer, S. J.; Myers, C. L.; Wallace, R. W.; Parks, T. P. Intercellular adhesion molecule-1 gene expression in human endothelial cells. Differential regulation by tumor necrosis factor-alpha and phorbol myristate acetate. J. Biol. Chem. 1992, 267, 12030-12035. 221. Proescholdt, M. G.; Chakravarty, S.; Foster, J. A.; Foti, S. B.; Briley, E. M.; Herkenham, M. Intracerebroventricular but not intravenous interleukin-1beta induces widespread vascular-mediated leukocyte infiltration and immune signal mRNA expression followed by brain-wide glial activation. Neuroscience 2002, 112, 731-749. 222. Corti, R.; Hutter, R.; Badimon, J. J.; Fuster, V. Evolving concepts in the triad of atherosclerosis, inflammation and thrombosis. J. Thromb. Thrombolysis 2004, 17, 35-44. 223. Villaran, R. F.; Espinosa-Oliva, A. M.; Sarmiento, M.; De Pablos, R. M.; Arguelles, S.; Delgado- Cortes, M. J.; Sobrino, V.; Van Rooijen, N.; Venero, J. L.; Herrera, A. J.; Cano, J.; Machado, A. Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: potential risk factor in Parkinson`s disease. J. Neurochem. 2010, 114, 1687-1700. 224. Alvarez, J. I.; Cayrol, R.; Prat, A. Disruption of central nervous system barriers in multiple sclerosis. Biochim. Biophys. Acta 2011, 1812, 252-264. 225. Lv, S.; Song, H. L.; Zhou, Y.; Li, L. X.; Cui, W.; Wang, W.; Liu, P. Tumour necrosis factor-alpha affects blood-brain barrier permeability and tight junction-associated occludin in acute liver failure. Liver Int. 2010, 30, 1198-1210. 40 226. Wong, D.; Prameya, R.; Dorovini-Zis, K. Adhesion and migration of polymorphonuclear leukocytes across human brain microvessel endothelial cells are differentially regulated by endothelial cell adhesion molecules and modulate monolayer permeability. J. Neuroimmunol. 2007, 184, 136-148. 227. Wosik, K.; Biernacki, K.; Khouzam, M. P.; Prat, A. Death receptor expression and function at the human blood brain barrier. J. Neurol. Sci. 2007, 259, 53-60. 228. Cayrol, R.; Wosik, K.; Berard, J. L.; Dodelet-Devillers, A.; Ifergan, I.; Kebir, H.; Haqqani, A. S.; Kreymborg, K.; Krug, S.; Moumdjian, R.; Bouthillier, A.; Becher, B.; Arbour, N.; David, S.; Stanimirovic, D.; Prat, A. Activated leukocyte cell adhesion molecule promotes leukocyte trafficking into the central nervous system. Nat. Immunol. 2008, 9, 137-145. 229. Larochelle C, Cayrol R, Kebir H et al MCAM/CD146 defines and regulates the function of a population of human effector memory Th17 lymphocytes subset involved in neuroinflammation. Clin. Immunol. 2010, S122, 135. 230. Furness JB The Enteric Nervous System; Blackwell: Oxford, 2006; . 231. Gershom MD The Second Brain; Harper Collins: New York, 1998; . 232. Berthoud, H. R.; Neuhuber, W. L. Functional and chemical anatomy of the afferent vagal system. Auton. Neurosci. 2000, 85, 1-17. 233. Collins, S. M.; Surette, M.; Bercik, P. The interplay between the intestinal microbiota and the brain. Nat. Rev. Microbiol. 2012, 10, 735-742. 234. Diano, S.; Farr, S. A.; Benoit, S. C.; McNay, E. C.; da Silva, I.; Horvath, B.; Gaskin, F. S.; Nonaka, N.; Jaeger, L. B.; Banks, W. A.; Morley, J. E.; Pinto, S.; Sherwin, R. S.; Xu, L.; Yamada, K. A.; Sleeman, M. W.; Tschop, M. H.; Horvath, T. L. Ghrelin controls hippocampal spine synapse density and memory performance. Nat. Neurosci. 2006, 9, 381-388. 235. Berthoud, H. R. Vagal and hormonal gut-brain communication: from satiation to satisfaction. Neurogastroenterol. Motil. 2008, 20 Suppl 1, 64-72. 236. Bercik, P.; Denou, E.; Collins, J.; Jackson, W.; Lu, J.; Jury, J.; Deng, Y.; Blennerhassett, P.; Macri, J.; McCoy, K. D.; Verdu, E. F.; Collins, S. M. The intestinal microbiota affect central levels of brain-derived neurotropic factor and behavior in mice. Gastroenterology 2011, 141, 599-609, 609.e1-3. 237. Schiano, T. D. Treatment options for hepatic encephalopathy. Pharmacotherapy 2010, 30, 16S-21S. 238. Abouesh, A.; Stone, C.; Hobbs, W. R. Antimicrobial-induced mania (antibiomania): a review of spontaneous reports. J. Clin. Psychopharmacol. 2002, 22, 71-81. 239. Spillantini, M. G.; Schmidt, M. L.; Lee, V. M.; Trojanowski, J. Q.; Jakes, R.; Goedert, M. Alphasynuclein in Lewy bodies. Nature 1997, 388, 839-840. 240. Bove, J.; Prou, D.; Perier, C.; Przedborski, S. Toxin-induced models of Parkinson's disease. NeuroRx 2005, 2, 484-494. 241. Shannon, K. M.; Keshavarzian, A.; Mutlu, E.; Dodiya, H. B.; Daian, D.; Jaglin, J. A.; Kordower, J. H. Alpha-synuclein in colonic submucosa in early untreated Parkinson's disease. Mov. Disord. 2012, 27, 709-715. 242. Beach, T. G.; Adler, C. H.; Sue, L. I.; Vedders, L.; Lue, L.; White Iii, C. L.; Akiyama, H.; Caviness, J. N.; Shill, H. A.; Sabbagh, M. N.; Walker, D. G.; Arizona Parkinson's Disease Consortium Multi- 41 organ distribution of phosphorylated alpha-synuclein histopathology in subjects with Lewy body disorders. Acta Neuropathol. 2010, 119, 689-702. 243. Braak, H.; de Vos, R. A.; Bohl, J.; Del Tredici, K. Gastric alpha-synuclein immunoreactive inclusions in Meissner's and Auerbach's plexuses in cases staged for Parkinson's disease-related brain pathology. Neurosci. Lett. 2006, 396, 67-72. 244. Wakabayashi, K.; Takahashi, H. Neuropathology of autonomic nervous system in Parkinson's disease. Eur. Neurol. 1997, 38 Suppl 2, 2-7. 245. Takeda, S.; Yamazaki, K.; Miyakawa, T.; Arai, H. Parkinson's disease with involvement of the parasympathetic ganglia. Acta Neuropathol. 1993, 86, 397-398. 246. Wakabayashi, K.; Takahashi, H.; Takeda, S.; Ohama, E.; Ikuta, F. Parkinson's disease: the presence of Lewy bodies in Auerbach's and Meissner's plexuses. Acta Neuropathol. 1988, 76, 217-221. 247. Wakabayashi, K.; Takahashi, H.; Ohama, E.; Ikuta, F. Parkinson's disease: an immunohistochemical study of Lewy body-containing neurons in the enteric nervous system. Acta Neuropathol. 1990, 79, 581-583. 248. Shannon, K. M.; Keshavarzian, A.; Dodiya, H. B.; Jakate, S.; Kordower, J. H. Is alpha-synuclein in the colon a biomarker for premotor Parkinson's disease? Evidence from 3 cases. Mov. Disord. 2012, 27, 716-719. 249. Qualman, S. J.; Haupt, H. M.; Yang, P.; Hamilton, S. R. Esophageal Lewy bodies associated with ganglion cell loss in achalasia. Similarity to Parkinson's disease. Gastroenterology 1984, 87, 848- 856. 250. Gray, M. T.; Gray, D. A.; Woulfe, J. M. Reply to: alimentary, my dear Watson? The challenges of enteric alpha-synuclein as a Parkinson's disease biomarker. Mov. Disord. 2014, 29, 1224-1225. 251. Visanji, N. P.; Marras, C.; Hazrati, L. N.; Liu, L. W.; Lang, A. E. Alimentary, my dear Watson? The challenges of enteric alpha-synuclein as a Parkinson's disease biomarker. Mov. Disord. 2014, 29, 444-450. 252. Kelly, L. P.; Carvey, P. M.; Keshavarzian, A.; Shannon, K. M.; Shaikh, M.; Bakay, R. A.; Kordower, J. H. Progression of intestinal permeability changes and alpha-synuclein expression in a mouse model of Parkinson's disease. Mov. Disord. 2014, 29, 999-1009. 253. Bjarnason, I.; MacPherson, A.; Hollander, D. Intestinal permeability: an overview. Gastroenterology 1995, 108, 1566-1581. 254. Keita, A. V.; Soderholm, J. D. The intestinal barrier and its regulation by neuroimmune factors. Neurogastroenterol. Motil. 2010, 22, 718-733. 255. Couch, Y.; Alvarez-Erviti, L.; Sibson, N. R.; Wood, M. J.; Anthony, D. C. The acute inflammatory response to intranigral alpha-synuclein differs significantly from intranigral lipopolysaccharide and is exacerbated by peripheral inflammation. J. Neuroinflammation 2011, 8, 166-2094-8-166. 256. Braak, H.; Del Tredici, K.; Rub, U.; de Vos, R. A.; Jansen Steur, E. N.; Braak, E. Staging of brain pathology related to sporadic Parkinson's disease. Neurobiol. Aging 2003, 24, 197-211. 257. Visanji, N. P.; Brooks, P. L.; Hazrati, L. N.; Lang, A. E. The prion hypothesis in Parkinson's disease: Braak to the future. Acta Neuropathol. Commun. 2013, 1, 2-5960-1-2. 258. Aguzzi, A.; Rajendran, L. The transcellular spread of cytosolic amyloids, prions, and prionoids. Neuron 2009, 64, 783-790. 42 259. Brundin, P.; Melki, R.; Kopito, R. Prion-like transmission of protein aggregates in neurodegenerative diseases. Nat. Rev. Mol. Cell Biol. 2010, 11, 301-307. 260. Polymenidou, M.; Cleveland, D. W. The seeds of neurodegeneration: prion-like spreading in ALS. Cell 2011, 147, 498-508. 261. Guo, J. L.; Lee, V. M. Cell-to-cell transmission of pathogenic proteins in neurodegenerative diseases. Nat. Med. 2014, 20, 130-138. 262. Yonetani, M.; Nonaka, T.; Masuda, M.; Inukai, Y.; Oikawa, T.; Hisanaga, S.; Hasegawa, M. Conversion of wild-type alpha-synuclein into mutant-type fibrils and its propagation in the presence of A30P mutant. J. Biol. Chem. 2009, 284, 7940-7950. 263. Heneka, M. T.; Kummer, M. P.; Latz, E. Innate immune activation in neurodegenerative disease. Nat. Rev. Immunol. 2014, 14, 463-477. 264. Fellner, L.; Irschick, R.; Schanda, K.; Reindl, M.; Klimaschewski, L.; Poewe, W.; Wenning, G. K.; Stefanova, N. Toll-like receptor 4 is required for alpha-synuclein dependent activation of microglia and astroglia. Glia 2013, 61, 349-360. 265. Jin, J. J.; Kim, H. D.; Maxwell, J. A.; Li, L.; Fukuchi, K. Toll-like receptor 4-dependent upregulation of cytokines in a transgenic mouse model of Alzheimer's disease. J. Neuroinflammation 2008, 5, 23- 2094-5-23. 266. Latz, E.; Xiao, T. S.; Stutz, A. Activation and regulation of the inflammasomes. Nat. Rev. Immunol. 2013, 13, 397-411. 267. Stewart, C. R.; Stuart, L. M.; Wilkinson, K.; van Gils, J. M.; Deng, J.; Halle, A.; Rayner, K. J.; Boyer, L.; Zhong, R.; Frazier, W. A.; Lacy-Hulbert, A.; El Khoury, J.; Golenbock, D. T.; Moore, K. J. CD36 ligands promote sterile inflammation through assembly of a Toll-like receptor 4 and 6 heterodimer. Nat. Immunol. 2010, 11, 155-161. 268. Strowig, T.; Henao-Mejia, J.; Elinav, E.; Flavell, R. Inflammasomes in health and disease. Nature 2012, 481, 278-286. 269. Udan, M. L.; Ajit, D.; Crouse, N. R.; Nichols, M. R. Toll-like receptors 2 and 4 mediate Abeta(1-42) activation of the innate immune response in a human monocytic cell line. J. Neurochem. 2008, 104, 524-533. 270. Shin, J. N.; Fattah, E. A.; Bhattacharya, A.; Ko, S.; Eissa, N. T. Inflammasome activation by altered proteostasis. J. Biol. Chem. 2013, 288, 35886-35895. 271. He, C.; Tsuchiyama, S. K.; Nguyen, Q. T.; Plyusnina, E. N.; Terrill, S. R.; Sahibzada, S.; Patel, B.; Faulkner, A. R.; Shaposhnikov, M. V.; Tian, R.; Tsuchiya, M.; Kaeberlein, M.; Moskalev, A. A.; Kennedy, B. K.; Polymenis, M. Enhanced longevity by ibuprofen, conserved in multiple species, occurs in yeast through inhibition of tryptophan import. PLoS Genet. 2014, 10, e1004860. 1 APPENDIX II: CASPASA 8, UNA HERRAMIENTA TERAPÉUTICA POTENCIAL EN EL TRATAMIENTO DEL SHOCK SÉPTICO (TRABAJO GANADOR DEL PREMIO AVENZOAR 2015) 2 1. EL SHOCK SÉPTICO: UNA BREVE INTRODUCCIÓN Una tarde de 1924, el hijo del presidente de Estados Unidos, Calvin Coolidge, estaba jugando al tenis en el jardín de su casa. Al terminar, Calvin Coolidge Junior, de quince años, observó que la fricción de sus zapatos le había producido una herida en el pie. Días después, caía enfermo víctima de una septicemia, tras la cual, fallecía en plena campaña electoral de su padre. En una sola frase, el shock séptico es el estadío final de una enfermedad infecciosa en la sangre, también conocida como septicemia o sepsis. Es el motivo por el que una apendicitis no operada a tiempo resulta mortal. Independientemente de su causa original, el shock séptico ha sesgado la vida de millones de personas, algunas de ellas personajes mundialmente conocidos, como Jin Henson, creador de los teleñecos. Desde tiempos inmemoriales, la septicemia ha constituido la primera causa de mortalidad en el mundo hasta que la mañana del 28 de septiembre de 1928, un científico llamado Alexander Fleming observó que cierta sustancia producida por el hongo Penicillium era capaz de evitar el crecimiento bacteriano. Años después, en 1939, Florey y Chain consiguieron aislar y purificar dicha sustancia, que permitió la salvación de millones de vidas durante la Segunda Guerra Mundial (Fig.1.). Hablamos de la tan conocida penicilina. El descubrimiento de la penicilina dio lugar a la llamada era de los antibióticos. Desde entonces, la mortalidad causada por septicemia se redujo a niveles históricos. Se redujo la mortalidad asociada al parto y a operaciones quirúrgicas, la tuberculosis y el tifus pasaron a ser enfermedades curables, la esperanza de vida se duplicó, y durante cierto tiempo, la humanidad pensó que había ganado la batalla a las enfermedades infecciosas. Pero desgraciadamente no ha sido así. A pesar del continuo descubrimiento y desarrollo de antibióticos, la sepsis grave o septicemia sigue representando la principal causa de muerte a nivel mundial, con 50.000 casos anuales en España y 18 millones a nivel mundial [2] [3]. Dado que en su estadío final, el shock séptico, no existe tratamiento, la mortalidad asciende a un 80%, cifras similares al ébola, lo que hace que cada día fallezcan por sepsis 1.400 personas en todo el mundo. Estos porcentajes superan a los de enfermedades de gran impacto social, como el SIDA o el cáncer de mama [3]. Además, debido al aumento de la resistencia a los antibióticos, las cifras de incidencia y mortalidad por sepsis siguen creciendo. La tuberculosis vuelve a representar una amenaza, y las bacterias hospitalarias multirresistentes, como el SARM (Staphilococcus Aureus Resistente a Meticilina) son responsables de muertes en pacientes ingresados por otras afecciones. El Registro Nacional de Emergencias Civiles del Gobierno británico ha llamado a la acción en un informe en el que estipula que un brote epidémico resistente a antibióticos podría afectar a más de 200.000 personas, causando la muerte a más de 80.000. Sin un tratamiento eficaz, cirugías ambulatorias o simples afecciones de Fig.1. Johnny Cox fue el primer paciente tratado con penicilina que sobrevivió a la septicemia. Sin embargo, aunque la infección había sido erradicada de su cuerpo, falleció poco después debido a un coágulo sanguíneo causado por los efectos de la enfermedad sobre su sistema inmune. 3 garganta pasarían a ser catalogadas de alto riesgo. No sólo las cifras de mortalidad son preocupantes. Los costes anuales de la sepsis en España oscilan en torno a los 500 millones de euros [2]. Para poder seguir manteniendo el acceso universal a nuestros sistemas sanitarios, la búsqueda de alternativas terapéuticas para el shock séptico representa una prioridad. El shock séptico no está causado por las bacterias en sí, sino que es un estado inflamatorio generalizado como consecuencia de una respuesta exagerada del sistema inmune. Cuando las células del sistema inmunitario detectan la presencia de bacterias en el torrente sanguíneo, liberan una cascada de moléculas pro y anti-inflamatorias llamadas citoquinas, que dan lugar a depósitos de fibrina, coagulopatías y liberación de radicales libres, lo cual lleva a una ruptura de los vasos sanguíneos con hemorragias, shock hipovolémico y muerte por fallo multiorgánico [4]. Este conjunto de síntomas recibe el nombre de SRIS (Síndrome de Respuesta Inflamatoria Sistémica), y una vez se desata, se sucede en cuestión de horas. Sin embargo, el SRIS también puede desencadenarse en situaciones de origen no bacteriano [5,6]. Politraumatismos, como los ocurridos en accidentes de coche, y quemaduras de alto grado desencadenan el mismo síndrome mortal en el organismo, sin que exista una causa inicial tratable, como es el caso de las infecciones bacterianas. Incluso ciertas enfermedades emergentes, como es el caso del ébola, cursan con una respuesta inflamatoria similar al SRIS, que en ocasiones compromete aún más la vida del paciente e impide el tratamiento. A fecha de hoy, aún no existe ningún tratamiento aprobado para el SRIS[7,8]. 2. EL SISTEMA INMUNITARIO Para comprender la patogénesis del SRIS, primero es necesario comprender el funcionamiento del Sistema Inmunitario. El cuerpo humano está permanentemente bajo amenazas externas e internas. Para prevenir el desarrollo de enfermedades, patógenos y células tumorales necesitan ser reconocidos y eliminados. El Sistema Inmunitario es, por tanto, un complejo despliegue de mecanismos defensivos que protegen al organismo de potenciales amenazas en su entorno [9]. Para la eliminación eficaz del patógeno, el Sistema Inmunitario necesita completar cuatro etapas diferentes. La primera es el reconocimiento del patógeno, la cual es llevada a cabo por los componentes de los sistemas inmunitarios innato y adquirido. Una vez que el microorganismo, toxina o célula tumoral han sido identificados, los efectores del Sistema Inmunitario ponen en marcha una variedad de herramientas que pueden ser inespecíficas, como la liberación de citoquinas por los monocitos, o específicas, como la producción de anticuerpos llevada a cabo por los linfocitos. En última instancia, estas acciones conducen a la destrucción de la amenaza. Es entonces cuando el Sistema Inmunitario necesita autorregularse y “apagar” su respuesta para evitar dañar a las propias células del organismo, como ocurre con las enfermedades autoinmunes o las alergias. Finalmente, el Sistema Inmunitario necesita responder rápidamente a una nueva entrada del mismo patógeno y así prevenir infecciones recurrentes. Esta última etapa recibe el nombre de memoria inmunológica y es llevada a cabo por los linfocitos sanguíneos [10]. Como puede deducirse de lo anterior, el Sistema Inmunitario está a su vez dividido en dos grandes grupos: el sistema inmune innato, formado por principalmente por células mieloides, y el sistema inmune adquirido, formado 10 extensiva de linfocitos T y B, que ya no pueden modular la respuesta inmune y prevenir infecciones recurrentes a través de la memoria inmunológica [23,24]. La inflamación persistente también conlleva un deterioro de los fagocitos, que son incapaces de ejercer acciones beneficiosas como la fagocitosis y la presentación antigénica. Las células dendríticas, cuyos efectos protectores en infecciones polimicrobianas han sido descritos, también sufren una muerte masiva y deficiencias funcionales. Esta combinación de depleción celular y activación desregulada lleva finalmente a un estado de inmunosupresión, que en parte interviene tanto en la mortalidad como en los efectos a largo plazo del SRIS. De hecho, el estado antiinflamatorio que sigue al estadío proinflamatorio inicial es la razón por la que tratamientos como los corticoides han resultado ser ineficientes, al exacerbar la fase inmunosupresiva [8] (Fig. 4). Existen otros factores contribuyentes en el desarrollo de la sepsis como son el desequilibrio de receptores hormonales y enzimas antioxidantes, la activación del sistema complemento y la anafilotoxina C5a o la desregulación del sistema nervioso autónomo [23]. Aún no existe un tratamiento específico aprobado para el tratamiento del SRIS [8,25]. El régimen se centra en el alivio de los síntomas por infusión de líquidos y, en el caso del SRIS de origen séptico, la erradicación del patógeno [7,26]. Se han realizado multitud de ensayos clínicos centrados en reducir la fase proinflamantoria a través de estrategias para neutralizar citoquinas, ya sea con anticuerpos neutralizantes como con productos trombogénicos. Aunque estos tratamientos han 11 demostrado cierta utilidad en ratón, en ensayos clínicos humanos han resultado ser ineficaces. El tratamiento con drotrecogina α mostró resultados positivos, pero fue retirado del mercado tras un aumento de episodios de hemorragia intracraneal en pacientes pediátricos. Actualmente, las investigaciones se centran en el uso de inhibidores de apoptosis, un tipo de muerte celular, para prevenir la pérdida de linfocitos y células dendríticas, junto a la infusión de este tipo de células de donantes sanos [8]. La ausencia de un tratamiento efectivo para el SRIS ha llevado a los clínicos a concentrar sus esfuerzos en el diagnostico precoz. Más de 170 marcadores han sido estudiados, la mayoría para establecer un pronóstico. Algunos de ellos son citoquinas proinflamatorias como IL-1β y TNF-α, citoquinas antiinflamatorias como IL-10, o marcadores de activación como el CD40. No obstante, dado que ninguno de ellos ha demostrado ser suficientemente específico o sensible, se tiende a valorar combinaciones de distintos parámetros en la práctica clínica diaria [27]. Dado que tantos factores interaccionan en el desarrollo del SRIS, el estudio in vitro de los componentes celulares por separado no es suficiente en ocasiones para elaborar conclusiones. El uso de modelos in vivo es desgraciadamente indispensable como paso intermedio previo a los ensayos clínicos. Es importante señalar que ningún modelo animal puede replicar el SRIS en su totalidad. La ligación cecal (CLP; del inglés caecal ligation and puncture) es considerado el estándar de referencia en el estudio de la septicemia. Sin embargo, este modelo excluye el SRIS de origen no infeccioso [28]. Por otro lado, existe la inyección intraperitoneal de LPS, que si bien no es representativa como un modelo de sepsis, sí constituye una alternativa al CLP en el estudio del SRIS, reduciendo el sufrimiento animal y disminuyendo la variabilidad interindividual, siendo más recomendable para estudios iniciales [29]. Aunque el SRIS es la manifestación más evidente de un descontrol agudo en el proceso inflamatorio, no debemos olvidar los efectos de la inflamación crónica. La tormenta de radicales libres liberada para contener la infección también puede dañar a las células propias, resultando en mutaciones y formación de tumores [11]. En el cerebro, la inflamación ha demostrado ser un factor fundamental en el desarrollo de enfermedades neurodegenerativas [30] y, de hecho, la inflamación crónica periférica puede inducir neurodegeneración en el sistema nervioso central[31]. Es más, bajos niveles sostenidos de inflamación terminan por envejecer al sistema inmune, haciéndolo incapaz de afrontar nuevas infecciones[32]. Tras décadas de investigaciones en el sistema inmune adaptativo, los científicos han vuelto la mirada al sistema inmune innato, conscientes de que aprender a modularlo podría convertirse en una posible herramienta terapéutica. 4. RUTAS DE MUERTE CELULAR Cuando se trata de entidades independientes, como células, la muerte es absolutamente necesaria. Aproximadamente un millón de células muere cada segundo en nuestro organismo, un proceso indispensable para nuestro desarrollo y para mantener la homeostasis de nuestros tejidos. Nuestros dedos no son más que el resultado de la muerte celular en nuestras manos durante el desarrollo embrionario. Del mismo modo tras un proceso infeccioso, el cuerpo necesita eliminar el exceso de células que una vez hubieron proliferado para hacer frente a la infección. Si consideramos este hecho, resulta evidente que un fallo en la programación de la muerte celular puede dar lugar al desarrollo de cáncer o enfermedades autoinmunes. Pero al mismo tiempo, un aumento en la tasa de muerte celular está asociado a múltiples 12 enfermedades degenerativas, inflamatorias o incluso con el infarto de miocardio. No es de extrañar que tratar de comprender los mecanismos de muerte celular haya cobrado suma importancia en los últimos años [33]. Si la muerte celular es necesaria, entonces las células deben ser capaces de controlar y regular su propio destino. Un ejemplo de ello ocurre cuando una célula es infectada por un virus. La presencia del “parásito” lleva a la célula a “suicidarse” para evitar la replicación del virus en su interior y así prevenir la dispersión de la infección. Actualmente, los mecanismos de muerte celular se dividen en tres grandes tipos [33]. El primero, conocido como tipo I o apoptosis, conlleva la condensación de la cromatina y la reducción del citoplasma, de modo que la célula muere silenciosamente, es decir, sin desencadenar una respuesta inmunitaria. El segundo tipo, la autofagia, ha ido asociada siempre a la inhibición de la apoptosis, aunque estudios recientes muestran un control muy refinado a nivel nuclear [34]. Aún se desconoce si la autofagia es en realidad un tipo de muerte celular o un esfuerzo final de la célula por mantenerse con vida. Por último, el tipo III o necrosis acarrea un hinchamiento de la célula, ruptura de la membrana plasmática y liberación del contenido intracelular, con la consecuente activación de la respuesta inflamatoria. Aunque las células pueden sufrir necrosis como resultado de un daño físico o un fallo energético, existe evidencia de que la necrosis puede suceder como resultado de una ruta celular programada [33]. En cualquier caso, las células son capases de advertir al organismo de su muerte, produciendo señales o liberando moléculas que atraen a fagocitos, facilitando así la limpieza de los restos o la activación del sistema inmune si fuese necesario. 4.1. La apoptosis y las caspasas Aunque la apoptosis fue inicialmente descrita por Carl Vogt en 1842, no fue hasta 1972 cuando Kerr, Wyllie y Currie acuñaron el término apoptosis basados en sus descubrimientos sobre el nemátodo C. elegans [35]. Desde entonces, la ciencia se ha centrado en dilucidar sus mecanismos, las proteínas implicadas (ej. Las caspasas), sus repercusiones en la homeostasis del organismo y sus aplicaciones potenciales en la práctica clínica. 2.1.1. Las caspasas: proteasas asesinas. El término caspasa deriva del acrónimo cisteína-aspartato proteasa, y engloba una gran familia de proteasas citosólicas con una cisteína en su centro activo que corta secuencias específicas que finalizan en un residuo de aspartato. La secuencia de aminoácidos que cada caspasa es capaz de reconocer determina su especificidad. Por ejemplo, los sustratos de caspasa 3 contienen la secuencia aminoacídica DEVD (aspartato-glutamato-valina- aspartato), mientras que los de caspasa 8 contienen la secuencia LETD (leucinaglutamanto-treonina-aspartato) [33]. Mediante la adición de radicales como la fluorometilcetona a péptidos específicos de cada caspasa podemos inhibir su actividad, lo cual resulta de especial relevancia en la modulación de la apoptosis y otros procesos en los que están implicadas las caspasas. Curiosamente, las células también poseen inhibidores endógenos de la apoptosis denominados IAPs. Mientras que algunos de ellos, como los XIAPs, son inhibidores directos de las caspasas, otros realizan sus funciones a través de la interacción con la plataforma molecular en la que las caspasas están implicadas[33]. Como cabe esperar, las caspasas no están siempre activas en la célula, sino que se presentan en forma de zimógenos o pro-formas. Todas las caspasas contienen tres regiones 13 llamadas prodominio, pequeña subunidad y gran subunidad. Este atributo nos permite distinguir entre dos tipos de caspasas: las caspasas iniciadoras (caspasas 8 y 9), que son capaces de autoactivarse por dimerización e iniciar así la cascada apoptótica, y las caspasas efectoras, que son activadas por las caspasas iniciadoras y que cortan a otros sustratos responsables de los “síntomas” apoptóticos. Los mecanismos por los que las caspasas efectoras conducen a la apoptosis continúan actualmente bajo estudio. Aunque no todos estos sustratos han sido identificados, algunos han sido localizados en el núcleo, en el citoplasma y en la mitocondria [33]. Un aspecto interesante es cómo las células apoptóticas son capaces de advertir a otras células de su muerte. Uno de los procesos implicados en la apoptosis es la traslocación de algunos fosfolípidos de membrana desde la cara interna a la externa de la membrana celular, actuando así como indicadores que atraen y favorecen la ingestión de la célula apoptótica por los fagocitos. Una de estas moléculas es la fosfatidilserina, cuya detección se emplea como técnica rutinaria en la detección de apoptosis[36]. No todas las caspasas están relacionadas con la muerte celular. La caspasa 1 es una caspasa iniciadora que se asocia al inflamasoma NLRP3 facilitando la formación de IL-1β, que como vimos en la sección 3, está implicada en el proceso de SRIS [37]. 2.1.2. Rutas de activación apoptóticas Aunque las caspasas efectoras y sus sustratos son siempre los mismos en todas las células, el proceso de apoptosis puede ser iniciado a través de dos mecanismos diferentes: la vía intrínseca y la extrínseca. 2.1.2.1. La vía intrínseca y la mitocondria La mayoría de los casos de apoptosis en vertebrados ocurre por la vía intrínseca. Es esencial para el desarrollo embrionario hasta el punto que alteraciones de esta vía de muerte resultan en individuos inviables por mutaciones diseminadas y disfunción cerebral por sobreacumulación de neuronas [33]. La vía intrínseca tiene lugar por dimerización y activación de caspasa 9 en un complejo denominado apoptosoma. La formación del apoptosoma está muy regulada y sólo ocurre si una proteína mitocondrial, el citocromo c, escapa de la mitocondria y estabiliza el apoptosoma. Esto sólo tiene lugar en situaciones de daño celular irreversible, tras el cual la célula experimenta una permeabilización de la mitocondria que permite la salida de citocromo c, la estabilización del apoptosoma y la activación de caspasa 9 (Figura 5) [33]. 2.1.2.2. La vía extrínseca y los receptores de muerte En las secciones 2 y 3 describimos cómo las células del sistema inmune necesitan proliferar para contener infecciones. No obstante, una vez se ha resuelto el proceso infeccioso, el exceso de células inmunitarias necesita reducirse para mantener la homeostasis. Es más, debe hacerse de un modo que no desate una nueva respuesta inmunológica. En otras ocasiones, como los procesos cancerígenos, las células inmunes necesitan reconocer e inducir la muerte de células tumorales. Todos estos eventos están mediados por la vía extrínseca de la apoptosis, de modo que una alteración de esta vía puede llevar consigo la generación de síndromes linfo y mieloproliferativos [33]. 14 La vía extrínseca comienza cuando ligandos de muerte presentes en el entorno de la célula interaccionan con sus correspondientes receptores de muerte en la membrana citoplasmática. Tras la unión, estos receptores se activan y reclutan una serie de proteínas, incluída la caspasa iniciadora 8, que puede entonces dimerizarse y autoactivarse. Existen varios receptores de muerte y cada uno recluta una serie de proteínas diferentes. Algunos de estos receptores son el factor de necrosis tumoral (TNFR1), la proteína CD95 y los receptores TRAIL. El mecanismo de señalización de TNFR1 es bastante complejo y puede conducir a otros procesos además de apoptosis (Figura 6) [33]. 2.1.3. La apoptosis en la práctica clínica Durante mucho tiempo se pensó que la apoptosis no generaba una respuesta inmunitaria. Sin embargo, se ha observado que ciertas formas de apoptosis pueden generar una respuesta inmune dependiendo de las moléculas de señalización expuestas en la superficie celular. Por ejemplo, mientras que la fosfatidilserina es capaz de inducir fagocitosis sin activar a los macrófagos, otras moléculas como las proteínas de choque térmico[38] o la calreticulina[39] son capaces de activar la respuesta inmune innata. Este hecho es ciertamente importante en patologías donde se quiere inducir muerte celular. Es el caso del cáncer, donde no sólo se busca inducir la muerte de las células tumorales sino también incrementar la respuesta inmune del organismo contra ellas. No resulta extraño que el tratamiento con drogas que estimulan la apoptosis con exposición de calreticulina, como es el caso de las antraciclinas, hayan mostrado resultados positivos en el tratamiento del cáncer [40]. Pero la apoptosis no siempre es una herramienta. De hecho, determinadas patologías, como las enfermedades neurodegenerativas, son debidas a un aumento en la tasa de muerte celular. En el caso del SRIS, hemos visto que la 15 apoptosis masiva de linfocitos y células dendríticas tiene efectos deletéreos en el paciente [8]. La inhibición de la apoptosis, pues, podría resultar útil en estas circunstancias. 4.2. La necrosis programada y el ripoptosoma, una plataforma molecular dual Anteriormente hemos considerado otro tipo de muerte celular conocido como necrosis. Las células que sufren necrosis lo hacen a causa de una falta de energía (ATP) que las hace incapaces de retener su potencial de membrana. Esto ocasiona su hinchamiento y consecuentemente la ruptura de la membrana plasmática y la liberación del contenido intracelular [33]. Asumiendo estos conceptos podemos imaginar posibles causas por las que una célula moriría por necrosis. La interrupción del aporte nutricional y de oxígeno, como ocurre en casos de isquemia, lleva a una extensa muerte del tejido (ej. Ictus cerebral o infarto de miocardio). Asimismo, las células apoptóticas pueden sufrir necrosis si no son fagocitadas a tiempo. Este último tipo de necrosis recibe el nombre de necrosis secundaria a apoptosis, y representa un sesgo importante en la determinación de las causas de muerte celular en el laboratorio [33]. Sin embargo, se ha descrito recientemente que la necrosis puede ocurrir como resultado de una ruta de señalización programada que deriva de la formación del complejo (TNFR1) (ver sección 4.2.2.). Este tipo de muerte celular, que constituye uno de los puntos principales de este trabajo, recibe el nombre de necrosis programada o necroptosis [33]. Las primeras descripciones de la necroptosis las realizaron Vercammen y col. en 1998, cuando observaron que la inhibición de las caspasa aumentaba la muerte por necrosis en células tratadas con TNF [41]. Posteriormente, Kim y col. (2001) mostraron que el inhibidor general de caspasas z-VAD-fmk inducía la muerte de una línea celular de macrófagos tratada con LPS [42]. Un año después, Sordet y col. extrapolaron este mismo efecto a cultivos primarios Fig. 6. Vía extrínseca de la apoptosis. La unión de los ligandos de muerte a sus receptores (Fas, DR4, DR5, TNFR1 y DR3) conlleva el reclutamiento de proteínas adaptadoras y, en última instancia, de caspasa 8. Imagen tomada de Marcos Martínez Banaclocha “Desregulación de Apoptosis en Cáncer”. Hospital Lluis Alcanyis. Servicio de Patología. Xátiva-Valencia. 16 de monocitos humanos [43]. En todos los casos se describió que se trataba de una muerte de tipo necrótico, independiente de caspasas y que sólo tenía lugar en células activadas. Sin embargo, no fue hasta 2009 cuando se estableció definitivamente el término necroptosis como un tipo de muerte celular necrótica mediada por la activación de las proteínas RIPK1 y RIPK3 [44-46]. Desde entonces, y hasta la fecha, muchos investigadores han tratado de caracterizar esta vía de muerte, intentando elucidar no sólo su mecanismo regulatorio, sino también sus consecuencias fisiológicas y patológicas en el organismo humano. 4.1. Mecanismos de activación y regulación de la necroptosis Aunque se ha demostrado que la necroptosis puede originarse tras la activación de receptores TLR1 y TLR2, nos centraremos exclusivamente en el mecanismo relacionado con la activación del receptor TNFR1. Al igual que en la vía extrínseca de la apoptosis, Ligand o TNFR1 Complejo I Activación de NF-ƙB Síntesis de FLIP Desestabilizació n y degradación del complejo RIPK1-RIPK3 No señalización RIPK3 Supervivencia Apoptosis Necroptosis Dominios de muerte RIPK1 citosólica Citosol Membrana plasmática Fig. 7. Diferentes funciones del ripoptosoma. El ripoptosoma, formado por la liberación del complejo TNFR1 al citosol, puede llevar a cabo diferentes funciones en la célula. Cuando los niveles de FLIP son elevados (a), caspasa 8 no puede dimerizarse y la célula sobrevive, realizando otras funciones no apoptóticas de caspasa 8. Cuando los niveles de flip son bajos (b) caspasa 8 se dimeriza y la célula entra en apoptosis. Cuando caspasa 8 está inhibida o ausente (c) RIPK1 se activa y fosforila a RIPK3 provocando la muerte por necroptosis. Imagen adaptada de Oberst et al. [1] 17 la ruta celular que lleva a la necroptosis comienza con la activación del receptor TNFR1. La activación de dicho receptor ocasiona el reclutamiento de RIPK1 y otras proteínas adaptadoras para formar el denominado complejo I (Fig. 7). El complejo I conlleva inicialmente la activación de NF-kB, el cual estimula la transcripción y producción de proteínas de supervivencia, como la proteína FLIP, un homólogo inactivo de caspasa 8 con gran afinidad por la misma. Tras recibir otras señales de muerte, el complejo I se desensambla de la membrana y se libera al citosol, donde recluta a las proteínas FADD y caspasa 8 para formar el complejo II, también conocido como ripoptosoma (Fig. 7) [33,47]. Cuando los niveles de FLIP son altos, este se une a caspasa 8 y previene su dimerización y, por tanto, la apoptosis. Este heterodímero de caspasa 8 también es responsable de los papeles no apoptóticos de caspasa 8 que mencionaremos en la sección 5. En cambio, cuando los niveles de FLIP son bajos, caspasa 8 puede dimerizarse e inducir muerte por apoptosis[48]. En ambos casos, caspasa 8 es capaz de cortar a RIPK1 previniendo así su activación [47]. Existe además una tercera alternativa, que tiene lugar cuando caspasa 8 está inactiva. En este caso, no existe ninguna proteína que pueda inactivar a RIPK1, la cual puede activarse y fosforilar a RIPK3 que es el último responsable de la muerte por necroptosis (Fig. 7) [1]. La necroptosis, pues, puede inhibirse empleando inhibidores de RIPK1, como la Necrostatina-1. Existe una vía alternativa de activación de la necroptosis, que ocurre como consecuencia de la oligomerización de RIPK1 y RIPK3. Bajo determinadas circunstancias, estas dos proteínas pueden formar fibrillas que finalmente conducen a la activación de RIPK3 y, por consiguiente, a la necroptosis [49,50]. 4.2. Implicaciones clínicas de la necroptosis Se cree que el origen fisiológico de la necroptosis surgió como un mecanismo de seguridad para contener infecciones virales[33]. Se ha descrito que muchos virus producen inhibidores de apoptosis para evitar la muerte de la célula infectada y continuar así la replicación de su maquinaria vírica. Resulta lógico que las células de mamíferos hayan desarrollado una herramienta para contrarrestar este efecto [51]. No obstante, es también cierto que la muerte celular por necrosis conlleva la liberación del contenido intracelular, incluidos DAMPs, señales de daño que activan a las células inmunológicas (ver sección 3) [6]. Este hecho, que resulta útil para contrarrestar una infección, podría tener consecuencias negativas para el propio organismo. Así, veíamos que el SRIS se producía por una activación descontrolada del sistema inmune como respuesta a una liberación masiva de DAMPs, y, de hecho, algunos investigadores han relacionado la necroptosis ocasionada por la liberación de TNF-α en sangre con el desarrollo de SRIS [52]. Otra de las consecuencias de la activación descontrolada del sistema inmunitario son las enfermedades autoinmunes y, de hecho, existen estudios que demuestran que la inducción de necroptosis en las células epiteliales del intestino ocasiona un síndrome similar al Crohn [53]. Sin embargo, algunos autores apuestan por los efectos beneficiosos de la necroptosis. Fricker y col. (2012) demostraron que la inducción de necroptosis en la microglía cerebral lograba rescatar la pérdida neuronal en ausencia de daño [54]. Al igual que en la apoptosis, en la que diferentes formas presentan propiedades proinflamatorias o antiinflamatorias, cabe la posibilidad de que esta ruta de muerte celular desconocida hasta hace poco contenga 18 posibilidades terapéuticas aún por descubrir. 5. ACTIVACIÓN Y DIFERENCIACIÓN DE CÉLULAS FAGOCÍTICAS Si partimos de la hipótesis de que modulando la activación de los monocitos podríamos controlar los síntomas del SRIS, entonces es necesario, en primer lugar, comprender las rutas de señalización del proceso de activación para así valorar a qué nivel deberíamos inhibir este proceso. Durante muchos años, apoptosis y activación se han considerado dos procesos completamente independientes. Sin embargo, estudios recientes han demostrado que las caspasas apoptóticas, que hasta ahora se habían vinculado exclusivamente a la muerte celular, podrían estar involucradas en ambos procesos [55]. Aunque este nuevo papel de las caspasas apoptóticas puede resultar sorprendente, no está lejos de las funciones de otras caspasas, como la caspasa 1 y su papel en la producción de citoquinas inflamatorias en el inflamasoma NLRP3 [37,56]. Es, por tanto, una hipótesis plausible que las caspasas apoptóticas puedan estar realizando otras funciones no apoptóticas en la célula. Diversos estudios han mostrado el papel indispensable de las caspasas 3 y 9 en la diferenciación de monocitos a macrófagos, reguladas por la activación de caspasa 8 [43,47]. Caspasa 8, a su vez, se activaría por la formación del complejo llamado ripoptosoma que veíamos en la sección 4.1. y 4.2., cuyos componentes se ensamblarían cuando la célula recibiese ciertos estímulos de diferenciación[47,57]. En concordancia con estos resultados, Burguillos y col. (2011) describieron la implicación de la caspasa 8, y por consiguiente caspasa 3, en el control de la activación proinflamatoria de la microglia y sus efectos tóxicos sobre las neuronas [55,58]. Poco después, Fricker y col. (2013) demostraron que la inhibición de caspasa 8 en la microglía activada era capaz de causar selectivamente su muerte por necroptosis, recuperando así la viabilidad neuronal [54]. Estos datos dieron apoyo a la hipótesis de que el ripoptosoma puede ensamblarse en presencia de estímulos proinflamatorios, algo que ya se ha observado en macrófagos periféricos [59,60]. Todo parece apuntar a que RIPK1 y caspasa 8 son dos interactores cuyas funciones en la célula no hacen más que emerger. OBJETIVOS El síndrome inflamatorio de respuesta sistémica ocurre cuando los monocitos sanguíneos, en presencia de una amenaza externa, se activan descontroladamente liberando una cascada de citoquinas pro y antiinflamatorias que ocasionan la muerte por shock hipovolémico y fallo multiorgánico. El objetivo del presente trabajo es, por tanto, hallar un mecanismo que regula el proceso de activación de los monocitos cuya inhibición sea aplicable al tratamiento del SRIS. Para ello valoramos si la caspasa 8, la cual se ha relacionado con la activación inflamatoria de la microglía, pudiera estar implicada en la activación de los monocitos sanguíneos. Nuestros resultados mostraron que esta enzima juega un importante papel en la activación de los monocitos sanguíneos y que su inhibición resulta en una reducción de la activación y la liberación de citoquinas relacionadas con el SRIS. Asimismo, la inhibición de la caspasa 8 ocasiona la muerte por necroptosis de los monocitos activados sin que ello repercuta en la reducción de los niveles de citoquinas. Por último, actualmente estamos desarrollando un modelo que nos permita valorar los efectos de la inhibición de la caspasa 8 in vivo, como paso intermedio a su potencial aplicación en ensayos clínicos en pacientes. 19 MATERIAL Y MÉTODOS 1. MATERIAL BIOLÓGICO 1.1. Muestras de origen humano Los estudios in vitro de monocitos se realizaron a partir de concentrados leuco-plaquetarios (Buffy- Coat), procedentes de hemodonaciones de donante sano extraídos en sistema de bolsa LQT 6280 (Macopharma) y de donaciones de sangre periférica de voluntarios sanos. Las muestras empleadas se obtuvieron del Centro Regional de Transfusiones Sanguíneas tras el correspondiente consentimiento informado de acuerdo con la Declaración de Helsinki. Los procedimientos se realizaron de acuerdo a las normas establecidas por el Comité Ético del hospital. El procesamiento de las muestras se llevó a cabo bajo estrictas condiciones de esterilidad. 1.2. Animales Todos los experimentos se realizaron de acuerdo con las Directrices de la Unión Europea sobre el uso de animales de laboratorio (2010/63/EU), siguiendo las regulaciones españolas (RD 1201/2005) para el uso de animales de laboratorio y aprobadas por el comité científico de la universidad. Para los estudios de activación y necroptosis de monocitos se emplearon ratones wild-type CB57BL/6. Cuando se quiso valorar la implicación de la caspasa 8, se emplearon ratones floxeados de caspasa 8 para la línea monocítica. Para inducir la eliminación de la caspasa 8 en ratones que expresan Cre en el linaje de células mieloides, los ratones CB57BL/6 que llevan un alelo floxeado de la caspasa8 (Kang et al., 2004; J Immunol. 2004 173(5):2976-2984.) se cruzaron con una línea transgénica que expresa Cre en el linaje celular mieloide. Los ratones floxeados fueron cedidos por el Professor Stephen M. Hedrick (University of California, San Diego, La Jolla, CA, USA). La línea transgénica Cre fue la B6.129P2- Lyzstm1(cre)Ifo/J de Jackson Laboratorios. En este caso, el sistema de recombinación Cre se asocia al gen de la lisozima 2, el cual se expresa en la línea celular mieloide incluyendo monocitos, macrófagos y microglía. Los ratones floxeados homocigóticos se cruzaron con los ratones heterocigóticos flox/+Cre/+. El genotipado se realizó mediante análisis de ADN por PCR obtenido de la cola del animal siguiendo protocolos estandarizados. Los ratones que contengan el gen floxeado pero que carezcan de Cre se utilizaron como controles. 1.3. Líneas celulares La línea celular THP-1 fue obtenida del banco de líneas celulares. Los experimentos se realizaron de acuerdo con las directrices nacionales y europeas. 2. MATERIAL NO BIOLÓGICO 2.1. Material químico general LPS, IETD-fmk, Necrostatina-1 y el DMSO fueron comprados a Sigma- Aldrich (St Louis, MO, USA). Z-VAD-fmk se obtuvo de Promega (Madison, EE.UU). El tampón fosfato (PBS), RPMI- 1640, suero bovino fetal (FBS) y os antibióticos se compraron a GIBCO (InvitrogenTM, Paisely, Reino Unido). El suero AB se adquirió en Sigma-Aldrich, St Louis, MO, USA. El MACS running buffer, las columnas y los separadores MACS fueron de Miltenyi Biotec S.L. (Bergisch Gladbach, Alemania). Todas las placas de pocillos para cultivos celulares se compraron a Thermo Fischer Scientific Nunc A/S, (Kamstrupvej, Roskilde, Dinamarca). El β-mercaptoetanol y el piruvato sódico se obtuvieron de Sigma-Aldrich (St Louis, MO, EE.UU). Los filtros de 40 µm se adquirieron en Becton Dickinson Bioscience (San Jose, CA, EE.UU.). El paraformaldehído se obtuvo de Carlo Erba®. 26 efecto de los fármacos sobre las distintas variables analizadas se empleó el test ANOVA o la T de student para datos pareados. Para los análisis estadísticos se usó el programa SPSS (SPSS 11.0 Inc. Chicago IL. EE.UU.). Las diferencias se consideraron estadísticamente significativas cuando el valor de p<0,05. RESULTADOS 1. OPTIMIZACIÓN DE UN MODELO IN VITRO DE LOS EFECTOS DEL SRIS EN MONOCITOS En primer lugar necesitábamos buscar un modelo que nos permitiese simular in vitro las condiciones del SRIS. La separación inmunomagnética de los monocitos humanos proporcionó una población única que nos permitía valorar la implicación de caspasa 8 en ausencia de la influencia de otras poblaciones hematológicas (datos no mostrados). El siguiente paso consistió en obtener monocitos activados. Es importante destacar que la activación de monocitos puede conducir a su diferenciación a macrófagos, lo cual podía alterar los resultados de nuestro estudio. Idealmente necesitábamos obtener monocitos activados no diferenciados que pudieran comportarse del mismo modo que en el SRIS. Para ello elegimos el tratamiento con 1 µg/ml de LPS (el cual está está presente en sangre en casos de shock séptico y es un fuerte activador del receptor TLR4) durante un tiempo corto, 48 horas, para evitar alcanzar estadíos de mayor diferenciación. Cuando observamos las células bajo el microscopio vimos que éstas no presentaban morfología de macrófago, lo cual sugería que no habían sufrido diferenciación. Aún así, decidimos medir la expresión de CD16 como marcador de diferenciación, confirmando que no se había producido ningún aumento que indicase una diferenciación a macrófago (Fig. 8A). Por otro lado se testaron dos anticuerpos diferentes, anti-CD26 y anti- CD40, para la valoración de los niveles de activación. Mientras que la expresión de CD26 no aumentó de forma significativa, sí que observamos un aumento significativo de la expresión de CD40 (Fig. 8B, C y D). Decidimos entonces realizar un estudio de tiempo respuesta en el que hallamos que la medida a 48 horas resultó ser la más robusta. Por todo ello decidimos tomar como modelo in vitro de los efectos del SRIS sobre los monocitos la adición de LPS durante 48 horas. De cara al empleo de la línea THP-1 en estudios de silenciamiento génico, era igualmente necesario confirmar el modelo de activación por LPS y CD40. Cuando los niveles de expresión de CD40 se cuantificaron en células tratadas con LPS observamos un incremento del 50% en el porcentaje de células que expresaban CD40, corroborando así el modelo establecido para monocitos humanos. 27 *** *** CD16 8.15 % 4.69 % CD40 CD26 0.31 % 1.09 % 4 ± 3.62 % 22 ± 0.53 % CD40 CONTROL CONTROL LPS LPS A B C D E Fig. 8. Optimización de un modelo in vitro de SRIS. Monocitos humanos y células THP-1 se trataron con LPS (1 µg/ml). A) Niveles de expresión de CD16 en monocitos humanos a las 48 horas. B) Niveles de expresión de CD26 en monocitos humanos a las 48 horas. C) Aumento en el canal de fluorescencia de CD40 con LPS en monocitos humanos. D) Porcentaje de células CD40 positivasen monocitos humanos. E) Comparación en el porcentaje de células CD40 positivas en monocitos humanos. t student = 1,39137 x 10-9. F) Comparación en el porcentaje de células CD40 positivas en células THP- 1. t student = 7,20031 x 10-7. F 28 2. LA ACTIVIDAD DE LA CASPASA 8 AUMENTA EN MONOCITOS TRATADOS CON LPS SIN SIGNOS DE APOPTOSIS En las células de microglía, donde el papel de la caspasa 8 en activación ya ha sido probado, se ha descrito que en presencia de LPS hay un aumento moderado de la actividad caspasa 8 que no se correlaciona con muerte celular. Con el objetivo de valorar el papel de la caspasa 8 en la activación de monocitos de la sangre, decidimos medir la actividad de la caspasa 8 y de sus caspasas efectoras (caspasa 3 y 7) en monocitos activados con LPS. 2.1. La actividad caspasa 8 en monocitos humanos aumenta en ausencia de muerte Para la medida de la actividad caspasa elegimos tiempos inferiores a aquellos en los que determinamos el grado de activación, asumiendo que la actividad caspasa debe ser mayor durante el proceso de activación. Las medidas mostraron un ligero pero significativo incremento en la actividad de la caspasa 8 (Fig. 9) que no se acompañaba con un aumento en el número de células apoptóticas (Anexina V positivas) o necróticas (7-AAD positivas). Fig. 9. Aumento de la actividad caspasa 8 en ausencia de muerte. Se sembraron monocitos humanos en presencia o ausencia de 1 µg/mL de LPS. A) Actividad caspasa 8 normalizada frente al número de células a 12 y 24 horas de tratamiento. t student = 0.0085 B) Porcentaje de células Anexina V positivas calculados por citometría de flujo. C) Porcentaje de células 7-AAD positivas calculados por citometría de flujo. 29 2.2. La actividad caspasa 8 en células THP-1 aumenta en ausencia de muerte Cuando se midió la actividad de la caspasa 8 en la línea THP-1 se observó nuevamente un ligero aumento significativo en la actividad caspasa 8 tras 6 y 24 horas de tratamiento. Cabe destacar que este consistente aumento de la actividad caspasa 8 fue sin embargo mucho menor que el observado bajo el tratamiento con inductores de apoptosis, como la estaurosporina (Fig. 10). 3. LA ACTIVIDAD DE LA CASPASA 8 ES INDISPENSABLE PARA LA CORRECTA ACTIVACIÓN DE LOS MONOCITOS HUMANOS Hemos observado previamente que el tratamiento con LPS causa un incremento en la actividad de la caspasa 8 que no se correlaciona con un aumento de muerte celular. Si caspasa 8 está implicada en la activación de monocitos sanguíneos, entonces la inhibición de dicha proteína debería reducir el porcentaje de activación. Un resultado positivo podría abrir una puerta a una nueva vía para modular la activación de los monocitos y la inflamación. Para inhibir la actividad de la caspasa 8 empleamos un inhibidor químico específico, el IETD-fmk, tanto en monocitos humanos como en células THP-1. Previamente se valoró el porcentaje de inhibición inducido, calculándose en torno a un 70% (Fig. 11C). En ambos casos, las células se pretrataron en los 30 minutos previos a la adición del LPS. A las 48 horas tras la inducción de la activación, se midieron los niveles de expresión de CD40 por citometría de flujo. Los resultados mostraron una bajada significativa en el porcentaje de células CD40 positivas, que se traducía en una reducción del porcentaje de monocitos activados (Fig. 11A y 9B). 2.00 13.00 Actividad caspasa 8/célula 2.00 7.00 Actividad caspasa 8/célula Figura 10. Aumento consistente de la actividad caspasa 8 menor que el ocasionado por inductores de apoptosis. Se trataron células THP-1 con 1 µg/ml de LPS o 0.5 µg/ml de estaurosporina A) actividad caspasa tras 6 horas de tratamiento. B) Actividad caspasa tras 24 horas de tratamiento. Valor de T en todos los casos: 0,000 *** *** *** *** A B 30 4. LA INHIBICIÓN DE CASPASA 8 DESENCADENA LA MUERTE 31 POR NECROPTOSIS DE LOS MONOCITOS ACTIVADOS En el transcurso de nuestros experimentos, advertimos que la inhibición de caspasa 8 en los monocitos sanguíneos tratados con LPS reducía los niveles de células viables (Fig. 12A). Con idea de determinar que ruta de muerte celular estaba implicada, medimos los porcentajes de células apoptóticas y necróticas a tiempos cortos, para evitar sesgos debidos a necrosis secundaria a apoptosis (Figura 12B y 12C). Encontramos que la tendencia observada para apoptosis no se correlacionaba con la tendencia vista en necrosis. De hecho, aunque el LPS por sí solo causaba un bajo porcentaje de apoptosis, la muerte desatada por la combinación de LPS e IETD-fmk era exclusivamente necrótica. También percibimos que las células tratadas con IETD-fmk solo sufrían cierto grado de necrosis, la cual atribuimos a un pequeño grado de activación basal como consecuencia del proceso de purificación desde la sangre. Dado que se requiere la formación del ripoptosoma para la activación de caspasa 8, era posible que la inhibición de esta proteína pudiera estar conduciendo a la activación de RIPK1, 32 la cual es responsable de la muerte por necroptosis. Con el objetivo de determinar si los monocitos activados podían estar sufriendo necroptosis decidimos pretratar las células con un inhibidor de RIPK1, la necrostatina-1. El uso de necrostatina-1 se emplea rutinariamente como una medida indirecta de confirmación de necroptosis. Encontramos que la adición de necrostatina-1 lograba revertir la necrosis inducida por el IETD-fmk, confirmando por tanto que el aumento de la muerte celular se debía a la activación de la ruta necroptótica (Fig. 13A y 13B). De manera interesante, observamos que la adición de necrostatina también revertía la muerte ocasionada por la adición de IETD-fmk solo (datos no mostrados), lo cual confirma que ésta se debiese a necroptosis causada por una activación parcial de los monocitos durante el proceso de purificación. Curiosamente, no pudimos ver necroptosis en la línea THP-1 a 48 horas (Fig. 14). Supusimos que esto podía deberse a que, dado que las líneas celulares se replican indefinidamente, los niveles crecientes de células vivas podrían estar enmascarando los porcentajes de muerte. Para comprobarlo, realizamos un muestreo de los porcentajes de necrosis a tiempos cortos (6 y 24 horas) (Fig. 14), hallando una vez más una ausencia de muerte celular bajo el tratamiento conjunto de LPS e IETD-fmk. Se ha descrito que ciertas líneas celulares poseen rutas de muerte celular defectuosas, como parte del proceso de inmortalización, que las hace incapaces de sufrir necroptosis. Por tanto, asumimos que la necroptosis se trataba de un efecto secundario inherente a las células extraídas directamente de los voluntarios sanos. Fig. 14. La necroptosis es un efecto secundario exclusivo de las células de sangre humana. Se trataron células THP-1 con 1 µg/ml de LPS en presencia o ausencia de 20 µM de IETD-fmk y el porcentaje de células necróticas se valoró a las 48 horas (arriba), 24 horas (abajo a la derecha) y 6 horas (abajo a la izquierda). 33 5. LA INHIBICIÓN DE LA CASPASA 8 PREVIENE LA SÍNTESIS Y PRODUCCIÓN DE CITOQUINAS A PESAR DE LA NECROPTOSIS Al tratarse de un tipo de muerte necrótico, cabía la sospecha de que la necroptosis de los monocitos sanguíneos implicase la liberación de señales de daño (DAMPs) en el entorno. Esto podría activar a los monocitos que quedasen vivos, contrarrestando los efectos beneficiosos del IETD-fmk y agravando la tormenta de citoquinas característica del SRIS. Aunque la medición de los niveles de activación mostró una bajada de expresión de CD40 en las células vivas, deseábamos obtener información de carácter funcional. Para ello medimos los niveles de expresión de ARNm de las principales citoquinas implicadas en SRIS, lo cual pueden equipararse a su tasa de producción. Sorprendentemente, lejos de encontrar un incremento hallamos un descenso de los niveles de producción de citoquinas tanto proinflamatorios (IL-1β) como anitiinflamatorias (IL-10) (Fig. 15). Estos datos plantean la posibilidad de que el tratamiento con IETD-fmk pueda resultar beneficioso de cara a las dos fases (proinflamatoria y anttiinflamatoria) de la enfermedad, no solo reduciendo la activación de los monocitos y eliminando su exceso en ausencia de daño, sino también reduciendo la posibilidad de entrada en la tan grave fase antiinflamatoria del SRIS. 34 6. LA LIBERACIÓN DE CITOQUINAS RELACIONADAS CON SRIS SE REDUCE BAJO LA INHIBICIÓN DE CASPASA 8 Aunque la inhibición de caspasa 8 parecía ser capaz de contrarrestar los efectos del LPS y del ambiente necroptótico previniendo así la activación de los monocitos y la síntesis de citoquinas asociadas al SRIS, era posible que aquellos monocitos que sí habían sufrido necroptosis hubieran liberado sus citoquinas a consecuencia de la ruptura de la membrana plasmática. Para averiguarlo, medimos la concentración de citoquinas asociadas a sepsis en el sobrenadante de los pocillos tratados con combinaciones de LPS e IETD-fmk. Encontramos que los niveles de IL-10 se mantenían tras la adición de IETD-fmk, pero que se reducían con la adición de necrostatina-1, lo cual sugiere que la necroptosis podría ser, contra todo pronóstico, antiinflamatoria (Fig. 16). Por otro lado, los niveles de IL-1β se redujeron de forma significativa en presencia de IETD-fmk, y aún más cuando se inhibió la necroptosis (Fig. 16). Estos resultados apuntan a que el tratamiento con IETD-fmk podría reducir el estadío proinflamatorio inicial, pero al mismo tiempo aminorar la producción de citoquinas antiinflamatorias a largo plazo, previniendo así la aparición de la fase inmunosupresora. 35 7. DESARROLLO DE UN MODELO IN VIVO PARA EL ESTUDIO DE CASPASA 8 COMO TRATAMIENTO PARA EL SHOCK SÉPTICO Habíamos observado que la inhibición de caspasa 8 era capaz de reducir la activación monocítica y la liberación de citoquinas. Sin embargo, los modelos in vitro que habíamos usado hasta la fecha se basaban en una población única y no tenían en cuenta la interacción con otros tipos de células inmunes. Por ello, antes de concluir en el uso del IETD-fmk en el tratamiento del SIRS era necesario realizar ensayos in vivo. 7.1. Caspasa 8 no está implicada en la activación de monocitos murinos Inicialmente se propuso un modelo de inyección de LPS en ratones deleccionados de caspasa 8 en la línea monocítica, que nos permitía extrapolar los efectos observados in vitro. Pero antes de llevar a cabo los experimentos era crucial confirmar que la inhibición de caspasa 8 ejercía el mismo efecto sobre los monocitos murinos. Para confirmar la implicación de caspasa 8 en la activación y necroptosis de monocitos murinos, se emplearon monocitos aislados de la médula ósea. Se trataron con LPS durante 24 horas tras lo cual se cuantificaron los niveles de activación y necroptosis en animales salvajes y transgénicos. Sorprendentemente, no pudimos hallar necroptosis ni descenso de activación (Fig. 17). Previo a establecer conclusiones, decidimos confirmar la delección del gen de la caspasa 8 en el ratón transgénico, así como el porcentaje de expresión de caspasa 8 en los monocitos purificados. Curiosamente, hallamos que los monocitos poseían delección del gen de caspasa 8 y que, efectivamente, expresaban menor cantidad de proteína (Fig. 18). Sin embargo, cuando medimos la actividad de la caspasa 8, observamos que ésta no se reducía en el transgénico. En base a estos resultados supusimos que la caspasa 8 restante podría estar de algún modo compensando la bajada de expresión con el fin de mantener la actividad. 42 MAPK MAP kinasa MPS Sistema fagocítico mononuclear PAMP Patrones moleculares asociados a patógenos PBS Tampón fosfato salino PCR Reacción en cadena de la polimerasa PRR Receptor de reconocimiento de patrón ROS Especies reactivas de oxígeno SARM Staphilococcus aureus resistente a meticilina SRIS Síndrome de Respuesta Inflamatoria Sistémica SSC Side scatter THP-1 Línea monocítica humana TLR Receptor de tipo toll (Receptor de peaje) TNF Factor de necrosis tumoral Z-VAD-fmk Inhibidor general de caspasas BIBLIOGRAFÍA 1. Oberst A, Green DR: It cuts both ways: reconciling the dual roles of caspase 8 in cell death and survival. Nature Reviews Molecular Cell Biology 2011, 12:757-763. 2. Esteban A, Frutos-Vivar F, Ferguson ND, Penuelas O, Lorente JA, Gordo F, Honrubia T, Algora A, Bustos A, Garcia G, et al.: Sepsis incidence and outcome: Contrasting the intensive care unit with the hospital ward. Critical Care Medicine 2007, 35:1284-1289. 3. Tallia S, Kunicka J: Sepsis: Improving the odds. In Perspectives. Edited by: Siemens; 2009. 4. Goldman L, Schafer A: Goldman's Cecil Medicine: Elsevier; 2011. 5. Feldman N, Rotter-Maskowitz A, Okun E: DAMPs as mediators of sterile in flammation in agingrelated pathologies. Ageing Res Rev 2015, [Epub ahead of print]. 6. Kang J, Kim S, Cho H, SM L: DAMPs activating innate immune responses in sepsis. Ageing Res Rev. 2015, [Epub ahead of print]. 7. Sharawy N, Lehmann C: New directions for sepsis and septic shock research. Journal of Surgical Research 2015, 194:520-527. 8. Ward PA, Bosmann M: A Historical Perspective on Sepsis. American Journal of Pathology 2012, 181:2-7. 9. Chaplin DD: Overview of the human immune response. Journal of Allergy and Clinical Immunology 2006, 117:S430-S435. 10. Janeway C, Murphy K, Travers P, Walport M: Janeway's Immunobiology edn 7th. New York, NY: Garland Science; 2008. 11. Nowarski R, Gagliani N, Huber S, Flavell RA: Innate Immune Cells in Inflammation and Cancer. Cancer Immunology Research 2013, 1:77- 84. 12. Karlmark KR, Tacke F, Dunay IR: Monocytes in health and disease - Minireview. European journal of microbiology & immunology 2012, 2:97-102. 13. Auffray C, Sieweke MH, Geissmann F: Blood Monocytes: Development, Heterogeneity, and Relationship with Dendritic Cells. Annual Review of Immunology 2009, 27:669-692. 14. Gutknecht MF, Bouton AH: Functional significance of mononuclear phagocyte populations generated through adult hematopoiesis. Journal of Leukocyte Biology 2014, 96:969-980. 15. Jenkins SJ, Hume DA: Homeostasis in the mononuclear phagocyte system. Trends in Immunology 2014, 35:358-367. 16. Italiani P, Boraschi D: From Monocytes to M1/M2 Macrophages: 43 Phenotypical vs. Functional Differentiation. Frontiers in immunology 2014, 5:514-514. 17. Ginhoux F, Greter M, Leboeuf M, Nandi S, See P, Gokhan S, Mehler MF, Conway SJ, Ng LG, Stanley ER, et al.: Fate Mapping Analysis Reveals That Adult Microglia Derive from Primitive Macrophages. Science 2010, 330:841-845. 18. Yona S, Kim K-W, Wolf Y, Mildner A, Varol D, Breker M, Strauss-Ayali D, Viukov S, Guilliams M, Misharin A, et al.: Fate Mapping Reveals Origins and Dynamics of Monocytes and Tissue Macrophages under Homeostasis. Immunity 2013, 38:79-91. 19. Strauss-Ayali D, Conrad SM, Mosser DM: Monocyte subpopulations and their differentiation patterns during infection. Journal of Leukocyte Biology 2007, 82:244- 252. 20. Ginhoux F, Jung S: Monocytes and macrophages: developmental pathways and tissue homeostasis. Nature Reviews Immunology 2014, 14:392-404. 21. Kawasaki T, Kawai T: Toll-like receptor signaling pathways. Frontiers in immunology 2014, 5:461-461. 22. Harrison CJ: Innate immunity as a key element in host defense against methicillin resistant Staphylococcus aureus. Minerva pediatrica 2009, 61:503-514. 23. Bosmann M, Ward PA: The inflammatory response in sepsis. Trends in Immunology 2013, 34:129-136. 24. Chong DLW, Sriskandan S: Proinflammatory mechanisms in sepsis. Contributions to microbiology 2011, 17:86-107. 25. Uppu DSSM, Ghosh C, Haldar J: Surviving sepsis in the era of antibiotic resistance: Are there any alternative approaches to antibiotic therapy? Microbial Pathogenesis 2015, 80:7-13. 26. Seymour CW, Cooke CR, Heckbert SR, Spertus JA, Callaway CW, Martin- Gill C, Yealy DM, Rea TD, Angus DC: Prehospital intravenous access and fluid resuscitation in severe sepsis: an observational cohort study. Critical Care 2014, 18. 27. Pierrakos C, Vincent J-L: Sepsis biomarkers: a review. Critical Care 2010, 14. 28. Lilley E, Armstrong R, Clark N, Gray P, Hawkins P, Mason K, Lopez- Salesansky N, Stark A-K, Jackson SK, Thiemermann C, et al.: Refinement of animal models of sepsis and septic shock. Shock (Augusta, Ga.) 2015, 43:304-316. 29. Remick DG, Ward PA: Evaluation of endotoxin models for the study of sepsis. Shock 2005, 24:7-11. 30. Herrera AJ, Tomas-Camardiel M, Venero JL, Cano J, Machado A: Inflammatory process as a determinant factor for the degeneration of substantia nigra dopaminergic neurons. Journal of Neural Transmission 2005, 112:111-119. 31. Villaran RF, Espinosa-Oliva AM, Sarmiento M, de Pablos RM, Argueelles S, Delgado-Cortes MJ, Sobrino V, van Rooijen N, Venero JL, Herrera AJ, et al.: Ulcerative colitis exacerbates lipopolysaccharide-induced damage to the nigral dopaminergic system: potential risk factor in Parkinson's disease. Journal of Neurochemistry 2010, 114:1687-1700. 32. Shaw AC, Joshi S, Greenwood H, Panda A, Lord JM: Aging of the innate immune system. Current Opinion in Immunology 2010, 22:507-513. 33. Green D: Means to an end. Apoptosis and other cell death mechanisms. edn 1st; 2010. 44 34. Fullgrabe J, Klionsky DJ, Joseph B: The return of the nucleus: transcriptional and epigenetic control of autophagy. Nature Reviews Molecular Cell Biology 2014, 15:65-74. 35. Peter ME, Heufelder AE, Hengartner MO: Advances in apoptosis research. Proceedings of the National Academy of Sciences of the United States of America 1997, 94:12736-12737. 36. Fadok VA, Bratton DL, Frasch SC, Warner ML, Henson PM: The role of phosphatidylserine in recognition of apoptotic cells by phagocytes. Cell Death and Differentiation 1998, 5:551-562. 37. Kang TB, Yang SH, Toth B, Kovalenko A, Wallach D: Activation of the NLRP3 inflammasome by proteins that signal for necroptosis. Methods Enzymol 2014, 545:67-81. 38. Hickman-Miller HD, Hildebrand WH: The immune response under stress: the role of HSP-derived peptides. Trends in Immunology 2004, 25:427-433. 39. Panaretakis T, Kepp O, Brockmeier U, Tesniere A, Bjorklund A-C, Chapman DC, Durchschlag M, Joza N, Pierron G, van Endert P, et al.: Mechanisms of pre-apoptotic calreticulin exposure in immunogenic cell death. Embo Journal 2009, 28:578-590. 40. Obeid M, Tesniere A, Ghiringhelli F, Fimia GM, Apetoh L, Perfettini J-L, Castedo M, Mignot G, Panaretakis T, Casares N, et al.: Calreticulin exposure dictates the immunogenicity of cancer cell death. Nature Medicine 2007, 13:54-61. 41. Vercammen D, Beyaert R, Denecker G, Goossens V, Van Loo G, Declercq W, Grooten J, Fiers W, Vandenabeele P: Inhibition of caspases increases the sensitivity of L929 cells to necrosis mediated by tumor necrosis factor. Journal of Experimental Medicine 1998, 187:1477-1485. 42. Kim SO, Ono K, Han JH: Apoptosis by pan-caspase inhibitors in lipopolysaccharide-activated macrophages. American Journal of Physiology-Lung Cellular and Molecular Physiology 2001, 281:L1095-L1105. 43. Sordet O, Rebe C, Plenchette S, Zermati Y, Hermine O, Vainchenker W, Garrido C, Solary E, Dubrez-Daloz L: Specific involvement of caspases in the differentiation of monocytes into macrophages. Blood 2002, 100:4446-4453. 44. Degterev A, Hitomi J, Germscheid M, Ch'en IL, Korkina O, Teng X, Abbott D, Cuny GD, Yuan C, Wagner G, et al.: Identification of RIP1 kinase as a specific cellular target of necrostatins. Nature Chemical Biology 2008, 4:313-321. 45. He S, Wang L, Miao L, Wang T, Du F, Zhao L, Wang X: Receptor Interacting Protein Kinase-3 Determines Cellular Necrotic Response to TNF-alpha. Cell 2009, 137:1100-1111. 46. Zhang D-W, Shao J, Lin J, Zhang N, Lu B-J, Lin S-C, Dong M-Q, Han J: RIP3, an Energy Metabolism Regulator That Switches TNF- Induced Cell Death from Apoptosis to Necrosis. Science 2009, 325:332-336. 47. Rebe C, Cathelin S, Launay S, Filomenko R, Prevotat L, L'Ollivier C, Gyan E, Micheau O, Grant S, Dubart-Kupperschmitt A, et al.: Caspase-8 prevents sustained activation of NF-kappa B in monocytes undergoing macrophagic differentiation. Blood 2007, 109:1442-1450. 48. Pop C, Oberst A, Drag M, Van Raam BJ, Riedl SJ, Green DR, Salvesen GS: FLIPL induces caspase 8 activity in the absence of interdomain caspase 8 cleavage and alters substrate specificity. Biochemical Journal 2011, 433:447-457. 45 49. Cook WD, Moujalled DM, Ralph TJ, Lock P, Young SN, Murphy JM, Vaux DL: RIPK1-and RIPK3-induced cell death mode is determined by target availability. Cell Death and Differentiation 2014, 21:1600-1612. 50. Orozco S, Yatim N, Werner MR, Tran H, Gunja SY, Tait SWG, Albert ML, Green DR, Oberst A: RIPK1 both positively and negatively regulates RIPK3 oligomerization and necroptosis. Cell Death and Differentiation 2014, 21:1511-1521. 51. Fliss PM, Brune W: Prevention of Cellular Suicide by Cytomegaloviruses. Viruses-Basel 2012, 4:1928-1949. 52. Duprez L, Takahashi N, Van Hauwermeiren F, Vandendriessche B, Goossens V, Vanden Berghe T, Declercq W, Libert C, Cauwels A, Vandenabeele P: RIP Kinase- Dependent Necrosis Drives Lethal Systemic Inflammatory Response Syndrome. Immunity 2011, 35:908-918. 53. Guenther C, Martini E, Wittkopf N, Amann K, Weigmann B, Neumann H, Waldner MJ, Hedrick SM, Tenzer S, Neurath MF, et al.: Caspase-8 regulates TNF-alpha-induced epithelial necroptosis and terminal ileitis. Nature 2011, 477:335-U108. 54. Fricker M, Vilalta A, Tolkovsky AM, Brown GC: Caspase Inhibitors Protect Neurons by Enabling Selective Necroptosis of Inflamed Microglia. Journal of Biological Chemistry 2013, 288:9145-9152. 55. Burguillos MA, Deierborg T, Kavanagh E, Persson A, Hajji N, Garcia- Quintanilla A, Cano J, Brundin P, Englund E, Venero JL, et al.: Caspase signalling controls microglia activation and neurotoxicity. Nature 2011, 472:319-U214. 56. Sutterwala FS, Haasken S, Cassel SL: Mechanism of NLRP3 inflammasome activation. Year in Immunology: Myeloid Cells and Inflammation 2014, 1319:82-95. 57. Jacquel A, Benikhlef N, Paggetti J, Lalaoui N, Guery L, Dufour EK, Ciudad M, Racoeur C, Micheau O, Delva L, et al.: Colony-stimulating factor-1-induced oscillations in phosphatidylinositol-3 kinase/AKT are required for caspase activation in monocytes undergoing differentiation into macrophages. Blood 2009, 114:3633-3641. 58. Kavanagh E, Rodhe J, Burguillos MA, Venero JL, Joseph B: Regulation of caspase-3 processing by cIAP2 controls the switch between proinflammatory activation and cell death in microglia. Cell Death & Disease 2014, 5. 59. Schworer SA, Smirnova II, Kurbatova I, Bagina U, Churova M, Fowler T, Roy AL, Degterev A, Poltorak A: Toll-like Receptor-mediated Down-regulation of the Deubiquitinase Cylindromatosis ( CYLD) Protects Macrophages from Necroptosis in Wild-derived Mice. Journal of Biological Chemistry 2014, 289:14422-14433. 60. McComb S, Cessford E, Alturki NA, Joseph J, Shutinoski B, Startek JB, Gamero AM, Mossman KL, Sad S: Type-I interferon signaling through ISGF3 complex is required for sustained Rip3 activation and necroptosis in macrophages. Proceedings of the National Academy of Sciences of the United States of America 2014, 111:E3206-E3213. 61. Iwata A, Nishio K, Winn RK, Chi EY, Henderson WR, Harlan JM: A broad-spectrum caspase inhibitor attenuates allergic airway inflammation in murine asthma model. Journal of Immunology 2003, 170:3386-3391. 62. Hotchkiss RS, Chang KC, Swanson PE, Tinsley KW, Hui JJ, Klender P, Xanthoudakis S, Roy S, Black C, Grimm E, et al.: Caspase inhibitors improve survival in sepsis: a critical role of the lymphocyte. Nature Immunology 2000, 1:496- 501. 46 63. Chopra M, Sharma AC: Contractile response of norepinephrine is modulated by caspase-3 in adult rat ventricular myocytes isolated from septic rat heart. Pharmacological Research 2009, 60:303-313.