Dual Expression of the Salmonella Effector SrfJ in Mammalian Cells and Plants

fmicb-08-02410 December 4, 2017 Time: 15:0 # 1 ORIGINAL RESEARCH published: 06 December 2017 doi: 10.3389/fmicb.2017.02410 Edited by: Xihui Shen, Northwest A&F University, China Reviewed by: Dipshikha Chakravortty, Indian Institute of Science, India Miguel A. De la Cruz, Instituto Mexicano de Seguridad Social (IMSS), Mexico Eleonora Garcia Vescovi, Institute of Molecular and Cellular Biology of Rosario (IBR), Argentina *Correspondence: Francisco Ramos-Morales [email protected] Specialty section: This article was submitted to Infectious Diseases, a section of the journal Frontiers in Microbiology Received: 21 July 2017 Accepted: 21 November 2017 Published: 06 December 2017 Citation: Aguilera-Herce J, Zarkani AA, Schikora A and Ramos-Morales F (2017) Dual Expression of the Salmonella Effector SrfJ in Mammalian Cells and Plants. Front. Microbiol. 8:2410. doi: 10.3389/fmicb.2017.02410 Dual Expression of the Salmonella Effector SrfJ in Mammalian Cells and Plants Julia Aguilera-Herce1, Azhar A. Zarkani2, Adam Schikora2and Francisco Ramos-Morales1* 1Departamento de Genética, Facultad de Biología, Universidad de Sevilla, Sevilla, Spain, 2Julius Kühn-Institut – Bundesforschungsinstitut für Kulturpflanzen, Federal Research Centre for Cultivated Plants, Institute for Epidemiology and Pathogen Diagnostics, Brunswick, Germany SrfJ is an effector of the Salmonella pathogenicity island 2-encoded type III secretion system. Salmonella enterica serovar Typhimurium expresses srfJ under two disparate sets of conditions: media with low Mg2+and low pH, imitating intravacuolar conditions, and media with myo-inositol (MI), a carbohydrate that can be used by Salmonella as sole carbon source. We investigated the molecular basis for this dual regulation. Here, we provide evidence for the existence of two distinct promoters that control the expression of srfJ. A proximal promoter, PsrfJ, responds to intravacuolar signals and is positively regulated by SsrB and PhoP and negatively regulated by RcsB. A second distant promoter, PiolE, is negatively regulated by the MI island repressor IolR. We also explored the in vivo activity of these promoters in different hosts. Interestingly, our results indicate that the proximal promoter is specifically active inside mammalian cells whereas the distant one is expressed upon Salmonella colonization of plants. Importantly, we also found that inappropriate expression of srfJ leads to reduced proliferation inside macrophages whereas lack of srfJ expression increases survival and decreases activation of defense responses in plants. These observations suggest that SrfJ is a relevant factor in the interplay between Salmonella and hosts of different kingdoms. Keywords: Salmonella, SrfJ, type III secretion, myo-inositol, macrophages, plants, bioluminescence INTRODUCTION Salmonella enterica serovar Typhimurium (S. Typhimurium) is a facultative intracellular bacterial pathogen that can survive and proliferate in diverse hosts (Wiedemann et al., 2014) as well as non-host environments (Winfield and Groisman, 2003). This non-typhoidal Salmonella serovar can infect a broad range of animal species. In humans, it causes gastrointestinal infections with occasional secondary bacteremia (Chen et al., 2013). In mice, in contrast, it produces systemic infections that are similar to typhoid fever induced by S. enterica serovar Typhi in humans (Garai et al., 2012). It also causes acute enteritis and exudative diarrhea in calves, which are considered as a relevant model for non-typhoidal salmonellosis in humans (Costa et al., 2012). In addition, chickens and pigs can be asymptomatic carriers of these bacteria (Foley et al., 2007). Frontiers in Microbiology | www.frontiersin.org 1December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 2 Aguilera-Herce et al. SrfJ in Animals and Plants As a consequence, these animals are important sources of S. Typhimurium in the food chain. S. Typhimurium and other serovars can also enter the agricultural production chain. This can happen on different levels, e.g., via animal feces used for soil amendments or as post-harvest contamination. Salmonella is able to adhere to plant surface, colonize plant organs, and suppress the plant immune system (Schikora et al., 2012;Neumann et al., 2014). Therefore, plants are considered as alternative hosts for these pathogens, and fresh fruits and vegetables are recognized as an important source of food-borne disease (Wiedemann et al., 2014;Holden et al., 2015). Many virulence factors are involved during the interactions of Salmonella with its host. Prominent among them are two type III secretion systems (T3SS), heteromultimeric nanomachines specialized in the delivery of effector proteins into host cells (Deng et al., 2017). More than 30 effectors are translocated by Salmonella into the host cell through both T3SSs (Ramos-Morales, 2012). Effectors secreted by the Salmonella Pathogenicity Island 1 (SPI1)-encoded system (T3SS1) (Galán and Curtiss, 1989) promote invasion of host cells by a trigger mechanism that involves remodeling the actin cytoskeleton to form membrane ruffles that internalize the bacteria in a vacuole known as Salmonella-Containing Vacuole (SCV). This system is also involved in modulation of epithelial tight junctions (Boyle et al., 2006;Liao et al., 2008;Zhang et al., 2015; Lin et al., 2016), induction of polymorphonuclear leukocytes transepithelial migration (Zhang et al., 2006;Wall et al., 2007), control of the initial stages of the SCV biogenesis (Bakowski et al., 2008;Steele-Mortimer, 2008), inhibition of host cell exocytosis (Perrett and Zhou, 2013), and induction of rapid pyroptosis in macrophages (Fink and Cookson, 2007). The SPI2-encoded system (T3SS2) is expressed several hours after internalization and is important for SCV biogenesis, intracellular survival and proliferation, generation of Salmonella-induced tubules, and systemic infection (Hensel, 2000;Knodler and Steele-Mortimer, 2003;Liss and Hensel, 2015). SrfJ is a poorly characterized T3SS2 effector (Cordero-Alba et al., 2012). Interestingly, virulence of a S. Typhimurium strain with mutation in srfJ was mildly attenuated in mice (Ruiz-Albert et al., 2002). The SrfJ protein shares 30% amino acid sequence identity with human glucosylceramidase over 447 residues (Kim et al., 2009). Initially, it was proposed as a putative effector because the gene srfJ is positively regulated by SsrB (Worley et al., 2000), the main positive regulator of T3SS2 (Fass and Groisman, 2009). Surprisingly, we found that, in addition to the regulation by SsrB, srfJ is also negatively regulated by IolR (Cordero-Alba et al., 2012), the repressor of the myo-inositol (MI) utilization genes in S. Typhimurium (Kröger and Fuchs, 2009). Salmonella and other bacteria can use MI as the sole carbon source, and this substrate is ubiquitous in soil and plants. Here, we analyzed the molecular basis and studied the ecological relevance of the dual regulation of srfJ. We found that two distinct promoters control the expression of srfJ. The proximal (PsrfJ) responds to intravacuolar signals in animal cells, whereas the second and distant PiolE is active during plant colonization. MATERIALS AND METHODS Bacterial Strains, Bacteriophages, and Strain Construction Escherichia coli and S. Typhimurium strains used in this study are described in Table 1.Salmonella strains derived from the mouse-virulent strain ATCC 14028. Transductional crosses using phage P22HT 105/1 int201 (Schmieger, 1972) were used for strain construction (Maloy, 1990). To obtain phage-free isolates, transductants were purified by streaking on green plates. Green plates were prepared as described previously (Chan et al., 1972), except that methyl blue (Sigma) substituted aniline blue. Phage sensitivity was tested by cross-streaking with the clear-plaque mutant P22 H5 (Chan et al., 1972). Bacterial Culture The standard culture medium for S. enterica and E. coli was Luria-Bertani (LB) broth. Solid LB contained 1.5% agar (final concentration). Antibiotics were used at the following concentrations: kanamycin (Km), 50 µg/ml; chloramphenicol (Cm), 20 µg/ml; ampicillin (Ap), 100 µg/ml; and tetracycline (Tc), 20 µg/ml. For some experiments, 55.5 mM MI was added for 4 h. For SPI1-inducing conditions, Salmonella strains were grown overnight at 37◦C in LB 0.3 M NaCl medium in static conditions. For SPI2-inducing conditions, cells from cultures in LB were washed and diluted 1:125 with minimal medium at pH 5.8 (LPM) containing 80 mM 2-(N-morpholino)-ethanesulfonic acid (pH 5.8), 5 mM KCl, 7.5 mM (NH4)2SO4, 0.5 mM K2SO4, 0.1% Casamino acids, 38 mM glycerol, 337.5 µM K2HPO4–KH2PO4 (pH 7.4), and 8 µM MgCl2, and then incubated overnight at 37◦C with shaking. Two different media with plants extracts were made: Lettuce Medium (LM) contained 25% lettuce plant extract sterilized with 0.22 µm filter and 20% M9-Minimal Salts (Sigma) (Fornefeld et al., 2017); Tomato Medium (TM) contained 25% tomato plant extract sterilized with 0.22 µm filter and 20% M9-Minimal Salts. Salmonella cells from saturated cultures in LB were washed with MgCl210 mM and diluted in each plant media at OD600 0.1, and then incubated at 37◦C with shaking. All the experiments involving S. Typhimurium were carried out using the standard biosecurity procedures that include containment level 2 practices, and safety equipment and facilities. DNA Amplification with the PCR Amplification reactions were carried out in a T100 Thermal Cycler (BioRad). For plasmid constructs, the final volume of reactions was 50 µl, and the final concentration of MgCl2was 1.5 mM. Reagents were used at the following concentrations: deoxynucleoside triphosphates (dNTPs), 300 µM; primers, 0.3 µM; and Taq polymerase (KAPA HiFi DNA Polymerase; Kapa Biosystems), 1 U per reaction. The PCR program included the following steps: (i) initial denaturation for 5 min at 95◦C; (ii) 25 cycles of denaturation (98◦C, 20 s), annealing (57◦C, 15 s), and extension (72◦C, 30 s); and (iii) final incubation at 72◦C for 5 min to complete the extension. For colony PCR, the final volume of reactions was 20 µl. Reagents were used at the following Frontiers in Microbiology | www.frontiersin.org 2December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 3 Aguilera-Herce et al. SrfJ in Animals and Plants TABLE 1 | Bacterial strains and plasmids used in this study. Strain/plasmid Relevant characteristics Source/reference E. coli strains DH5αsupE44 1lacU169 (180 lacZ1M15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Hanahan, 1983 S. enterica serovar Typhimurium strainsa 14028 Wild type ATCC 55130 14028 pho-24 (PhoP constitutive) E.A. Groisman SV4608 14028 trg::MudJ KmrSegura et al., 2004 SV4699 14028 phoP7953::Tn10 Laboratory stock SV4758 14028 rcsC55 García-Calderón et al., 2005 SV5049 14028 1rcsB::CmrLaboratory stock SV5373 14028 1hilA Laboratory stock SV5452 14028 1ssrB::CmrGarcía-Calderón et al., 2007 SV5559 14028 1srfJ::lacZ KmrLaboratory stock SV5599 14028 srfJ::3xFLAG KmrCordero-Alba et al., 2012 SV6891 14028 1iolR::CmrCordero-Alba et al., 2012 SV9416 14028 1PiolE::CmrThis study Plasmids pGEM-T Easy Vector for cloning PCR products Promega pIZ2182 pSB377-PiolG1 This study pIZ2183 pSB377-PiolI1 This study pIZ2184 pSB377-PsrfJ This study pIZ2185 pSB377-PiolE This study pIZ2306 pSB377-PiolE-PsrfJ This study pKD3 bla FRT cat FRT PS1 PS2 oriR6K Datsenko and Wanner, 2000 pKD46 bla PBAD gam bet exo pSC101 oriTS Datsenko and Wanner, 2000 pSB377 Parent for luxCDABE transcriptional fusions, Apr Winson et al., 1998 aDerivatives of these strains were used as indicated in the text. concentrations: 1×MyTaq Red Reaction Buffer; primers, 0.3 µM; and Taq polymerase (MyTaq Red DNA Polymerase; Bioline), 1 U per reaction. The program included the following steps: (i) initial denaturation for 3 min at 95◦C; (ii) 25 cycles of denaturation (95◦C, 15 s), annealing (57◦C, 15 s), and extension (72◦C, 30 s–2 min); and (iii) final incubation at 72◦C for 5 min to complete the extension. Primers are listed in Table 2. PCR constructs were sequenced with an automated DNA sequencer (Stab Vida, Oeiras, Portugal) to confirm that the sequence was correct. Plasmids Plasmids used in this study are listed in Table 1. Plasmid pSB377 (Winson et al., 1998) was used to make transcriptional fusions of putative promoter regions with the luxCDABE operon from Photorhabdus luminescens. This operon encodes a bacterial luciferase whose product, the light, can be measured without disturbing the cell or adding any substrate. To make these constructions, DNA from strain 14028 was used as a template for PCR amplification with the primers listed in Table 2. The amplified fragments were digested with EcoRI and ligated with EcoRI digested and dephosphorylated pSB377. The ligation mixture was transformed into E. coli DH5αand transformants were selected in LB agar supplemented with Ap. Transformants with plasmids containing the correct transcriptional lux fusions were isolated and verified by PCR and sequencing (Stab Vida, Oeiras, Portugal). Generation of a PiolE Mutant Disruption and replacement of PiolE with a Cm resistance gene were performed as described previously (Datsenko and Wanner, 2000). Briefly, the Cm resistance gene from plasmid pKD3 was PCR amplified with primers PiolEH1P1fw and PiolEH2P2rev (Table 2). The PCR product was used to transform the wild-type strain carrying the Red recombinase expression plasmid pKD46. Mammalian Cell Culture RAW264.7 cells (murine macrophages; ECACC No. 91062702) were cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum and 2 mM L-glutamine. The 60 µg/ml penicillin and 100 µg/ml streptomycin were included in the culture media (except for bacterial infection experiments). Cells were maintained in a 5% CO2humidified atmosphere at 37◦C. Luminescence Measurements and Infection of Cultured Cells Salmonella strains were grown in triplicate in the media described above and samples of 150 µl of each culture were used to measure luminescence and OD600. Luminescence was read in Frontiers in Microbiology | www.frontiersin.org 3December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 4 Aguilera-Herce et al. SrfJ in Animals and Plants white, clear bottom 96-well plates (Corning) using a Synergy HT microplate reader (BioTek) or a Sunrise reader (Tecan). To measure luminescence of intracellular bacteria, RAW264.7 TABLE 2 | Oligonucleotides used in this study. Oligonucleotide/use Sequence (50–30) Construction of pIZ2182 PiolG1ecofw GTTCGAATTCCATGCCGCTACTGAGTAAAC PiolG1ecorev ATGCGAATTCTTAAAGTCATTTTCTGTTTCC Construction of pIZ2183 PiolI1ecofw CTGAGAATTCTGACATGATTGGTAATTTCAAATC PiolIecorev ATGCGAATTCTCAGATCGACTCCTGCCGCC Construction of pIZ2184 PsrfJecofw ATGCGAATTCTCACTGCGATGTTACCGGCG PsrfJecorev TGCAGAATTCAGGGAAGTTCCGGATAAAAGAAG Construction of pIZ2185 PiolEecofw GTCAGAATTCTCAATATCGCAAGGACTATC PiolEecorev CTGAGAATTCTGGCTCCCACTTAATGAAAC Construction of pIZ2306 PiolEecofw GTCAGAATTCTCAATATCGCAAGGACTATC PsrfJecorev TGCAGAATTCAGGGAAGTTCCGGATAAAAGAAG Deletion of PiolE PiolEH1P1fw TTCAGAATTACTTCAAAAATAAAGTAGGGAAAAC GCCCGGGTGTAGGCTGGAGCTGCTTC PiolEH2P2rev ATCCCCAACTTAATGCTCTTTTTTACATTGTAC ATATTGCCATATGAATATCCTCCTTAG qRT-PCR CHI3fw TGCAGGAACATTCACTGGAG CHI3rev TAACGTTGTGGCATGATGGT CHI9fw GAAATTGCTGCTTTCCTTGC CHI9rev CTCCAATGGCTCTTCCACAT GLUAfw GGTCTCAACCGCGACATATT GLUArev CACAAGGGCATCGAAAAGAT GLUBfw TCTTGCCCCATTTCAAGTTC GLUBrev TGCACGTGTATCCCTCAAAA PR-1afw TCTTGTGAGGCCCAAAATTC PR-1arev ATAGTCTGGCCTCTCGGACA actinfw AGGCACACACAGGTGTTATGGT actinrev AGCAACTCGAAGCTCATTGT RT-PCR Efw GGGCATCAATATTCTGGCTG G1fw ACCCTCAAAACCTGATTTCTAC G1rev TTAAGTGATCGGAGCCGATC Jrev2 GACGATGCGAAAAAGAGACC Jfw CAGACTCATCTCTTCCGATC Jrev CATGCTGTTGAATACCACGC Irev AAACGTTCCGCCAACACAAC Jfw2 GATGTCCAGGAAAGGCGTTG 50-RACE 5RaceNested GACACTGACATGGACTGAAGGA Erev GAAACAACGGCGACATATGC Erev2 ATCATTGCGCCAACCGATAG Jrev CATGCTGTTGAATACCACGC Jrev2 GACGATGCGAAAAAGAGACC Gene Racer RNA Oligo UGGAGCACGAGGACACUGACAU GGACUGAAGGAGUAGAAA cells were plated into white, clear bottom, 96-well plates at 3×104cells per well, and were infected 24 h later with noninvasive bacteria. For that purpose, bacteria were grown in LB medium for 24 h at 37◦C with shaking and were added at a multiplicity of infection (MOI) of 500. Bacteria were centrifuged onto the cell monolayer at 200 g for 5 min and then incubated at 37◦C with 5% CO2. The cell culture was washed twice with phosphate-buffered saline (PBS) 30 min post-infection (p.i.), overlaid with DMEM containing 100 µg/ml gentamicin, and incubated for 1 h and 30 min. The culture was then washed twice with PBS, covered with DMEM with gentamicin (16 µg/ml), and incubated for 24 h. Luminescence was measured 2, 4, 8, and 24 h p.i. and the numbers of CFU per well were calculated after incubation with 1% Triton X-100 in PBS for 10 min at 37◦C to release bacteria, plating appropriate dilutions in LB with Ap, and counting colonies after 24 h of incubation at 37◦C. For proliferation assays, infections were carried out using a mix of two strains, as indicated in the Section “Result.” Competitive index for proliferation was calculated as previously described (Segura et al., 2004) after plating appropriate dilutions and enumerating colonies of both strains. Bacteria were recovered 1.25 h p.i. (input) and 24 h p.i. (output). RNA Extraction and Reverse Transcription Bacterial strains were grown overnight in LPM or LB. Thereafter, 4 ml of each strain were pelleted and resuspended in 100 µl of water containing 3 mg/ml lysozyme. RNA from these lysates was isolated with 1 ml of TRIzol reagent (Invitrogen) by using the protocol supplied by the manufacturer. An additional step of phenolization or the kit Direct-zolTM RNA MiniPrep Plus (Zymo Research) was carried out to obtain pure samples. RNA (∼1µg) was reverse transcribed into cDNA with the Quantitect Reverse Transcriptase (Qiagen) before carrying out PCR with appropriate primers. 50-RACE Fifteen micrograms of RNA was used to determine the cDNA 50- end (Bensing et al., 1996;Saito et al., 2009). RNAs were prepared either with or without RNA 50-Pyrophosphohydrolase (RppH) (New England BioLabs) to distinguish primary transcript 50- ends from internal 50-processing sites. DNA primers Jrev and Erev were used for cDNA synthesis with SuperScript III Reverse Transcriptase (Invitrogen) after fusing the GeneRacer RNA Oligo to the isolated RNA. Additional primers for subsequent PCR amplification of cDNAs were GeneRacer 50-nested primer, homologous to the adaptor GeneRacer RNA oligo, Erev2 and Jrev2. PCR products that were detected both with and without tobacco acid pyrophosphatase treatment were purified by using a PCR clean-up system kit (Promega) and cloned by using the pGEM-T Easy kit (Promega), and three clones of each candidate were sequenced. Western Blotting and Antibodies Protein lysates were prepared in SDS–PAGE sample buffer. Proteins were separated by SDS–PAGE in 12% polyacrylamide Frontiers in Microbiology | www.frontiersin.org 4December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 5 Aguilera-Herce et al. SrfJ in Animals and Plants gels and electrophoretically transferred to nitrocellulose filters for Western blot analysis using anti-Flag M2 monoclonal antibodies (1:5000; Sigma) or anti-GroEL polyclonal antibodies (1:30,000; Sigma). Goat anti-mouse IgG IRDye 800CW and goat anti-rabbit IgG IRDye 680RD (LICOR) were used as secondary antibodies. Bands were detected using and Odyssey Fc infrared imaging system (LICOR). Plant Cultivation Tomato (Solanum lycopersicum) seeds were surface sterilized in 2% natrium hypochlorite solution (10 ml) for 10 min. The seeds were then washed vigorously six times with sterile distilled water. Seeds were germinated during 1 week in Petri dishes with sterile 0.5×Murashige and Skoog (MS) medium (Sigma). Seedlings were grown in sterile conditions in 0.25×MS medium (Sigma) in a cabinet with a light intensity of 150 µmol ×m2/s (16 h photoperiod) for a further 2 weeks at 22◦C. Bacterial Colonization of Tomato Plants Salmonella enterica serovar Typhimurium strain 14028 carrying derivatives of plasmid pSB377 (empty, PiolE, PsrfJ, PiolE–PsrfJ) was used to spray 3-week-old tomato plants grown in sterile conditions. Bacteria were grown 1 day before the infection on LM or TM plates. Three tomato plants were spray-inoculated with bacteria suspended in 10 mM MgCl2at OD600 0.1. Tomato plants were imaged 2 days p.i. with an X-ray film exposed for 48 h. Bacterial Survival in Plants To prepare the bacterial inoculum, bacteria were grown on solid LM and then suspended in 10 mM MgCl2and diluted to an OD600 =0.01. Leaves of tomato and lettuce (Lactuca sativa) were syringe infiltrated with bacterial solutions, the inoculated leaf areas were sampled 3 h (day 0), 7 days, and 14 days after the inoculation. Serial dilutions were plated on XLD agar to determine the CFU numbers. The experiments were repeated three times with six plants per experiment. Analysis of Defense Gene Expression Using Quantitative Real-Time PCR (qRT-PCR) Total RNA from plant leaves was extracted with TRIZOL reagent (Ambion) and treated with DNase I (Quanta BioSciences) following the suppliers’ protocols. Poly A-tailed RNA (1 µg) was converted to cDNA using the qScript cDNA Synthesis Kit (Quanta BioSciences) and oligo-dT primers. qRT-PCR reactions were performed in triplicates with the Maxtra SYBR Green Master Mix (Fermentas) and run on a BioRad iCycler according to the manufacturer’s instructions. The primers used for the qRT-PCR are presented in Table 2. Relative gene expression was normalized to the expression of actin transcript. Expression levels were compared to the control (10 mM MgCl2). Data were processed with the iQ software (BioRad). Statistical Analysis Student’s t-test was used to analyze every competitive index against the null hypothesis that the mean is not significantly different from 1. This test was also used to compare mean survival of mutants and wild-type Salmonella strains in plants, as well as expression levels of defense response genes after colonization with different Salmonella strains. P-values of 0.05 or less were considered significant. RESULTS Identification of Promoter Regions Driving the Expression of srfJ Previous data showed expression of srfJ under two disparate conditions: culture medium imitating the intravacuolar environment (LPM) and culture medium supplemented with MI (Cordero-Alba et al., 2012). To understand this dual expression at the molecular level, we explored the genomic region around the srfJ gene. As shown in Figure 1A, this gene resides inside the MI utilization island (Kröger and Fuchs, 2009), with iolE and iolG1 upstream and iolI1 downstream of srfJ. Promoter activities for regions upstream of these genes (putatively called PiolE, PiolG1, PsrfJ, and PiolI1) were tested using plasmid pSB377 (Winson et al., 1998) that carries a promoterless version of the luxCDABE operon of P. luminescens that encodes the luciferase LuxAB subunits and a fatty acid reductase complex involved in synthesis of the fatty aldehyde substrate for the luminescence reaction (Meighen, 1991). This reporter system allows continuous monitoring of light production without disrupting the bacteria or the infected host. Plasmids were introduced in wild-type S. Typhimurium strain 14028 and the luminescence was measured after growth in three different culture conditions: LPM at pH 5.8 with high aeration for SPI2-inducing conditions, LB with 0.3 M NaCl without aeration for SPI1-inducing conditions, and the later medium supplemented with MI to induce expression of the iol genes. Only DNA fragments upstream of iolE and srfJ coding regions showed promoter activity (Figure 1B). Interestingly, PiolE was specifically active in the presence of MI whereas PsrfJ was only active upon SPI2-inducing conditions. These results suggest that expression of srfJ is driven by two promoters: a distal promoter, PiolE, and a proximal promoter, PsrfJ, depending on the environmental conditions. Additional support for these conclusions was obtained studying the production of a chromosomically tagged version of the protein SrfJ by immunoblot. As shown in Figure 1C, SrfJ-3xFLAG was detected in extracts from bacteria grown in minimal LPM medium and in rich LB medium supplemented with MI. In a 1PiolE background, however, the protein was detected only in LPM, confirming that the distal promoter, PiolE, is specifically necessary for MI-dependent induction of srfJ. Differential Regulation of PiolE and PsrfJ In order to study the regulation of both promoters, the corresponding plasmids were transferred into different genetic backgrounds. We tested the effect of null mutations in genes encoding relevant regulators: IolR, SsrB, PhoP, and RcsB. IolR is the negative regulator of the MI utilization island (Kröger and Fuchs, 2009). SsrB is encoded in SPI2 and is the main positive Frontiers in Microbiology | www.frontiersin.org 5December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 6 Aguilera-Herce et al. SrfJ in Animals and Plants FIGURE 1 | Activity of the putative promoter regions in response to LPM and myo-inositol (MI). (A) Representation of the coding regions of srfJ and surrounding genes in S. Typhimurium strain 14028. The distance between vertical lines represents 1 kb. (B) Fragments of DNA upstream the coding regions of genes iolE,iolG1, srfJ, and iolI1 were cloned into plasmid pSB377 to generate luxCDABE transcriptional fusions. These plasmids were introduced into S. Typhimurium strain 14028 and luminescence was measured in cultures grown until stationary phase in LPM, LB 0.3 M NaCl, and LB 0.3 M NaCl with MI. RLU, relative light units. (C) Extracts of a derivative of S. Typhimurium 14028 expressing 3xFLAG-tagged SrfJ were resolved by 12% SDS–PAGE. Immunoblotting was performed with monoclonal anti-FLAG antibodies. Anti-GroEL antibodies were used as loading control. Media tested were LPM, LB, LB with 0.3 M NaCl (LB 0.3), and LB 0.3 M NaCl with MI (LB 0.3 MI). Molecular mass markers are indicated on the left. regulator of the island (Cirillo et al., 1998). PhoP positively regulates SPI2 through SsrB (Bijlsma and Groisman, 2005). RcsB is the response regulator of the Rcs phosphorelay system (Stout and Gottesman, 1990;Chen et al., 2001). In Salmonella, it positively or negatively regulates genes in SPI1 and SPI2 depending on the level of activation (Wang et al., 2007;Wang and Harshey, 2009). We also used the allele rcsC55 that causes constitutive activation of the Rcs system (García-Calderón et al., Frontiers in Microbiology | www.frontiersin.org 6December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 7 Aguilera-Herce et al. SrfJ in Animals and Plants 2005). Analysis of the expression patterns in the different genetic backgrounds (Figure 2) indicates that IolR negatively regulates PiolE, whereas PsrfJ is positively regulated by PhoP and SsrB. In addition, PsrfJ is also negatively regulated by the Rcs global regulatory system, since the activating mutation rcsC55 abrogates expression of the lux reporter from this promoter. Interestingly, a transcriptional lux fusion with 2357 bp upstream of srfJ containing both promoters and the intervening genes (PiolE–PsrfJ) is regulated by IolR, PhoP, SsrB, and Rcs, recapitulating the regulation patterns observed with the isolated promoters (Figures 2B,D). Characterization of Transcriptional Units Containing srfJ Results presented above suggest that two different promoters can initiate the expression of srfJ. This would result in RNAs of different lengths. To test this hypothesis, RT-PCR was performed using primers designed to amplify different fragments in the srfJ region (Figure 3A). RNA was obtained from two sources: (i) wild-type S. Typhimurium incubated in LPM, where PsrfJ is expected to be active, and (ii) iolR mutant strain incubated in LB, where the absence of IolR repressor should lead to constitutive expression from PiolE. Positive and negative controls were carried out using genomic DNA and non-retrotranscribed RNA, respectively. As seen in Figure 3B, RT-PCR carried out on RNA from wild-type bacteria incubated in LPM yielded only an internal fragment of srfJ. In contrast, fragments partially expanding iolE–iolG1 and iolG1–srfJ were obtained when RTPCR was carried out using RNA from the iolR mutant, indicating that these genes are transcriptionally linked when PiolE is derepressed. 50-RACE was used for the determination of both transcriptional start sites. They were located 99 and 33 bp upstream of the coding regions of iolE and srfJ, respectively (Figure 3C). These results confirm that srfJ belongs to two different transcriptional units: a short transcriptional unit with FIGURE 2 | Regulation of PiolE and PsrfJ promoters. Fragments of DNA containing the promoters of iolE (PiolE)(A) or srfJ (PsrfJ)(C) or the region containing from the promoter of iolE to the promoter of srfJ, including genes iolE and iolG1 (PiolE–PsrfJ)(B,D) were cloned into plasmid pSB377 to generate luxCDABE transcriptional fusions. These plasmids were introduced into S. enterica serovar Typhimurium strain 14028 or derivatives with null mutations in iolR,ssrB,phoP,rcsB, or a point mutation in rcsC (rcsC55) that confers constitutive activation to the Rcs system. Luminescence was measured in cultures grown until stationary phase in LB 0.3 M NaCl (A,B) and LPM (C,D). RLU, relative light units. Frontiers in Microbiology | www.frontiersin.org 7December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 8 Aguilera-Herce et al. SrfJ in Animals and Plants FIGURE 3 | Transcriptional organization of the srfJ region. (A) Organization of the chromosomal region containing the srfJ gene in S. Typhimurium strain 14028. Vertical lines are separated by 1 kb. The arrows indicate the positions and orientations of the primers that were used for RT-PCR. (B) Agarose gel of the products obtained with the following primers: 1, Efw and G1rev; 2, G1fw and Jrev2; 3, Jfw and Jrev; and 4, Jfw2 and Jrev. RT-PCR was carried out on RNA isolated from cultures on LPM of the wild-type strain (wt, RT RNA LPM) and cultures in LB of the iolR mutant strain (iolR, RT RNA LB). PCR were also carried out on genomic DNA (gDNA) as positive control and non-retrotranscribed RNA as negative control (RNA LPM and RNA LB). Vertical arrows indicated lanes with amplified products after retrotranscription. The molecular weight marker is the 1 kb DNA ladder (NIPPON Genetics). (C) 50-RACE was carried out on RNA isolated from cultures in LB of the iolR mutant to map the transcriptional start site of iolE and from cultures in LPM of the wild-type strain to map the transcriptional start site of srfJ. The sequences surrounding the transcriptional start sites (+1) and the start of the coding regions are shown. RBS, ribosomal binding site. PsrfJ as promoter and an operon including genes iolE,iolG1, and srfJ with PiolE as promoter. Expression of srfJ Inside Macrophages Salmonella enterica serovar Typhimurium is known to infect macrophages and express the T3SS2 several hours p.i. (Drecktrah et al., 2006). Since SrfJ is an effector of this secretion system, it is expected to be produced inside macrophages. To ascertain the relevance in this context of the two promoters that drive the expression of srfJ,Salmonella strains carrying PiolE::lux or PsrfJ::lux transcriptional fusions were used to infect RAW264.7 macrophages. The luminescence resulting from the activity of the lux operon driven by PsrfJ increased over time during the infection (Figure 4A). In these conditions the PiolE promoter was not active. Expression of srfJ in internalized bacteria was also studied by immunoblot using a strain of Salmonella that expresses a chromosomally 3xFLAG- tagged version of SrfJ. Intracellular expression was detected both in a wild-type background and in a strain lacking the distal promoter PiolE (Figure 4B). These results suggest that Frontiers in Microbiology | www.frontiersin.org 8December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 9 Aguilera-Herce et al. SrfJ in Animals and Plants FIGURE 4 | Activity of PiolE and PsrfJ during macrophage infection. (A) The wild-type strain of S. Typhimurium carrying a plasmid expressing PiolE::luxCDABE or PsrfJ::luxCDABE transcriptional fusions was grown for 24 h in LB at 37◦C with aeration (non-invasive conditions). These bacteria were used to infect RAW264.7 murine macrophage-like cells and luminescence produced by intracellular bacteria was measured 2, 4, 8, and 24 h p.i. RLU, relative light units. (B) The wild-type strain of S. Typhimurium (14028) and derivatives expressing a 3xFLAG-tagged form of SrfJ in a wild-type (wt) background or in a 1PiolE background were grown under non-invasive conditions and used to infect RAW264.7 cells. Expression of srfJ was measured 8 h p.i. by immunoblot using anti-FLAG antibodies. Anti-GroEL antibodies were used as loading control. Molecular mass markers, in kDa, are indicated on the left. srfJ expression is induced in response to intravacuolar signals and that the induction depends specifically on the proximal promoter. Contribution of SrfJ to Proliferation of Salmonella in Macrophages Since the srfJ mutant is attenuated in mice (Ruiz-Albert et al., 2002), we decided to explore the possibility that this mutant could also have a defect in survival and proliferation inside macrophages. This was assessed calculating the competitive index in RAW264.7 macrophages of the srfJ mutant against the trg::MudJ strain, which is wild-type for intracellular proliferation (Segura et al., 2004). No significant defect was detected for this FIGURE 5 | Effect of the expression of srfJ in intracellular proliferation. Analysis of intracellular proliferation of srfJ,iolR, and srfJ iolR mutants in mixed infections with a trg::MudJ mutant or the 14028 strain (wt) used as control strains. The competitive indices are the mean from three infections. Error bars represent the standard deviations. Asterisks denote that the indices are significantly different from 1 for a t-test: ∗P-value <0.05, ∗∗ P-value <0.01. mutant (P>0.05; Figure 5). We also tested the effect of a null mutation in iolR and we found a very significant defect in intracellular proliferation (Figure 5). Since the iolR mutation leads to derepression of srfJ transcription (Figure 2), we then measured the intracellular proliferation of the double null mutant iolR srfJ. Interestingly, the srfJ mutation suppressed the effect of the iolR mutation on macrophages (Figure 5), suggesting that the proper regulation of the expression of srfJ is essential for survival and/or proliferation of S. Typhimurium inside murine macrophages. Expression of srfJ in the Presence of Plant Extracts The results obtained in macrophages confirmed our hypothesis and proved that SrfJ, as a T3SS2 effector, depends on PsrfJ, the promoter that is induced in media imitating intravacuolar conditions. In contrast, it is more difficult to understand the physiological role of the expression of srfJ from the distal promoter, PiolE. In order to investigate the significance of the double regulation we analyzed different environments known to host Salmonella, one of them are plants. Salmonella is able to thrive and proliferate in plants, including crop plants designated for direct consumption, e.g., lettuce or tomatoes. Thus, we reasoned that since most plants produce MI, PiolE could be relevant in allowing transcription of srfJ in these alternative hosts. We therefore explored the expression of srfJ in response to plant signals. Salmonella with lux transcriptional fusions were grown in LB or in media supplemented with lettuce (LM) or tomato (TM) extracts. We detected high level of luminescence 24 h after the inoculation of LM or TM media with Salmonella Frontiers in Microbiology | www.frontiersin.org 9December 2017 | Volume 8 | Article 2410 fmicb-08-02410 December 4, 2017 Time: 15:0 # 16 Aguilera-Herce et al. SrfJ in Animals and Plants Ramos-Morales, F. (2012). Impact of Salmonella enterica Type III secretion system effectors on the eukaryotic host cell. ISRN Cell Biol. 2012:787934. doi: 10.5402/ 2012/787934 Ruiz-Albert, J., Yu, X.-J., Beuzón, C. R., Blakey, A. N., Galyov, E. E., and Holden, D. W. (2002). Complementary activities of SseJ and SifA regulate dynamics of the Salmonella typhimurium vacuolar membrane. Mol. Microbiol. 44, 645–661. Saddoughi, S. A., and Ogretmen, B. (2013). Diverse functions of ceramide in cancer cell death and proliferation. Adv. Cancer Res. 117, 37–58. doi: 10.1016/B978-0- 12-394274-6.00002-9 Saito, S., Kakeshita, H., and Nakamura, K. (2009). Novel small RNA-encoding genes in the intergenic regions of Bacillus subtilis.Gene 428, 2–8. doi: 10.1016/ j.gene.2008.09.024 Schikora, A., Garcia, A. V., and Hirt, H. (2012). Plants as alternative hosts for Salmonella.Trends Plant Sci. 17, 245–249. doi: 10.1016/j.tplants.2012.03.007 Schikora, A., Virlogeux-payant, I., Bueso, E., Garcia, A. V., Nilau, T., Pelletier, S., et al. (2011). Conservation of Salmonella infection mechanisms in plants and animals. PLOS ONE 6:e24112. doi: 10.1371/journal.pone.0024112 Schmieger, H. (1972). Phage P22-mutants with increased or decreased transduction abilities. Mol. Gen. Genet. 119, 75–88. Segura, I., Casadesús, J., and Ramos-Morales, F. (2004). Use of mixed infections to study cell invasion and intracellular proliferation of Salmonella enterica in eukaryotic cell cultures. J. Microbiol. Methods 56, 83–91. doi: 10.1016/j.mimet. 2004.03.013 Shirron, N., and Yaron, S. (2011). Active suppression of early immune response in tobacco by the human pathogen Salmonella Typhimurium. PLOS ONE 6:e18855. doi: 10.1371/journal.pone.0018855 Steele-Mortimer, O. (2008). The Salmonella-containing vacuole: moving with the times. Curr. Opin. Microbiol. 11, 38–45. doi: 10.1016/j.mib.2008.01.002 Stout, V., and Gottesman, S. (1990). RcsB and RcsC: a two-component regulator of capsule synthesis in Escherichia coli.J. Bacteriol. 172, 659–669. Ton, J., De Vos, M., Robben, C., Buchala, A., Métraux, J.-P., Van Loon, L. C., et al. (2002). Characterization of Arabidopsis enhanced disease susceptibility mutants that are affected in systemically induced resistance. Plant J. 29, 11–21. Tran, T.-K., Han, Q.-Q., Shi, Y., and Guo, L. (2016). A comparative proteomic analysis of Salmonella typhimurium under the regulation of the RstA/RstB and PhoP/PhoQ systems. Biochim. Biophys. Acta 1864, 1686–1695. doi: 10.1016/j. bbapap.2016.09.003 Uehara, T., Sugiyama, S., Matsuura, H., Arie, T., and Masuta, C. (2010). Resistant and susceptible responses in tomato to cyst nematode are differentially regulated by salicylic acid. Plant Cell Physiol. 51, 1524–1536. doi: 10.1093/pcp/ pcq109 Üstün, S˛., Müller, P., Palmisano, R., Hensel, M., Börnke, F., Ustün, S., et al. (2012). SseF, a type III effector protein from the mammalian pathogen Salmonella enterica, requires resistance-gene-mediated signalling to activate cell death in the model plant Nicotiana benthamiana.New Phytol. 194, 1046–1060. doi: 10.1111/j.1469-8137.2012.04124.x Wall, D. M., Nadeau, W. J., Pazos, M. A., Shi, H. N., Galyov, E. E., and McCormick, B. A. (2007). Identification of the Salmonella enterica serotype Typhimurium SipA domain responsible for inducing neutrophil recruitment across the intestinal epithelium. Cell. Microbiol. 9, 2299–2313. doi: 10.1111/j.1462-5822. 2007.00960.x Wang, Q., and Harshey, R. M. (2009). Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility. Mol. Microbiol. 74, 71–84. doi: 10.1111/j.1365-2958. 2009.06851.x Wang, Q., Zhao, Y., McClelland, M., and Harshey, R. M. (2007). The RcsCDB signaling system and swarming motility in Salmonella enterica serovar typhimurium: dual regulation of flagellar and SPI-2 virulence genes. J. Bacteriol. 189, 8447–8457. doi: 10.1128/JB.01198-07 Warnecke, D., and Heinz, E. (2003). Recently discovered functions of glucosylceramides in plants and fungi. Cell. Mol. Life Sci. 60, 919–941. doi: 10.1007/s00018-003-2243-4 Wiedemann, A., Virlogeux-Payant, I., Chaussé, A.-M., Schikora, A., and Velge, P. (2014). Interactions of Salmonella with animals and plants. Front. Microbiol. 5:791. doi: 10.3389/fmicb.2014.00791 Winfield, M. D., and Groisman, E. A. (2003). Role of nonhost environments in the lifestyles of Salmonella and Escherichia coli.Appl. Environ. Microbiol. 69, 3687–3694. Winson, M. K., Swift, S., Hill, P. J., Sims, C. M., Griesmayr, G., Bycroft, B. W., et al. (1998). Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol. Lett. 163, 193–202. doi: 10.1016/S0378-1097(98)00173-6 Worley, M. J., Ching, K. H. L., and Heffron, F. (2000). Salmonella SsrB activates a global regulon of horizontally acquired genes. Mol. Microbiol. 36, 749–761. doi: 10.1046/j.1365-2958.2000.01902.x Xu, X., and Hensel, M. (2010). Systematic analysis of the SsrAB virulon of Salmonella enterica.Infect. Immun. 78, 49–58. doi: 10.1128/IAI.00931-09 Zhang, Y., Higashide, W. M., McCormick, B. A., Chen, J., and Zhou, D. (2006). The inflammation-associated Salmonella SopA is a HECT-like E3 ubiquitin ligase. Mol. Microbiol. 62, 786–793. doi: 10.1111/j.1365-2958.2006.05407.x Zhang, Y., Wu, S., Ma, J., Xia, Y., Ai, X., and Sun, J. (2015). Bacterial protein AvrA stabilizes intestinal epithelial tight junctions via blockage of the C-Jun N-terminal kinase pathway. Tissue Barriers 3:e972849. doi: 10.4161/21688362. 2014.972849 Zwir, I., Shin, D., Kato, A., Nishino, K., Latifi, T., Solomon, F., et al. (2005). Dissecting the PhoP regulatory network of Escherichia coli and Salmonella enterica.Proc. Natl. Acad. Sci. U.S.A. 102, 2862–2867. doi: 10.1073/pnas. 0408238102 Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Copyright © 2017 Aguilera-Herce, Zarkani, Schikora and Ramos-Morales. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms. Frontiers in Microbiology | www.frontiersin.org 16 December 2017 | Volume 8 | Article 2410