Contribution of Efflux Pumps, Porins, and B-Lactamases to Multidrug Resistance in Clinical Isolates of Acinetobacter baumannii

Contribution of Efflux Pumps, Porins, and ␤-Lactamases to Multidrug Resistance in Clinical Isolates of Acinetobacter baumannii C. Rumbo, a E. Gato, a M. López, a C. Ruiz de Alegría, b F. Fernández-Cuenca, c L. Martínez-Martínez, b J. Vila, d J. Pachón, e J. M. Cisneros, e J. Rodríguez-Baño, c A. Pascual, c G. Bou, a M. Tomás, a on behalf of the Spanish Group of Nosocomial Infections and Mechanisms of Action and Resistance to Antimicrobials (GEIH-GEMARA) from the Spanish Society of Clinical Microbiology and Infectious Diseases (SEIMC) and the Spanish Network for Research in Infectious Diseases (REIPI) Department of Microbiology, Complejo Hospitalario Universitario a Coruña-INIBIC, La Coruña, Spain a ; Department of Clinical Microbiology, Hospital Universitario Marqués de Valdecilla-IFIMAV, Santander, Spain b ; Clinical Unit of Infectious Diseases and Microbiology, Hospital Universitario Virgen Macarena, Seville, Spain c ; Department of Clinical Microbiology, Hospital Clinic-CRESIB, School of Medicine, University of Barcelona, Barcelona, Spain d ; Institute of Biomedicine of Seville (IBiS), University Hospital Virgen del Rocío/CSIC/University of Seville, Seville, Spain e We investigated the mechanisms of resistance to carbapenems, aminoglycosides, glycylcyclines, tetracyclines, and quinolones in 90 multiresistant clinical strains of Acinetobacter baumannii isolated from two genetically unrelated A. baumannii clones: clone PFGEROC-1 (53 strains producing the OXA-58 ␤-lactamase enzyme and 18 strains with the OXA-24 ␤-lactamase) and clone PFGE-HUI-1 (19 strains susceptible to carbapenems). We used real-time reverse transcriptase PCR to correlate antimicrobial resistance (MICs) with expression of genes encoding chromosomal ␤-lactamases (AmpC and OXA-51), porins (OmpA, CarO, Omp33, Dcap-like, OprB, Omp25, OprC, OprD, and OmpW), and proteins integral to six efflux systems (AdeABC, AdeIJK, AdeFGH, CraA, AbeM, and AmvA). Overexpression of the AdeABC system (level of expression relative to that by A. baumannii ATCC 17978, 30- to 45-fold) was significantly associated with resistance to tigecycline, minocycline, and gentamicin and other biological functions. However, hyperexpression of the AdeIJK efflux pump (level of expression relative to that by A. baumannii ATCC 17978, 8- to 10-fold) was significantly associated only with resistance to tigecycline and minocycline (to which the TetB efflux system also contributed). TetB and TetA(39) efflux pumps were detected in clinical strains and were associated with resistance to tetracyclines and doxycycline. The absence of the AdeABC system and the lack of expression of other mechanisms suggest that tigecycline-resistant strains of the PFGE-HUI-1 clone may be associated with a novel resistance-nodulation-cell efflux pump (decreased MICs in the presence of the inhibitor Phe-Arg ␤-naphthylamide dihydrochloride) and the TetA(39) system. Acinetobacter baumannii is an important pathogen that causes nosocomial infections associated with high morbidity and mortality (1). Multidrug-resistant (MDR) strains of A. baumannii have emerged in the last few decades as a result of the combination of two main factors: (i) a high level of genomic plasticity (2) and (ii) mutation of endogenous genes, alteration of which is associated with antimicrobial resistance, such as overexpression of the chromosomally encoded ADC ␤-lactamase (AmpC) (3) and the OXA-51-like ␤-lactamase (4), loss of expression of porins (CarO and Omp33) (5,6), mutation in the gyrA and parC genes (7), and overexpression of efflux systems (8). Overexpression of the OXA-51-like ␤-lactamase has been associated with resistance to carbapenems and decreased expression of CarO and Omp33 (5,6,9). Efflux pumps have multifactorial roles. These mechanisms are important for detoxification of intracellular metabolites, bacterial virulence (in both animal and plant hosts), intercellular signaling and trafficking, and cell homeostasis (10). Three resistance-nod- ulation-cell division (RND) systems, AdeABC, AdeIJK, and AdeFGH, have been characterized and reported to cause MDR in A. baumannii (8). AdeABC is the RND system most frequently involved in MDR in clinical strains; it has been found in approximately 80% of clinical isolates (the rates reported vary from 53% to 97%) (11) but was not detected in 32 environmental isolates (12). AdeRS is a two-component system that regulates AdeABC expression (13). Mutations in this system and the presence of an ISAba1 insertion sequence in this system can lead to overexpression of the AdeABC operon (13–15). However, strains of A. baumannii that express AdeABC without mutations have been found in association with AdeRS (16,17). Recently, the adeN gene has been found to be associated with the regulation of the AdeIJK system (18), and mutations in the adeL gene have been associated with overexpression of the AdeFGH pump (11). Three other types of efflux systems have been described in A. baumannii: CraA (a major facilitator superfamily [MFS] pump), which confers intrinsic chloramphenicol resistance (19); AbeM (a member of the multidrug and toxic compound extrusion [MATE] family of pumps), which extrudes several antimicrobials and biocides (20); and AmvA (an MFS pump), which confers resistance to detergents, disinfectants, dyes, and erythromycin. Overexpression of the AmvA efflux pump has been associated with increased drug resistance in A. baumannii clinical isolates (21). Finally, several tetracycline efflux pumps (systems acquired from the MFS superfamily) have been described in A. baumannii. The most prevalent of these are TetA, which is associated with resistance to tetracycline, and TetB, which is implicated in resistance to tetracycline, doxy- Received 10 April 2013 Returned for modification 19 May 2013 Accepted 3 August 2013 Published ahead of print 12 August 2013 Address correspondence to G. Bou, [email protected], or M. Tomás, [email protected]. Copyright © 2013, American Society for Microbiology. All Rights Reserved. doi:10.1128/AAC.00730-13 November 2013 Volume 57 Number 11 Antimicrobial Agents and Chemotherapy p. 5247–5257 aac.asm.org 5247 cycline, and minocycline (8). TetA(39) is an important tetracycline resistance mechanism in clinical strains (22). Because of the complexity of clinical strains of A. baumannii, many researchers have used ATCC reference strains to investigate the mechanisms of resistance. However, very few studies have analyzed the combinations of mechanisms and their interrelation in clinical isolates of Acinetobacter baumannii. Here, we studied the interplay between the mechanisms of multidrug resistance in clinical A. baumannii strains, particularly those involving efflux pumps, the influx of antimicrobials, and chromosomally encoded ␤-lactamases. MATERIALS AND METHODS Bacterial isolates and molecular typing. In 2010, 444 strains of A. baumannii were isolated (from 273 patients) in 42 participating hospitals and identified as part of the second multicenter study on this pathogen in Spain (GEIH-REIPI-2010-Ab) (23). The strains were identified by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometry (24) and amplified rRNA gene restriction analysis (ARDRA) (25). Species identification was confirmed by detection of the OXA-51 gene by PCR (26) and also by detection of the bsp gene (a novel target) by real-time quantitative PCR (27,28). The clonal relationship between all strains displaying various levels of antibiotic susceptibility (n⫽71) from a hospital in southern Spain and a hospital in the Canary Islands (n⫽19) was determined by pulsed-field gel electrophoresis (PFGE) (29,30) of samples of chromosomal DNA digested with ApaI (Roche, Mannheim, Germany) and embedded in lowmelting point agarose. The restriction fragments thus obtained were separated in a CHEF DR-III system (Bio-Rad, Hercules, CA). FPQuest II software, version 4.5 (Bio-Rad), was used to analyze the band patterns in the agarose gel electrophoresis images (cutoff ⫽85%). Strains of both clones were analyzed by multilocus sequence typing, according to the system developed by Nemec and coworkers (31). Susceptibility testing. The antibiotic susceptibility profile was determined according to CLSI recommendations (23). In strains of the PFGEHUI-1 clone, we determined MICs in the presence of Phe-Arg ␤-naph- thylamide dihydrochloride (PAbetaN; a commonly assumed inhibitor of the RND efflux pump) (32). DNA amplifications studies. We used PCR to detect the genes coding for common aminoglycoside-modifying enzymes (AacA4, AacC1, AacC2, AadB, AadA1, AphA1, AphA6, and AadA2) (33); CHDL enzymes (OXA- 23, -24, -51, -58, and -143) (34,35); MBL enzymes (IMP, VIM, SPM-1, GIM-1, SIM-1, BIC, DIM, and NDM) (36); extended-spectrum ␤-lacta- mases (ESBLs), such as GES enzymes; and carbapenemases, such as KPC enzymes. We sequenced the gyrA and parC genes to study the presence of the mutations. Finally, we analyzed the tet genes most commonly detected in isolates of A. baumannii [tetA,tetB,tetA(34), and tetA(39)] (37,38). Real-time RT-PCR studies. We used real-time reverse transcriptase PCR (RT-PCR) to examine all isolates for expression of adeB,adeJ,adeG, abeM,craA, and amvA (genes belonging to efflux pumps systems); oprC, oprD,ompW,ompA,carO,omp33,dcap-like, oprB, and omp25 (genes harboring porins or outer membrane protein); and finally, the OXA-51 and ampC ␤-lactamase genes. We obtained DNase-treated RNA from latelog-phase cultures (optical density ⫽0.4 to 0.6 absorbance units) by using a High Pure RNA isolation kit (Roche, Germany) and 50 ng of RNA. Analysis of controls without reverse transcriptase confirmed the absence of contaminating DNA in the samples. We used a LightCycler 480 RNA master hydrolysis probe (Roche, Germany) for the RT-PCR studies. The Universal Probe Library (UPL) TaqMan probes (Roche, Germany) and primers used are listed in Table 1. All were designed from conserved regions of DNA after the alignment of the genomes of the following strains of A. baumannii: AB 307-0294, AB 0057, ACICU, SDF, AYE, and ATCC 17978. We adjusted the concentrations of the samples to achieve efficiencies of 90% to 110% and performed all experiments in triplicate from three RNA extractions. For each strain, we normalized the levels of expression of all genes relative to those of the single-copy housekeeping genes rpoB and gyrB. We then calibrated the normalized expression of each gene of interest relative to its expression by A. baumannii ATCC 17978, which was assigned a value of 1.0. Sequencing of the genes regulating AdeABC and AdeIJK efflux pumps. We sought mutations in the regulatory genes adeR-adeS and adeN, which have previously been associated with upregulation of the AdeABC and AdeIJK efflux systems, respectively. We amplified the genes by using the primers listed in Table 1. We used the Macrogen program (Macrogen Europe, Amsterdam, Netherlands) for DNA sequencing and the NCBI BLAST (www.ncbi.nlm.gov/BLAST) and CLUSTAL (www.ebi .ac.uk/Tools/msa/clustalw2/) programs for posterior analyses. Statistical analysis. We categorized the strains into two groups according to antimicrobial susceptibility (not following the CLSI or EUCAST clinical breakpoints). We worked with the Student’s ttest to compare differences in gene expression between groups and thus evaluate any associations with antibiotic resistance. Differences were considered significant at a Pvalue of ⬍0.05. Nucleotide sequence accession numbers. The nucleotide sequences of the adeR,adeS, and adeN genes from strains of the PFGE-ROC-1 clone were submitted to the GenBank database and have been assigned accession numbers KF147860,KF147861, and KF147862, respectively. RESULTS MICs, typing, and PCR detection of genes of the isolates. To study the expression levels of efflux pump systems, porins, and chromosomal ␤-lactamases, we selected clonally related strains with different antibiotic susceptibilities (39). In Spain, OXA-type enzymes are prevalent in carbapenem-resistant strains of A. baumannii (40, 41). Isolates of A. baumannii from two hospitals in Spain that showed some clonal relation were designated clone PFGE-ROC-1 (sequence type 2 [ST2]) (n⫽71; Fig. 1) and clone PFGE-HUI-1 (ST79) (n⫽19; Fig. 2). Moreover, 53 strains of the PFGE-ROC-1 clone carried the OXA-58 ␤-lactamase gene (designated PFGE-ROC-1 OXA-58; imipenem MICs, 8 to 64 mg/liter; meropenem MICs, 8 to 16 mg/liter) and 18 isolates carried the OXA-24 ␤-lactamase gene (designated PFGE-ROC-1 OXA-24 ; imipenem MICs, ⱖ64 mg/liter; meropenem MICs, 32 to 64 mg/liter). The isolates of clone PFGE-HUI-1 (n⫽19) were susceptible to carbapenems. We studied the variability in the MICs of glycylcyclines, aminoglycosides, tetracyclines, rifampin, and doripenem for all isolates, with the following results: (i) for PFGEROC-1 OXA-58 (Table 2) tigecycline MICs were ⱕ0.25 to 2 mg/liter, gentamicin MICs were 1 to ⬎64 mg/liter, amikacin MICs were ⬍2to 64 mg/liter, doxycycline MICs were 16 to ⬎64 mg/liter, minocycline MICs were 1 to 8 mg/liter, tetracycline MICs were ⬎64 mg/liter, netilmicin MICs were 1 to ⬎64 mg/liter, rifampin MICs were 1 to 64 mg/liter, tobramycin MICs were ⬍0.5 to 64, and doripenem MICs were 4 to 8 mg/liter. (ii) For PFGE-ROC-1 OXA-24 (Table 3), tigecycline MICs were ⱕ0.25 to 1 mg/liter, gentamicin MICs were 2 to ⬎64 mg/liter, amikacin MICs were ⬍2 to 64 mg/liter, doxycycline MICs were 16 to 32 mg/liter, minocycline MICs were ⬍0.5 to 4 mg/liter, tetracycline MICs were ⬎64 mg/liter, netilmicin MICs were 64 to ⬎64 mg/liter, rifampin MICs were ⬍0.5 to 4 mg/liter, tobramycin MICs were 4 to 64 mg/liter, and doripenem MICs were 64 to ⬎64 mg/liter. (iii) For PFGE-HUI-1 (Table 4), tigecycline MICs were 1 to 2 mg/liter, gentamicin MICs were 16- to ⬎64 mg/liter, amikacin MICs were 4 to 64 mg/liter, doxycycline MICs were ⬍0.5 to 8 mg/ liter, minocycline MICs were ⬍0.5 to 1 mg/liter, tetracycline MICs were 4 to ⬎64 mg/liter, netilmicin MICs were 4 to ⬎64 mg/liter, rifampin MICs were 2 to 32 mg/liter, tobramycin MICs were 8 to 64 mg/liter, and doripenem MICs were ⬍0.5 to 2 mg/liter. Rumbo et al. 5248 aac.asm.org Antimicrobial Agents and Chemotherapy We detected tet genes in both clones: the tetB gene in all strains of PFGE-ROC-1 and the tetA(39) gene in strains of the PFGEHUI-1 clone (except for strains 421, 422, 423, 424, and 426). In both A. baumannii clones, we detected the AacC1/AphA1/ AadB combination of acetylases in strains displaying some resistance to aminoglycosides. We also detected mutations in the gyrA (Ser 83 ¡Leu) and parC (Ser 80 ¡Leu) genes in strains showing resistance to quinolones. Relative gene expression. The levels of expression of the efflux pump genes in the isolates relative to that by A. baumannii ATCC 17978 (relative expression ([RE] values) are shown in Tables 2 to 4. For clone PFGE-ROC-1, we applied statistical analysis to genes with RE values higher than 8 (i.e., genes adeB and adeJ) to determine how gene expression was related to the antibiotic MICs (for strains carrying the OXA-58 ␤-lactamase gene, see Fig. 3; for strains carrying the OXA-24 ␤-lactamase gene, see Fig. 4). However, we were not able to analyze the adeB gene in strains of clone PFGE-HUI-1, because the internal and external primers used did not amplify the genes in the AdeABC operon of these strains. Moreover, the relative expression of adeJ in this clone was not higher than 2. The RE values of adeG,craA,abeM, and amvA in all strains ranged from 0.003 to 1. Porin expression was not significantly related to antibiotic resistance in strains of clone PFGE-ROC-1 or PFGE-HUI-1. However, in strains of clone PFGE-ROC-1 OXA-24 , the RE values of the carO and omp25 genes were lower than those in strains of clone PFGE-ROC-1 OXA-58 (Fig. 5). However, the RE values of the OXA-51 and ampC ␤-lactamase genes were similar among the isolates. Polymorphisms of the regulatory genes of the AdeABC and AdeIJK efflux pumps. Strains of the PFGE-ROC-1 clone that overexpressed the AdeABC efflux pump had three mutations in the adeS gene (Ala 94 ¡Val, Gly 186 ¡Val, and Phe 214 ¡Leu) and TABLE 1 Primers used in this study Analysis and gene Orientation Primer sequence (5=–3=) UPL probe a Reference or source RT-PCR analysis rpoB Forward CGTGTATCTGCGCTTGG 131 This study Reverse CGTACTTCGAAGCCTGCAC gyrB Forward TGGTGGAACGTGGTCATATTT 76 This study Reverse TGCTCTTGCTTACCCTTTTTG adeB Forward CGAGTGGCACAACTAGCATC 61 This study Reverse CCTTGTCTTGGCTGCACTCT adeJ Forward CCTATTGCACAATATCCAACGA 119 This study Reverse AGGATAAGTCGCAGCAATCG adeG Forward GTCCTGAAATGGTCGTTCGT 43 This study Reverse AGCTTCTGCTTGGCTAGATGA craA Forward TTCATTGCTTGCGCCTTT 125 This study Reverse CCAGTGCCATGAAACATAATCA abeM Forward AGGGACGTATTATGGCGAAA 165 This study Reverse CTGCTGTGCTTAGACCAATTTTT amvA Forward GCAGAGAAATTTTGCACTTGG 10 This study Reverse CGACTAATGGACCAAAAGCTG ompA Forward GGTATTCAGATAATTTTTCAGCAACTT 129 This study Reverse AACAAATCAAACATCAAAGACCAA ompW Forward GCCTTATTTGCTCTGCCAAC 60 This study Reverse CGTTTGAAACCATCACCATCT dcap-like Forward TGATCGACTTCTCGACAAACA 77 This study Reverse GTGTAGTTGGGCCTAGTTTGTAGTT oprC Forward ACTCGATACAAAGCGGTGGA 9 This study Reverse TTTAATACGTGAACCAAACATACCTC oprB Forward GCCCCACACTTCTTGAACAG 67 This study Reverse ATGGGCAATCGCTTTCTG omp25 Forward CGAACGTGAAATCGACAACA 128 This study Reverse CGTAACCTTTAACACCTAGAGCAAG omp33-omp36 Forward CAAGTGTTGCTAACCAATTCGCT FAM-CCAAACTGCTGCTATCCAAAA CGACCAA-BBQ This study Reverse GTTTTCTTGACCGAATGCACC carO Forward TGTTCATGACAGCTATGCATTCGATA FAM-CGCTCGTGCTGAAGTAGGTAC TACAGGTT-BBQ This study Reverse CCCAATGCTAAACCTACATATGGGT Sequencing analysis adeR Forward ACTACGATATTGGCGACATT Reverse GCGTCAGATTAAGCAAGATT 13–15 adeS Forward TTGGTTAGCCACTGTTATCT Reverse AGTGGACGTTAGGTCAAGTT 13–15 adeN Forward GCTGTTAGGTTGGGGTCGTA Reverse CGTGACCAAAAGTACGAATCA 18 a FAM, 6-carboxyfluorescein; BBQ, BlackBerry Quencher. Complex Mechanisms in MDR Clinical A. baumannii November 2013 Volume 57 Number 11 aac.asm.org 5249 FIG 1 Pulsed-field electrophoresis of strains of the PFGE-ROC-1 clone. REP-PCR, repetitive element palindromic PCR. Rumbo et al. 5250 aac.asm.org Antimicrobial Agents and Chemotherapy one mutation in the adeR gene (Ala 136 ¡Val). Only two strains of this clone had mutations in the adeN regulatory gene in the AdeIJK efflux pump (His 111 ¡Pro, Ile 112 ¡Phe). The adeS and adeR genes in strains of clone PFGE-HUI-1 were not successfully amplified. In all strains of this clone, the adeN gene had one mutation (Pro 16 ¡Lys). Relation between relative gene expression and MICs. Possible interactions between the mechanisms of resistance of the clinical strains of the two clones are summarized in Table 5. (i) Carbapenems. For the carbapenems (imipenem, meropenem, and doripenem), resistance was associated with the presence of the OXA-type enzymes (OXA-24 and OXA-58 ␤-lactama- ses) in strains of clone PFGE-ROC-1. (ii) Aminoglycosides. In gentamicin-resistant strains (MICs ⬎8 mg/liter) of clone PFGE-ROC-1, the AdeABC system was overexpressed and/or acetylases (AacC1/AphA1/AadB) were present. Moreover, in strains of both clones (PFGE-ROC-1 and PFGEHUI-1), the presence of acetylases (AacC1/AphA1/AadB) was associated with resistance to netilmicin (MICs ⬎16 mg/liter), tobramycin (MICs ⬎8 mg/liter), and amikacin (MICs ⬎16 mg/ liter). (iii) Glycylcyclines. Resistance to tigecycline (MICs ⬎0.5 mg/ liter) was associated with overexpression of the RND systems (AdeIJK efflux pump in PFGE-ROC-1 OXA58 [Fig. 3] and AdeABC efflux pump in PFGE-ROC-1 OXA24 [Fig. 4]) and the TetA(39) effux pump. The presence of PAbetaN (an inhibitor of the RND system) in strains of clone PFGE-HUI-1 was associated with decreased resistance to tigecycline. In the strains of this clone with no TetA efflux pump (strains 421, 422, 423, 424, and 426), the tigecycline MIC decreased from 1 to ⱕ0.25 mg/liter (with PA- betaN). In those strains of clone PFGE-HUI-1 with a TetA system, the tigecycline MIC decreased from 2 to 1 mg/liter in the presence of PAbetaN. The AdeIJK and AdeABC efflux pumps (in strains of clone PFGE-ROC-1) were associated with resistance to minocycline (MICs ⬎2 mg/liter). However, PFGE-ROC OXA-58 displayed resistance to this antibiotic, possibly because of overexpression of the AdeIJK and TetB efflux pumps. (iv) Tetracyclines. Resistance to tetracyclines was associated with TetB and TetA(39) efflux pumps. In doxycycline-resistant isolates (strains of PFGE-ROC-1 OXA-58 with MICs of ⬎16 mg/ liter), AdeIJK was overexpressed together with Tet systems. (v) Quinolones. Finally, mutations of the gyrA and parC genes conferred resistance to ciprofloxacin without any variations in MICs. DISCUSSION The impact of the interplay between different mechanisms of antimicrobial resistance in the susceptibility or resistance to antibiotics has been addressed in previous studies. Here, we focused on two of these studies in relation to the present study. One of these studies involved clinical strains of P. aeruginosa isolated from cystic fibrosis patients (representative of the Liverpool epidemic strain) (39), and the other involved strains isolated from bloodstream infections (40). In the present study, we attempted to determine if similar conclusions can be applied to clinical strains of A. baumannii in which resistance is associated with a multifactorial mechanism. We analyzed strains of two different clones, PFGE-ROC-1 and PFGE-HUI-1. The PFGE-ROC-1 clone included 53 strains carrying the OXA-58 ␤-lactamase gene (PFGEROC-1 OXA-58 ) and 18 strains carrying the OXA-24 carbapenemase gene (PFGE-ROC-1 OXA-24 ). The enzymes encoded by both of these genes are highly prevalent in isolates of A. baumannii in FIG 2 Pulsed-field electrophoresis of strains of the PFGE-HUI-1 clone. Complex Mechanisms in MDR Clinical A. baumannii November 2013 Volume 57 Number 11 aac.asm.org 5251 the Iberian Peninsula (41,42). Only strains of the PFGE-HUI-1 clone (n⫽19 strains) have previously shown susceptibility to carbapenems (23). Overexpression of the AdeABC system (RE, 30- to 45-fold) was significantly associated with resistance to gentamicin (MICs ⬎8 mg/liter) in strains of PFGE-ROC-1 (which produce the OXA-58 and OXA-24 ␤-lactamases) (8). Moreover, in strains of PFGEROC-1 OXA-24 , resistance to tigecycline (MICs ⬎0.5 mg/liter) and minocycline (MICs ⬎2 mg/liter) was also significantly associated with expression of this efflux pump, as previously reported (8). All strains of the PFGE-ROC-1 clone had mutations in the adeR (Ala 136 ¡Val) and adeS (Ala 94 ¡Val, Gly 186 ¡Val, and Phe 214 ¡Leu) genes. Hornsey et al. associated the Ala 94 ¡Val substitution with overexpression of the AdeABC efflux pump in A. baumannii strains representative of the prevalent United Kingdom lineage, OXA-23 clone 1 (16,43). However, the other mutations have not previously been described. Peleg et al. (17) reported that increased (40- to 54-fold) expression of the adeB gene was TABLE 2 MICs and RE of genes harboring efflux pumps c Strain a MIC d (mg/liter) RE b TIG GEN AMK DOX MIN NET TET RIF TOB DOR adeB adeJ adeG craA abeM amvA 65 ⱕ0.25 8 ⬍216 2 1 ⬎64 2 1 4 1.13 3.10 1.00 0.43 0.21 0.002 34 0.5 2 32 32 2 ⬎64 ⬎64 64 32 8 27.73 0.55 0.70 1.31 0.60 0.003 35 0.5 4 16 32 2 ⬎64 ⬎64 64 64 8 31.97 0.40 0.82 1.12 0.66 0.003 37 0.5 4 16 32 2 ⬎64 ⬎64 64 32 8 28.10 0.42 0.70 1.25 0.78 0.003 41 0.5 4 32 16 2 ⬎64 ⬎64 64 64 4 26.89 0.57 0.66 1.34 0.50 0.003 51 0.5 4 16 32 4 ⬎64 ⬎64 64 64 8 16.21 1.62 0.41 0.65 0.70 0.004 53 0.5 4 16 32 4 ⬎64 ⬎64 64 32 8 17.03 1.06 0.49 0.70 0.48 0.003 55 0.5 4 16 32 4 ⬎64 ⬎64 64 64 8 18.25 1.38 0.85 0.64 0.37 0.004 57 0.5 4 16 32 4 ⬎64 ⬎64 64 64 8 10.43 4.69 0.37 0.70 0.78 0.003 78 0.5 32 ⬍216 2 4 ⬎64 64 ⬍0.5 4 23.88 5.44 0.96 1.14 0.40 0.007 88 0.5 4 32 16 2 ⬎64 ⬎64 32 32 4 11.77 6.60 0.92 0.73 0.24 0.003 118 0.5 32 16 32 2 ⬎64 ⬎64 32 64 4 35.08 0.61 1.31 0.64 0.27 0.003 126 0.5 16 ⬍22 4 4 ⬎64 32 ⬍0.5 4 1.77 1.06 1.27 0.64 0.32 0.004 36 1 4 16 32 2 ⬎64 ⬎64 64 64 4 32.25 0.61 0.80 1.03 0.69 0.004 38 1 4 32 32 2 ⬎64 ⬎64 64 64 8 30.51 1.34 0.78 1.14 0.51 0.002 58 1 4 32 32 4 ⬎64 ⬎64 64 64 8 26.93 2.20 0.44 0.85 0.45 0.005 83 1 2 32 32 4 ⬎64 ⬎64 64 32 4 33.76 7.98 1.37 0.80 0.19 0.002 84 1 2 32 32 4 ⬎64 ⬎64 64 64 4 13.45 10.02 1.08 0.85 0.24 0.003 86 1 64 8 32 4 32 ⬎64 2 2 4 22.39 6.85 0.97 0.69 0.19 0.004 87 1 64 4 64 4 16 ⬎64 2 2 4 43.48 6.82 0.92 0.67 0.08 0.003 89 1 ⬎64 4 64 4 32 ⬎64 64 64 4 7.25 5.61 1.17 0.89 0.21 0.003 90 1 2 16 64 4 ⬎64 ⬎64 64 32 8 20.86 10.33 1.00 0.72 0.23 0.004 110 1 2 16 16 4 ⬎64 ⬎64 32 64 4 30.22 5.18 1.25 0.31 0.30 0.003 111 1 2 16 16 2 ⬎64 ⬎64 32 32 4 9.86 5.39 1.55 0.31 0.21 0.003 112 1 2 8 16 2 ⬎64 ⬎64 32 32 8 11.45 3.06 1.23 0.21 0.18 0.36 113 1 2 ⬍232 2 4 ⬎64 32 ⬍0.5 4 24.40 4.27 0.89 0.31 0.25 0.006 114 1 1 ⬍232 2 4 ⬎64 32 1 4 7.01 3.87 0.77 0.27 0.26 0.004 115 1 1 ⬍216 2 4 ⬎64 16 ⬍0.5 4 30.32 3.13 0.82 0.75 0.19 0.003 119 1 32 16 32 2 ⬎64 ⬎64 32 32 4 43.01 0.60 1.23 0.54 0.33 0.003 120 1 32 16 16 2 ⬎64 ⬎64 32 32 4 35.43 0.66 0.75 0.65 0.19 0.003 124 1 4 64 64 4 ⬎64 ⬎64 32 64 4 46.58 0.72 0.79 0.63 0.30 0.004 125 1 4 16 32 8 ⬎64 ⬎64 64 32 4 32.77 8.97 0.45 0.70 0.30 0.005 56 2 2 ⬍232 4 8 ⬎64 64 1 8 21.05 5.82 0.48 0.87 0.38 0.003 64 2 64 4 32 2 16 ⬎64 2 4 4 68.98 2.94 0.36 0.62 0.21 0.004 79 2 ⬎64 4 16 1 16 ⬎64 2 2 8 37.66 12.58 1.57 0.59 0.22 0.004 80 2 ⬎64 8 32 4 32 ⬎64 1 2 8 32.70 10.77 0.97 0.63 0.19 0.002 81 2 64 4 32 4 16 ⬎64 2 2 4 46.54 11.16 0.92 0.86 0.18 0.002 82 2 64 ⬍232 2 16⬎64 1 1 4 27.63 10.04 1.00 0.97 0.15 0.002 101 2 2 16 32 4 ⬎64 ⬎64 32 32 4 12.44 4.13 1.25 0.24 0.13 0.003 102 2 2 16 32 4 ⬎64 ⬎64 32 32 4 8.91 7.26 1.17 0.36 0.28 0.005 106 2 2 8 64 8 ⬎64 ⬎64 64 32 4 12.06 10.55 1.38 0.76 0.31 0.006 107 2 2 32 64 8 ⬎64 ⬎64 64 32 4 16.38 10.80 0.91 0.25 0.32 0.004 108 2 4 32 64 8 ⬎64 ⬎64 64 32 8 23.92 10.94 1.07 0.21 0.29 0.002 109 2 4 32 64 8 ⬎64 ⬎64 64 32 8 23.37 6.32 0.68 0.32 0.22 0.003 a Strains are ranked according to the MIC of tigecycline. b Increased gene RE values of ⱖ2 are indicated in bold. c The reference strain used was A. baumannii ATCC 17978. RNA (50 ␮g/ml) was from strains of the PFGE-ROC-1 OXA58 clone. d TIG, tigecycline; GEN, gentamicin; AMK, amikacin; DOX, doxycycline; MIN, minocycline; NET, netilmicin; TET, tetracycline; RIF, rifampin; TOB, tobramycin; DOR, doripenem. Rumbo et al. 5252 aac.asm.org Antimicrobial Agents and Chemotherapy associated with tigecycline MICs of 4 to 16 mg/liter in A. baumannii. We found that tigecycline-susceptible strains (MIC ⫽0.5 mg/ liter) were associated with increased expression of the adeB gene (about 20- to 30-fold), which could indicate the role of the AdeABC efflux pump in others functions necessary for the pathogenesis of clinical strains of A. baumannii, such as colonization, infection, and the persistence of microorganisms in the host (10). We did not detect the AdeABC efflux pump or regulator genes in clinical strains of A. baumannii clone PFGE-HUI-1 (susceptible to carbapenems). As mentioned above, this efflux pump is present in 80% (range, 53% to 97%) of clinical isolates studied so far (8). Increased expression of the AdeIJK efflux pump (RE, 8- to 10-fold) was significantly associated with tigecycline resistance (MICs ⬎0.5 mg/liter) and minocycline resistance (MICs ⬎2 TABLE 3 MICs and RE of genes harboring efflux pumps c Strain a MIC d (mg/liter) RE b TIG GEN AMK DOX MIN TET NET RIF TOB DOR adeB b adeJ adeG craA abeM amvA 44 ⱕ0.25 2 32 16 1 ⬎64 ⬎64 2 32 64 26.60 1.69 0.68 1.47 0.39 0.002 45 ⱕ0.25 2 32 16 1 ⬎64 ⬎64 1 64 ⬎64 15.00 1.21 0.67 0.71 0.43 0.001 47 ⱕ0.25 4 16 16 1 ⬎64 ⬎64 1 64 64 19.50 1.29 0.80 0.53 0.45 0.002 61 ⱕ0.25 4 16 16 4 ⬎64 ⬎64 2 64 64 23.25 1.24 0.34 0.99 0.15 0.005 62 ⱕ0.25 2 32 16 1 ⬎64 ⬎64 1 64 ⬎64 20.19 1.67 0.49 0.49 0.17 0.002 95 ⱕ0.25 4 32 16 1 ⬎64 ⬎64 ⬍0.5 32 ⬎64 33.95 1.33 1.06 0.32 0.22 0.002 40 0.5 4 32 16 1 ⬎64 ⬎64 1 64 64 12.88 0.25 0.59 0.91 0.36 0.001 46 0.5 2 32 16 1 ⬎64 ⬎64 1 64 ⬎64 10.82 1.70 0.84 1.18 0.38 0.002 48 0.5 8 32 16 1 ⬎64 ⬎64 1 64 64 10.28 1.13 1.04 0.81 0.33 0.002 50 0.5 2 64 16 ⬍0.5 ⬎64 ⬎64 2 64 64 11.91 1.25 0.44 0.70 0.41 0.002 60 0.5 4 64 16 1 ⬎64 ⬎64 1 64 64 29.20 1.52 0.36 1.18 0.41 0.003 72 0.5 2 32 16 ⬍0.5 ⬎64 ⬎64 1 32 ⬎64 24.94 1.19 0.87 0.73 0.23 0.004 73 0.5 2 32 16 ⬍0.5 ⬎64 ⬎64 2 64 ⬎64 7.53 1.21 0.60 0.72 0.17 0.004 74 0.5 ⬎64 ⬍232 4 ⬎64 64 4 4 ⬎64 22.19 1.08 0.51 0.68 0.17 0.003 75 0.5 ⬎64 4 16 4 ⬎64 64 4 4 ⬎64 13.95 0.84 0.49 0.52 0.17 0.002 96 0.5 4 32 16 1 ⬎64 ⬎64 1 64 64 8.55 1.46 0.97 0.31 0.22 0.002 63 1 4 16 16 1 ⬎64 ⬎64 1 32 64 43.11 1.87 0.41 0.59 0.23 0.005 67 1 64 32 16 ⬍0.5 ⬎64 ⬎64 1 64 ⬎64 44.95 0.81 0.63 0.45 0.19 0.002 a Strains are ranked according to the MIC of tigecycline. b Increased gene RE values of ⱖ2 are indicated in bold. c The reference strain used was A. baumannii ATCC 17978. RNA (50 ␮g/ml) was from strains of the PFGE-ROC-1 OXA24 clone. d TIG, tigecycline; GEN, gentamicin; AMK, amikacin; DOX, doxycycline; MIN, minocycline; TET, tetracycline; NET, netilmicin; RIF, rifampin; TOB, tobramycin; DOR, doripenem. TABLE 4 MICs and RE of efflux pumps c Strain a MIC d (mg/liter) RE b TIG GEN AMK DOX MIN TET NET RIF TOB DOR adeB adeJ adeG craA abeM amvA 421 1 ⬎64 64 ⬍0.5 ⬍0.5 4 64 2 64 1 NA 1.44 1.23 1.20 0.04 0.01 422 1 16 16 ⬍0.5 ⬍0.5 8 8 2 8 ⬍0.5 NA 1.37 2.11 0.82 0.05 0.02 423 1 16 16 ⬍0.5 ⬍0.5 8 8 2 16 1 NA 1.21 1.16 0.63 0.07 0.02 424 1 16 64 1 1 4 8 16 32 ⬍0.5 NA 1.41 0.89 0.68 0.04 0.02 426 1 64 32 1 1 8 64 16 32 ⬍0.5 NA 1.69 1.00 0.45 0.04 0.02 427 2 16 16 8 ⬍0.5 ⬎64 8 4 8 1 NA 1.46 0.83 0.42 0.04 0.02 428 2 16 16 4 ⬍0.5 ⬎64 4 2 8 1 NA 1.64 0.89 0.49 0.05 0.02 429 2 64 4 4 ⬍0.5 ⬎64 8 4 8 1 NA 1.75 0.91 0.48 0.04 0.01 430 2 32 16 8 ⬍0.5 ⬎64 16 4 16 1 NA 1.22 0.76 0.48 0.04 0.02 431 2 64 4 8 1 ⬎64 32 32 32 1 NA 1.28 1.00 0.44 0.04 0.02 432 2 16 16 4 ⬍0.5 ⬎64 4 4 16 2 NA 1.61 0.90 0.53 0.04 0.02 433 2 16 16 8 ⬍0.5 ⬎64 8 4 16 2 NA 1.51 0.89 0.54 0.04 0.02 434 2 16 16 4 ⬍0.5 ⬎64 8 4 8 2 NA 1.82 1.09 0.50 0.04 0.02 435 2 32 32 4 ⬍0.5 ⬎64 8 2 32 1 NA 1.27 0.90 0.34 0.05 0.01 436 2 16 16 8 1 ⬎64 16 4 8 1 NA 1.32 0.79 0.43 0.04 0.01 437 2 16 16 4 1 ⬎64 4 4 16 ⬍0.5 NA 0.72 1.18 0.78 0.03 0.03 438 2 32 16 8 1 ⬎64 8 4 16 ⬍0.5 NA 1.25 1.51 0.60 0.03 0.02 443 2 16 16 4 ⬍0.5 ⬎64 8 4 8 1 NA 0.91 0.80 0.52 0.04 0.01 a Strains are ranked according to the MIC of tigecycline. b Primers for adeA and adeC genes were also used. NA, not applicable. c The reference strain used was A. baumannii ATCC 17978. RNA (50 ␮g/ml) was from strains of the PFGE-HUI-1 clone (susceptible to carbapenems). d TIG, tigecycline; GEN, gentamicin; AMK, amikacin; DOX, doxycycline; MIN, minocycline; TET, tetracycline; NET, netilmicin; RIF, rifampin; TOB, tobramycin; DOR, doripenem. Complex Mechanisms in MDR Clinical A. baumannii November 2013 Volume 57 Number 11 aac.asm.org 5253 mg/liter) in strains of PFGE-ROC-1 OXA-58 . However, this system was not significantly associated with resistance to netilmicin or tobramycin (aminoglycosides). These results are consistent with those obtained by Coyne et al. (44). These authors also noted that overexpression of this pump is always lower than that of the AdeABC system. These results could confirm the theory that highlevel expression of the AdeIJK efflux pump is toxic to the host cell (45). The adeJ gene was not overexpressed in strains of the PFGEROC-1 OXA-24 and PFGE-HUI-1 clones. Only two strains of the PFGE-ROC-1 OXA-58 clone had two new mutations in a gene regulating the AdeIJK pump (adeN; His 111 ¡Pro, Ile 112 ¡Phe), and all strains of PFGE-HUI-1 had a Pro 16 ¡Lys substitution in the adeN gene. None of these mutations have been associated with overexpression of AdeIJK, although other possible mechanisms of regulation cannot be ruled out (18). Expression of adeG (AdeFGH), craA,abeM, and amvA was not increased (RE, 0.003 to 1) in strains of the PFGE-ROC-1 or PFGEHUI-1 clone. Gram-positive bacteria are the origin of tet genes detected in Gram-negative bacteria, such as A. baumannii (22,38). Here, we detected the tetB gene in strains of the PFGE-ROC-1 clone, all of which were resistant to tetracycline (MICs ⫽16 to 64 mg/liter) and doxycycline (MICs ⫽16 to 64 mg/liter). Moreover, in some strains (PFGE-ROC-1 OXA-58 ), overexpression of AdeIJK together with the presence of this acquired efflux pump was possibly associated with resistance to minocycline (MICs ⫽2 to 4 mg/liter). In FIG 3 Relative expression of the adeB and adeJ genes from strains of the PFGE-ROC-1 OXA-58 clone in relation to the MICs of different antibiotics.*, P⬍0.05 (Student’s ttest). Light gray bars, strains susceptible to several antibiotics (grouped by MIC [in mg/liter]); dark gray bars, strains resistant to several antibiotics (grouped by MIC [in mg/liter]); TIG, tigecycline; GEN, gentamicin; AMK, amikacin; DOX, doxycycline; MIN, minocycline; NET, netilmicin; RIF, rifampin; TOB, tobramycin. FIG 4 Relative expression of the adeB and adeJ genes from strains of the PFGE-ROC-1 OXA-24 clone in relation to the MICs of different antibiotics.*, P⬍0.05 (Student’s ttest). Light gray bars, strains susceptible to several antibiotics (grouped by MIC [in mg/liter]); dark gray bars, strains resistant to several antibiotics (grouped by MIC [in mg/liter]); TIG, tigecycline; GEN, gentamicin; AMK, amikacin; DOX, doxycycline; MIN, minocycline. Rumbo et al. 5254 aac.asm.org Antimicrobial Agents and Chemotherapy other pathogens, such as Escherichia coli, the combination of AcrAB-TolC and TetA has been associated with a high degree of resistance to tetracycline (46). Our results showed that detection of the tetA(39) gene in all strains of this clone was associated with resistance to tetracycline and doxycycline. Agersø and Guardabassi (47) analyzed the presence of this gene in A. baumannii strains. These authors located the gene in both environmental and clinical strains, and they found the tetA(39) gene in 33 tigecyclineresistant strains (MICs ⱖ16 mg/liter). We noted that in strains of PFGE-HUI-1 harboring the tetA(39) gene, the tigecycline MIC was lower (2 to 1 mg/liter) in the presence of PAbetaN (an RND efflux pump inhibitor), and the MIC decreased from 1 to 0.25 mg/liter in the A. baumannii strains without this gene. This suggests the involvement of a new RND efflux pump, together with the TetA(39) system, in the resistance to tigecycline. In relation to porins and unlike in other pathogens, such as Pseudomonas aeruginosa, in which OprD expression plays an important role in resistance to carbapenem antibiotics (39), we found that decreased expression of a porin was significantly associated with antimicrobial resistance. We observed decreased RE only of the carO and omp25 genes, on comparing strains of PFGE clone-ROC-1 OXA-58 and PFGE clone-ROC-1 OXA-24 . This decrease was not associated with resistance to carbapenems, which is known to be associated with the presence of the ␤-lactamases (9). Moreover, the carbapenem resistance was not associated with expression of the OXA-51 and AmpC chromosomal ␤-lactamases. Overall, our data revealed that the presence of OXA-type enzymes (OXA-24 and/or OXA-58) is sufficient to confer resistance to carbapenem in the A. baumannii strains under study, as previously found (41,42). Moreover, resistance to doripenem was also associated with the presence of the ␤-lactamases OXA-58 (MICs ⫽4 to 8 mg/liter) and OXA-24 (MICs ⫽64 to ⬎64 mg/liter) (compared with MICs for strains of the PFGE-HUI-1 clone of 0.5 to 1 mg/liter). Marti and colleagues (48) analyzed the activity of doripenem against clinical isolates of A. baumannii and concluded that doripenem was more active than imipenem and meropenem in strains carrying the OXA-58 ␤-lactamase gene. However, in the present study, doripenem, imipenem, and meropenem MICs were high for the clinical strains producing the OXA-24 enzyme. Quinolone resistance did not vary between the strains under study and was associated with previously reported mutations in gyrA and parC (7). Aminoglycoside-resistant isolates of clones PFGE-ROC-1 and PFGE-HUI-1 showed acetylases known to be common in A. baumannii strains (AacC1, AphA1, and AadB) (49). In conclusion, (i) the clinical strains of Acinetobacter baumannii under study possess efflux systems and other mechanisms (possibly connected) that enable them to develop resistance to various antimicrobials and that also have other functions necessary in bacterial pathogenesis. (ii) Overexpression of the AdeABC system was found to be associated with resistance to glycylcycline (tigecycline and minocycline) and aminoglycosides (gentamicin), and possibly other biological functions, in the clinical strains under study. (iii) Hyperexpression of the AdeIJK efflux pump was significantly associated with resistance to tigecycline and minocycline but did not appear to be involved in other functions related to the pathogenesis of the bacterium. This efflux pump may be related to the TetB system and, thus, to minocycline resistance. (iv) Porins, AmpC ␤-lactamases, and OXA-51 were not involved in the antimicrobial resistance observed in the present study in the presence of OXA-type enzymes (OXA-24 and OXA-58). (v) The OXA-24 and OXA-58 ␤-lactamases were associated with resistance to meropenem, doripenem, and imipenem (especially the OXA-24 ␤-lactamase). (vi) The presence of the Tet efflux pumps in A. baumannii isolates was associated with resistance to tetracyclines and doxycycline. (vii) Finally, a new RND efflux pump may FIG 5 Relative expression of porin genes by strains of the PFGE-ROC-1 OXA-58 and PFGE-ROC-1 OXA-24 clones. *, P⬍0.05 (Student’s ttest). TABLE 5 Interplay of mechanisms of resistance to several antibiotics of the strains of clones PFGE-ROC-1 and PFGE-HUI-1 under study Antibiotic(s) Mechanism of resistance PFGE-ROC-1 OXA-58 PFGE-ROC-1 OXA-24 PFGE-HUI-1 Tigecycline Overexpression of AdeIJK Overexpression of AdeABC New RND efflux system/TetA(39) efflux pump c Gentamicin Overexpression of AdeABC/acetylases (aacC1,aphA1,aadB) Overexpression of AdeABC/acetylases (aacC1,aphA1,aadB) Acetylases (aacC1,aphA1,aadB) Minocycline Overexpression of AdeIJK/TetB efflux pumps Overexpression of AdeABC b Netilmicin, tobramycin, and amikacin Acetylases (aacC1,aphA1,aadB) Acetylases (aacC1,aphA1,aadB) Acetylases (aacC1,aphA1,aadB) Imipenem, meropenem, and doripenem OXA-58 ␤-lactamase OXA-24 ␤-lactamase Ciprofloxacin Mutations in gyrA and parC Mutations in gyrA and parC Mutations in gyrA and parC Doxycycline Overexpression of AdeIJK a /TetB efflux pumps TetB efflux pump TetA(39) efflux pump c Tetracyclines TetB efflux pump TetB efflux pump TetA(39) efflux pump c a Nonsignificantly increased expression relative to strains with doxycycline resistance. b Only three isolates, 61, 74, and 75. c Except for strains 421, 422, 423, 424, and 426. Complex Mechanisms in MDR Clinical A. baumannii November 2013 Volume 57 Number 11 aac.asm.org 5255