Unsaponifiable fraction isolated from grape (vitis vinifera l.) seed oil attenuates oxidative and inflammatory responses in human primary monocytes

1 Unsaponifiable fraction isolated from grape (Vitis vinifera L.) seed oil 1 attenuates oxidative and inflammatory responses in human primary 2 monocytes 3 Maria C Millan-Linares a , Beatriz Bermudez b , Maria E Martin b , Ernesto 4 Muñoz c , Rocio Abia c , Francisco Millan a , Francisco JG Muriana c , Sergio 5 Montserrat-de la Paz d, * 6 a Plant Protein Group, Instituto de la Grasa, CSIC. Ctra. de Utrera Km. 1, 41013 7 Seville, Spain 8 b Department of Cell Biology, Faculty of Biology, Universidad de Sevilla. C/ 9 Profesor Garcia Gonzalez, s/n, 41012 Seville, Spain 10 c Laboratory of Cellular and Molecular Nutrition, Instituto de la Grasa, CSIC. 11 Ctra. de Utrera Km. 1, 41013 Seville, Spain 12 d Department of Medical Biochemistry, Molecular Biology and Immunology, 13 School of Medicine, Universidad de Sevilla. Av. Dr Fedriani, 3, 41071 Seville, 14 Spain 15 16 *Corresponding Author: Sergio Montserrat-de la Paz 17 Department of Medical Biochemistry, Molecular Biology and Immunology, 18 School of Medicine, Universidad de Sevilla. Av. Dr Fedriani, 3, 41071 Seville, 19 Spain 20 Tel: +34 954 559 850 21 E-mail: dela[email protected] 22 Running title: Anti-oxidant and anti-inflammatory activities of GSO 23 24 Abbreviations 25 CCR: C-C chemokine receptor, GSO: grape seed oil, GSOUF: grape seed oil 26 unsaponifiable fraction, IL: interleukin, LPS: lipopolysaccharide, NO: nitric 27 oxide, PBMC: peripheral blood mononuclear cell, ROS: reactive specie oxygen, 28 TLR: toll like receptor, TNF: tumor necrosis factor, UF: unsaponifiable fraction 29 30 31 32 33 Page 2 of 30Food & Function Postprint of Food and Function 2018, 9, 2517-2523 DOI: 10.1039/C8FO00063H 2 ABSTRACT 34 Grape (Vitis vinifera L.) seed has a well-known potential for production of oil as 35 a byproduct of winemaking and is a rich source of bioactive compounds. Herein, 36 we report that unsaponifiable fraction (UF) isolated from grape seed oil (GSO) 37 possesses anti-oxidative and anti-inflammatory properties in human primary 38 monocytes. UF isolated from GSO was phytochemically characterized by GC- 39 MS and HPLC. Freshly human monocytes were used to analyse the effects of 40 GSOUF (10-100 µg/mL) on oxidative and inflammatory responses using FACS 41 analysis, RT-qPCR, and ELISA procedures. GSOUF skewed the monocyte 42 plasticity towards the anti-inflammatory non-classical CD14 + CD16 ++ monocytes 43 and reduced the inflammatory competence of LPS-treated human primary 44 monocytes diminishing TNF-α, IL-1β, and IL-6 gene expression and secretion. 45 In addition, GSOUF showed a strong reactive oxygen species (ROS)- 46 scavenging activity, reducing significantly nitrite levels with a significant 47 decrease on Nos2 gene expression. Our results suggest that UF isolated from 48 GSO has significant potential for management of inflammatory and oxidative 49 conditions and offer novel benefits derived from the consumption of GSO in the 50 prevention of inflammatory-related diseases. 51 Keywords: Unsaponifiable, grape seed oil, monocyte, sterols, inflammation. 52 53 54 55 56 57 58 Page 3 of 30 Food & Function 3 INTRODUCTION 59 Grapes, the berries of Vitis vinifera L. spp sativa, are widely cultivated in 60 climate zones all over the world for various utilizations since ancient times. 1 61 During wine production, approximately 25% (w/w) of the grape results in 62 byproduct, which is comprised of skins and seeds. 2 For instance, grape seed 63 has a high antioxidant potential; its beneficial effects include the modulation of 64 antioxidant enzyme expression, protection against oxidative damage in cells, 65 anti-atherosclerotic and anti-inflammatory effects, and protection against some 66 cancer types, in both humans and animal models. 1,3,4 Recently, grape seed has 67 shown a potential for production of oil, up to 15%, as a byproduct of 68 winemaking. 5 A straightforward calculation indicates that the 2015 world grape 69 seed oil (GSO) production would have been ≈261 tons of oil, with worth about 70 $US 1.58-2.08 million. GSO is very high in linoleic acid (58–78%, 18:2n-6) 71 followed by oleic acid (3–15%, 18:1n-9) and minor amounts of saturated fatty 72 acids (10%). 4 Additionally, this oil is reported to contain minor components such 73 as phenolic compounds. 6 The beneficial effects of GSO are thought to be due to 74 its polyphenolic and vitamin E content. In contrast, little effort has been 75 expended to characterize the unsaponifiable fraction (UF) of GSO. The UF, 76 about 1.5–2% of the oils, is an important source of interesting minor 77 compounds. 7,8 As part of ongoing investigations on bioactive secondary plant 78 metabolites in medicinal and food plants, our aim of the present study was to 79 conduct a detailed analysis to establish the anti-oxidant and anti-inflammatory 80 effects for this valuable oilseed crop. 81 The production of reactive oxygen species (ROS), the down-regulation of 82 antioxidant response genes, and the secretion of pro-inflammatory mediators 83 Page 4 of 30Food & Function 4 work as an inflammatory beacon for leukocytes, which contribute to all stages of 84 atherosclerosis and other inflammatory disorders, therefore representing an 85 important therapeutic targets. 9 Human monocytes are classified into three 86 subsets; CD14 ++ CD16 – (claasical monocytes), intermediate CD14 ++ CD16 + 87 (intermediate monocytes), and CD14 + CD16 ++ (non-classical monocytes). 10 So 88 far, classical monocytes represent the major fraction (about 85% of total 89 monocytes) and highly express CCR2, they are professional phagocytes giving 90 rise to M1 macrophages, which generate ROS and secrete cytokines (TNF-α, 91 IL-1β, and IL-6) in response to LPS during infection or inflammation. 11 92 Intermediate monocytes display highest levels of CCR5, TLR4, CD163, and 93 HLA-DR during activation and also secrete pro-inflammatory cytokines. 12 Non- 94 classical monocytes are less granular and smaller in size, with lower expression 95 of CCR2 than classical or intermediate subsets. 12 These monocytes rich in 96 CD16 are functionally involved in tissue repairing, patrolling, and wound 97 healing, and have the tendency to be polarized into M2 macrophages with an 98 anti-inflammatory phenotype in response to a variety of stimuli, including IL-4. 13 99 The aim of the present study was to investigate the effects of GSOUF on 100 human primary monocytes activation as hallmarks of oxidative and 101 inflammatory disorders. 102 MATERIALS AND METHODS 103 Isolation and chemical characterization of unsaponifiable fraction from 104 grape seed oil 105 The UF was isolated from GSO (1 Kg, Naturgreen, Murcia, Spain) 106 following conventional procedures and its components were analysed following 107 Page 5 of 30 Food & Function 5 the IUPAC method and described in Montserrat-de la Paz et al. 7 In brief, GSO 108 was saponified at 80ºC by refluxing with 50 ml of 2 N potassium hydroxide 109 solution in ethanol (Panreac, Barcelona, Spain), boiling gently until the solution 110 became clear and then for additional 20 min. Heating was stopped by addition 111 of 50 ml distillate water through the top of the condenser and the solution was 112 swirled. After cooling to 30-35ºC, the solution was rinsed several times with 113 water and UF was extracted with diethyl ether (Panreac) used as solvent for 114 evaporation by distillation on a rotary evaporator (B-480 model, Büchi 115 Labortechnik, Essen Germany) at 30ºC under vacuum. Then the wash water 116 was removed, and the organic sample was dried with anhydrous sodium 117 sulphate, filtered, taken to dryness and the residue was weighed. The yield in all 118 samples was between 2.2% and 2.4%. 119 Quantitative analysis of UF aliphatic alcohols, sterols, and triterpenic 120 alcohols were performed according to the European Regulation EEC/2568/91 121 for olive oil. α-Cholestanol and 1-eicosanol (Sigma–Aldrich, Madrid, Spain) were 122 added as internal standards. UF was extracted, as mentioned above, and the 123 bands corresponding to the sterols, triterpenic alcohol, and aliphatic and 124 terpenic alcohols fractions were separated, by thin-layer chromatography, on a 125 basic silica gel plate. The sterols recovered from the plate were transformed 126 into trimethylsilyl ethers and the mixture was analysed by GC using an HP 5890 127 series II gas chromatograph equipped with a flame ionisation detector and a 30 128 m 0.32 mm i.d. Tracsil TRB-5 (95% dimethylpolysiloxane 5% diphenyl, film 129 thickness 0.25 lm) capillary column (Teknokroma, Barcelone, Spain). The 130 chromatographic conditions were as follows: injector 300 °C, isothermal column 131 275 °C, and detector 300 °C. The split ratio was 1:50 and the hydrogen flow 132 Page 6 of 30Food & Function 6 rate of 1.0 ml/min, 130 Kpa. The chromatographic conditions for alcohol 133 determination were the same as those mentioned above for sterols, except that 134 the oven temperature was as follows: 215 °C (5 min); 3 °C/min increase to 290 135 °C and held for 2 min. 136 The quantification of tocopherols was based on the comparison of the 137 peak areas with those of an external standard curve of R-tocopherol and 138 identified by high-performance liquid chromatography (HPLC) chromatograms 139 (AOCS Ce 8-89). The test sample was prepared as a dissolution to 10% by 140 weight in hexane (Panreac) and analysed in a HPLC system (Hewlett–Pack- 141 ard, Minnesota, US 1050) equipped with a fluorescence detector (Shimadzu 142 RF-535), with the excitation wavelength set at 290 nm 170, and emission 143 wavelength at 330 nm and HPLC analytical column silica (250 mm 4 mm i.d. 5 144 lm) (Merck Superspher Si60 Darmstadt, Germany), at a temperature of 30 °C. A 145 flow rate of 1 ml/min, 400 bar was used. Results are expressed as mg/100 g 146 GSO (Table 1). 147 Blood collection and isolation of human monocytes 148 This study was conducted according to Good Clinical Practice Guidelines 149 and in line with the principles outlined in the Helsinki Declaration of the World 150 Medical Association. Informed consent for the study was obtained from healthy 151 male blood donors (age <35 years) at the University Hospital Virgen del Rocio, 152 Seville. Participants declared that they were non-smokers and were not taking 153 any medication. Peripheral blood samples were drawn from a large antecubital 154 vein and collected into K3EDTA-containing tubes (Becton Dickinson, NJ, USA). 155 Peripheral blood mononuclear cells (PBMCs) were isolated from peripheral 156 Page 7 of 30 Food & Function 7 blood samples by centrifugation over a Ficoll-Histopaque (Sigma-Aldrich, 157 Madrid, Spain) gradient. Monocytes were isolated from PBMCs using CD14 158 microbeads and LS columns on a midiMACS system (Miltenyi Biotec, Madrid, 159 Spain) according to the manufacturer’s instructions. The purity for CD14 160 monocyte isolations was routinely >90% by flow cytometry (FACScanto II flow 161 cytometer and FACSDiva software, BD). Following isolation, monocytes were 162 suspended in a RPMI 1640 medium supplemented with L-glutamine, penicillin, 163 streptomycin and 10% heat-inactivated foetal bovine serum. 14 For treatments, 5 164 × 10 5 of purified monocytes, after in vitro stimulation with or without LPS (100 165 ng/mL), were exposed to GSOUF at 10-100 mM for 24 h. 166 Cell viability assay (MTT) 167 Cells were incubated with the MTT solution (Sigma) until a purple 168 precipitate was visible. MTT-formazan crystals were solubilized with DMSO 169 (Sigma), and then measured with a microplate reader at 570 nm corrected to 170 650 nm. 15 Cell survival was expressed as the percentage of absorbance 171 compared with that obtained in control, non-treated cells. 172 Immunostaining of circulating monocytes by FACS 173 Monocyte membrane expression of CD16 (PE anti-human CD16, 174 Miltenyi) and CD14 (APC-Cy7 anti-human CD14, Miltenyi) was assessed by 175 flow cytometry. According to the manufacturer’s instructions, cells were 176 incubated with antibodies at room temperature and in the dark for 15 min; 177 erythrocytes were removed with FACS lysing solution (BD). Mean fluorescence 178 intensity (MFI) was measured by using a FACSCanto II flow cytometer (BD) and 179 calibrated by using a FACSDiva software (BD). MFI of 10 4 counted cells was 180 Page 8 of 30Food & Function 8 assessed for each sample. Monocytes were gated as forward scatter high 181 (FSC high )-side scatter high (SSC high )-cells. 10 Expression levels are presented as 182 MFI corrected for nonspecific binding of isotope control antibodies. 183 Measurement of intracellular ROS 184 Intracellular ROS production was measured using 2',7'- 185 dichlorfluorescein-diacetate (DCFH-DA) and CellROX Green Reagent 186 (ThermoFisher Scientific, Madrid, Spain). 16 DCFH-DA penetrates into the cells 187 and is hydrolyzed by intracellular esterases to the non-fluorescent 2,7- 188 dichlorofluorescein (DCFH), which can be rapidly oxidized to the highly 189 fluorescent 2,7-dichlorofluorescein (DCF) in the presence of ROS. The 190 fluorescence intensity was measured as described previously Cardeno et al. 17 191 In addition, intracellular ROS production was measured with CellROX Green 192 Reagent (5 µM) for 30 min. Cells were washed with PBS, fixed with 3.7% 193 formaldehyde, and the fluorescence signal was analyzed in a Fluoroskan 194 Microplate Fluorometer (ThermoFisher Scientific) equipped with a 485/555 195 excitation/emission filter set. The auto-fluorescence of cells was measured in 196 the same conditions but without adding CellROX Green Reagent.Results were 197 expressed as intracellular ROS production percentage compared with LPS 198 control cells (stimulated non-treated cells). H 2 O 2 (100 µM, 30% pure) (Panreac) 199 was used as pro-oxidant positive control (data not shown). 200 Measurement of nitrite production 201 Cells in 24-well plates were untreated or treated with different 202 concentrations of squalene (12.5, 25 or 50 µM), and 30 min later stimulated with 203 LPS for 18 h. The culture supernatants (100 µl) were transferred to a 96-well 204 Page 9 of 30 Food & Function 9 assay plate mixed with Griess reagent (Sigma®, St Louis, MO, USA) and 205 incubated for 15 min at room temperature. The amount of nitrite, as an index of 206 NO generation, was determined by a spectrophotometric method using the 207 Griess reaction and obtained by extrapolation from a standard curve with 208 sodium nitrite. 18 The absorbance at 540 nm was measured by an enzyme-linked 209 immunosorbent assay reader (BioTek®, Bad Friedrichshall, Germany). Results 210 were expressed as the nitrite production percentage compared with LPS control 211 cells (stimulated untreated cells). 1 µM Dexamethasone (Sigma) was used as 212 positive control (data not shown). 213 RNA isolation and qRT-PCR analysis 214 Total RNA was extracted by using Trisure Reagent (Bioline), as 215 instructed by the manufacturer. RNA quality was assessed by A260/A280 ratio 216 in a NanoDrop ND-1000 Spectrophotometer (Thermo Scientific, Madrid, Spain). 217 Briefly, RNA (1 µg) was subjected to reverse transcription (iScript, Bio-Rad, 218 Madrid, Spain). An amount of 20 ng of the resulting cDNA was used as a 219 template for real-time PCR amplifications. The mRNA levels for specific genes 220 were determined in a CFX96 system (Bio-Rad). For each PCR reaction, cDNA 221 template was added to Brilliant SYBR green QPCR Supermix (Bio-Rad) 222 containing the primer pairs for either gene or for glyceraldehyde 3-phosphate 223 dehydrogenase (GAPDH) as housekeeping genes (Table 2). All amplification 224 reactions were performed in triplicate and average threshold cycle (Ct) numbers 225 of the triplicates were used to calculate the relative mRNA expression of 226 candidate genes. The magnitude of change of mRNA expression for candidate 227 genes was calculated by using the standard 2 -(∆∆Ct) method. 19 All data were 228 Page 10 of 30Food & Function 16 15. S. Montserrat-de la Paz, A. Fernandez-Arche, M. Angel-Martin and M.D. 369 Garcia-Gimenez. The sterols isolated from Evening Primrose oil modulate the 370 release of proninflammatory mediators. Phytomedicine, 2012, 19, 1072-1076. 371 16. S. Montserrat-de la Paz, M.C. Naranjo, B. Bermudez, S. Lopez, W. Moreda, 372 R. Abia and F.J.G. Muriana. Postprandial dietary fatty acids exert divergent 373 inflammatory responses in retinal-pigmented epithelium cells. Food Funct., 374 2016, 7, 1345-1353. 375 17. A. Cardeno, M. Aparicio-Soto, S. Montserrat-de la Paz, B. Bermudez, F.J.G. 376 Muriana and C. Alarcon-de-la-Lastra. Squalene targets pro- and anti- 377 inflammatory mediators and pathways to modulate over-activation of 378 neutrophils, monocytes and macrophages. J. Funct. Foods, 2015, 14, 779-790. 379 18. S. Montserrat-de la Paz, M.D. Garcia-Gimenez, M. Angel-Martin, M.C. 380 Perez-Camino and A. Fernandez-Arche. Long-chain fatty alcohols from evening 381 primrose oil inhibit the inflammatory response in murine peritoneal 382 macrophages. J. Ethnopharmacol., 2014, 151, 131-136. 383 19. S. Montserrat-de la Paz, B. Bermudez, S. Lopez, M.C. Naranjo, Y. Romero, 384 M.J. Bando, R. Abia and F.J.G. Muriana. Exogenous fatty acids and niacin on 385 acute prostaglandin D2 production in human myeloid cells. J. Nutr. Biochem., 386 2017, 39, 22-31. 387 20. M.C. Naranjo, I. Garcia, B. Bermudez, S. Lopez, M.P. Cardelo, R. Abia, 388 F.J.G. Muriana and S. Montserrat-de la Paz. Acute effects of dietary fatty acids 389 on osteclastogenesis via RANKL/RANK/OPG system. Mol. Nutr. Food Res., 390 2016, 60, 2505-2513. 391 Page 17 of 30 Food & Function 17 21. S. Karaman, S. Karasu, F. Tornuk, O.S. Toker, U. Gecgel, O. Sagdic, N. 392 Ozcan and O. Gul. Recovery potential of cold press byproduct obtained from 393 the edible oil industry: physicochemical, bioactive, and microbial properties. J. 394 Agric. Food Chem., 2015, 63, 2305-2313. 395 22. L. Ziegler-Heitbrock. Monocyte subsets in man and other species. Cell 396 Immunol 2014, 289, 135-139. 397 23. S. Montserrat-de la Paz, M.C. Naranjo, S. Lopez, R. Abia, F.J.G. Muriana and B. 398 Bermudez. Olive oil, compared to a saturated dietary fat, has a protective role on 399 atherosclerosis in niacin-treated mice with metabolic síndrome. J. Funct. Foods, 2016, 400 26, 557-564. 401 24. J.E. Freedman, C. Parker, L. Li, J.A. Perlman, B. Frei, V. Ivanov, L.R. Deak, M.D. 402 Iafrati and J.D. Folts. Select flavonoids and whole juice from purples grapes inhibit 403 platelet function and enhance nitric oxide release. Circulation, 2001, 103, 2792-2798. 404 25. E.Q. Xia, G.F. Deng, Y.J. Guo and H.B. Li. Biological activities of polyphenols from 405 grapes. Int. J. Mol. Sci., 2010, 11, 622-646 406 26. A. Hernandez-Jimenez, E. Gomez-Plaza, A. Martinez-Cutillas and J.A. Kennedy. 407 Grape skin and seed proanthocyanidins from Monastrell x Syreh grapes. J. Agric. Food 408 Chem., 2009, 57, 10798-10803. 409 27. S. Khurana, K. Venkataraman, A. Hollingsworth, M. Piche and T.C. Tai. 410 Polyphenols benefits to the cardiovascular system in health and in aging. Nutrients, 411 2013, 5, 3779-3827. 412 28. J. Chang, B.M. Kim and C.H. Chang. Co-stimulation of TLR4 and Dectin-1 Induces 413 the Production of Inflammatory Cytokines but not TGF-beta for Th17 Cell 414 Differentiation. Immune Netw., 2014, 14, 30-37. 415 Page 18 of 30Food & Function 18 29. B. Olas, B. Wachowicz, A. Stochmal and W. Oleszek. The polyphenol-rich extract 416 from grape sedes inhibits platelet signaling pathways triggered by both proteolytic and 417 non-proteolytic agonists. Platelets, 2012, 23, 282-289. 418 30. C. Santangelo, R. Vari, B. Scazzocchio, R. Di Benedetto, C. Filesi and R. Masella. 419 Polyphenols, intracelular signalling and inflammation. Ann. Ist. Super Sanita, 2007, 43, 420 394-405. 421 31. L. Zhao, Y. Yagiz, C. Xu, J. Lu, S. Chung and M.R. Marshall. Muscadine grape 422 seed oil as a novel source of tocotrienols to reduce adipogenesis and adipocyte 423 inflammation. Food Funct., 2015, 6, 2293-2302. 424 425 426 427 428 429 430 431 432 433 434 435 436 Page 19 of 30 Food & Function 19 Figure legends 437 Figure 1. Effect of unsaponifiable fraction isolated from grape seed oil 438 (GSOUF) on monocytes subsets. FACS analysis (MFI) of monocyte surface 439 markers CD14 and CD16 after 24 h incubation with or without LPS (100 ng/mL) 440 and GSOUF at 10-100 µg/mL. (A) Classical CD14 ++ CD16 - monocytes, (B) 441 intermediate CD14 ++ CD16 + monocytes, and (C) non-classical CD14 + CD16 ++ 442 monocytes. (D) Representative CD14/CD16 dot plots of monocyte subsets. 443 Values are presented as means ± SD (n = 3) and those marked with different 444 letters are significantly different (P < 0.01). 445 Figure 2. Effect of unsaponifiable fraction isolated from grape seed oil 446 (GSOUF) on ROS and NO generation and iNOS expression in LPS-treated 447 monocytes. Monocytes were treated with or without LPS (100 ng/mL) and then 448 incubated with GSOUF at 10-100 µg/mL for 24 h. The production of intracellular 449 ROS (A,B) and nitrites (C) was expressed as percentage of 450 fluorescence/absorbance relative to cells treated with LPS. (D) Relative Nos2 451 mRNA expression levels detected by qRT-PCR. Values are presented as 452 means ± SD (n = 3) and those marked with different letters are significantly 453 different (P < 0.01). 454 Figure 3. Effect of unsaponifiable fraction isolated from grape seed oil 455 (GSOUF) on inflammatory gene expression in LPS-treated monocytes. 456 Monocytes were treated with or without LPS (100 ng/mL) and then incubated 457 with GSOUF at 10-100 µg/mL for 24 h. Relative expression of (A) Trl4, (B) 458 Tnfalpha, (C) Il1beta, and (D) Il6 mRNA expression levels detected by qRT- 459 Page 20 of 30Food & Function 20 PCR. Values are presented as means ± SD (n = 3) and those marked with 460 different letters are significantly different (P < 0.01). 461 Figure 4. Effect of unsaponifiable fraction isolated from grape seed oil 462 (GSOUF) on inflammatory cytokine secretion in LPS-treated monocytes. 463 Monocytes were treated with or without LPS (100 ng/mL) and then incubated 464 with GSOUF at 10-100 µg/mL for 24 h. Concentration of (A) TNF-α, (B) IL-1β, 465 and (C) IL-6 was measured by ELISA in culture supernatants of LPS-treated 466 monocytes. Values are presented as means ± SD (n = 3) and those marked 467 with different letters are significantly different (P < 0.01). 468 469 470 471 472 473 474 475 476 477 478 479 480 Page 21 of 30 Food & Function 21 Table 1. Unsaponifiable fraction of grape seed oil composition 481 Component mg/100 g GSO Total sterols 418,63 ± 9.37 β-Sitosterol 292.85 ± 7.79 Total aliphatic alcohols 63.33 ± 3.18 C:26 18.15 ± 1.63 Total methylsterols 20.17 ± 2.86 Dammaradienol 3.92 ± 0.92 Total triterpenic alcohols 28.76 ± 3.17 Cicloartenol 6.98 ± 1.26 Tocopherols and tocotrienols 328.3 ± 12.21 α-Tocopherol 154.1 ± 4.94 482 483 484 485 486 487 488 489 490 491 Page 22 of 30Food & Function 22 Table 2. Sequences of RT-PCR primers for gene expression analysis 492 Target GenBank accession number Direction Sequence (5’→3’) Tlr4 NM_138554 Forward Reverse CTGCCACATGTCAGGCCTTAT AATGCCCACCTGGAAGACTCT Nos2 NM_000625 Forward Reverse ACCCAGACTTACCCCTTTGG GCCTGGGGTCTAGGAGAGAC Tnfalpha NM_000594 Forward Reverse TCCTTCAGACACCCTCAACC AGGCCCCAGTTTGAATTCTT Il1beta NM_000576 Forward Reverse GGGCCTCAAGGAAAAGAATC TTCTGCTTGAGAGGTGCTGA Il6 NM_000600 Forward Reverse TACCCCCAGGAGAAGATTCC TTTTCTGCCAGTGCCTCTTT Gapdh NM_001289746 Forward Reverse CACATGGCCTCCAAGGAGTAAG CCAGCAGTGAGGGTCTCTCT 493 494 495 496 497 498 499 500 501 Page 23 of 30 Food & Function 0 20 40 60 80 100 a a a,b b b % of CD14++CD16- Monocytes 0 5 10 15 20 a b b b b % of CD14++CD16+ Monocytes 0 5 10 15 20 25 a a a a b % of CD14+CD16++ Monocytes (A) (B) (C) Classical monocytes Non-Classical monocytes Intermediate monocytes Untreated LPS GSOUF 10 µg/mL GSOUF 50 µg/mL GSOUF 100 µg/mL (D) CD14 CD16 Untreated LPS GSOUF 10 µg/mL GSOUF 100 µg/mL Page 24 of 30Food & Function 0 50 100 150 a b b c d ROS level (% of control) 0 50 100 150 a b b c d NO2- production (% of control) 0 50 100 150 a b b c d DCF fluorescence (% of control) (A) (B) (C) 0.0 0.5 1.0 1.5 a b c d e Nos2 relative expression (AU) Untreated LPS GSOUF 10 µg/mL GSOUF 50 µg/mL GSOUF 100 µg/mL Page 25 of 30 Food & Function 0.0 2.0 4.0 6.0 8.0 a b c d d TLR4 relative expression (AU) 0.0 0.5 1.0 1.5 a b c c d TNFalpha relative expression (AU) 0.0 0.5 1.0 1.5 a b c d d Il6 relative expression (AU) (A) (B) (C) 0.0 0.5 1.0 1.5 a b b b c Il1beta relative expression (AU) (D) Untreated LPS GSOUF 10 µg/mL GSOUF 50 µg/mL GSOUF 100 µg/mL Page 26 of 30Food & Function