Characterization of the sucrose phosphate phosphatase (SPP) isoforms from Arabidopsis thaliana and role of the S6PPc domain in dimerization

RESEARCH ARTICLE Characterization of the Sucrose Phosphate Phosphatase (SPP) Isoforms from Arabidopsis thaliana and Role of the S6PPc Domain in Dimerization Toma ´s Albi, M. Teresa Ruiz, Pedro de los Reyes, Federico Valverde, Jose ´M. Romero* Instituto de Bioquı ´mica Vegetal y Fotosı ´ntesis, Universidad de Sevilla and Consejo Superior de Investigaciones Cientı ´ficas, Seville, Spain *[email protected] Abstract Sucrose-phosphate phosphatase (SPP) catalyses the final step in the sucrose biosynthesis pathway. Arabidopsis thaliana genome codifies four SPP isoforms. In this study, the four Arabidopsis thaliana genes coding for SPP isoforms have been cloned, expressed in Escherichia coli and the kinetic and regulatory properties of the purified enzymes analysed. SPP2 is the isoform showing the highest activity, with SPP3b and SPP3a showing lower activity levels. No activity was detected for SPP1. We propose that this lack of activity is probably due to the absence of an essential amino acid participating in catalysis and/or in the binding of the substrate, sucrose-6-phosphate (Suc6P). The expression patterns of Arabidopsis SPP genes indicate that SPP2 and SPP3b are the main isoforms expressed in different tissues and organs, although the non-catalytic SPP1 is the main isoform expressed in roots. Thus, SPP1 could have acquired new unknown functions. We also show that the three catalytically active SPPs from Arabidopsis are dimers. By generating a chimeric SPP composed of the monomeric cyanobacterial SPP fused to the higher plant non-catalytic S6PPc domain (from SPP2), we show that the S6PPc domain is responsible for SPP dimerization. This is the first experimental study on the functionality and gene expression pattern of all the SPPs from a single plant species. Introduction Sucrose is an essential carbohydrate for higher plants and other photosynthetic organisms and considered to be one of the main products of photosynthesis [1,2]. Sucrose is primarily synthesized in photosynthetic cells and transported to the rest of the plant to provide carbon and energy for growth and for the accumulation of carbon reserves. Besides, sucrose is involved in the regulation of different processes including transcriptional and post-transcriptional control and stress responses [2–8]. PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 1 / 19 a11111 OPEN ACCESS Citation: Albi T, Ruiz MT, de los Reyes P, Valverde F, Romero JM (2016) Characterization of the Sucrose Phosphate Phosphatase (SPP) Isoforms from Arabidopsis thaliana and Role of the S6PPc Domain in Dimerization. PLoS ONE 11(11): e0166308. doi:10.1371/journal.pone.0166308 Editor: Hector Candela, Universidad Miguel Herna ´ndez de Elche, SPAIN Received: May 13, 2016 Accepted: October 26, 2016 Published: November 17, 2016 Copyright: ©2016 Albi et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: BIO2011-28847-C02-00 and BIO2014- 52425-P to FV and JMR; TRANSPLANTA Consolider 28317 project from Spanish Ministry of Economy and Competitivity (MINECO, https://sede. micinn.gob.es/portal/site/eSede/). Excellence Project P08-AGR-03582 and CVI-281 help from the Andalusian Government (http://www. juntadeandalucia.es/organismos/ economiayconocimiento.html). The funders had no Sucrose is synthesised by the consecutive action of sucrose-phosphate synthase (SPS; EC 2.4.1.14) and sucrose-phosphate phosphatase (SPP; EC 3.1.3.24). SPS catalyses the synthesis of Suc-6-P from UDP-glucose and fructose-6-phosphate (Fru6P). In the second step of the pathway, SPP catalyses the irreversible hydrolysis of Suc-6-P to sucrose and displaces the reaction catalysed by SPS in the direction of sucrose synthesis [9,10]. SPP encoding genes have been described in different plant species such as Arabidopsis, tomato, rice, wheat, maize and coffee [11,12] where they constitute gene families with different number of members depending on the species. However, studies on the biochemical properties of SPP isoforms are scarce and no comprehensive study of all the isoforms from a single species have been done to date. In Arabidopsis, four genes show homology to SPP, while in wheat and rice three and four genes have been described, respectively [11]. The four genes that code for SPP in Arabidopsis display a similar exon-intron structure [2,11]. Arabidopsis SPPs are referred as SPP1 (At1g51420), SPP2 (At2g35840), SPP3a (At3g54270) and SPP3b (At3g52340) [11]. SPP sequences share homology with members of the L-2-haloacid dehalogenase (HAD, http://pfam.sanger.ac.uk/family/PF00702) superfamily of proteins [2,13–15]. Arabidopsis SPPs belong to the subfamily IIB that includes sucrose phosphate phosphatases from plants and cyanobacteria (IPR012847, http://www.ebi.ac.uk/interpro/entry/IPR012847) [16]. The HAD superfamily is characterized by three conserved motifs (I, II and III) related to the active site [13,17,18]. The crystal structure of SPP from the cyanobacterium Synechocystis sp. PCC 6803 has been elucidated and a catalytic mechanism proposed in which the three typical domains of the HAD proteins are involved in catalysis [13]. SPPs from different plants have been characterized. The enzyme has been shown to be a dimer with a molecular mass of around 100 kDa, formed by subunits of approximately 50 kDa [19–21]. A carboxy-terminal domain of about 160 amino acids is present in higher plant SPPs that has been proposed to participate in dimerization (S6PPc domain), while prokaryotic forms of SPP are monomeric and lack this domain [2]. However, no functional studies have been performed to demonstrate the role of the S6PPc domain in dimerization. As above referred, the sucrose synthesis pathway involves two enzymatic steps. SPS has been reported as the main regulatory point [3,22–25], with some isoforms showing overlapping functions [26], while the role of SPP in the control of sucrose synthesis still remains controversial. SPP has not been considered to be rate limiting for sucrose synthesis and, in the case of tobacco, the control coefficient on sucrose synthesis was estimated to be close to zero [23]. In fact, tobacco plants transformed with SPP RNAi, with reductions of up to 80% in SPP activity, show almost none or little effect on sucrose synthesis, suggesting that there is no requirement for a 1:1 molar ratio between SPS and SPP [23]. Similar conclusions were obtained in cold-stored potato tubers transformed with SPP RNAi [27]. On the other hand, some evidences on enzyme activity indicate that SPP may contribute to sucrose synthesis control [19,28,29], role that could be related to the fact that SPP may establish a complex with SPS [30,31]. In fact, it has recently been shown that SPS and SPP interact in planta [32], and this interaction may provide a new level of regulation. Additionally to their role in sucrose synthesis, it has been reported that SPP may have other functions. In this respect, Arabidopsis plants overexpressing sorghum SPP show an alteration in seed germination, suggesting a role of SPP in the process [33]. Different studies on the regulation of SPP suggest that sucrose may act as a regulator of the enzyme activity, while in other cases the results are not so evident. It has been reported that SPP activity from partially purified sugar cane and from carrot roots crude extracts is inhibited by sucrose at physiological concentrations (K i 10 mM) [34]. 100 mM sucrose only partially inhibited the activity in crude extracts from a number of species [35]; i.e. only a 9% inhibition was observed in purified SPP from pea shoots [20]. Also, partially purified SPP from rice and Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 2 / 19 role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. lettuce, showed a weak inhibition of the enzyme activity similar to that observed in pea shoots [21,36]. In accordance, Lunn et al. [19], studying homogeneity-purified SPP from rice, observed that sucrose is a weak competitive inhibitor of SPP with a K i around 200–400 mM, but the inhibition was slightly potentiated by decreasing concentrations of Suc6P, the substrate of the enzyme. In this study, the four different Arabidopsis SPP cDNAs were cloned and expressed in Escherichia coli. The activity and properties of the recombinant enzymes were studied and analysed. A highly conserved Ser was identified as an amino acid residue necessary for catalysis. We also present novel data about the expression pattern of the four Arabidopsis SPP genes. Finally, we show that the non-catalytic S6PPc domain is involved in SPP dimerization. Materials and Methods Plant material and growth conditions Arabidopsis thaliana, Columbia ecotype-0 (Col-0) plants were grown in controlled cabinets on soil under 16 h light / 8 h dark cycle, with temperatures ranging from 22˚C (day) to 18˚C (night). Seeds were incubated 4 days at 4˚C in the dark before sowing. Q-PCR assays were performed using plant material harvested 19 (leaves) or 28 (shoots, flowers, siliques and roots) days after sowing, at Zeitgeber time (ZT) 16. Cloning of cDNA and plasmids construction cDNAs encoding SPP2 and SPP3b were obtained from the RIKEN Genomic Sciences Center, Japan [37,38]. SPP1 and SPP3a were PCR-amplified from total cDNA preparations from roots or rosette leaves, respectively. cDNA fragments were amplified by PCR using specific primers (Table 1) which were designed with the appropriate restriction sites and a start codon (Met). Next, they were cloned into the pGEM-T Easy vector and finally, in the desired expression vector, which incorporated either a His 6 (pQE-80L) or a His 10 tag in the N-terminus (pET-19b). The resulting constructs were individually introduced into E.coli BL21 (DE3) cells for induction assays and further heterologous recombinant protein expression analysis. RNA isolation and Real-Time Q-PCR RNA was isolated employing Trizol reagent (Invitrogen) and 1 μg used to synthesize cDNA employing the Quantitec Reverse Kit (Qiagen) as described by Ortiz-Marchena et al. [39]. Real-time quantitative PCR (Q-PCR) assays were achieved using Exiqon Universal Library probes as described by Ventriglia et al. [40]. The specific oligonucleotides and Exiqon probes used were: SA648 (5’-tgttgcacaacaactgtcaaat-3’), SA649 (5’-gcacatgttcc cacacaaac-3’) and probe #12 for SPP1; SA584 (5’-agaagctagcaacttccctgag- 3’), SA585 (5’-gctaaccttgtgtggcctct-3’) and probe #124 for SPP2; SA661 (5’- ggttcttccagggatattagagg-3’), SA662 (5’-caagtagatatgtcaaagcaccttgt- 3’) and #17 for SPP3a; SA646 (5’-gaggcattgaccaaggaact-3’), SA647 (5’- ccccaactgtaaattatcttgacat-3’) and probe #67 for SPP3b; and SA532 (5’- gaagttcaatgtttcgtttcatgt-3’), SA533 (5’-ggattatacaaggccccaaaa-3’) and probe #119 for ubiquitin. For Real-Time Q-PCR assays, three technical repetitions of samples obtained from three independent experiments were performed. Purification of recombinant enzymes 10 ml of an overnight culture of E.coli BL21 overexpressing the desired SPP gene was added to 1 L of LB medium supplemented with 100 μg/mL ampicillin and subsequently grown at Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 3 / 19 30˚C until the A 600 reached 0.8. Protein induction was started by addition of 1 mM IPTG and further incubation during 4 h at 30˚C. At this stage, cells were harvested by centrifugation and the cell precipitate resuspended in lysis buffer (25 mM HEPES-KOH (pH 7.5), 150 mM KCl, 1 mM PMSF, 8 mM MgCl 2 ) and disrupted by sonication. The crude lysate was centrifuged at 60,000 gfor 30 min at 4˚C and the resulting supernatant was used in an affinity purification step employing a HisTrap HP Column (GE Healthcare). Bound proteins were eluted under native conditions by applying a linear gradient from 0% to 100% (v/v) elution buffer (25 mM HEPES-KOH (pH 7.0), 150 mM KCl, 8 mM MgCl 2 , 500 mM imidazole). Protein was quantified by the Bradford dye-binding method [41] with ovalbumin as standard. Molecular mass determination For further purification and molecular mass determination, chromatographic fractions showing SPP activity were combined and dialyzed against lysis buffer, without Mg 2+ , in the presence of 1 mM PMSF. 0.5 ml fractions were loaded onto a Superose 12 10/300 GL column (GE Healthcare) for size-exclusion chromatography. Elution was performed with the same buffer at a rate of 0.4 ml/min. 0.4 ml fractions were collected and assayed for SPP activity. The molecular mass estimation of the eluted fractions was calculated based on a protein standards calibration curve: β-amylase (β-Amy, 200 kDa), alcohol dehydrogenase (ADH, 150 kDa), bovine serum albumin (BSA, 66 kDa), carbonic anhydrase (CA, 29 kDa) and cytochrome c (Cyt.c, 12.4 kDa). Table 1. Primers used in this study. Primer Sequence a,b Construct P1 (BamHI) AAATGGGGATCCGAGCGGTTAACATCTCCTCCTCG His 6 -SPP1 (pQE-80L) P2 (PstI) AATCGGCTGCAGTCAGATGATCCAGTTGCTATCATCC P3 (NdeI) GGAATTCCATATGGAGCGGTTAACATCTCC His 10 -SPP1 (pET-19b) P4(BamHI) GGGGGATCCTCAGATGATCCAGTTGCTATC P5 (NdeI) GGAATTCCATATGGAGCGTCTAACATCTCC His 10 -SPP2 (pET-19b) P6 (BamHI) GGGGGATCCTCAGATGATCCAGCTGCTATC P7 (NdeI) GGAATTCCATATGGATAGGCTTGAAGGACC His 10 -SPP3a (pET-19b) P8 (BamHI) GGGGGATCCTTAGAAAATCCATTTTTCTTG P9 (NdeI) GGAATTCCATATGGAGCGGCTGATTTCTCA His 10 -SPP3b (pET-19b) P10 (BamHI) GGGGGATCCTCAGAGAATCCAAGAACTGTT P11 (BamHI) GGGGGATCCTTAAAGCTTGAAGTGACCAAT His 10 -S6PP (pET-19b) P12 (NdeI) GGAATTCCATATGCCGAACCTTTCTCCAAG His 10 -S6PPc (pET-19b) P13 (BamHI) GGAATTCAGGATCCCGACAGTTATTGCTAATTTCTG His 6 -SynSPP (pQE-80L) P14 (PstI) AAACATCTGCAGTTAAGCTTGGCTGCAGGTCG P15 (SpeI) GGAATTCACTAGTCTTGGTCCGAACCTTTCTCCAAGA S6PPc-Ct-fusion P16 (SpeI) GGAATTCACTAGTGCTCAAAAAATCGAAATGGGCGAT SynSPP-Nt-fusion P17 GTGTTTTCTACGGGAAGAGCACCGACATTGTATAAAG SPP2 S54A P18 AAGAAGAGAGTCATGGCGATAAGCGTGTTC P19 GTTTTCTCAACAGGAAGATCTCAAACAATGTACAAGA SPP1 A55S P20 AAGAAGAGAGTCGTGTCGATAAGCGTCTTC a Restriction sites are highlighted in bold. b Single base substitutions are marked within squares. doi:10.1371/journal.pone.0166308.t001 Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 4 / 19 Gel electrophoresis and Western blotting Proteins were separated by SDS-PAGE on 10% or 12% (w/v) polyacrylamide gels as described by Laemmli [42] and stained with Coomassie Blue R-250 or transferred to nitrocellulose membranes. The membranes were then probed with anti-His-tag antibody (Qiagen, Cat No. 34660). Membranes were incubated with the antibody at an 1:1000 dilution in TBS containing non-fat milk 5% (w/v) as blocking agent, washed with TBS buffer plus 0.1% (v/v) Tween 20 and developed with a luminescent assay (WesternBright™Quantum, Advansta). Enzyme assays SPP activity was determined by following the release of Pi from Suc6P. Unless otherwise indicated, the assay mixture contained 25 mM HEPES-KOH (pH 7.0), 8 mM MgCl 2 and 1.25 mM Suc6P in 1 ml at 37˚C. Modifications of the reaction components were made as required in individual experiments. The reaction was initiated by the addition of the enzyme sample and stopped with 54 μl of trichloroacetic acid 6.1 M. Pi released was measured using SnCl 2 -ammo- nium molybdate reagent [43]. Kinetic parameters (K m and kc at ) were determined from initial velocity data using the nonlinear regression software Anemona.xlt [44]. One unit (U) corresponds to 1 μmol of Pi released per minute. Effect of divalent ions and determination of optimum pH For the study of the effect of divalent ions, purified fractions were dialyzed against 25 mM HEPES-KOH (pH 7.5). Later, the divalent ion of interest was added to a final concentration of 8 mM. The pH dependence of SPP activity was determined at optimum values of divalent ion, temperature and Suc6P concentration. pH-dependent curves were performed using the following buffers: MES (pH 5.5–7.0), HEPES (pH 7.0–8.0), Tris (pH 8.0–9.0), CHES (pH 9.0–10.0) and CAPS (10.0–11.0) at 50 mM final concentration, adjusted to the indicated pH with NaOH or HCl. Transitory expression in Nicotiana benthamiana To verify SPP dimerization in vivo,Arabidopsis SPP2 and the chimeric Synechocystis SPP fused to the S6PPc domain of SPP2 were cloned in pYFN43 and pYFC43 to produce fusions to the YTP N-terminal part (YFN-SPP2 and YFN-SynSPP-S6PPc) as well as to the YFP C-terminal part (YFC-SPP2 and YFC-SynSPP-S6PPc) to perform BiFC assays. Specific primers were used for each gene (SPP2:5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGAGCGTCTAAC ATCTCCTCCT-3',3'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGATGATCCAGC TGCTATCATCC-5';SynSPP-S6PPc: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATG AGAGGATCGCATCACCATCAC-3',3'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTC AAAGCTTGAAGTGACCAATGGCT-5'). These constructs were introduced into Agrobacterium tumefaciens strain GVG3101 pmp90. 4-week old Nicotiana plants were agroinfiltrated with the following combinations: YFN-SPP2 and YFC-SPP2 and YFN- SynSPP-S6PPc and YFC- SynSPP-S6PPc. As negative controls, pairs of YFC-SPP2 and YFC-SynSPP-S6PPc with YFN-AKIN10 were used. As positive controls, amino and carboxy parts of AKIN10 were used, following protocols previously described [45,46]. Fluorescent interactions were visualized under a confocal microscope Leica TCS SP2/DMRE using an excitation wavelength of 514 nm. Genome databases Completed cyanobacterial genomes in GenBank [47] and CyanoBase [48] were searched for ORFs with homology to plant SPP (Arabidopsis thaliana) sequences, using the TBLASTN Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 5 / 19 algorithm. The deduced amino acid sequences with E values lower than 1 x 10 −5 were used to search GenBank non-redundant database using the BLASTP algorithm. Reagents and services Biochemical reagents were purchased from Sigma-Aldrich. Restriction endonucleases were obtained from Takara™. Primers were synthetized by IDT. The pGEM-T Easy vector was purchased from Promega. pQE-80L and pET-19b vectors were purchased from Qiagen and Novagen, respectively. Anti-His-tag antibodies were obtained from Qiagen (Cat No. 34660). Sequencing was carried out at The Institute of Parasitology and Biomedicine "Lo ´pez-Neyra" (IPBLN), Spanish National Research Council (CSIC). Results and Discussion Properties of Arabidopsis Sucrose phosphate phosphatases Heterologous production of recombinant Nt-Histag Arabidopsis SPP1, SPP2, SPP3a and SPP3b were carried out in E.coli as described in the Materials and Methods section. The recombinant SPPs fused to a His-Tag were purified to a high level (Fig 1A). Table 2 summarizes the purification steps followed for SPP2. SPP2 was purified about 306-fold, while SPP3a and SPP3b were purified about 109 and 226-fold (data not shown), respectively. SPPs from Arabidopsis showed a molecular mass of about 52 kDa under denaturing conditions (Fig 1A). However, when SPP2, SPP3a and SPP3b were analysed by gel filtration under non-denaturing conditions they displayed a molecular mass of about 90 kDa (Fig 1B,1Cand 1D), thus indicating that Arabidopsis SPPs are dimeric proteins. This is in accordance with previous studies from other higher plants as pea and rice [19–21], but differs from cyanobacterial SPPs that have been shown to be monomeric enzymes [49]. Even in the pure fractions, we could not detect any activity for the recombinant SPP1 isoform. Among the active Arabidopsis SPPs, SPP2 was shown to be the enzyme with the highest activity, while SPP3a and SPP3b showed lower activity levels (Table 3): SPP3b activity was about 20-times lower than SPP2, while SPP3a displayed about 200-times less activity. When we tested the affinity for Suc6P of the three active SPPs (Table 3), SPP2 was shown to have the lowest Km for Suc6P (0.73 mM), SPP3a showed a similar Km value (0.87 mM), while SPP3b displayed a 5-times higher Km (3.46 mM) than SPP2. Taken together, these results suggest that SPP2 is the main isoform responsible for sucrose synthesis in Arabidopsis with the highest activity and affinity for the substrate, while SPP3a is the isoform with the lowest activity and catalytic efficiency for the substrate (Table 3). Studies of SPP from different organisms show that the enzyme has a relatively high specificity for Suc6P [49]. Therefore, we tested the specificity of the active SPPs from Arabidopsis for different substrates. In agreement with previous studies in other species [49], Fruc6P, Gluc1P, Gluc6P, PEP, p-nitrophenyl phosphate (PNPP) and Gluc1,6BP were poor substrates for SPPs (Fig 2A) and only in the case of SPP3b, PEP could account for about 15% of the activity obtained for Suc6P as substrate. It seems thus clear that SPPs are enzymes that show a high affinity for suc6P and very low for other phosphorylated sugars. It has been previously shown that SPP activity is strictly dependent on the presence of Mg 2 + . Accordingly, the purification of the Arabidopsis SPPs including a dialysis step in a buffer without divalent cations resulted in enzyme preparations with no activity. Fig 2Bshows that activity of SPP2, SPP3a and SPP3b is dependent on the presence of a divalent cation in the reaction buffer, the maximal activity being observed in the presence of Mg 2+ , as previously described for rice and pea SPPs [19–21]. In the presence of other divalent cations, Arabidopsis SPP activity reached very low levels (about 5% of maximal activity), except for SPP2 and Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 6 / 19 Fig 1. Purification and molecular mass determination of Arabidopsis SPP isoforms. (A) SDS-PAGE analysis of purified SPP fractions after gel filtration (Superose 12 10/300 GL). In each case 4 μg of protein were loaded per lane. Purification folds were 306, 109 and 226 for SSP2, SPP3a and SPP3b, respectively. This parameter could not be estimated for SPP1 due to its lack of activity. Proteins were visualized by staining with Coomassie Blue R-250. Lane M, Molecular mass (kDa) markers. Elution profiles of recombinant N t - Histag-SPP isoform SPP2 (B), SPP3a (C) and SPP3b (D), applied to a Superose 12 10/300 GL column. A calibration curve is displayed on the upper insert. Molecular mass standards: β-Amy, β-Amylase (200 kDa); ADH, alcohol dehydrogenase (150 kDa); BSA, bovine serum albumin (66 kDa); CA, carbonic anhydrase (29 kDa); and Cyt.c, cytochrome c (12.4 kDa). SDS-PAGE analysis of the fractions around the activity peaks (highest activity fraction marked with an asterisk) is displayed in the lower insert. As observed, both peaks, corresponding to absorbance at 280 nm (broken line) and sucrose-phosphate phosphatase activity (solid line), co-eluted. doi:10.1371/journal.pone.0166308.g001 Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 7 / 19 SPP3b that in the presence of Mn 2+ exhibited 30% of their maximal activity (Fig 2B). Fig 2B insert shows that SPP2 maximal activity was obtained in the presence of 5 mM Mg 2+ , with a K m for Mg 2+ of 2.3 mM, in the range reported for the rice enzyme [21]. The high preference of SPP for Mg2+, which can only be partially replaced by Mn2+, appears to be a common property of the enzyme in all organisms investigated to date [21,36,50]. Arabidopsis thaliana SPPs showed their maximal activity at neutral pH (Fig 2C). As reported for rice, lettuce and sugar cane [21,36,51], the activity of the three active Arabidopsis SPPs decreased sharply at more acidic pHs, with no activity remaining at pH 5, while at more basic pH the activity was detectable up to pH 9–9.5 (Fig 2C). On the other hand, maximal activity of SPPs was observed at temperatures ranging between 35–45˚C (Fig 2D). In some species, it has been described that SPP is inhibited by sucrose, while in others it has no effect or acts as a weak competitive inhibitor [13,19–21,34–36,50]. We have analysed the effect of sucrose on purified Arabidopsis SPPs and observed that this sugar differentially inhibited Arabidopsis SPP isoforms. Sucrose was a weak inhibitor of SPP2 and SPP3a (Fig 3), while SPP3b was the most sensitive isoform (K i of 24 mM). SPP2 and SPP3a inhibition by sucrose required much higher concentrations (K i 611 mM for SPP2, K i 604 mM for SPP3a) than for SPP3b, suggesting that under physiological conditions SPP2 and SPP3a are not inhibited by sucrose. In this sense, sucrose could bind to the active site of the SPP enzyme in a position similar to the substrate Suc6P as a competitive inhibitor [13]. In our hands, SPP2 and SPP3a activities were slightly inhibited by sucrose concentrations around 100 mM in the presence of 1.25 mM Suc6P in the reaction assay mixture (Fig 3), with K i around 600 mM. These results are comparable to those reported for pea shoots [20], rice leaves [21] and lettuce leaves [36]; but differ from those for sugar cane SPP [34], that was significantly inhibited (60%) at 50 mM sucrose concentration. Similarly to sugar cane SPP, SPP3b showed a Ki for sucrose of 24 mM. Thus, we have observed two types of responses to sucrose inhibition for Arabidopsis SPPs isoforms. Concentrations required for SPP2 and SPP3a inhibition by sucrose are much higher than those physiologically occurring [52], except perhaps in sink organs such as sugar cane shoots or carrot roots, while SPP3b might be regulated by sucrose in physiological conditions. Table 2. Purification of Nt-Histag SPP2 expressed in E.coli (BL21). Purification steps Total protein (mg) Yield (%) Total activity a (U) Specific activity (U/mg protein) Purification (fold) Crude supernatant 1252 100 164.01 0.131 1 Ni-NTA column 4.8 0.3 107.40 22.376 171 Concentration b 3.6 0.2 78.19 21.721 166 Superose 12 1.2 0.1 48.04 40.039 306 a One unit (U) is defined as the hydrolysis of 1 μmol of sucrose-6-phosphate/min at 30˚C. b Ni-NTA fractions were pooled and concentrated to 0.25 ml with an Amicon Ultra-3K concentrator. doi:10.1371/journal.pone.0166308.t002 Table 3. Kinetic properties of Arabidopsis SPP isoforms. SPP2 SPP3a SPP3b K m S6P (mM) 0.73 ±0.32 0.87 ±0.39 3.46 ±0.71 SA max (μmol min -1 mg -1 prot) a 40.04 ±7.31 0.22 ±0.04 2.09 ±0.28 k cat (min -1 ) 4066.36 23.75 215.32 k cat /K m (min -1 mM -1 ) 5551.34 27.26 62.18 a The limit of detection was approximately 0.4 nmol min -1 mg -1 prot. doi:10.1371/journal.pone.0166308.t003 Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 8 / 19 Recovery of Arabidopsis SPP1 activity As indicated in the Introduction section, SPP protein sequences share homology with members of the L-2-haloacid dehalogenase (HAD, IPR006379) superfamily of proteins [13], with the Arabidopsis SPPs included in the family of Sucrose Phosphate Phosphatases from plants and cyanobacteria (IPR012847). The HAD superfamily is characterized by three conserved motifs (I, II and III) related to the active site [13,17,18]. To determine the basis for the lack of Fig 2. Biochemical characterization of recombinant Arabidopsis SPP isoforms. Substrate dependence, metal cofactor specificity, as well as the optimum temperature and pH of Arabidopsis SPP isoforms are shown. (A) SPP activity using different sugar-phosphates as substrate. 100% activity corresponds to 37.68 ±0.18, 0.14±0.01 and 1.93±0.05 μmol min -1 mg -1 prot for SPP2 (black column), SPP3a (grey column) and SPP3b (white column) with Suc6P as substrate, respectively. (B) SPP activity was determined in the presence of 8 mM divalent cation. 100% activity is determined in the presence of optimum Mg 2+ concentration (5 mM) and corresponds to 38.13±0.92, 0.14±0.00 and 1.92±0.04 μmol min -1 mg -1 prot for SPP2, SPP3a and SPP3b as in (A), respectively. Insert shows the Mg 2+ dependence of SPP2 activity. (C) SPP activities were estimated at different pH using a combination of buffers as described in the Materials and Methods section. 100% activity corresponds to 36.35±0.54, 0.13±0.01 and 1.90±0.01 μmol min -1 mg -1 prot for SPP2 (open circle), SPP3a (open triangle) and SPP3b (open square), respectively. (D) Effect of temperature on the activity of Arabidopsis SPP isoforms. 100% specific activity corresponds to 37.21±0.61, 0.14±0.01 and 1.92 ±0.06 μmol min -1 mg -1 prot for SPP2, SPP3a and SPP3b as in (C) respectively. Data were obtained from three independent experiments and are shown as means ±S.D. Fruc6P, fructose-6-phosphate; Gluc1P, glucose-1-phosphate; Gluc6P, glucose-6-phosphate; Gluc1,6BP, glucose-1,6-bisphosphate; Suc6P, sucrose-6-phosphate; PEP, phosphoenol pyruvate; PNPP, p-nitrophenyl phosphate. doi:10.1371/journal.pone.0166308.g002 Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 9 / 19 Supporting Information S1 Fig. Analysis by Western blotting of the fractions eluted from gel filtration of the Histagged monodomain and bidomain SPP proteins. Fractions were resolved by SDS-PAGE (10 w/v for Arabidopsis SPP2 and Synechocystis SPP fused to S6PPc domain of Arabidopsis SPP2 and 12% w/v for S6PP domain of Arabidopsis SPP2 and for Synechocystis SPP). Fractions were transferred onto a nitrocellulose membrane and probed with a specific anti-His-tag antibody (Qiagen, Cat No. 34660). Number-average degree of polymerization is given on top of each blot. (TIFF) S1 Table. Amino acid sequences of the different SPPs displayed in phylogenetic tree of Fig 6. (PDF) Acknowledgments This work was published thanks to helps from the projects BIO2011-28847-C02-00 and BIO2014-52425-P to FV and JMR; by the TRANSPLANTA Consolider 28317 project from Spanish Ministry of Economy and Competitivity (MINECO) and by the Excellence Project P08-AGR-03582 and CVI-281 help from the Andalusian Government. Author Contributions Conceptualization: FV JMR. Funding acquisition: FV JMR. Investigation: TA MTR PR. Methodology: TA MTR PR. Project administration: FV JMR. Resources: FV JMR. Supervision: JMR. Writing – original draft: TA MTR FV JMR. Writing – review & editing: JMR. References 1. Lunn JE, Furbank RT. Sucrose biosynthesis in C4 plants. New Phytologist. 1999; 143(2):221–37. doi: 10.1046/j.1469-8137.1999.00450.x 2. Lunn JE, MacRae E. New complexities in the synthesis of sucrose. Current opinion in plant biology. 2003; 6(3):208–14. PMID: 12753969. 3. Ruan YL. Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annual review of plant biology. 2014; 65:33–67. doi: 10.1146/annurev-arplant-050213-040251 PMID: 24579990. 4. Koch KE. Carbohydrate-Modulated gene expression in plants. Annual review of plant physiology and plant molecular biology. 1996; 47:509–40. doi: 10.1146/annurev.arplant.47.1.509 PMID: 15012299. 5. Osuna D, Usadel B, Morcuende R, Gibon Y, Blasing OE, Hohne M, et al. Temporal responses of transcripts, enzyme activities and metabolites after adding sucrose to carbon-deprived Arabidopsis seedlings. The Plant journal: for cell and molecular biology. 2007; 49(3):463–91. doi: 10.1111/j.1365-313X. 2006.02979.x PMID: 17217462. Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 16 / 19 6. Pal SK, Liput M, Piques M, Ishihara H, Obata T, Martins MC, et al. Diurnal changes of polysome loading track sucrose content in the rosette of wild-type arabidopsis and the starchless pgm mutant. Plant physiology. 2013; 162(3):1246–65. doi: 10.1104/pp.112.212258 PMID: 23674104; PubMed Central PMCID: PMC3707535. 7. Crevillen P, Ventriglia T, Pinto F, Orea A, Merida A, Romero JM. Differential pattern of expression and sugar regulation of Arabidopsis thaliana ADP-glucose pyrophosphorylase-encoding genes. The Journal of biological chemistry. 2005; 280(9):8143–9. doi: 10.1074/jbc.M411713200 PMID: 15598655. 8. Yadav UP, Ivakov A, Feil R, Duan GY, Walther D, Giavalisco P, et al. The sucrose-trehalose 6-phos- phate (Tre6P) nexus: specificity and mechanisms of sucrose signalling by Tre6P. Journal of experimental botany. 2014; 65(4):1051–68. doi: 10.1093/jxb/ert457 PMID: 24420566; PubMed Central PMCID: PMC3935566. 9. Lunn JE, ap Rees T. Apparent equilibrium constant and mass-action ratio for sucrose-phosphate synthase in seeds of Pisum sativum. The Biochemical journal. 1990; 267(3):739–43. PMID: 2140258; PubMed Central PMCID: PMC1131360. 10. Leloir LF, Cardini CE. The biosynthesis of sucrose phosphate. The Journal of biological chemistry. 1955; 214(1):157–65. PMID: 14367374. 11. Lunn JE. Sucrose-phosphatase gene families in plants. Gene. 2003; 303:187–96. PMID: 12559580. 12. Privat I, Foucrier S, Prins A, Epalle T, Eychenne M, Kandalaft L, et al. Differential regulation of grain sucrose accumulation and metabolism in Coffea arabica (Arabica) and Coffea canephora (Robusta) revealed through gene expression and enzyme activity analysis. The New phytologist. 2008; 178 (4):781–97. doi: 10.1111/j.1469-8137.2008.02425.x PMID: 18384509. 13. Fieulaine S, Lunn JE, Borel F, Ferrer JL. The structure of a cyanobacterial sucrose-phosphatase reveals the sugar tongs that release free sucrose in the cell. The Plant cell. 2005; 17(7):2049–58. doi: 10.1105/tpc.105.031229 PMID: 15937230; PubMed Central PMCID: PMC1167551. 14. Fieulaine S, Lunn JE, Ferrer JL. Crystal structure of a cyanobacterial sucrose-phosphatase in complex with glucose-containing disaccharides. Proteins. 2007; 68(3):796–801. doi: 10.1002/prot.21481 PMID: 17510968. 15. Finn RD, Bateman A, Clements J, Coggill P, Eberhardt RY, Eddy SR, et al. Pfam: the protein families database. Nucleic acids research. 2014; 42(Database issue):D222–30. doi: 10.1093/nar/gkt1223 PMID: 24288371; PubMed Central PMCID: PMC3965110. 16. Jones P, Binns D, Chang HY, Fraser M, Li W, McAnulla C, et al. InterProScan 5: genome-scale protein function classification. Bioinformatics. 2014; 30(9):1236–40. doi: 10.1093/bioinformatics/btu031 PMID: 24451626; PubMed Central PMCID: PMC3998142. 17. Aravind L, Galperin MY, Koonin EV. The catalytic domain of the P-type ATPase has the haloacid dehalogenase fold. Trends in biochemical sciences. 1998; 23(4):127–9. PMID: 9584613. 18. Collet JF, Stroobant V, Pirard M, Delpierre G, Van Schaftingen E. A new class of phosphotransferases phosphorylated on an aspartate residue in an amino-terminal DXDX(T/V) motif. The Journal of biological chemistry. 1998; 273(23):14107–12. PMID: 9603909. 19. Lunn JE, Ashton AR, Hatch MD, Heldt HW. Purification, molecular cloning, and sequence analysis of sucrose-6F-phosphate phosphohydrolase from plants. Proceedings of the National Academy of Sciences of the United States of America. 2000; 97(23):12914–9. doi: 10.1073/pnas.230430197 PMID: 11050182; PubMed Central PMCID: PMC18864. 20. Whitaker DP. Purification and properties of sucrose-6-phosphatase from Pisum sativum shoots. Phytochemistry. 1984; 23(11):2429–30. http://dx.doi.org/10.1016/S0031-9422(00)84069-8. 21. Echeverrı ´a E, Salerno G. Properties of sucrose-phosphate phosphatase from rice (Oryza sativa) leaves. Plant Science. 1994; 96(1–2):15–9. http://dx.doi.org/10.1016/0168-9452(94)90217-8. 22. Huber SC, Huber JL. Role and regulation of sucrose-phosphate synthase in higher plants. Annual review of plant physiology and plant molecular biology. 1996; 47:431–44. doi: 10.1146/annurev.arplant. 47.1.431 PMID: 15012296. 23. Chen S, Hajirezaei M, Peisker M, Tschiersch H, Sonnewald U, Bornke F. Decreased sucrose-6-phos- phate phosphatase level in transgenic tobacco inhibits photosynthesis, alters carbohydrate partitioning, and reduces growth. Planta. 2005; 221(4):479–92. doi: 10.1007/s00425-004-1458-4 PMID: 15657716. 24. Toroser D, Athwal GS, Huber SC. Site-specific regulatory interaction between spinach leaf sucrosephosphate synthase and 14-3-3 proteins. FEBS letters. 1998; 435(1):110–4. PMID: 9755869. 25. Winter H, Huber SC. Regulation of sucrose metabolism in higher plants: localization and regulation of activity of key enzymes. Crit Rev Biochem Mol Biol. 2000; 35(4):253–89. doi: 10.1080/ 10409230008984165 PMID: 11005202. 26. Bahaji A, Baroja-Fernandez E, Ricarte-Bermejo A, Sanchez-Lopez AM, Munoz FJ, Romero JM, et al. Characterization of multiple SPS knockout mutants reveals redundant functions of the four Arabidopsis Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 17 / 19 sucrose phosphate synthase isoforms in plant viability, and strongly indicates that enhanced respiration and accelerated starch turnover can alleviate the blockage of sucrose biosynthesis. Plant science: an international journal of experimental plant biology. 2015; 238:135–47. doi: 10.1016/j.plantsci.2015.06. 009 PMID: 26259182. 27. Chen S, Hajirezaei MR, Zanor MI, Hornyik C, Debast S, Lacomme C, et al. RNA interference-mediated repression of sucrose-phosphatase in transgenic potato tubers (Solanum tuberosum) strongly affects the hexose-to-sucrose ratio upon cold storage with only minor effects on total soluble carbohydrate accumulation. Plant, cell & environment. 2008; 31(1):165–76. doi: 10.1111/j.1365-3040.2007.01747.x PMID: 17999659. 28. Lunn JE, Furbank RT. Localisation of sucrose-phosphate synthase and starch in leaves of C4 plants. Planta. 1997; 202(1):106–11. PMID: 9177054. 29. Lunn JE, Hatch MD. The role of sucrose-phosphate synthase in the control of photosynthate partitioning in Zea mays leaves. Functional Plant Biology. 1997; 24(1):1–8. http://dx.doi.org/10.1071/PP96088. 30. Salerno GL, Echeverria E, Pontis HG. Activation of sucrose-phosphate synthase by a protein factor/ sucrose-phosphate phosphatase. Cellular and molecular biology. 1996; 42(5):665–72. PMID: 8832097. 31. Echeverria E, Salvucci ME, Gonzalez P, Paris G, Salerno G. Physical and kinetic evidence for an association between sucrose-phosphate synthase and sucrose-phosphate phosphatase. Plant physiology. 1997; 115(1):223–7. PMID: 12223802; PubMed Central PMCID: PMC158478. 32. Maloney VJ, Park J-Y, Unda F, Mansfield SD. Sucrose phosphate synthase and sucrose phosphate phosphatase interact in planta and promote plant growth and biomass accumulation. Journal of experimental botany. 2015; 66(14):4383–94. doi: 10.1093/jxb/erv101 PMID: 25873678 33. Jiang SY, Chi YH, Wang JZ, Zhou JX, Cheng YS, Zhang BL, et al. Sucrose metabolism gene families and their biological functions. Sci Rep. 2015; 5:17583. doi: 10.1038/srep17583 PMID: 26616172; PubMed Central PMCID: PMCPMC4663468. 34. Hawker JS, Hatch MD. A specific sucrose phosphatase from plant tissues. The Biochemical journal. 1966; 99(1):102–7. PMID: 4290548; PubMed Central PMCID: PMC1264962. 35. Hawker JS, Smith GM. Occurrence of sucrose phosphatase in vascular and non-vascular plants. Phytochemistry. 1984; 23(2):245–9. http://dx.doi.org/10.1016/S0031-9422(00)80311-8. 36. Echeverrı ´a E, Salerno G. Intracellular localization of sucrose-phosphate phosphatase in photosynthetic cells of lettuce (Lactuca sativa). Physiologia plantarum. 1993; 88(3):434–8. doi: 10.1111/j.1399-3054. 1993.tb01356.x 37. Seki M, Carninci P, Nishiyama Y, Hayashizaki Y, Shinozaki K. High-efficiency cloning of Arabidopsis full-length cDNA by biotinylated CAP trapper. The Plant journal: for cell and molecular biology. 1998; 15 (5):707–20. PMID: 9778851. 38. Seki M, Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, et al. Functional annotation of a full-length Arabidopsis cDNA collection. Science. 2002; 296(5565):141–5. doi: 10.1126/science.1071006 PMID: 11910074. 39. Ortiz-Marchena MI, Albi T, Lucas-Reina E, Said FE, Romero-Campero FJ, Cano B, et al. Photoperiodic control of carbon distribution during the floral transition in Arabidopsis. The Plant cell. 2014; 26(2):565– 84. doi: 10.1105/tpc.114.122721 PMID: 24563199; PubMed Central PMCID: PMCPMC3967026. 40. Ventriglia T, Kuhn ML, Ruiz MT, Ribeiro-Pedro M, Valverde F, Ballicora MA, et al. Two Arabidopsis ADP-glucose pyrophosphorylase large subunits (APL1 and APL2) are catalytic. Plant physiology. 2008; 148(1):65–76. doi: 10.1104/pp.108.122846 PMID: 18614708; PubMed Central PMCID: PMCPMC2528121. 41. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 1976; 72:248–54. PMID: 942051. 42. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 227(5259):680–5. PMID: 5432063. 43. Rathbun WB, Betlach MV. Estimation of enzymically produced orthophosphate in the presence of cysteine and adenosine triphosphate. Analytical biochemistry. 1969; 28(1):436–45. PMID: 5781434. 44. Hernandez A, Ruiz MT. An EXCEL template for calculation of enzyme kinetic parameters by non-linear regression. Bioinformatics. 1998; 14(2):227–8. PMID: 9545460. 45. Voinnet O, Rivas S, Mestre P, Baulcombe D. An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant journal: for cell and molecular biology. 2003; 33(5):949–56. PMID: 12609035. 46. Lucas-Reina E, Romero-Campero FJ, Romero JM, Valverde F. An Evolutionarily Conserved DOFCONSTANS Module Controls Plant Photoperiodic Signaling. Plant physiology. 2015; 168(2):561–74. doi: 10.1104/pp.15.00321 PMID: 25897001; PubMed Central PMCID: PMCPMC4453789. Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 18 / 19 47. Benson DA, Cavanaugh M, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, et al. GenBank. Nucleic acids research. 2013; 41(Database issue):D36–42. doi: 10.1093/nar/gks1195 PMID: 23193287; PubMed Central PMCID: PMC3531190. 48. Fujisawa T, Okamoto S, Katayama T, Nakao M, Yoshimura H, Kajiya-Kanegae H, et al. CyanoBase and RhizoBase: databases of manually curated annotations for cyanobacterial and rhizobial genomes. Nucleic acids research. 2014; 42(Database issue):D666–70. doi: 10.1093/nar/gkt1145 PMID: 24275496; PubMed Central PMCID: PMC3965071. 49. Lunn JE. Evolution of sucrose synthesis. Plant physiology. 2002; 128(4):1490–500. doi: 10.1104/pp. 010898 PMID: 11950997; PubMed Central PMCID: PMC154276. 50. Hawker JS. Studies on the location of sucrose phosphatase in plant tissues. Phytochemistry. 1966; 5 (6):1191–9. http://dx.doi.org/10.1016/S0031-9422(00)86114-2. 51. Hawker JS, Smith GM, Phillips H, Wiskich JT. Sucrose phosphatase associated with vacuole preparations from red beet, sugar beet, and immature sugarcane stem. Plant physiology. 1987; 84(4):1281–5. PMID: 16665598; PubMed Central PMCID: PMC1056765. 52. Winter H, Robinson DG, Heldt HW. Subcellular volumes and metabolite concentrations in spinach leaves. Planta. 1994; 193(4):530–5. doi: 10.1007/bf02411558 53. Crevillen P, Ballicora MA, Merida A, Preiss J, Romero JM. The different large subunit isoforms of Arabidopsis thaliana ADP-glucose pyrophosphorylase confer distinct kinetic and regulatory properties to the heterotetrameric enzyme. The Journal of biological chemistry. 2003; 278(31):28508–15. doi: 10.1074/ jbc.M304280200 PMID: 12748181. 54. Yang H-L, Liu Y-J, Wang C-L, Zeng Q-Y. Molecular Evolution of Trehalose-6-Phosphate Synthase (TPS) Gene Family in Populus, Arabidopsis and Rice. PloS one. 2012; 7(8):e42438. doi: 10.1371/ journal.pone.0042438. PMC3414516. PMID: 22905132 55. Satoh-Nagasawa N, Nagasawa N, Malcomber S, Sakai H, Jackson D. A trehalose metabolic enzyme controls inflorescence architecture in maize. Nature. 2006; 441(7090):227–30. http://www.nature.com/ nature/journal/v441/n7090/suppinfo/nature04725_S1.html. doi: 10.1038/nature04725 PMID: 16688177 56. Sun CW, Callis J. Independent modulation of Arabidopsis thaliana polyubiquitin mRNAs in different organs and in response to environmental changes. The Plant journal: for cell and molecular biology. 1997; 11(5):1017–27. PMID: 9193073. 57. Ginzinger DG. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Experimental hematology. 2002; 30(6):503–12. PMID: 12063017. 58. Rippka R, Deruelles J, Waterbury JB, Herdman M, Stanier RY. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. Journal of General Microbiology. 1979; 111(1):1–61. doi: 10.1099/00221287-111-1-1 59. Cumino A, Ekeroth C, Salerno GL. Sucrose-phosphate phosphatase from Anabaena sp. strain PCC 7120: isolation of the protein and gene revealed significant structural differences from the higher-plant enzyme. Planta. 2001; 214(2):250–6. PMID: 11800389. 60. Cumino AC, Perez-Cenci M, Giarrocco LE, Salerno GL. The proteins involved in sucrose synthesis in the marine cyanobacterium Synechococcus sp. PCC 7002 are encoded by two genes transcribed from a gene cluster. FEBS letters. 2010; 584(22):4655–60. doi: 10.1016/j.febslet.2010.10.040 PMID: 20974142. 61. Sievers F, Higgins DG. Clustal Omega, accurate alignment of very large numbers of sequences. Methods Mol Biol. 2014; 1079:105–16. doi: 10.1007/978-1-62703-646-7_6 PMID: 24170397. Arabidopsis thaliana Sucrose Phosphate Phosphatases PLOS ONE | DOI:10.1371/journal.pone.0166308 November 17, 2016 19 / 19