R Loops Are Linked to Histone H3 S10 Phosphorylation and Chromatin Condensation

Depósito de investigación de la Universidad de Sevilla https://idus.us.es/ “This is an Accepted Manuscript of an article published by Elsevier (Cell Press) in: MOLECULAR CELL on 2013, available at: https://doi.org/10.1016/j.molcel.2013.10.006” R-loops are linked to histone H3 S10 phosphorylation and chromatin condensation Maikel Castellano-Pozo,1 José M. Santos-Pereira,1 Ana G. Rondón,1 Sonia Barroso,1 Eloisa Andújar,2 Mónica Pérez-Alegre,2 Tatiana García-Muse,1 and Andrés Aguilera1,2,* 1Department of Molecular Biology 2Genomic Unit, Centro Andaluz de Biología Molecular y Medicina Regenerativa CABIMER Universidad de Sevilla-CSIC, Avenida Amé rico Vespucio, 41092 Seville, Spain *Correspondence: [email protected] SUMMARY R loops are transcription byproducts that constitute a threat to genome integrity. Here we show that R loops are tightly linked to histone H3 S10 phosphorylation (H3S10P), a mark of chromatin condensation. Chromatin immunoprecipitation (ChIP)-on-chip (ChIP-chip) analyses reveal H3S10P accumulation at centromeres, pericentromeric chromatin, and a large number of active open reading frames (ORFs) in R-loop-accumulating yeast cells, better observed in G1. Histone H3S10 plays a key role in maintaining genome stability, as scored by ectopic recombination and plasmid loss, Rad52 foci, and Rad53 checkpoint activation. H3S10P coincides with the presence of DNA-RNA hybrids, is suppressed by ribonuclease H overexpression, and causes reduced accessibility of restriction endonucleases, implying a tight connection between R loops, H3S10P, and chromatin compaction. Such histone modifications were also observed in R-loop-accumulating Caenorhabditis elegans and HeLa cells. We therefore provide a role of RNA in chromatin structure essential to understand how R loops modulate genome dynamics. INTRODUCTION R loops are essential in replication initiation of mitochondrial DNA, in an alternative mechanism of replication initiation in bacteria, and in class-switch recombination in vertebrate B cells (Aguilera and García-Muse, 2012) and have been suggested to play a role in transcription termination (Skourti- Stathaki et al., 2011). However, R loops are potentially harmful structures that promote genome instability by impairing replication fork progression (Gan et al., 2011; Wellinger et al., 2006). Accordingly, cells use factors to either remove R loops, such as ribonuclease H (RNase H) or the Sen1/SETX DNA-RNA helicase (Cerritelli and Crouch, 2009; Mischo et al., 2011), or prevent their formation, such as a number of mRNA biogenesis and processing proteins (Huertas and Aguilera, 2003; Li and Manley, 2005; Paulsen et al., 2009; Stirling et al., 2012; Wahba et al., 2011), the THO complex being a paradigmatic example conserved from yeast to humans (Domínguez-Sánchez et al., 2011). Different mechanisms have been proposed to explain how R loops can contribute to genome instability. It is believed that R loops can either enhance the susceptibility of DNA to endogenous genotoxic agents or be an obstacle to the progression of replication fork that can lead to its collapse (Aguilera and García- Muse 2012). However, we do not yet know the mechanism and factors responsible for genome instability mediated by R loops or whether additional elements, such as R-loop-mediated chromatin modifications, could modulate genome dynamics. Here we investigated the possible connections of R loops with histone modifications as a first step to explore additional elements by which R loops can contribute to genome instability. Strikingly, we found that R loops are linked to histone H3 S10 phosphorylation, a mark of chromatin condensation that opens unexpected views to understand the role of R loops in genome dynamics. RESULTS High levels of the H3S10P chromatin compaction mark in R-loop-accumulating strains during mitosis and meiosis To address whether R loops were connected to specific chromatin modifications in Saccharomyces cerevisiae, we assayed first by western blotting if posttranslational histone modifications were altered in R-loop-accumulating mutants. Notably, we found that histone H3 was highly phosphorylated at S10 (H3S10P), a marker of chromatin condensation (Hsu et al., 2000), both in mitotic and meiotic cells. In wild-type (WT) cells, H3S10P was either poorly or not detected in G1 during the mitotic cycle. Instead, H3S10 was clearly phosphorylated during G1 in R- loop-accumulating hpr1D mutants of the THO complex as well as at high levels in S/G2 (Figure 1A). In meiosis, H3S10P was observed only 1.5 hr after initiating synchronous meiosis in WT cells, whereas in hpr1D cells, H3S10P was clearly detected at all meiotic stages, as determined in synchronous meiosis of SK1 isogenic cells (Figure 1B), as the SK1 genetic background is able to undergo rapid and synchronized meiosis. Importantly, this mark is not specific to THO mutants, as we can also see a significant presence of H3S10P in G1-arrested cells of R-loop- accumulating rnh1D rnh2D strains (Figure S1A available online). Even though hpr1D cells remained longer in S/G2, the difference in H3S10P with respect to WT persists and even increases when cells are arrested in G1 for 3 hr (Figure S1B), confirming a true phosphorylation of H3S10 in G1 hpr1D cells that does not occur in WT cells. Other histone H3 modifications, such as H3K14 acetylation (H3K14ac) and H3K4 trimethylation (H3K4me3) known to be associated with transcription, presented the same pattern as the wild-type, as determined by western blotting (Figure S1C) and by chromatin immunoprecipitation (ChIP) in the GAL1- FMP27 fusion construct (Figure S1D). Background levels of H3S10P were observed all over the FMP27 gene in wild-type and hpr1D cells (Figure S1D). The results indicate that the genome of R-loop-accumulating strains shows high levels of the H3S10P chromatin mark, known to associate with chromatin condensation, in mitosis and meiosis. Deregulation of histone H3S10 phosphorylation results in genome instability We next determined whether such a chromatin mark had any effect on genome instability, a hallmark of R-loop-accumulating mutants. For this, we used specific histone H3 point mutations at S10 that cannot be phosphorylated (H3S10A) or that mimic constitutive phosphorylation (H3S10D). A slight, but significant, increase in direct-repeat recombination together with an increase in Rad52 foci and plasmid loss was observed in both H3S10 mutants (Figures 1C–1E). In addition, the S phase checkpoint was activated, as determined by Rad53 phosphorylation in both H3S10 mutants (Figure 1F). The results indicate that H3S10 is important for genome integrity, consistent with our prediction. However, the similar phenotypes observed in both H3S10 mutants indicate that the phosphorylation state of this residue, or even the S10 residue itself, may control genome dynamics by itself, whether or not R loops are involved. Indeed, Rad52 foci accumulation and hyperrecombination of hpr1D cells are partially suppressed in the double mutants hpr1D H3S10A and hpr1D H3S10D (Figures 1C and 1D), confirming the role of the S10 residue in genome instability in hpr1D cells regardless of its R-loop-dependent phosphorylation stage. It is possible that H3S10 itself, or its phosphorylation state, controls different DNA metabolic processes, including replication and repair, by helping recruit specific factors, but this is an open question. A similar situation can be that of other histone modifications like H3K56 acetylation (Muñoz-Galván et al., 2013). Genome-wide distribution of H3S10P in R-loop-accumulating strains To get further insight into the physiological meaning of the H3S10P mark, we determined the distribution of this mark along the yeast genome of the R-loop-accumulating hpr1D strain compared to WT cells in G1 and S phase by ChIP-on-chip (ChIP-chip) analyses. Notably, in contrast to WT cells, there is a much more abundant and spread distribution of H3S10P along all chromosomes in the hpr1D strain that is clearly manifested in G1 cells (Figures 2 and S2). The H3S10P signal was clearly overabundant at the centromeres and the pericentromeric regions as well as all over the genome in G1- arrested hpr1D cells (Figures 2A, 2B, and S2). The number of genes located in the 40 kb pericentromeric region and all over the genome that contained H3S10P signals was significantly higher (p < 0.001) in G1-arrested hpr1D cells than in wild-type cells (Figure 2A). Interestingly, a detailed statistical analysis of all 40 kb pericentromeric regions of the genome revealed a significantly high H3S10P accumulation in hpr1D cells not observed in the wild-type, while the global amount of histone H3 was unchanged (Figures 2C and S3A). The accumulation profile of H3S10P at the pericentromeric genes was clearly higher along the whole extension of the open reading frames (ORFs) analyzed in hpr1D cells as compared to WT cells, which show a reduced signal (Figure 2D). Importantly, even though this higher H3S10P accumulation is better observed in the pericentromeric ORFs, it is also higher along the length of most ORFs, pericentromeric or not (Figures 2D and S3). Moreover, 92% of all H3S10P-positive ORFs (2,373 out of 2,578) show transcription at highly detectable levels in hpr1D cells (Gómez-González et al., 2011), indicating that H3S10P is a feature of transcribed DNA regions. In general, a higher H3S10P signal could still be seen in S cells, in which H3S10P was clearly detected at centromeres (Figures 2A, S2, and S3), but at this phase the differences between hpr1D and WT cells diminished, consistent with the western analysis (Figure 1A). No significant differences could be seen in tRNAs and other DNA regions at any cell cycle stage, although the number of autonomously replicating sequences (ARSs) with H3S10P was higher in G1-arrested cells (Figure 2A). H3S10P is linked to R-loops and chromatin compaction The results suggest that the high levels of H3S10P are linked to R loops. To determine whether this was the case, we performed ChIP and DNA-RNA immunoprecipitation (DRIP) analysis of the pericentromeric region in chromosome VI with anti-H3S10P and anti-RNA-DNA hybrid (S9.6) antibodies, respectively (Figures 3A and 3B). G1 cells clearly accumulated the H3S10P signal in hpr1D, but not in WT cells, validating the ChIP-chip results. This signal was abolished by RNH1 overexpression (Figure 3A), indicating a tight link between R loops and H3S10P. Importantly, RNH1 overexpression does not affect cell-cycle progression in either WT or in hpr1D cells, excluding any possible effect of cell-cycle stage in the results (Figure S4A). Notably, RNA-DNA hybrids were detected in these regions in hpr1D, but not in WT cells (Figure 3B). Moreover, R loops accumulated in hpr1D were strongly reduced by RNH1 treatment, whereas WT cells with or without RNH1 treatment were unable to accumulate detectable R loops (Figure 3B). This strong correlation between H3S10P and R loops was also observed in genes located at different distances from the centromere (Figure 3C), implying that it occurs all over the genome and not only at centromeric and pericentromeric regions. Therefore, R loops are physically linked to H3S10P. To determine whether R-loop-dependent H3S10P behaved as a mark of chromatin compaction or condensation (Hsu et al., 2000; Wei et al., 1999), we assayed the accessibility of the restriction enzyme DraI to the pericentromeric chromatin by monitoring DNA cleavage in vivo. Clearly, the efficiency of DraI and EcoRI cleavage was significantly reduced in the R-loop-accumulating hpr1D cells, but not in WT cells (Figure 3D). Consistently, in the hpr1-101 mutant, which carries a defective hpr1 allele that does not enhance R loops (Gómez- González and Aguilera, 2009), H3S10 phosphorylation (Figure S4B) and restriction enzyme accessibility were the same as in the wild-type (Figure 3D). Importantly, the difference in DraI accessibility is also observed in non-centromeric regions (Figure S4C), matching with the results of H3S10P distribution. These results are consistent with the conclusion that the H3S10P mark reflects a major compaction or condensation of chromatin. The link between R-loops and H3S10P also occurs in C. elegans and human cells In parallel with our yeast study, we wondered whether this phenomenon was conserved in multicellular eukaryotes. Given that R loops also accumulate in C. elegans thoc-2 null mutants of the THO complex, causing replication defects linked to genome instability (Castellano-Pozo et al., 2012), we determined by immunostaining whether chromatin compaction also occurred in these C. elegans strains. Notably, histone H3 was not only highly phosphorylated at S10 (H3S10P), but it was also dimethylated at K9 (H3K9me2), a marker of heterochromatin not conserved in yeast (Hsu et al., 2000; Reddy and Villeneuve, 2004), both at mitotic and pachytene meiotic regions of the germline of the R-loop- accumulating thoc-2 strain (Figure 4A). Such modifications are not found in N2(WT) worms during mitosis, whereas in meiosis they are observed only after pachytene, consistent with them being marks of condensation. Indeed, DAPI staining shows bright and condensed nuclei in the germline of thoc-2 worms, as compared to those of N2(WT) worms (Figure S4D). In agreement with the yeast data, we detect S9.6 foci in thoc-2 germlines, but not in N2(WT) worms (Figure S4E). No difference between N2(WT) and thoc-2 was observed for the H4 tetra-acetylation pattern used as a marker of euchromatin (Figure 4A) (Reddy and Villeneuve, 2004). Next, we asked whether this phenomenon was also conserved in human cells. For this, we assayed H3S10P accumulation in R-loop-accumulating THOC1- and senataxin (SETX)-depleted human cells (Domínguez-Sánchez et al., 2011; Skourti-Stathaki et al., 2011). We included senataxin-depleted cells to assay whether the R-loop-associated H3S10 phosphorylation occurred regardless of the system we used to enhance R loops. We performed immunofluorescence with anti-H3S10P antibody in HeLa cells grown in ethynyldeoxyuridine (EdU)-containing media to differentiate nonreplicating G1 cells from actively replicating S phase cells. Consistent with the yeast and worm results, G1 HeLa cells with H3S10P foci were only observed in the absence of THOC1 or SETX (Figures 4B and 4C). Moreover, RNase H1 overexpression decreases H3S10P foci formation, supporting the connection between H3S10P and R loops (Figures 4B and 4C). The results suggest that the link between R loops and chromatin condensation marks such as H3S10P is conserved in all eukaryotes, including yeast, nematodes, and humans. DISCUSSION The link between different histone modifications and RNA molecules has been shown in eukaryotes. A well-known example is the X-inactivation in mammals by RNA Xist (Lee and Bartolomei, 2013) or gene silencing linked to long noncoding RNAs (ncRNA) that, in most cases, is mediated by siRNAs (Bernstein and Allis, 2005) or via chromatin deacetylation by an antisense ncRNA, as shown in S. cerevisiae (Camblong et al., 2007). Interestingly, RNA-DNA hybrids prevent methylation and transcriptional silencing at CpG island promoters (Ginno et al., 2012) and induce transcriptional silencing, likely through siRNA, in S. pombe (Nakama et al., 2012). Furthermore, centromeres and pericentromeric regions are known to be transcribed, and transcription of pericentromeric DNA repeats is required for pericentromeric heterochromatin formation in S. pombe (Chan and Wong, 2012). Histone H3S10P and chromatin condensation have never been connected to RNA metabolism, even though H3S10P also controls transcription elongation by releasing the RNA polymerase II (RNAPII) from promoter-proximal pausing sites in Drosophila (Ivaldi et al., 2007). It is believed that H3S10P may modulate the access of different proteins to chromatin, establishing a hierarchy of subsequent events that affect chromatin structure and function (Liokatis et al., 2012). Our study shows that R loops are linked to H3S10P and chromatin compaction. The H3S10P mark is scattered at transcribed genes all over the genome, even though it is better detected at the pericentromeric and centromeric regions. This phenomenon is independent of siRNA, provided that S. cerevisiae does not have siRNA processes. According to our results, R loops can either trigger phosphorylation of H3S10 or inhibit its dephosphorylation. This can be achieved by either enhancement of the recruitment of the responsible kinase or inhibition of the activity of the responsible phosphatase. As more than one enzyme may be involved in this process (Baek, 2011), further extensive work will be needed to decipher the molecular mechanism of this control. Nevertheless, it has been shown that H3S10P levels in yeast depend on the Ipl1 kinase and the Glc7 phosphatase and that Ipl1 and Glc7 interact physically or genetically with factors, such as Set1 and Sen1 (Breitkreutz et al., 2010; Nedea et al., 2008; Zhang et al., 2005), that have been implicated in the metabolism of R loops (Mischo et al., 2011). These data open the possibility of a functional link between R loops and H3S10P that would need to be explored in the future. Although our study does not establish whether R loops help chromatin condensation or vice versa, we favor a model in which R loops trigger the formation of highly condensed chromatin patches that would appear throughout the genome, in particular at centromere and pericentromeric regions due to its higher capacity to nucleate chromatin condensation (Figure 4D). This model is supported by the reduction of H3S10P levels along the yeast genome of hpr1D cells by RNase H1 overexpression. Thus, it is possible that condensation spreads from the R loop. Importantly, such condensed regions would interfere with replication and/or transcription (Figure 4D), causing transcription-associated genome instability and gene silencing. This could contribute to the previously reported effect of R loops on both processes in eukaryotes (Huertas and Aguilera 2003). Interestingly, the observations that common fragile sites (CFSs) can be explained by retarded or incomplete replication at chromatin-condensed regions (Debatisse et al., 2012) and that CFSs can be related to cotranscriptional R loops (Helmrich et al., 2011) open the possibility that local chromatin compaction contributes to the replication fork progression impairment or to a delayed or less-efficient replication initiation as possible factors that cause genome instability. This unexpected link between R loops, histone H3S10P, and chromatin compaction or condensation therefore opens unexpected perspectives with which to understand the mechanism by which RNA controls genome dynamics and function. EXPERIMENTAL PROCEDURES Yeast strains and growth The yeast strains used in this work are listed in Table S1. Cells were arrested in G1 with a factor (0.14 mg/ml) and in S phase with 200 mM hydroxyurea (HU). For meiotic analysis, synchronous meiotic cultures were prepared as previously described (Alani et al., 1990). Nematode strains and growth The nematode strain Bristol N2 used as wild-type was provided by the Caenorhabditis Genetics Center. The thoc-2 (tm1310) mutant was previously characterized (Castellano-Pozo et al., 2012). C. elegans strains were grown at 20◦C, and standard methods were used for their maintenance and manipulation (Brenner, 1974). Human cell culture and transfection HeLa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO) supplemented with 10% heat-inactivated fetal bovine serum at 37◦C (5% CO2). Transient transfection of siRNA (10 nM) was performed using DharmaFECT (Dharmacon) according to the manufacturer’s instructions. Then, 96 hr after transfection, cells were incubated with 20 mM EdU (Click-iT EdU Imaging Kit, Invitrogen) for 20 min to label replicating cells. ChIP and DIP/DRIP assays For ChIP experiments at the pericentromeric region of CEN6, cells harboring the empty vector pCM189 or the ptetRNH1 plasmid were grown in synthetic complete media without uracil (SC-ura), and samples were treated as described (Duch et al., 2013). Antibodies used are listed in Table S2. For real-time PCR, oligonucleotides for the CEN6 pericentromeric region previously described (Choy et al., 2011) and for other loci (Table S3) were used. Means ± SD of three independent experiments are shown. DRIP experiments were carried out essentially as originally described like DNA IP (DIP) (Mischo et al., 2011). Means ± SD of three independent experiments are shown. ChIP-Chip Cells were grown in YEPD medium and arrested in G1 with a factor (0.14 mg/ml) for 2 hr (G1 phase) and then released in new rich medium with 200 mM HU for another hour (S phase). ChIP-chip was carried out as previously described (Bermejo et al., 2007; Bermejo et al., 2009; Katou et al., 2003; 2006). For details and bioinformatics analysis, see Supplemental Information. Chromatin accessibility assays Nuclei preparations from G1-arrested cells with a factor (0.14 mg/ml) were made as previously described (Crotti and Basrai, 2004). Similar quantities of nuclei were incubated with 0, 5, 15, 50, and 150 units/ml of DraI at 37◦C for 30 min followed by digestion with 250 U/ml EcoRI. Southern blotting was performed, and filters were probed with a 32P-deoxycytidine triphosphate (dCTP)-labeled CEN3 0.9 kb HindIII-BamHI fragment following standard procedures. Miscellanea Immunofluorescence analyses using the indicated antibodies were performed in 1 day post-L4 C. elegans adult gonads treated as described (Castellano- Pozo et al., 2012) and in human cells cultured on glass coverslips and fixed as described previously (Domínguez-Sánchez et al., 2011). EdU detection was performed using a Click-iT EdU Imaging Kit (Invitrogen) following manufacturer’s instructions. DNA was stained with DAPI. Recombination and plasmid-loss assays and Rad52 foci are described in Gómez-González et al. (2009) and the Supplemental Information. ACCESSION NUMBERS The Gene Expression Omnibus accession number for the set of ChIP-chip data reported in this paper is GSE46627. ACKNOWLEDGMENTS We thank J.C. Reyes and F. Monje-Casas for useful comments on the manuscript and D. Haun for style correction. Research was funded by grants from the Spanish Ministry of Economy and Competitiveness (Consolider Ingenio 2010 CSD2007-0015 and BFU2010-16372), Junta de Andalucía (CVI-4567), and the European Union (FEDER). M.C.-P. and J.M.S.-P. were recipients of predoctoral training grants from the Spanish National Institute of Health Carlos III and the Consejo Superior de Investigaciones Científicas (CSIC), respectively. REFERENCES Aguilera, A., and García-Muse, T. (2012). R loops: from transcription by products to threats to genome stability. Mol. Cell 46, 115–124. Alani, E., Padmore, R., and Kleckner, N. (1990). Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61, 419–436. Baek, S.H. (2011). When signaling kinases meet histones and histone modifiers in the nucleus. Mol. Cell 42, 274–284. Bermejo, R., Doksani, Y., Capra, T., Katou, Y.M., Tanaka, H., Shirahige, K., and Foiani, M. (2007). Top1- and Top2-mediated topological transitions at replication forks ensure fork progression and stability and prevent DNA damage checkpoint activation. Genes Dev. 21, 1921–1936. Bermejo, R., Katou, Y.M., Shirahige, K., and Foiani, M. (2009). ChIP-on-chip analysis of DNA topoisomerases. Methods Mol. Biol. 582, 103–118. Bernstein, E., and Allis, C.D. (2005). RNA meets chromatin. Genes Dev. 19, 1635–1655. Breitkreutz, A., Choi, H., Sharom, J.R., Boucher, L., Neduva, V., Larsen, B., Lin, Z.Y., Breitkreutz, B.J., Stark, C., Liu, G., et al. (2010). A global protein kinase and phosphatase interaction network in yeast. Science 328, 1043– 1046. Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71–94. Camblong, J., Iglesias, N., Fickentscher, C., Dieppois, G., and Stutz, F. (2007). Antisense RNA stabilization induces transcriptional gene silencing via histone deacetylation in S. cerevisiae. Cell 131, 706–717. Castellano-Pozo, M., García-Muse, T., and Aguilera, A. (2012). R-loops cause replication impairment and genome instability during meiosis. EMBO Rep. 13, 923–929. Cerritelli, S.M., and Crouch, R.J. (2009). Ribonuclease H: the enzymes in eukaryotes. FEBS J. 276, 1494–1505. Chan, F.L., and Wong, L.H. (2012). Transcription in the maintenance of centromere chromatin identity. Nucleic Acids Res. 40, 11178–11188. Choy, J.S., Acuña, R., Au, W.C., and Basrai, M.A. (2011). A role for histone H4K16 hypoacetylation in Saccharomyces cerevisiae kinetochore function. Genetics 189, 11–21. Crotti, L.B., and Basrai, M.A. (2004). Functional roles for evolutionarily conserved Spt4p at centromeres and heterochromatin in Saccharomyces cerevisiae. EMBO J. 23, 1804–1814. Debatisse, M., Le Tallec, B., Letessier, A., Dutrillaux, B., and Brison, O. (2012). Common fragile sites: mechanisms of instability revisited. Trends Genet. 28, 22–32. Domínguez-Sánchez, M.S., Barroso, S., Gómez-González, B., Luna, R., and Aguilera, A. (2011). Genome instability and transcription elongation impairment in human cells depleted of THO/TREX. PLoS Genet. 7, e1002386. Duch, A., Felipe-Abrio, I., Barroso, S., Yaakov, G., García-Rubio, M., Aguilera, A., de Nadal, E., and Posas, F. (2013). Coordinated control of replication and transcription by a SAPK protects genomic integrity. Nature 493, 116–119. Gan, W., Guan, Z., Liu, J., Gui, T., Shen, K., Manley, J.L., and Li, X. (2011). R-loop-mediated genomic instability is caused by impairment of replication fork progression. Genes Dev. 25, 2041–2056. Ginno, P.A., Lott, P.L., Christensen, H.C., Korf, I., and Che´ din, F. (2012). R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Mol. Cell 45, 814–825. Gómez-González, B., and Aguilera, A. (2009). R-loops do not accumulate in transcription-defective hpr1-101 mutants: implications for the functional role of THO/TREX. Nucleic Acids Res. 37, 4315–4321. Gómez-González, B., Felipe-Abrio, I., and Aguilera, A. (2009). The S-phase checkpoint is required to respond to R-loops accumulated in THO mutants. Mol. Cell. Biol. 29, 5203–5213. Gómez-González, B., García-Rubio, M., Bermejo, R., Gaillard, H., Shirahige, K., Marín, A., Foiani, M., and Aguilera, A. (2011). Genome-wide function of THO/TREX in active genes prevents R- loop-dependent replication obstacles. EMBO J. 30, 3106–3119. standard deviations of three fluctuations tests, each one performed from six independent colonies. Rad52 foci Cells harboring the pWJ1344 plasmid containing the tagged RAD52-YFP27 fusion (Lisby et al., 2003) were 4’,6-diamidino-2-phenylindole (DAPI)-stained and scored for spontaneous Rad52– YFP foci in nuclei from S–G2 mid-log cells, which were visualized with a Leica DC 350F microscope. The data obtained represent the average values and standard deviations of three experiments performed with independent transformants. FACS and Western analysis For FACS analysis, cells were fixed in ethanol, treated overnight with RNase A at 37ºC in PBS, stained with propidium iodide and analyzed in a FACScan cytometer (Becton Dickinson). A total of 100,000 cells were analyzed. TCA protein extracts were resolved using SDS–PAGE. Total amounts of the indicated proteins were detected by immunoblotting using the antibodies listed in Table S2 using the ECL detection reagent (Amersham). ChIP and DIP/DRIP assays For chromatin immunoprecipitation (ChIP) experiments at the pericentromeric region of CEN6, cells harboring the empty vector pCM189 or the ptetRNH1 plasmid were grown in SC-ura to mid-log exponential phase to an OD600 nm of 0.5. Cells were synchronized at G1-phase as explained above. ChIP assays at the GALp::YRL454w fusion construct were made in asynchronously mid-log exponential phase cultures growing in YEPD rich medium. For ChIP samples cells were treated as described (Duch et al., 2013), except that chromatin was incubated overnight with the specific antibody pre-coupled to Dynabeads Protein A (Invitrogen). Antibodies used are listed in Table S2. For real-time PCR, oligonucleotides for the pericentromeric region of the CEN6 and for HML locus previously described were used (Choy et al., 2011). Oligonucleotides at GALp::YRL454w construction and intergenic region of chromosome V have been previously described (Gonzalez-Aguilera et al., 2008). Other oligonucleotids used are listed in Table S3. Average and standard deviations of three independent experiments are shown. DNA-RNA hybrid immunoprecipitation (DRIP) experiments were carried out essentially as originally described as DIP (Mischo et al., 2011), with some modifications: genomic DNA was treated with RNase A, resuspended in lysis buffer (50 mM HEPES-KOH pH 7,5; 140 mM NaCl; 1 mM EDTA pH 8; 1% Triton X-100; 0,1% sodium deoxycholate), sonicated and 16 immunoprecipitated with 10 µg of S9.6 antibody overnight at 4ºC. The abundance of each DNA fragment was calculated by real-time quantitative PCR. The average and standard deviation of three independent experiments are shown. ChIP-chip assays ChIP-chip was carried out as previously described (Bermejo et al., 2007; Bermejo et al., 2009; Katou et al., 2006; Katou et al., 2003). Briefly, we disrupted 1.5 x 107 cells by multi-beads shocker (MB400U, Yasui Kikai, Japan), which was able to keep cells precisely at 4ºC during disruption by glass beads. αH3S10P (Millipore) or αH3 (Abcam) were used for ChIP analysis. ChIP DNA was purified and amplified by random priming using a WGA2 kit (Sigma-Aldrich) and following the manufacturer’s procedure. A total of 4 µg of amplified DNA was digested with DNase I to a mean size of 100 bp. The resulting fragments were purified and end-labeled with biotin-N6-ddATP23. S. cerevisiae high-density oligonucleotide tiling microarrays from Affymetrix were used. They allowed the analysis of yeast chromosomes at a 5-bp resolution. Labeled probes were hybridized to GeneChip® S. cerevisiae Tilling 1.0R Arrays. The intensity files (*.bar) were produced with Tiling Array Suite 1.1 (signal log2 ratio IP/sup and p-value) using quantile normalization plus scaling. Positive enrichment intervals were determined as the regions with P-value<0.01 (considering a maximum gap of 250-bp and a minimum run/length of 30-bp). The entire set of data can be accessed at Gene Expression Omnibus (GSE46627). To visualize the H3S10P signals along specific chromosome regions, the UCSC Genome Browser was used. To visualize the distribution of H3S10P or H3 signals along centromere and 40-kb pericentromeric regions (CEN±20Kb), these were divided into 81 segments, the central segment (CEN) corresponding to the chromosomal coordinates defining the centromeres, and the rest to consecutive segments of 500-bp. Data were analyzed using Galaxy, an open web-based platform, and are expressed as the average of H3S10P or H3 signal log2 ratio along each segment and as the average signal of all segments in the same position of each chromosome. To visualize the distribution of H3S10P along genes, ORFs were divided into 10 equivalent segments. Two additional segments of 500-bp size were added as the upstream (5’) and downstream (3’) of each ORF. The average signal log2 ratio along each segment was calculated. In the analysis we included all ORFs that fulfilled the P-value<0.01 criteria. Immunofluorescence analysis For antibody staining one day post-L4 C. elegans adult gonads were treated as described (Castellano- Pozo et al., 2012) for all antibodies. Antibodies, used at a 1:200 dilution, are listed in Table S2. Leica DM6000B inverted microscope was used to examine the germlines with 63X HCXPL APO/1.40 OIL lens, and images were captured using Leica LAS AF computer software. Maximum intensity projections were imported to Adobe Photoshop CS4 for further processing. For antibody staining cells were cultured on glass coverslips and fixed as described previously (Dominguez-Sanchez et al., 2012). EdU detection was performed using a Click-iT EdU Imaging Kit (Invitrogen), following manufacturer’s instructions. After blocking with 3% bovine serum albumin 17 (BSA) in PBS, the coverslips were incubated with primary antibody as described previously (Dominguez-Sanchez et al., 2012) and in the case of S9.6 as described in Ginno et al., 2012. DNA was stained with DAPI. SUPPLEMENTAL REFERENCES Aguilera, A., and Klein, H.L. (1989). Genetic and molecular analysis of recombination events in Saccharomyces cerevisiae occurring in the presence of the hyperrecombination mutation hpr1. Genetics 122, 503-517. Alani, E., Padmore, R., and Kleckner, N. (1990). Analysis of wild-type and rad50 mutants of yeast suggests an intimate relationship between meiotic chromosome synapsis and recombination. Cell 61, 419-436. Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94. Castellano-Pozo, M., Garcia-Muse, T., and Aguilera, A. (2012). R-loops cause replication impairment and genome instability during meiosis. EMBO reports 13, 923-929. Chavez, S., and Aguilera, A. (1997). The yeast HPR1 gene has a functional role in transcriptional elongation that uncovers a novel source of genome instability. Genes & development 11, 3459- 3470. Choy, J.S., Acuna, R., Au, W.C., and Basrai, M.A. (2011). A role for histone H4K16 hypoacetylation in Saccharomyces cerevisiae kinetochore function. Genetics 189, 11-21. Crotti, L.B., and Basrai, M.A. (2004). Functional roles for evolutionarily conserved Spt4p at centromeres and heterochromatin in Saccharomyces cerevisiae. The EMBO journal 23, 1804- 1814. Dominguez-Sanchez, M.S., Barroso, S., Gomez-Gonzalez, B., Luna, R., and Aguilera, A. (2011). Genome instability and transcription elongation impairment in human cells depleted of THO/TREX. PLoS genetics 7, e1002386. Duch, A., Felipe-Abrio, I., Barroso, S., Yaakov, G., Garcia-Rubio, M., Aguilera, A., de Nadal, E., and Posas, F. (2013). Coordinated control of replication and transcription by a SAPK protects genomic integrity. Nature 493, 116-119. Gari, E., Piedrafita, L., Aldea, M., and Herrero, E. (1997). A set of vectors with a tetracyclineregulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast 13, 837-848. Ginno, P.A., Lott, P.L., Christensen, H.C., Korf, I., and Chedin, F. (2012). R--‐loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Mol. Cell 45, 814--‐825. Gomez-Gonzalez, B., and Aguilera, A. (2009). R-loops do not accumulate in transcription-defective hpr1-101 mutants: implications for the functional role of THO/TREX. Nucleic Acids Res. 37, 4315-4321. Gonzalez-Aguilera, C., Tous, C., Gomez-Gonzalez, B., Huertas, P., Luna, R., and Aguilera, A. (2008). The THP1-SAC3-SUS1-CDC31 complex works in transcription elongation-mRNA export preventing RNA-mediated genome instability. Molecular biology of the cell 19, 4310-4318. Huertas, P., and Aguilera, A. (2003). Cotranscriptionally formed DNA:RNA hybrids mediate transcription elongation impairment and transcription-associated recombination. Molecular cell 12, 711-721. Jimeno, S., Luna, R., Garcia-Rubio, M., and Aguilera, A. (2006). Tho1, a novel hnRNP, and Sub2 provide alternative pathways for mRNP biogenesis in yeast THO mutants. Molecular and cellular biology 26, 4387-4398. Lisby, M., Antunez de Mayolo, A., Mortensen, U.H., and Rothstein, R. (2003). Cell cycle-regulated centers of DNA double-strand break repair. Cell Cycle 2, 479-483. Mischo, H.E., Gomez-Gonzalez, B., Grzechnik, P., Rondon, A.G., Wei, W., Steinmetz, L., Aguilera, A., and Proudfoot, N.J. (2011). Yeast Sen1 helicase protects the genome from transcriptionassociated instability. Molecular cell 41, 21-32. Piruat, J.I., and Aguilera, A. (1998). A novel yeast gene, THO2, is involved in RNA pol II transcription and provides new evidence for transcriptional elongation-associated recombination. The EMBO journal 17, 4859-4872. Sikorski, R.S., and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27. 18 Table S1. Strains used in this study. Strain Genotype Reference WBAR1 MATa, his3-11,15 leu2-3,112 trp1-1 ura3-1 ade2-1 can1-100 bar1Δ::HYG Gómez- González, 2009 HPBAR-1D MATa, his3-11,15 leu2-3,112 trp1-1 ura3-1 ade2-1 can1-100 bar1Δ::HYG hpr1Δ::HIS3 Gómez- González, 2009 H101BAR- 2B MATa, his3-11,15 leu2-3,112 trp1-1 ura3-1 ade2-1 can1-100 bar1Δ::HYG hpr1-101 Gómez- González, 2009 HRN2-10C MATa his3 leu2 trp1 ura3 rnh1∆KanMX rnh2∆KanMX Huertas and Aguilera, 2003 H3S10A MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 can1::MFA1pr-HIS3 hht1-hhf1::NatMX4 S10A]-URA ura3Δ0 met15Δ0 hht2-hhf2::[HHTS- H3/H4 mutant collection (1) H3S10D MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 can1::MFA1pr-HIS3 hht1-hhf1::NatMX4 S10D]-URA ura3Δ0 met15Δ0 hht2-hhf2::[HHTS- H3/H4 mutant collection (1) H3S10A hpr1∆ MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 met15Δ0 can1::MFA1pr- HIS3 hht1-hhf1::NatMX4 hhT2- hhf2::[HHTS(S10A)]*-URA3 hpr1∆KAN. This study H3S10D hpr1∆ MATa his3Δ200 leu2Δ0 lys2Δ0 trp1Δ63 ura3Δ0 met15Δ0 hht1- hhf1::NatMX4 hhT2-hhf2::[HHTS(S10D)]*-URA3 hpr1∆KAN. This study WWYL.1D MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 GAL1pr::YLR454w (TRP1) Jimeno et 2006 al., WHYL.2A MATa ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 hpr1Δ::HIS3 GAL1pr::YLR454w (TRP1) Jimeno et 2006 al., NKY1551 MATa/MATα ho::LYS2/ho::LYS2 ura3/ura3 lys2/lys2 leu2::hisG/leu2::hisG arg-4-Nsp/arg4-Bgl his4X::LEU2(Bam)- URA3/HIS4B::LEU2 Alani et 1990 al., NKY155- hpr1Δ MATa/MATα ho::LYS2/ho:LYS2 ura3/ura3 lys2/lys2 leu2::hisG/leu2::hisG arg-4-Nsp/arg4-Bgl his4X::LEU2(Bam)- URA3/HIS4B::LEU2, hpr1Δ::HYG/hpr1Δ::KAN Castellano- Pozo et 2012 al., (1)Thermo Fisher Scientific non-essential Histone H3/H4 mutant collection 19 Table S2. List of antibodies used in this study. Antibody Origin Source Usage β actin Mouse Abcam Western Blot H4-K5,8,12,16-ac Rabbit Millipore Immunofluorescence and Western Blot Clb2 Rabbit Santa Cruz Western Blot H3K4me3 Rabbit Millipore Western Blot and ChIP H3K14ac Rabbit Millipore ChIP H3K9me2 Rabbit Millipore Immunofluorescence H3S10P Rabbit Millipore Immunofluorescence, Western Blot, ChIP and ChIP-chip 8WG16 Mouse Covance ChIP S9.6 Mouse ATCC DRIP, Immunofluorescence Histone H3 Rabbit Abcam Western Blot, ChIP, ChIP-chip Rad53 (yC-19) Goat Santa Cruz Western Blot Table S3. List of oligonucleotides used in this study. Primer Sequence (5' to 3') GLY1 F TCGCACTCTTTGGCTCATGA GLY1 R AAGTTGGTGTCTGCTGGAGACTCT PDC1 F GAAGGTATGAGATGGGCTGGTAA PDC1 R CCTTGATACGAGCGTAACCATCA PMA1 F AAGAAGTACGGTTTGAATCAAATGG PMA1 R GAATTGGACCGACGAAAAACA GCN4 F TTGTGCCCGAATCCAGTGA GCN4 R TGGCGGCTTCAGTGTTTCTA SSK1 F GGATGACCGACAGTGTTTTGG SSK1 R TGAGGGTTGGAAGGTGCAAT RAD57 F GGCAAGCTTCTGGCAAGTTAA RAD57 R TGACCAGGCTTAGCGAATGTG Figure S1. H3S10P deregulation is common to R loop-accumulating yeast mutants, related to Figure 1. (A) Immunoblotting with αH3S10P and αH3 after G1 arrest with α-factor of W303 wild-type, H3S10A mutant, hpr1∆ and rnh1∆ rnh2∆ strains. DNA content was analyzed by flow cytometry. (B) H3S10P ChIP analysis at CEN6 on wild-type and hpr1∆ cells arrested in G2/M with nocodazole and released in the presence of α-factor for the indicated times. Values are normalized to signal in G2/M. Data are represented as mean ± SEM from three independent experiments. (C) Immunoblotting with αH4-ac, αH3K4me3 and αβ-actin after G1 arrest with α-factor and release of W303 wild-type and hpr1∆ isogenic strains. DNA content was analyzed by flow cytometry. (D) ChIP analyses using H3S10P, H3K4me3, H3K14ac, H3 and RNA PolII antibodies. The y axis shows the H3S10P-IP/input median of three independent experiments measured at the GAL1p::YLR454w fusion construct in the W303 wild-type and mutant hpr1Δ isogenic strains, grown in glucose (Glu)- or galactose (Gal)-containing media (transcription repression and activation, respectively). V is the ChrV intergenic region (9716–9863 ChrV) used as a negative control. Data are represented as mean ± SD. A! B! H3K4me3! WT!hpr1 Δ ! α! H4-ac! β-actin! (min)!20!40!60!80 !100 ! α! 20!40!60!80 !100 ! 100! 80! 60! 40! 20! α! A! WT!hpr1 Δ ! 1C 2C! 1C 2C! (min)! H3! H3S10A! WT! hpr1∆! rnh1∆ rnh2∆! H3S10P! C! 60! 0! 0.5! 1! 1.5! 2! 2.5! G2/M!120!180! Relative H3S10P-IP! WT! hpr1Δ! D! 1C 2C! 1C 2C! 1C 2C! 1C 2C! hpr1 Δ !WT!H3S10A!rnh1 Δ rnh2 Δ ! αfactor! 180! 120! 60! G2/M! WT!hpr1∆! (min)! 1C 2C! 1C 2C! H3K14ac-IP! 0! 0.02! 0.04! 0.06! 0.08! 0.1! 0.12! 0.14! Pr!5´!mid!3´!pA!V! IP/ input! H3K4me3-IP! 0! 0.2! 0.4! 0.6! 0.8! 1! 1.2! 1.4! 1.6! Pr!5´!mid!3´!pA!V! IP/ input! H3S10P-IP! 0! 0.005! 0.01! 0.015! 0.02! 0.025! Pr!5´!mid!3´!pA!V! IP/ input! Pol II-IP! 0! 0.5! 1! 1.5! 2! 2.5! Pr!5´!mid!3´!pA!V! IP/ input! H3-IP! 0! 0.5! 1! 1.5! 2! 2.5! 3! Pr!5´!mid!3´!pA!V! IP/ input! GALp!p(A)! Pr!5´!3´!mid!pA! FMP27! WT Glu! hpr1∆ Glu! WT Gal! hpr1∆ Gal! Figure S2. hpr1Δ mutants show a genome-wide increase of H3S10 phosphorylation levels, related to Figure 2. Chromosome distribution of H3S10P in wild-type (top) and hpr1∆ (bottom) strains arrested in G1 (left) and S phase (right). The y-axis shows the signal log2 ratio that are significantly enriched in the immunoprecipitated fraction (P-value<0.01). The x-axis shows the chromosomal coordinates in kb. G1 Phase!S Phase! CEN!CEN! CEN!CEN! CEN! hpr1∆! WT! CEN! CEN!CEN! CEN!CEN! CEN!CEN! CEN!CEN! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! CEN! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! CEN! CEN! CEN! 0 100 200 kb! 2.25! ! 0! H3S10P-IP ! Signal log2 ratio ! CEN!CEN! CEN! CEN! CEN!CEN! CEN!CEN! CEN!CEN! CEN!CEN! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! hpr1∆! WT! CEN! CEN! G1 Phase!S Phase! Chr.I! Chr.II! Chr.VII! Chr.VIII! Chr.III! Chr.IV! Chr.V! Chr.VI!Chr.XIV! Chr.XV! Chr.XVI! Chr.I! Chr.III! Chr.IV! Chr.V! Chr.VI! Chr.VII! Chr.VIII! Chr.IX!Chr.IX! Chr.XI! Chr.XII! Chr.XIII!Chr.XIII! Chr.XIV! Chr.XV! Chr.XVI! Chr.X! Chr.II! Chr.XI! Chr.XII! Chr.X! Figure S3. Increase of H3S10 phosphorylation in hpr1Δ mutants, related to Figure 2. (A) Profile of histone H3 enrichment (determined by ChIP-chip) across the 40-kb pericentromeric regions for wild-type and hpr1∆ asynchronous cells. The y-axis shows the median signal log2 ratio significantly enriched in the immunoprecipitated fraction (P- value<0.01). (B) Profile of H3S10P enrichment (determined by ChIP-chip) across the average 20-kb pericentromeric ORFs plotted as the median signal log2 ratio significantly enriched in the immunoprecipitated fraction per segment in wild-type and hpr1∆ S-arrested cells. This analysis includes ORFs that fulfill the P-value<0.01 criteria. (C) Profile of H3S10P enrichment across the average ORFs plotted as the median signal log2 ratio significantly enriched in the immunoprecipitated fraction per segment in wild-type and hpr1∆ S-arrested cells. (D) Detailed analysis of the ChIP-chip data of H3S10P at a 15-kb region of the 40-kb pericentromeric region of chromosome VII (top) and X (bottom) for wild-type and hpr1∆ cells arrested in G1 and S-phase. The y-axis shows the median signal log2 ratio significantly enriched in the immunoprecipitated fraction (P-value<0.01). The x-axis shows the chromosome coordinates and the SGD annotations. The distance to the centromere in kb is also shown. (E) Detailed analysis of ChIP-chip data of H3S10P at a 15-kb non-pericentromeric region of chromosomes XIII (top) and IV (bottom) for wild-type and hpr1∆ cells arrested in G1 and S phase. Other details as in D. Centromere coordinates are: CEN7 496920-497038, CEN10 436307-436425, CEN13 268031-268149, CEN4 449711-449821. E! WT! hpr1∆! H3S10P-IP Signal! log2 ratio ! S phase! Pericentromeric ORFs! 0! 0.2! 0.4! 0.6! 0.8! Total ORFs! B!C! Non-pericentromeric region! 2.5! 0! 2.5! 0! 2.5! 0! 2.5! 0! G1 phase!WT! hpr1∆! S phase!WT! hpr1∆! 108 kb!123 kb! distance from CEN13! HMG1!BET5! WAR1! CRP3! YML079w! DUS1!FPR3! G1 phase!WT! hpr1∆! 2.5! 0! 2.5! 0! S phase!WT! hpr1∆! 2.5! 0! 2.5! 0! PEX29!SNF1!TRS31!JIP4!YDR476c!PRP3!UGO1! 950 kb!965 kb! distance from CEN4! D!Pericentromeric region! 2.5! 2.5! 2.5! 2.5! 0! 0! 0! 0! G1 phase!WT! hpr1∆! S phase!WT! hpr1∆! PMA1!LEU1! YGL010W! SCL1! ERG4!PDR1! 29kb!14 kb! H3S10P-IP Signal log2 ratio! distance from CEN7! 0! 0! 0! 2.5! 2.5! 2.5! 2.5! 0! G1 phase!WT! hpr1∆! S phase!WT! hpr1∆! SUI2!HYS2!TDH2!MET3! SPC1! YJR013w!YJR011c! YJR012c!YJR015w! 13 kb!28 kb! H3S10P-IP Signal log2 ratio! distance from CEN10! ORF segments ! 1!2!3!4!5!6!7!8!9!10! G1 phase! -0.5! -0.25! 0! 0.25! 0.5! H3-IP Signal log2 ratio! (kb)! 20!15!10!5!CEN!5!10!15!20! WT! hpr1∆! A! -0.4! -0.2! 0! 0.2! 0.4! S phase! ORF segments ! 1!2!3!4!5!6!7!8!9!10! WT! hpr1∆! YJR008w! 2.7 kb! 4 kb! EcoRI!EcoRI!DraI! probe!BUD3! EcoRI! 3.7 kb! DCC1! Figure S4. Link of H3S10P with R loops and chromatin condensation and compaction in yeast and C. elegans, related to Figures 3 and 4. (A) DNA content analyzed by flow cytometry in W303 wild-type and hpr1∆ asynchronous and G1-arrested cultures with or without RNase H1 over-expression showing that RNase H1 does not alter cell-cycle. (B) Immunoblotting with αH3S10P and αH3 after G1 arrest with α-factor of W303 wild-type (HPR1), hpr1∆ and hpr1-101 isogenic strains. DNA content was analyzed by flow cytometry. The percentage of cells in G1 or G2 phases scored by microscopy is indicated bellow. (C) Analysis of chromatin compaction at DCC1/BUD3 loci in chromosome III of W303 wild-type, hpr1∆ and hpr1-101 cells during G1 as determined by restriction endonuclease accessibility. Southern blotting of EcoRI-digested chromatin from wild-type, hpr1∆ or hpr1-101 G1-arrested cells incubated with increasing amounts of DraI restriction enzyme. Restriction map of the analyzed region shown on the left. (D) Detailed picture of DAPI-stained nuclei showing high condensation of the nuclei at mitotic region of thoc-2 worms. (E) Representative images of mitotic region from fixed germlines of N2(wt) and thoc-2 mutant worms immunostained with S9.6 antibody and counterstained with DAPI. C! DraI ! (U/ml)! 3.7 kb! 2.7 kb! WT! 0 5 15!50!150! hpr1∆! 0 5 15!50!150! hpr1-101! 0 5 15!50!150! 4 kb! A! B! αfactor! HPR1! %!1C 2C!1C 2C!1C 2C! 100 0!97.1 2.9!99.5 0.5! hpr1-101! hpr1Δ! HPR1!hpr1Δ! hpr1-101! H3S10P! H3! WT! +RNH1! -RNH1! αfactor! async! 1C 2C!1C 2C!1C 2C!1C 2C! hpr1∆ ! +RNH1! -RNH1! D! C. elegans DAPI (mitotic region)! E! N2(wt)! S9.6!S9.6+DAPI! thoc-2! (tm1310)! C. elegans! N2(wt)!thoc-2(tm1310)!