Isolation of 91 polymorphic microsatellite loci in the western mediterranean endemic carex helodes (Cyperaceae)

1 of 6 Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Applications in Plant Sciences 2016 4 ( 1 ): 1500085; http://www.bioone.org/loi/apps © 2016 Arroyo et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons Attribution License (CC-BY-NC-SA). Ap Applica ti ti ons ons in in Pl Plan t t Scien Scien ces ces Carex helodes Link (sect. Spirostachyae (Drejer) L. H. Bailey, Cyperaceae) is a diploid, wind-pollinated, perennial herb with a minimum generation time of two years. The species is endemic to the western Mediterranean, being locally distributed in southern Portugal and southwestern Spain, and rare in northern Morocco ( Escudero et al., 2008a ). This sedge occurs in temporarily inundated acidic soils in open cork oak woodlands. Despite its well-characterized morphology, C. helodes has been misidentifi ed as C. laevigata Sm. by some authors (see Luceño et al., 2009 ). Recent cytotaxonomic and nuclear- and plastid-based phylogenetic studies have revealed the monophyly of C. helodes populations and its taxonomic independence within sect. Spirostachyae ( Escudero et al., 2008a , 2008b ; Escudero and Luceño, 2009 ). Carex helodes is an endangered species in Spain because the extent of its severely fragmented occurrence is less than 100 km 2 , with continued loss of area and habitat quality ( Moreno, 2008 ; Bañares et al., 2010 ). Our aim is to develop molecular markers for further studies of gene fl ow among and within populations. Nuclear microsatellites have been proven to be highly variable and very suitable to the study of recent gene fl ow between populations ( Ouborg et al., 1999 ). To accomplish our task, we isolated and characterized 109 nuclear microsatellites. METHODS AND RESULTS We extracted genomic DNA using a DNeasy Plant Mini Kit (QIAGEN, Valencia, California, USA). We used ~5 μ g from one C. helodes individual collected in Madroñalejo (Aznalcóllar, Seville, Spain; see Appendix 1 for GPS coordinates and voucher specimens) to construct a shotgun genomic library that was sequenced on 1/4th of a plate using 454 GS FLX Titanium chemistry (Roche Applied Science, Indianapolis, Indiana, USA) at the University of Arizona Genetic Core (Tucson, Arizona, USA). We generated 108.3 Mb of qualityfi ltered data, distributed over 221,198 unique reads with an average length of 490 bp after quality fi ltering (quality score [Q] ≥ 20 using a 10-bp sliding window). We searched for all possible microsatellite loci containing at least six perfect repeats for hexa-, penta-, tetra-, and trinucleotides or 12 perfect repeats for dinucleotides and designed primers using the software QDD version 3 ( Meglécz et al., 2014 ). We used the unique reads as input to detect microsatellite sequences. The reads were used to build contigs using QDD version 3 (default options were used: sequence set limit of 80 bp, 95% minimum identity between two sequences to make a consensus, and 66% as the proportion of sequences that must have the same base on the aligned site to accept it as a consensus). For primer design, the default options were also used but the minimum size of the PCR product was set to 100 bp and the maximum to 450 bp. We found a total of 3985 microsatellite loci, including 51 hexa-, 58 penta-, 78 tetra-, 406 tri-, and 3392 dinucleotide loci. We selected 27 hexa-, 26 penta-, 23 tetra-, 206 tri-, and 152 dinucleotide loci that met our criteria (at least 12 repeats for dinucleotides and six for the rest) and tested a total of 132 loci. Specifi cally, we tested the eight hexa-, eight penta-, eight tetra-, 18 tri-, and 90 dinucleotide loci with the highest numbers of repeats ( Table 1 ) . For primer testing, DNA was isolated from silica gel–dried leaves using a modified cetyltrimethylammonium bromide (CTAB) extraction method 1 Manuscript received 24 July 2015; revision accepted 23 September 2015. The authors are grateful for logistical support provided by the Molecular Ecology Laboratory, Estación Biológica de Doñana (LEM-EBD-CSIC) for primer testing. This study was supported by a postdoctoral 2011 Marie Curie International Outgoing Fellowship for Career Development (IOF; HoloChromEvol 301119) to M.E. and a Junta de Andalucía grant (RNM- 5731) to P.J., as well as a Severo Ochoa Excellence Award (SEV-2012- 0262). 4 Author for correspondence: [email protected] doi:10.3732/apps.1500085 P RIMER NOTE I SOLATION OF 91 POLYMORPHIC MICROSATELLITE LOCI IN THE WESTERN MEDITERRANEAN ENDEMIC C AREX HELODES (CYPERACEAE) 1 J UAN M . A RROYO 2 , M ARCIAL E SCUDERO 2,3,4 , AND P EDRO J ORDANO 2 2 Department of Integrative Ecology, Estación Biológica de Doñana, Consejo Superior de Investigaciones Científi cas (CSIC), Calle Américo Vespucio s/n, E-41092 Seville, Spain; and 3 Department of Plant Biology and Ecology, Universidad de Sevilla, Apartado 1095, E41080 Seville, Spain • Premise of the study: Microsatellite primers were developed for Carex helodes (Cyperaceae), a western Mediterranean endemic that is locally distributed in southern Portugal and southwestern Spain and rare in northern Morocco. • Methods and Results: One hundred nine nuclear microsatellite markers were developed using a shotgun pyrosequencing method, resulting in 91 polymorphic and 18 monomorphic loci when tested using 19 individuals sampled from fi ve populations from Portugal, Spain, and Morocco. Loci averaged 3.23 alleles per locus (SD = 1.15). In a single population (Cortelha population, Portugal), the 34 most polymorphic loci showed a mean observed heterozygosity of 0.357 (SD = 0.292) and mean expected heterozygosity of 0.384 (SD = 0.255). • Conclusions: Next-generation sequencing allowed us to develop a high number of genetic markers with levels of polymorphism adequate to study gene fl ow among populations. However, when genotyping the individuals within a population, we found low levels of variation. Key words: Carex helodes ; Cyperaceae; endemism; sedge; shotgun sequencing; simple sequence repeat (SSR) marker. 2 of 6 Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Arroyo et al.— Carex helodes microsatellites doi:10.3732/apps.1500085 http://www.bioone.org/loi/apps T ABLE 1. Characteristics of 109 microsatellite markers isolated from populations of Carex helodes . Locus Primer sequences (5 ′ –3 ′ ) Repeat motif Allele size range (bp) A a T a ( ° C) Fluorescent dye Mix no. for capillary electrophoresis b Cahe914 F: ATCAAGAATTCAAGATTCAGGG (TATTAC) 7 112–130 3 53 FAM 1 R: AAGTCCACGTTGAGGACGAA CahePM5 c F: TCGGAGCTTTATCAGATTGATGT (TATAGA) 8 282–294 4 (5) d 53 FAM 1 R: TCCAAACATTTGTTCTACGACTT Cahe587 c F: TGTCTAGTCCATGCCACGTT (ATACAT) 14 320–420 6 55 FAM 1 R: GCAACCTAGTTATGCTGAAGCTG CaheYES c F: AAGTGCCAAAGTTTATTATGAGTTGT (AGGCTG) 6 110–134 5 54 VIC 1 R: GTTTGCCATGTGGGAAGTTT Cahe9PD F: GGTTAATACCGTTATTCAGATGAAAC (TGATGG) 7 286–292 2 54 VIC 1 R: CATTCCGGTTATTTAATGCGA Cahe837 F: CACATACACTATGATCGAAACAAAT (TTTTAC) 7 447–464 3 53 VIC 1 R: CACTATACAATAGCACTGCACCA Cahe130 c F: TCCAGTTCCTCCCTCTCCTC (CCATCC) 7 268–292 4 55 NED 1 R: CATTCACCATCAGTACCGGA CaheR56 F: GAGTTTGAGGAGCGAGGAGA (CTACT) 8 138–144 2 54 NED 1 R: GCTATTGTTACAGGGTGCGA Cahe8IO F: CCGTAAGGCCAGCTGTAAAT (CATTT) 7 130–152 2 55 PET 1 R: TGTCACTGGACAGTGGGAAG CaheFOY F: TTTCTTCTCTATGTTTCTTTCCGTT (TTTTC) 6 158–187 6 d 53 NED 2 R: CAGAGGGAGACTACATTATATGGAA CaheC2B c F: CTCTGACTGTACATCTGACCGA (TGCG) 7 169–181 4 53 FAM 2 R: GATACCTATCGAATATTCCTTCTTCC CaheWE1 c F: AAGTGAACCACCTTTGGCAC (TTAT) 8 229–269 4 (7) 55 NED 2 R: GATTTGGAGGAAATGTACGCA CaheBI5 c F: GGTGTTTATCATAAGAATGAAATTGA (AGAT) 7 215–231 3 53 PET 2 R: TTATCTGTGTATCTCATGATCCATTG CaheXAF c F: TCATCAATTGGAGCAATTACAGTT (TCA) 18 321–449 5 (6) 55 FAM 3 R: ATAAAGAGTGCTGCCGATGG Cahe147 c F: TCGGCAAATACGTTGTCCAT (TTA) 16 147–154 4 (5) d 53 VIC 3 R: AATGATGACAATTTAGATAAGACCACT CaheJEU F: TAATTGCAATCAAGCGACCA (TAA) 10 235–241 2 56 VIC 3 R: TTGTGGATTGCCGAAGGTAT CaheFG7 c F: ATCCGCTTCTTCATTCGCT (TAA) 11 469–496 4 (6) d 54 VIC 3 R: TGATAGTCACGACTGTTCATGC CaheMIW c F: GGATGATTCATAAGGCCTCTCA (ATC) 12 (GTC) 4 262–280 3 56 NED 3 R: TTCAGGTTTAATCACAAGACAGGA CaheQWB c F: GTGTAAATGGCTACTGAAACATTG (AAT) 10 AG(TAA) 6 122–147 3 53 PET 4 R: CCACTTGCATAACAGTGAATTG Cahe121 c F: GATATAATCGTGGAAGTCATTTCA (ATT) 16 374–410 4 (6) 53 NED 3 R: TTGCAATTAGCAAGAGATCAATTAG CaheGVB c F: CTACGAGCACTTTGGGCATT (TAT) 14 112–135 4 55 PET 3 R: TTGATTTGAATTTGACCGTTTG Cahe4Q8 F: AACACAAAGAAGAGGGCGAG (GAG) 10 219–234 3 55 FAM 4 R: GGAGAATGACGACGCTGAG Cahe965 F: GGAGGATACATAACAGAGATTGGG (AAT) 10 275–278 2 56 VIC 4 R: TTGTAAGTTTGCAGAATCAATATGGT Cahe468 c F: GGCAAGAACAAAGAAAGGTCG (AGA) 9 461–475 3 (5) 55 VIC 4 R: ATGGATCTAGTCACCGCTCC CaheT2N c F: TATTCACCAATAATTCCACAAACAA (CA) 17 (TA) 6 154–176 4 55 FAM 3 R: TCTTCTACAGCCTCTCAAAGACTTG CaheODD c F: TCAATATTTCTACTTGATATGATGAGC (TA) 16 129–180 7 (10) 53 NED 4 R: AACATTCCGCAAATAACAAATACG Cahe7LF c F: TTGAGGAGGTACAACATTATCCA (AT) 16 (AAT) 3 225–258 7 (9) d 53 NED 4 R: TTTGCCCATTAATCACCTATTT Cahe408 F: GATGCGCGAGATACACATTT (AT) 18 468–473 3 54 NED 4 R: AAAGACCTGAGACTAGAGCAGGAA CaheTDK F: TGGAGATTCTGTTTGTAACCACC (TA) 7 TG(TA) 3 C(GT) 16 238–242 3 55 PET 4 R: TTTAGAGTCATGGATAATTGGTCCT Cahe829 c F: TTTGTTGGGCTGAGCCTG (GT) 3 GG(GT) 10 (AT) 12 342–402 4 (6) 55 FAM 5 R: ATCCATTGAAGAAATGGAAGGA Cahe971 F: AATTAGCATTAATTTCCACAGGC (CT) 9 133–137 2 54 PET 5 R: GGAGTTCGACAGCTCATTCA Cahe215 F: CTCACAGAAGAGAAAGTCAGCG (GA) 8 277–282 2 55 PET 5 R: TGGAATTTCTAAGTCTTGACTAGCG Cahe2121 F: AGGTCAGAAGTCTTGCCGAG (GA) 9 419–427 3 55 PET 5 R: CCGGGTAGATATACTCTCCTCTCA Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Arroyo et al.— Carex helodes microsatellites doi:10.3732/apps.1500085 3 of 6http://www.bioone.org/loi/apps Locus Primer sequences (5 ′ –3 ′ ) Repeat motif Allele size range (bp) A a T a ( ° C) Fluorescent dye Mix no. for capillary electrophoresis b Cahe677 c F: TTAGTTGAACCGAACAGCCC (CT) 15 131–139 3 54 FAM 6 R: CAGCCTAGGTTCAGCACTCTT Cahe84P c F: AATCAAGGTTGCTTTGAGCC (AT) 13 245–247 2 55 FAM 6 R: CAATCTAAAGACATGATACGATCGAG CahePUI c F: TGTGGCTGATACTGACATTCTG (AT) 15 318–337 4 54 FAM 6 R: TTGCTCGAGATCCTTTGCAG CaheL4G F: ATGTTGCGCTGGTACGGT (AG) 13 467–475 3 56 FAM 6 R: TTTACGGGAGAAACAGTCGG Cahe222 c F: ATCTCGATTGGAAAGAGGGC (TA) 14 324–336 5 (6) 55 VIC 6 R: TTGCTCTTCTCCTCACGGTT CaheEZE c F: TTTCCCTTTCTTGGGCTTTC (TG) 14 153–164 4 54 NED 6 R: ACCGATAAATTAGTCAATTATGCTATG Cahe1SD F: TTACGTGTTTAGACCATCCCTCA (TA) 15 218–226 3 55 NED 6 R: TCTAAACAGATTCATTTGACATTTCC CaheVSD F: CCCAGTTTCCCTCCCTCTTT (TC) 13 306–308 2 56 NED 6 R: AAGCCCGGGAATACTTTACG CaheSGU c F: AAATCCTATCTTATACACCTACGGG (AT) 15 114–128 4 54 PET 6 R: TTCAGTCCATATGCTTCCGA Cahe423 F: TCAACTTTGGCCTCCTATTG (AG) 14 167–171 3 53 NED 8 R: CCATTTCGTACCCTTGACCT CaheORP c F: AGCTTTCTATGCAACCCATAACA (TA) 13 177–185 5 55 PET 6 R: GCTTGGATTAACCAAATAATATTGAGA CaheWMU c F: CAGATGCATGTCTTCTGACACA (TA) 15 398–402 3 55 FAM 7 R: GTCTGCCTCCTTAGGCACATA Cahe192 c F: ACTTGGTGCGGAGCCTATAA (AC) 14 295–305 3 55 VIC 7 R: GCTCGATTGCTTCCTGAGTC CaheB4G F: TTACCTTGAATGCTCGAGGAAG (AT) 13 175–187 3 53 NED 7 R: GATATCATCTTTCATATTGTATTGGC Cahe8RA c F: TGAATGGAAGGCACTGCTTA (CT) 13 154–158 3 54 PET 7 R: TCCAGTGGATTTCTAACATAGCTC CaheSF0 F: TTTGAAGTTCACTTTCATTTAGAAAC (AT) 7 AC(AT) 6 (AG) 5 175–181 3 53 VIC 8 R: ATGTAACAAAGAAGACATATACATTGC Cahe242 F: GATCCAACGGTGGCTTAACA (CT) 10 (AT) 7 148–150 2 55 PET 8 R: AAGATACCAGGAAGAGAAGAGGG CaheL7Z c F: CAATGAATTGTTCATCAAGACTGG (CT) 9 (CA) 11 373–380 4 d 56 FAM 8 R: TGACTAGTGACTACAGCTGCCAA Cahe488 F: GGATCTGACCGGAGCTATTG (TC) 11 (CA) 7 238–246 2 54 PET 8 R: GCAAGGCAATGTGTAACTTGA CaheDHT F: TCCAAATAGCGAACCAAACC (AT) 8 (AG) 9 183–187 3 d 54 VIC 9 R: ATGGTGCATTTGAACCCTC CaheUAX c F: GATCGGAGGGTTGACATTC (AT) 6 AG(TA) 8 G(TA) 3 182–229 3 53 PET 9 R: ATCAAATCCGACAGCTAGCTAAA Cahe932 c F: AAACCACCGTCAAACTGTGATA (AG) 12 158–160 2 55 FAM 10 R: AGAAGAGAAGGAAGGCAGGC CaheQ9D c F: AGCAATATTCATGTCGACTGTCA (AC) 11 342–348 3 54 FAM 10 R: AACATTCAAATTACCTTAGAGCCA Cahe553 F: AGTGTTTGGTTGACACCCGT (AT) 13 139–143 2 56 NED 10 R: AATGTTGTGGGAACCTTGGA CaheFTM F: ACCTCTTCCTGCCATCCCTA (TG) 12 355–357 2 55 NED 10 R: CAGACTCAACCACAGCTTCG Cahe2519 F: TTGAGTCGTCATTTGTTGGC (AT) 13 386–398 4 55 VIC 10 R: GTGAACGTGGCAAATCTTGA Cahe002 F: ACCCATAGCACCCTAGCCTT (TA) 13 200–214 3 55 FAM 11 R: CCATGCGATAACCTTTCCTC Cahe3IX F: AATTGGAGCAAACATTTGGG (AG) 12 281–287 3 55 FAM 11 R: CAGACGGTCTTGATCTAAACTCAG CaheLJZ F: AGGTAGACAGAATCAAATTCAGGG (AT) 12 174–186 2 55 VIC 11 R: TTGACATATTAATGACAAGGTACCAAA Cahe711 F: GTTACAGTGGGCCATCGTG (CT) 12 282–304 3 55 NED 11 R: GCGGATGCTTTAGTGTGCAT CaheQWV c F: GCGCTTCTAGATATACGTGCAA (TA) 12 175–181 3 54 PET 11 R: AATTGTCTATACATTAACATGTCCTCG Cahe3XU F: CGACTTAGACGTTGTATGGGA (TA) 12 279–285 3 53 PET 11 R: CTTGACTGCCCTTGTTTGTC CaheD2S F: CGCGAGAATAGATAGGCGAC (AAGGG) 6 251–261 3 55 PET 2 R: ACGTCCAAACAAACCGTTCA CaheUNE F: TTTGTGGAAAGTTAAATCAGTTAATCA (ATT) 10 AC(TAT) 13 477–493 3 54 FAM 3 R: AAACCTTCACCTGTGGTTATAGAAT TABLE 1. Continued. 4 of 6 Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Arroyo et al.— Carex helodes microsatellites doi:10.3732/apps.1500085 http://www.bioone.org/loi/apps Locus Primer sequences (5 ′ –3 ′ ) Repeat motif Allele size range (bp) A a T a ( ° C) Fluorescent dye Mix no. for capillary electrophoresis b CaheHGI F: CTCTTGGCTTCCTTGTTTCTC (AG) 16 A(TGTGT) 3 159–185 3 54 VIC 4 R: TTTCCTGCCATTCCACAAG CaheTC7 F: AGGTTAGGATAGTTGCATAATTTACGA (ATT) 13 142–145 2 54 FAM 4 R: GAGCCTTATGCTCACCAACA Cahe522 F: ACGAGATGATCTTCTGCCAT (AT) 6 173–191 2 53 FAM 5 R: TGAAAGTCGAATATTGAGCCG Cahe86O F: TTGAGTTGCCAGAACCATCA (GA) 14 447–453 3 55 NED 6 R: TTCCTTGCCCTCTGTCTGTT Cahe68X F: CATTTAGAATTGTTATGCCAGCG (AC) 12 209–225 2 55 NED 10 R: GGAGTTGGAGATTGAGTCGG Cahe322 F: GGTGTGCAAGCGATCATTTA (TC) 12 386–408 2 54 FAM 11 R: TTTCGCCTTCTTCTCCATTT Cahe824 F: CAGAGCCGATCTGTCCAATA (TA) 12 128–141 3 54 PET 10 R: GACTCAGGTTAGCTGCCGAC Cahe818 F: CGAGAAACATTGTTAGACTCCA (AG) 13 286–288 2 53 VIC 11 R: TTGCTTATTGGCAAGTTCTAGAGATA CaheXN6 F: TTTGGATTAGGGTTTGCAGC (TTCTGA) 7 433–439 2 54 FAM 1 R: TGGATTTACTATTATGAAATGAAGCA CaheJSN F: GGCAACTTGGCTGTTCCTAA (TTTCT) 7 136–147 2 54 NED 3 R: CTGAGGTCAGGTGGCAATTA CahePYI F: TTCGTTATTTCTGACTGACACG (TTTTC) 7 440–444 2 53 FAM 2 R: CAAATGGTTGCAGCGGAA CaheASM F: GGAAACTTCGCGGAGAAATA (TGTT) 7 122–130 2 54 VIC 2 R: AGATTCCATGTGGTTCTACTGTTC Cahe5PU F: CGCTTATCATGAAGTTTGTTCAC (CTAT) 7 179–196 2 54 VIC 2 R: GCCCAACCCTGACAGATAAA CaheVDJ F: CTGGCAGGAGTTCATTTGCT (ATA) 16 256–262 2 55 PET 3 R: GCTTACTAGAGGTTGTAGGCTTAACAG CaheR17 F: GTCTGAAAGCGACGATTGAA (ACC) 7 428–434 2 54 FAM 5 R: TGGTTTCATTTCGAGAAGGG Cahe001 F: CTTCCTGCAATGTAGGCTCC (TG) 4 TC(AG) 8 288–294 3 55 NED 5 R: AATCGGGCTGACATCCTAGA Cahe670 F: TCCCGTATACCGGCTTCAG (TA) 14 189–191 2 55 FAM 7 R: CACATTGTGTCAAACACATGAAA CaheGHR F: TTACAACTTCCTTCAAATTTGTGAT (CT) 13 292–294 2 54 FAM 7 R: GAATAGGCACCGGACACG Cahe7K7 F: AAACTGAAGATATTGCGTGAAGT (TC) 9 (TA) 9 155–157 2 53 FAM 8 R: AAAGTTTGAATGGGTACACTGAA Cahe303 F: GGCATTGTTTGGAGCGATATT (TC) 11 N(TG) 6 281–283 2 54 NED 8 R: GAAATGGTAGTGCTTCTTCTGAAC Cahe6A8 F: TGGCCTTTGCTTCTATCTCA (GA) 5 G(GA) 12 168–174 2 54 NED 9 R: GCCATGCCTCTCATGCTACT CaheL2M F: AAATGACCTGATCTGACCGA (GT) 7 (GA) 9 284–296 2 54 FAM 9 R: ACGTGAATAGTATCACATCGAACA Cahe647 F: GGAGCATTCACCAATCCTCTA (TC) 12 223–227 2 55 PET 10 R: CCCGTCGTAATCATATCTCTAATGA Cahe332 F: AAGACAGCCAAAGTGAGCTTG (CT) 13 161–171 2 55 NED 11 R: CGCCATGTTAACTTGATGAGG CaheBUE F: TTCAATTATGATCCAGCTTCACA (TATAT) 6 443 1 55 VIC 2 R: TTCTTTCTTCCCTCCCTTCC CaheOPJ F: TCCACCTTACACTTTATTCACCC (CAAA) 7 278 1 55 FAM 2 R: GATGCATCCTATCCCTCCGT CaheNT5 F: TGAGCTGGCACACTCTATGG (GTAT) 6 311 1 55 VIC 2 R: AGAACTATAGCTTTGAAACAGCCC CaheQQ1 F: TAATGGTAAATTTGGATTTGCG (TAAT) 6 145 1 54 PET 2 R: GCAATTGGTGTAACAGCACC Cahe06U F: AGAACAAGACAAGACTATCTTTATGCC (GGA) 10 423 1 54 VIC 3 R: TTCTCCCTTCGCATCTCC Cahe476 F: ACCAGGAACCAGCTGGAATA (TAG) 10 477 1 55 FAM 4 R: ATCACCAAGCTCATCAGGGT Cahe993 F: ATGGGTGCTATATTTCACCTTG (GAT) 6 423 1 54 NED 5 R: ACACTAGAACATGACTCGTCGC Cahe280 F: CGGATTCGATTTCATTCACC (TC) 12 184 1 55 VIC 5 R: AAAGCAAGACAAATCAGCCAC Cahe930 F: AAGGCACATCCAAGTTTACCA (AG) 5 423 1 54 VIC 5 R: GGAAGGAGCATGCATCTGTA TABLE 1. Continued. Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Arroyo et al.— Carex helodes microsatellites doi:10.3732/apps.1500085 5 of 6http://www.bioone.org/loi/apps Locus Primer sequences (5 ′ –3 ′ ) Repeat motif Allele size range (bp) A a T a ( ° C) Fluorescent dye Mix no. for capillary electrophoresis b Cahe835 F: TTTCGATCCATTACCCTCCC (CT) 7 189 1 56 NED 5 R: TCACATCAACAACATCGCCT Cahe36X F: AAGCTTGTCTTGAGTGACGGA (AG) 14 216 1 55 VIC 6 R: AAGAGTTGTTCGTTTCTGTTCCTT CaheXTE F: GGGACACCTTCCATTGATAAAG (AG) 13 471 1 55 VIC 6 R: TCACGATTTCATGCAACACA CaheHL4 F: CGGAGGTGAAATTAATTAAGCG (AG) 13 241 1 55 PET 7 R: GTTTAAATTTGGGCTTGGGC Cahe2SB F: ACTTAGCAGCTGCCACCAA (AG) 5 G(GA) 8 229 1 54 VIC 8 R: TGCATTGCAGCTTACTAGAACTT Cahe519 F: ATCGATTATCCTTTAATCAACTAACAA (GT) 4 (AT) 4 AC(AT) 8 363 1 53 VIC 8 R: GGGTATCACTTGAAAGAAACAAA Cahe0PF F: CTTGCAGATCCAAAGGAGGT (CT) 12 147 1 55 VIC 10 R: ACTGCAATAACAGCCATAGGAAA Cahe770 F: TTGATCCACTTTCTATGACAAGGA (TG) 12 229 1 55 VIC 10 R: TCCCATAAGAATATCCTTCGATTC CaheX4D F: GGAAGTTTCAGATCAGTGACCA (CT) 12 185 1 55 NED 1 R: AGAGGCTTGAGGAAGAAGCTC Note : A = number of alleles; T a = annealing temperature (given for nontailed primers). a Total number of alleles, including seven additional individuals from the Cortelha population of Portugal, is shown in parentheses. b Mix number indicates loci that were mixed in the same capillary electrophoresis run. c One of 34 most polymorphic loci. d Loci showing one to three alleles with a size difference of 1–2 bp relative to contiguous alleles. TABLE 1. Continued. ( Milligan, 1998 ) that included tissue grinding in a Mixer Mill MM301 (Retsch GmbH, Haan, Germany) and resuspension in TLE buffer (10 m M Tris-HCl [pH 8.0], 0.1 m M EDTA). We sampled a total of 64 individuals from fi ve different populations (Appendix 1). Initially, 19 individuals from the fi ve populations were sampled and genotyped for 109 loci. Nine individuals from the Madroñalejo population, four individuals from the Barraçao-Caldas de Monchique population, one individual from the Cortelha population, four individuals from population 1 (Pop. 1) at Ksar el Kebir, and one individual from population 2 (Pop. 2) at Ksar el Kebir (Appendix 1). Finally, 38 additional individuals from the Madroñalejo population (Spain) and seven additional individuals from the Cortelha population (Portugal, Table 2 ) were genotyped for the 34 most polymorphic loci. The 34 most polymorphic loci were estimated based on the initial screening using 19 individuals from fi ve populations. PCR amplifi cations were performed in a 20- μ L final volume containing 1 × buffer (67 m M Tris-HCl [pH 8.8], 16 m M (NH 4 ) 2 SO 4 , 10 m M KCl, 0.01% stabilizer), 2.5 m M MgCl 2 , 0.01% bovine serum albumin (BSA; Roche Diagnostics, Mannheim, Germany), 0.25 m M dNTP, 0.40 μ M dye-labeled M13 primer, 0.40 μ M PIG-tailed reverse primer, 0.04 μ M M13-tailed forward primer (see M13 and PIG-tail sequences in Table 1 ), 0.5 units Taq DNA polymerase (Bioline, London, United Kingdom), and approximately 50–70 ng genomic DNA. Reactions were undertaken in a touchdown PCR protocol in a Bio-Rad DNA Engine Peltier Thermal Cycler (Bio-Rad Laboratories, Hercules, California, USA), with an initial 2 min of denaturation at 94 ° C; 17 cycles at 92 ° C for 30 s, annealing at 60–44 ° C for 30 s (1 ° C decrease in each cycle), and extension at 72 ° C for 30 s; 25 cycles at 92 ° C for 30 s, 44 ° C for 30 s, and 72 ° C for 30 s; and a fi nal extension of 5 min at 72 ° C. PCR products were labeled using FAM, VIC, NED, or PET dyes (Applied Biosystems, Foster City, California, USA) on an additional 19-bp M13 primer (5 ′ -CACGACGTTGTAAAAC- GAC-3 ′ ) according to the methods of Boutin-Ganache et al. (2001) . Moreover, a palindromic sequence tail (5 ′ -GTGTCTT-3 ′ ) was added to the 5 ′ end of the reverse primer to improve adenylation and facilitate genotyping. Amplified fragments were analyzed on an ABI 3130xl Genetic Analyzer (Applied Biosystems) and sized using GeneMapper 4.0 and GeneScan 500 LIZ Size Standard (Applied Biosystems). No multiplexing was attempted at the PCR stage. From a total of 132 loci tested, 18 were monomorphic, 14 showed complex or nonspecifi c amplifi cation, and nine failed to amplify. The remaining 91 loci were polymorphic in Portugal and Morocco ( Table 1 ). Sequences of 109 loci (18 monomorphic and 91 polymorphic) from a shotgun genomic library were submitted to the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA; accession SRP062192). We observed a total of 275 alleles for our initial sampling of C. helodes (nine individuals from Madroñalejo, fi ve from Portugal, and fi ve from Morocco), averaging overall 3.23 alleles per locus (SD = 1.15). Gametic disequilibrium (GENEPOP 4.1.4; Rousset, 2008 ) and the presence of null alleles according to the Oosterhout method (MICRO-CHECKER 2.2.3; van Oosterhout et al., 2004 ) were checked using Bonferroni-corrected P values ( P < 0.05 / 34 = 0.0015) to assess the signifi cance of the results obtained. No signifi cant gametic disequilibrium was detected for any pair of loci ( P > 0.01), and four loci (Cahe587, CaheWE1, CaheGVB, and CaheQWV) showed signs of the presence of null alleles suggested by an excess of homozygotes. Some loci showed one to three alleles with a size difference of one to two base pairs relative to contiguous alleles (see Table 1 ). Nevertheless, no variation outside of the microsatellite region was shown by these loci, and no scoring errors were detected by MICRO-CHECKER ( van Oosterhout et al., 2004 ). These polymorphisms could result from nonstepwise mutations in the repeat array. The 47 individuals from the Madroñalejo population (Spain) showed an identical genotype (nine individuals were genotyped using 109 loci, and 38 additional individuals were genotyped using the 34 most variable loci). This seems to indicate that this population has probably suffered a recent founder or bottleneck event. We used Arlequin 3.5.1.3 ( Excoffi er and Lischer, 2010 ) to calculate number of alleles, observed ( H o ) and expected heterozygosities ( H e ), and to test for deviations from Hardy–Weinberg equilibrium (HWE; Table 2 ) for the 34 most polymorphic loci in the eight individuals from the Cortelha population (Portugal). The eight individuals from the Cortelha population had a mean H o of 0.357 (SD = 0.292) and a mean H e of 0.384 (SD = 0.255). Six loci were monomorphic in this population, and only one (CaheWE1, P < 0.05; Table 2 ) of the 28 remaining loci deviated from HWE ( Table 2 ). CONCLUSIONS This study provides 109 simple sequence repeat markers to quantify the degree of genetic diversity in the endangered C. helodes . These markers may also help disentangle the phylogeographic history of C. helodes as well as gene fl ow among populations. This next-generation sequencing approach may also be useful for linkage mapping studies of experimental crosses between populations in a nonmodel organism. However, the low observed levels of variation within populations 6 of 6 Applications in Plant Sciences 2016 4 ( 1 ): 1500085 Arroyo et al.— Carex helodes microsatellites doi:10.3732/apps.1500085 http://www.bioone.org/loi/apps T ABLE 2. Results of screening 34 loci in the Cortelha population of Carex helodes . a Locus N A H o H e HWE CaheC2B 8 2 0.625 0.525 1 Cahe587 8 2 0 0.233 0.0668 CaheYES 8 4 0.625 0.592 1 CaheFG7 8 5 0.500 0.533 0.5924 CaheWE1 8 6 0.500 0.825 0.0054 Cahe121 7 1 0 0 NA CaheT2N 8 2 0.625 0.525 1 CaheXAF 7 3 0.571 0.659 0.0975 Cahe147 8 4 0.625 0.575 0.5498 CaheODD 8 4 1 0.642 0.0594 CaheMIW 8 1 0 0 NA CaheGVB 8 2 0 0.233 0.0667 CahePM5 8 3 0.250 0.433 0.1368 CaheQ9D 8 1 0 0 NA Cahe468 8 3 0.500 0.633 0.0969 Cahe7LF 8 3 0.875 0.625 0.3286 CaheQWB 8 2 0.625 0.525 1 CaheQWV 8 2 0.125 0.458 0.0768 CahePUI 8 2 0.125 0.125 1 Cahe222 8 4 0.625 0.675 0.4806 CaheEZE 8 2 0.250 0.233 1 CaheSGU 8 1 0 0 NA Cahe8RA 8 2 0.250 0.400 0.3843 CaheORP 8 2 0.250 0.233 1 CaheBI5 8 2 0.125 0.125 1 Cahe130 8 3 0.625 0.575 1 Cahe829 8 5 0.750 0.767 0.0523 Cahe677 8 1 0 0 NA Cahe84P 6 2 0.333 0.485 1 CaheWMU 8 2 0.125 0.125 1 CaheL7Z 8 2 0.375 0.525 0.5299 CaheUAX 8 3 0.625 0.542 0.4024 Cahe932 8 1 0 0 NA Cahe192 8 2 0.250 0.233 1 Note : A = number of alleles; H e = expected heterozygosity; H o = observed heterozygosity; HWE = nominal P values for tests of deviation from Hardy–Weinberg equilibrium; N = number of successfully genotyped individuals; NA = not applicable . a GPS coordinates and voucher information are available in Appendix 1. are not enough to genotype reproductive individuals and their seeds within populations and study gene interchange patterns within populations. LITERATURE CITED B AÑARES , Á . , G . B LANCA , J . G ÜEMES , J. C. MORENO , AND S . O RTIZ . 2010 . Atlas y Libro Rojo de la fl ora vascular amenazada de España. Adenda 2010. Dirección General de Medio Natural y Política Forestal (Ministerio de Medio Ambiente, y Medio Rural y Marino), y Sociedad Española de Biología de la Conservación de Plantas, Madrid, Spain. B OUTIN-GANACHE , I . , M . R APOSO , M . R AYMOND , AND C. F. DESCHEPPER . 2001 . M13-Tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques 31 : 24 – 27 . E SCUDERO , M . , P . V ARGAS , V . V ALCÁRCEL , AND M . L UCEÑO . 2008a . Strait of Gibraltar: An effective gene-fl ow barrier for wind-pollinated Carex helodes (Cyperaceae) as revealed by DNA sequences, AFLP, and cytogenetic variation. American Journal of Botany 95 : 745 – 755 . E SCUDERO , M . , V . V ALCÁRCEL , P . V ARGAS , AND M . L UCEÑO . 2008b . Evolution in Carex sect. Spirostachyae (Cyperaceae): A molecular and cytogenetic approach. Organisms, Diversity & Evolution 7 : 271 – 291 . E SCUDERO , M . , AND M . L UCEÑO . 2009 . Systematics and evolution of Carex sects. Spirostachyae and Elatae (Cyperaceae). Plant Systematics and Evolution 279 : 163 – 189 . E XCOFFIER , L . , AND H. E. L. LISCHER . 2010 . Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10 : 564 – 567 . L UCEÑO , M . , M . E SCUDERO , AND F . M UÑOZ GARMENDIA . 2009 . Typifi cation of Carex helodes Link, Carex laevigata Sm. and Carex patula Link ex Schkuhr (Cyperaceae). Candollea 64 : 39 – 43 . M EGLÉCZ , E . , N . P ECH , A . G ILLES , V . D UBUT , P . H INGAMP , A . T RILLES , R . G RENIER , AND J. F. MARTIN . 2014 . QDD version 3.1: A user-friendly computer program for microsatellite selection and primer design revisited: Experimental validation of variables determining genotyping success rate. Molecular Ecology Resources 14 : 1302 – 1313 . M ILLIGAN , B. G. 1998 . Total DNA isolation. In A. R. Hoelzel [ed.], Molecular genetic analysis of populations: A practical approach, 2nd ed., 43–44. Oxford University Press, Oxford, United Kingdom. M ORENO , J. C. 2008 . Lista Roja 2008 de la fl ora vascular española. Dirección General de Medio Natural y Politica Forestal (Ministerio de Medio Ambiente y Medio Rural y Marino), y Sociedad Española de Biología dela Conservacion de Plantas, Madrid, Spain. O UBORG , N. J. , Y. PIQUOT , AND J. M. VAN GROENENDAEL . 1999 . Population genetics, molecular markers, and the study of dispersal in plants. Journal of Ecology 87 : 551 – 568 . R OUSSET , F. 2008 . GENEPOP’007: A complete re-implementation of the GENEPOP software for Windows and Linux. Molecular Ecology Resources 8 : 103 – 106 . VAN OOSTERHOUT , C. , W. F. HUTCHINSON , D. P. M. WILLS , AND P . S HIPLEY . 2004 . MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes 4 : 535 – 538 . A PPENDIX 1 . Voucher and locality information for Carex helodes populations sampled in this study. Vouchers are deposited at the Universidad Pablo de Olavide herbarium (UPOS), Seville , Spain . Locality Population Geographic coordinates N a Voucher no. Spain, Seville, Aznalcóllar, Madroñalejo Madroñalejo 37 ° 35 ′ 24.0 ″ N, 6 ° 21 ′ 30 ″ W 9 (38) 24ME07, 1ME14 Portugal, Algarve, betw. Barraçao Caldas de Monchique Pop. 1 37 ° 15 ′ 44.4 ″ N, 8 ° 45 ′ 47.4 ″ W 4 8101JMM Portugal, Algarve, Cortelha Pop. 2 37 ° 14 ′ 56.4 ″ N, 7 ° 57 ′ 45.5 ″ W 1 (7) 7901JMM Morocco, Tanger-Tetuan, Chauen, Ksar el Kebir Pop. 1 35 ° 05 ′ 09.0 ″ N, 5 ° 22 ′ 07.0 ″ W 4 34JFA03, 27PJM04 Morocco, Tanger-Tetuan, Chauen, Ksar el Kebir Pop. 2 35 ° 06 ′ 02 ″ N, 5 ° 20 ′ 37 ″ W 1 22PJM04 Note : N = number of sampled individuals. a The number of additional individuals sampled to test the 34 most polymorphic loci is given in parentheses.