Increase of aerobic glycolysis mediated by activated T helper cells drives synovial fibroblasts towards an inflammatory phenotype: new targets for therapy?

RESEARCH ARTICLE Open Access Inc ease o ae obic glycolysis media ed by ac i a ed T helpe cells d i es syno ial ib oblas s owa ds an in lamma o y pheno ype: new a ge s o he apy? Pe e K acskay 1 , Nina Yao 1 , Jü gen-Heinz Schno z 1 , Robe a Sca pone 1 , Rui de Albuque que Ca alho 2,3 , Ka el D. Klika 4 , Wol gang Me k 1 , The esa T e e 1 , Hanns-Ma in Lo enz 1 and La s-Oli e Tykocinski 1* Abs ac Backg ound: A dys egula ed glucose me abolism in syno ial ib oblas s (SF) has been associa ed wi h hei agg essi e pheno ype in heuma oid a h i is (RA). E en hough T helpe (Th) cells a e key e ec o cells in he p opaga ion and exace ba ion o syno i is in RA, li le is known abou hei in luence on he me abolism o SF. Thus, his s udy in es iga es he e ec o Th cells on he glucose me abolism and pheno ype o SF and how his is in luenced by he blockade o cy okines, janus kinases (JAKs) and glycolysis. Me hods: SF om pa ien s wi h RA o os eoa h i is (OA) we e cul u ed in he p esence o a s able glucose iso opome ([U- 13 C]-glucose) and s imula ed wi h he condi ioned media o ac i a ed Th cells (ThCM). Glucose consump ion and lac a e p oduc ion we e measu ed by p o on nuclea magne ic esonance ( 1 H NMR) spec oscopy. Cy okine sec e ion was quan i ied by ELISA. The exp ession o glycoly ic enzymes was analysed by PCR, wes e n blo and immuno luo escence. JAKs we e blocked using ei he ba ici inib o o aci inib and glycolysis by using ei he 3-b omopy u a e o FX11. Resul s: Quiescen RASF p oduced signi ican ly highe le els o lac a e, in e leukin (IL)-6 and ma ix me allop o einase (MMP) 3 han OASF. S imula ion by ThCM clea ly changed he me abolic p o ile o bo h RASF and OASF by inducing a shi owa ds ae obic glycolysis wi h s ongly inc eased lac a e p oduc ion oge he wi h a ise in IL-6 and MMP3 sec e ion. In e es ingly, ch onic s imula ion o OASF by ThCM igge ed an in lamma o y pheno ype wi h signi ican ly inc eased glycoly ic ac i i y compa ed o uns imula ed, singly s imula ed o e- s imula ed OASF. Finally, in con as o cy okine-neu alizing biologics, inhibi ion o JAKs o glycoly ic enzymes bo h signi ican ly educed lac a e p oduc ion and cy okine sec e ion by Th cell-s imula ed SF. (Con inued on nex page) © The Au ho (s). 2021 Open Access This a icle is licensed unde a C ea i e Commons A ibu ion 4.0 In e na ional License, which pe mi s use, sha ing, adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as long as you gi e app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o he C ea i e Commons licence, and indica e i changes we e made. The images o o he hi d pa y ma e ial in his a icle a e included in he a icle's C ea i e Commons licence, unless indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no included in he a icle's C ea i e Commons licence and you in ended use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed use, you will need o ob ain pe mission di ec ly om he copy igh holde . To iew a copy o his licence, isi h p://c ea i ecommons.o g/licenses/by/4.0/. The C ea i e Commons Public Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he da a made a ailable in his a icle, unless o he wise s a ed in a c edi line o he da a. * Co espondence: [email p o ec ed] 1 Depa men o Medicine V, Di ision o Rheuma ology, Uni e si y o Heidelbe g, INF 410, 69120 Heidelbe g, Ge many Full lis o au ho in o ma ion is a ailable a he end o he a icle K acskay e al. A h i is Resea ch & The apy (2021) 23:56 h ps://doi.o g/10.1186/s13075-021-02437-7 (Con inued om p e ious page) Conclusions: Soluble media o s eleased by Th cells d i e SF owa ds a glycoly ic and p o-in lamma o y pheno ype. Ta ge ing o JAKs o glycoly ic enzymes bo h po en ly modula e SF’s glucose me abolism and dec ease he elease o IL-6 and MMP3. Thus, manipula ion o glycoly ic pa hways could ep esen a new he apeu ic s a egy o dec ease he p o-in lamma o y pheno ype o SF. Keywo ds: Rheuma oid a h i is, Syno ial ib oblas s, Fib oblas -like syno iocy es, T lymphocy es, T helpe cells, Me abolism, Glycolysis, Janus kinases, In lamma ion, T ansla ional esea ch Backg ound Rheuma oid a h i is (RA) is a sys emic au oimmune dis- ease cha ac e ized by ch onic in lamma ion, ecu ing syno i is and des uc ion o he ca ilage and bone [1,2]. The cha ac e is ic ans o ma ion o he syno ial mem- b ane in o a des uc i e umou -likepannusisaccompan- ied by a pe sis en in a-a icula in asion o immune cells. Syno ial ib oblas s (SF), also known as ib oblas -like syno- iocy es, a e he majo cell ype wi hin he hype plas ic pannus and he main e ec o cells o join des uc ion. SF o RA pa ien s (RASF) p esen an agg essi e pheno ype wi h abno mally inc eased p oli e a ion, sec e ion o p o- in lamma o y cy okines and issue-in asi e p ope ies [3– 5]. The abe an ib oblas pheno ype and he hypoxic and nu ien -dep i ed mic o-en i onmen o he pannus a e cha ac e is ics which a e also ound in solid umou s. Fo umou cells, i is well known ha hey adap hei glucose me abolism o mee he inc eased bioene ge ic and biosyn- he ic demands in a umou mic o-en i onmen [6,7]. Al eady in 1924, Wa bu g showed ha malignan cells p o- duce signi ican ly highe amoun s o lac a e han no mal cells unde no moxic condi ions [8,9]. He s a ed ha up- egula ion o ae obic glycolysis allowed malignan cells o su i e he hypoxic condi ions p e ailing in highly p oli e - a i e umou issues. The e is g owing e idence la ely ha his well-desc ibed Wa bu ge ec ,i.e. heme abolic swi ch om oxida i e phospho yla ion owa ds glycolysis, is also a cha ac e is ic ea u e o in lamed join s o RA pa ien s [10,11]. Se e al s udies ha e demons a ed ha lac a e le els we e signi i- can ly inc eased while glucose le els we e dec eased in syn- o ial luid o in syno ial issue o RA pa ien s compa ed o hose o os eoa h i is (OA) pa ien s o heal hy indi iduals [12–15]. In he se um o RA pa ien s, an inc ease o bo h glucose and lac a e le els has been desc ibed [16]. Using luo odeoxyglucose-posi on emission omog aphy, he in- c eased glucose up ake by cells o he pannus was able o be imaged, sugges ing an enhanced glycoly ic ac i i y o RASF and in ading immune cells [17,18]. Mo eo e , a signi ican co ela ion be ween mi ochond ial dys unc ion, enhanced ae obic glycolysis and he in lamma o y, des uc i e p ope - ies o RASF has been desc ibed [19–23]. Al hough a dys egula ed glucose me abolism in RASF has been sugges ed o play a c i ical ole in he pa hogenesis o RA, e y li le is known abou he im- pac o ac i a ed immune cells on he egula ion o he glucose me abolism o SF. The associa ion o RA, espe- cially in he mos e osi e o m, wi h speci ic HLA-DR al- leles p o ides s ong e idence o a key ole o T helpe (Th) cells in RA pa hogenesis and disease se e i y. T lymphocy es in il a e he join s o RA pa ien s and con- s i u e abou 30–50% o all cell ypes in he sub-lining egion o syno ial issues. In his way, T cells and SF a e in close con ac and s imula e each o he by di ec cell- cell con ac o by he elease o soluble ac o s [24]. The in e ac ion be ween Th17 cells and SF has been de- sc ibed as a key mechanism o he de elopmen o syn- o ial issue in lamma ion [25]. In e ac ion and ecip ocal ac i a ion o Th cells and RASF ha e ecen ly been shown o induce and ampli y in lamma o y esponses and o esul in a me abolic shi owa ds glycolysis in SF o mee he inc eased me abolic demand [26]. On he o he hand, in e ac ion wi h Th cells induces immuno- supp essi e unc ions o SF, a capaci y ha has been shown o be educed in RASF compa ed o OASF [27, 28]. Al oge he , c oss- alk wi h Th cells clea ly a ec s SF’s pheno ype and unc ion. In his s udy, we in es iga ed he impac o Th cells on he glucose me abolism and pheno ype o SF. Fu he , we compa ed he e ec o ch onic s imula ion wi h sin- gle s imula ion and e-s imula ion by Th cells on SF. Fi- nally, we analysed he po ency o cy okine-neu alizing biologics and janus kinase inhibi o s (JAKi), used in he ea men o in lamma o y heuma ic diseases like RA, as well as o inhibi o s a ge ing glycoly ic enzymes in limi ing he T cell-media ed induc ion o a glycoly ic and in lamma o y pheno ype in SF. OASF ha e been de- sc ibed o di e om RASF in many ways, e.g. OASF a e less esis an o apop osis, ha e a di e en epigene ic signa u e and do no possess an in insically ac i a ed, agg essi e and in asi e pheno ype like RASF [29–31]. In he p esen s udy, OASF we e used as a degene a i e disease con ol o RASF. Me hods Cell isola ion and cul u e SF om pa ien s wi h ei he OA o RA we e isola ed om syno ial issues collec ed du ing diagnos ic K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 2 o 15 a h oscopy o he apeu ic join su ge y as desc ibed p e- iously [28]. CD4 + Th cells we e isola ed om hepa inized enous blood o RA pa ien s o no mal heal hy dono s (NHD) by densi y g adien cen i uga ion and sepa a ion using he MojoSo human CD4 T cell isola ion ki (Bio- Legend) acco ding o he manu ac u e ’sins uc ions (pu i y ≥98%). All RA pa ien s ul illed he Ame ican Col- lege o Rheuma ology/Eu opean League Agains Rheuma- ism c i e ia o he classi ica ion o RA [32]. SF we e cul u ed in DMEM-F12 medium (Me ck) sup- plied wi h 10% hea -inac i a ed oe al cal se um (The mo Fishe Scien i ic). Passages 4–10 we e used o expe imen s. Th cells we e s imula ed wi h an i-CD3 and an i-CD28 (bo h 1 μg/ml, The mo Fishe Scien i ic) in glucose- ee RPMI-1640 medium (Biological Indus- ies) supplemen ed wi h 10% oe al cal se um and he s able glucose iso ope ace [U- 13 C]-glucose (2 g/l, T ace ec). Th cell-condi ioned media (ThCM) we e collec ed on day 4. Fo mos expe imen s, SF we e s im- ula ed wi h ThCM dilu ed 1:5 in RPMI-1640 medium. Hypoxic cul u e condi ions we e main ained using a glo e box (Coylab) and an incuba o (He acell 150i, The mo Fishe Scien i ic) wi h oxygen le el con ol. In some expe imen s, SF we e s imula ed wi h di e en concen a ions o ecombinan human in e leukin (IL)- 1β, IL-17A (bo h BioLegend), in e e on (IFN)γ(R&D Sys ems) o umou nec osis ac o (TNF)α(Pep o ech). Cy okines o cy okine ecep o s we e neu alized using canakinumab (No a is), e ane cep (P ize ), secukinu- mab (No a is) o ocilizumab (Roche). Janus kinases (JAKs) we e a ge ed by ba ici inib (Ta ge Mol) o o a- ci inib (P ize ). Hexokinase (HK) 2 was inhibi ed by 3- b omopy u a e (3-B Pa) (Gen au ) and lac a e dehyd o- genase (LDH)-A by FX11 (Me ck). Cell su i al was de e mined by Annexin V and p opi- dium iodide s aining and measu ed by low cy ome y using a BD FACSCan o II analyse (BD Biosciences). S au ospo in- ea ed cells (2 μM, 24 h) se ed as a posi- i e con ol. Analysis o lac a e and glucose le els by 1 H NMR spec oscopy SF we e cul u ed in he p esence o [U- 13 C]-glucose ei- he wi h o wi hou s imula ion by ThCM. Cul u e su- pe na an s we e ha es ed on day 4 and analysed using a B uke A ance II spec ome e equipped wi h a 5-mm indi ec de ec ion p obe (B uke BioSpin) ope a ing a 600 MHz o 1 H. The 1 H NMR spec a wi h wa e sup- p ession using p esa u a ion we e acqui ed wi h 43k poin s de ining a spec al wid h o 7.2 kHz using a 30° adio equency pulse and a o al epe i ion ime o 10 s o ensu e ull elaxa ion o he 1 H nuclei. Spec al ana- lyses we e pe o med using NUTSp o™NMR so wa e (Aco n NMR Inc.). Each ee induc ion decay was mul iplied by a decaying exponen ial wi h a decay con- s an o 0.2 Hz p io o Fou ie ans o ma ion. Fo quan i ica ion, sodium uma a e (10 mM) dissol ed in a 0.2-M phospha e bu e solu ion p epa ed wi h D 2 O (99.9%) was used as an in e nal s anda d. Quan i ica ion o cy okine sec e ion The concen a ions o IL-6, IL-8 and ma ix me allop o- einase (MMP) 3 in cul u e supe na an s we e quan i ied by enzyme-linked immunoso ben assay (ELISA) using he Duo Se ELISA ki s (R&D Sys ems) o all cy okines acco ding o he manu ac u e ’s ins uc ions. Cy okines in he ThCM we e quan i ied using he LEGENDplex Hu- man Th Cy okine Panel 12-plex assay ki (BioLegend). In i o sc a ch mig a ion assay To assess he mig a ion o SF in he p esence o absence o s imula ion by soluble media o s eleased by ac i a ed Th cells o ecombinan human TNFα, IL-17A o IFNγ (10 ng/ml each, all Pep oTech), we pe o med an in i o sc a ch assay as desc ibed [33]. RNA isola ion, cDNA ansc ip ion and quan i a i e RT- PCR The High Pu e RNA isola ion ki (Roche) was used o isola e o al RNA. To al RNA was e e se ansc ibed in o cDNA wi h he Quan iTec e e se ansc ip ion ki (Qiagen). RT-PCRs we e pe o med using he Powe Up SYBR G een mas e mix and a S epOnePlus sys em (bo h Applied Biosys ems). The ollowing p ime s we e u ilized: HK2—Fwd-AAGGCTTCAAGGCATCTG, e - CCACAGGTCATCATAGTTCC; PFKp—Fwd-AGAT CCATAAGGAGGCCGTG, e -AGAACGAAGGTCCT CTGGTG; PKM2—Fwd-ATTATTTGAGGAACTCCG CCGCCT, e -ATTCCGGGTCACAGCAATGATGG; and LDH-A—Fwd-ACCCAGTTTCCACCATGATT, e - CCCAAAATGCAAGGAACACT. Wes e n blo analysis Isola ion o o al cell ex ac s om SF was pe o med by lysing cells in RIPA bu e (ccp o) con aining a p o ease inhibi o cock ail (comple eMini, Boeh inge ) o 20 min on ice. A e dilu ion in a loading bu e , p o ein samples we e esol ed using s anda d SDS-PAGE and ans e ed on o ni ocellulose memb anes. HK2, phospho uc oki- nase (PFK)p, py u a e kinase M2 (PKM2) and LDH-A we e de ec ed by co esponding an ibodies (CellSignal- ing). β-Ac in was used as a loading con ol. Quan i ica- ion was pe o med by densiome ic analysis using ImageJ2. Fluo escence mic oscopy SF we e le o adhe e on glass co e slips and we e ei- he s imula ed wi h ThCM o 4 days o le K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 3 o 15 uns imula ed. Cells we e ixed by pa a o maldehyde and pe meabilized wi h e hanol. Fluo escen an ibody s ain- ing was pe o med using an ibodies agains HK2 (eBioscience), PKM2 (CellSignaling) and Cy3-labelled an i- abbi -IgG. Cell nuclei we e s ained wi h 4′,6-dia- midino-2-phenylindole (DAPI). The analysis was pe - o med a he Imaging Facili y o he Cen e o Molecula Biology Heidelbe g (ZMBH) using an Olym- pus IX81 mic oscope. S a is ics Resul s a e p esen ed as he mean ± SEM. The Mann- Whi ney U es and he Wilcoxon signed- ank es we e applied o unpai ed and pai ed, espec i ely, sample se s using G aphPad P ism o s a is ical analysis. Values o p less han 0.05 we e conside ed s a is ically signi ican . Resul s Ac i a ed Th cells elease media o s ha induce a me abolic shi owa ds ae obic glycolysis in SF In o de o in es iga e he in luence o Th cells on he glucose me abolism o bo h OASF and RASF, SF we e cul u ed in he p esence o a s able glucose iso ope ([U- 13 C]-glucose) ei he unde es ing condi ions o s imula ed by ThCM. The amoun o [U-13C]-glucose emaining and he glucose-de i ed [U- 13 C]-lac a e p o- duced by he SF was measu ed using 1 H NMR spec os- copy. This me hod allowed us o quan i y he concen a ion o esidual, non-me abolized glucose in he cul u e supe na an s as well as he concen a ion o gene a ed and sec e ed lac a e as he p oduc o glycoly- sis. By calcula ing he amoun o glucose ha was con- sumed by SF, bu no me abolized in o lac a e, i was possible o indi ec ly quan i y he le el o oxida i e glu- cose me abolism. Figu e 1a shows ep esen a i e 1 H NMR spec a o cul u e supe na an s om uns imula ed SF and om SF s imula ed by ThCM. S imula ion wi h ThCM esul ed in a dec ease o glucose and a clea in- c ease o lac a e in SF cul u e supe na an s. Compa ing OASF and RASF unde es ing condi ions, RASF showed signi ican ly mo e lac a e p oduc ion and a signi ican ly highe a io o glucose me abolized by ae obic glycolysis e sus ha me abolized by oxida i e phospho yla ion han OASF (Fig. 1b). S imula ion by condi ioned cul u e medium om Th cells o RA pa ien s esul ed in a sig- ni ican inc ease in lac a e p oduc ion and a signi ican shi owa ds glycoly ic glucose me abolism by bo h RASF and OASF (Fig. 1b). Howe e , in con as o es - ing condi ions, no signi ican di e ence in lac a e p o- duc ion was de ec ed be ween RASF and OASF unde s imula ion wi h ThCM, al hough a end owa ds s ill highe lac a e le els and glycoly ic a es in RASF could be seen (Fig. 1b). Simila o he s imula ion by RA pa- ien s’ThCM, s imula ion o OASF and RASF by condi ioned cul u e medium om Th cells o heal hy dono s esul ed in a s ong inc ease o lac a e p oduc- ion by SF (Addi ional ile 1: Fig. S1). Since he e we e no signi ican de ec able di e ences be ween he induc- ion o glycolysis in SF by ThCM om he T cells o heal hy indi iduals o RA pa ien s, all o he expe imen s in his s udy we e ca ied ou wi h s imula ion o SF by RA pa ien s’ThCM. As shown in Addi ional ile 2: Fig. S2, he s imula o y e ec o ThCM on SF’s lac a e p o- duc ion a es was dose-dependen . Analysis o he cy okines p esen in he ThCM used o s imula e he SF e ealed ha IFNγ ep esen ed he highes con en o all he cy okines es ed (Add- i ional ile 3: Fig. S3). Addi ionally, TNFα, IL-6, IL-9, IL- 22, IL-5, IL-13 and o a lesse ex en IL-17A and IL-10 we e also de ec ed. Howe e , a 151.07 ± 36.42 ng/ml, he concen a ion o IFNγwas mo e han 25- old highe han any o he o he cy okines (Addi ional ile 3: Fig. S3). Since hypoxia has been desc ibed as a cha ac e is ic mic o-en i onmen al ea u e o in lamed join s o RA pa ien s wi h a mean ambien oxygen ension o only 3.2% O 2 [34], we he e o e nex in es iga ed he in lu- ence o hypoxic condi ions on he glucose me abolism o SF. As expec ed, cul u e unde hypoxic condi ions (3% O 2 ) esul ed in an inc eased lac a e p oduc ion by bo h OASF and RASF. Simila o wha had been obse ed unde no moxic condi ions, RASF showed signi ican ly highe lac a e p oduc ion han OASF unde hypoxia in he absence o u he s imula ion (Addi ional ile 4: Fig. S4). S imula ion by ThCM unde hypoxic condi ions equally induced a signi ican and dose-dependen up eg- ula ion o lac a e p oduc ion in bo h RASF and OASF. Howe e , a u he shi om oxida i e owa ds glyco- ly ic glucose me abolism could no be de ec ed in s imu- la ed e sus un-s imula ed SF unde hypoxia (Addi ional ile 4: Fig. S4). Toge he , hese esul s dem- ons a e ha RASF displayed a highe basic a e o gly- colysis unde es ing condi ions compa ed o OASF; bu unde s imula ion by Th cells, OASF acqui ed a simila high glycoly ic ac i i y as RASF. Mo eo e , he da a indi- ca e ha pa icula ly RASF use glycolysis as a means o ene gy p oduc ion unde hypoxic condi ions. Soluble media o s eleased by ac i a ed Th cells induce a p o-in lamma o y pheno ype in SF To de e mine whe he ac i a ed Th cells also s imula ed he de elopmen o a p o-in lamma o y p o ile in SF, we analysed he sec e ion o IL-6, IL-8 and MMP3 by OASF and RASF cul u ed unde es ing condi ions o unde s imula ion by ThCM. In he absence o s imula ion, RASF showed signi ican ly highe le els o IL-6 and MMP3 sec e ion compa ed o OASF (Fig. 2a). S imula- ion wi h ThCM s ongly augmen ed he sec e ion o IL- K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 4 o 15 6, IL-8 and MMP3 in bo h g oups. Cy okines IL-6 and IL-8 can also be sec e ed by ac i a ed Th cells, howe e only in much lowe amoun s compa ed o Th cell- s imula ed SF as epo ed p e iously [27,28] and shown in Addi ional ile 3: Fig. S3. The ThCM used he e o s imula e SF only con ained app oxima ely 6 ng/ml IL-6 (6.04 ± 2.95 ng/ml). The e o e, he p opo ion o Th cell- de i ed IL-6 and IL-8 in he supe na an s o ThCM- s imula ed SF can be neglec ed. To in es iga e he impac o s imula ion by Th cells on he mig a ion o SF, we pe o med an in i o sc a ch assay. No di e ence in he mig a o y capaci ies could be de ec ed be ween OASF and RASF unde es ing condi- ions. In e es ingly, unde s imula ion by ThCM, bo h RASF and OASF displayed signi ican ly dec eased mig a- ion a es compa ed o uns imula ed condi ions (Fig. 2b and Addi ional ile 5: Fig. S5). Simila ly, s imula ion o SF wi h a combina ion o IFNγ,TNFαand IL-17A also s ongly educed hei mig a ion. This e ec was less p onounced when he SF we e s imula ed by indi idual cy okines alone (Addi ional ile 5: Fig. S5). Thus, media- o s eleased by ac i a ed Th cells induced a s ong me abolic shi owa ds glycolysis in SF in andem wi h an augmen ed sec e ion o in lamma o y media o s and educed mig a o y p ope ies. Ch onic s imula ion by Th cells igge s a highly glycoly ic and in lamma o y pheno ype in OASF Fib oblas s ha e been desc ibed o play a c i ical ole in he induc ion o a ch onic pe sis en in lamma ion in RA, and s imula ion seems o p ime e en SF om non- in lamed join s o a p o-in lamma o y memo y esponse [35]. He e, we wan ed o in es iga e whe he a single s imula ion o a ch onic s imula ion by Th cells p imes Fig. 1 Th cells induce a me abolic shi owa ds ae obic glycolysis in SF. OASF (n= 12) and RASF (n= 12) we e cul u ed o 4 days in he p esence o [U- 13 C]-glucose ei he unde es ing condi ions o s imula ed by condi ioned cul u e media o ac i a ed Th cells (ThCM). The amoun o [U- 13 C]-glucose and [U- 13 C]-lac a e p oduced by he SF was measu ed using 1 H NMR spec oscopy. aRep esen a i e examples o 1 H NMR spec a o SF s imula ed by ThCM ( ed) and uns imula ed SF (blue). bThe amoun o sec e ed [U- 13 C]-lac a e and he a io o [U- 13 C]-glucose me abolized by glycolysis (Gly) and hose me abolized by oxida i e phospho yla ion (OXPHOS) was de e mined o SF cul u e supe na an s. Resul s a e p esen ed as he mean ± SEM. *p< 0.05, **p< 0.01, Mann-Whi ney U es and Wilcoxon signed- ank es . w/o s im, wi hou s imula ion K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 5 o 15 he pheno ype and glucose me abolism o OASF. The e- o e, OASF we e cul u ed unde ou di e en condi- ions: The i s g oup was cul u ed wi hou s imula ion o a o al pe iod o 18 days (uns imula ed). The second g oup o OASF was s imula ed by ThCM on day 14 o cul u e (p ima y s imula ion (1s s im)). The hi d g oup was i s s imula ed be ween days 1 and 4 o cul u e, hen washed and emained uns imula ed un il a second s imula ion on day 14 ( e-s imula ion (2nd s im)). And inally, he ou h g oup was epea edly s imula ed be- ween days 1 and 12 and e-s imula ed on day 14 by ThCM (ch onic s imula ion). On day 18, we quan i ied he concen a ions o lac a e, IL-6 and MMP3 in he cul- u e supe na an s o all ou g oups. As p esen ed in Fig. 3, uns imula ed SF showed e y low lac a e p oduc- ion and nea ly no IL-6 o MMP3 sec e ion. Single s imula ion on day 14 esul ed in a sha p inc ease o lac- a e and IL-6 p oduc ion and a mild up egula ion o MMP3 sec e ion. Rema kably, p e-s imula ion and la e e-s imula ion o SF did no induce a memo y esponse wi h highe lac a e, IL-6 o MMP3 p oduc ion compa ed o he singly s imula ed g oup. Howe e , ch onic s imu- la ion o he SF esul ed in a signi ican ly inc eased se- c e ion o lac a e, as well as o IL-6 and MMP3 (Fig. 3). Hence, a epea ed s imula ion o OASF by Th cells, bu no a single e-s imula ion, igge ed an agg essi e pheno ype wi h signi ican ly highe p oduc ion o lac a e and in lamma o y cy okines compa ed o once only s imula ed OASF. S imula ion o SF by Th cells enhance he exp ession o glycoly ic enzymes Since RASF displayed inc eased baseline le els o gly- colysis unde es ing condi ions when compa ed o OASF and s imula ion by ThCM boos ed he glycoly ic ac i i y o bo h OASF and RASF, o u he elucida e he ole o glycoly ic key egula o s in he enhanced glyco- ly ic ac i i y o RASF and he shi in glucose me abol- ism owa ds glycolysis upon s imula ion by Th cells, we quan i ied he exp ession o HKII, PFKp, PKM2 and Fig. 2 Media o s eleased by Th cells induce p o-in lamma o y cy okine exp ession by SF bu diminish hei mig a ion. Sec e ion o p o- in lamma o y cy okines co ela es wi h enhanced glycoly ic ac i i y in SF. OASF and RASF we e cul u ed in he p esence o absence o ThCM. a A e 4 days, he concen a ion o in e leukin (IL)-6, IL-8, and ma ix me allop o ease (MMP)3 wi hin he cul u e supe na an s was quan i ied by ELISA (n= 10). bAn in i o sc a ch assay was pe o med o in es iga e he cell mig a ion o SF cul u ed wi h o wi hou ThCM (n= 6). Da a a e p esen ed as he mean ± SEM. *p< 0.05, **p< 0.01, Mann-Whi ney U es and Wilcoxon signed- ank es K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 6 o 15 LDH-A in OASF and RASF unde es ing condi ions and unde s imula ion by ThCM. E en hough he e was mo e ae obic glycolysis in es ing RASF han in OASF, we did no ind any di e ences in he mRNA and p o- ein exp ession o he analysed glycoly ic enzymes be- ween es ing OASF and RASF (Fig. 4a, b). S imula ion wi h ThCM esul ed in a signi ican inc ease in he ex- p ession o HK2 mRNA by bo h RASF and OASF com- pa ed o uns imula ed condi ions. Fo PFKp, PKM2 and LDH-A, a endency owa ds highe mRNA exp ession upon s imula ion by ThCM could be obse ed (Fig. 4a). Compa able esul s we e ob ained on he p o ein le el by wes e n blo and immuno luo escence analysis (Fig. 4b and Addi ional ile 6Fig. S6). Ta ge ing pa icula cy okines by biologics is no su icien o educe he Th cell-s imula ed glycolysis in SF Ou da a p esen ed abo e showed ha bo h he p oduc- ion o p o-in lamma o y cy okines and a me abolic shi owa ds ae obic glycolysis we e induced in SF by ThCM by soluble ac o s in a cell con ac -independen way. We nex in es iga ed whe he cy okines known o play key oles in he pa hogenesis o RA and o ha e he capaci y o ac i a e SF, namely TNFα, IL-1βand IL-17A, and IFNγ, which we ound in highes concen a ions in ThCM, a e known o play a ole in he pa hogenesis o RA o o he heuma ic diseases, alone o in combin- a ion, a e able o induce he p oduc ion o lac a e by SF. The e o e, OASF and RASF we e incuba ed wi h di e - en concen a ions o ecombinan TNFα,IL-1β, IL-17A and IFNγ, ei he indi idually o wi h all ou cy okines. On day 4, he lac a e p oduc ion by he s imula ed SF was quan i ied. As p esen ed in Fig. 5a, all indi idual cy- okines induced a end owa ds an enhanced lac a e p oduc ion by bo h OASF and RASF, a leas a he highes concen a ions es ed. Howe e , only IL1-βhad a signi ican and dose-dependen glycolysis-p omo ing e ec on OASF and RASF. In addi ion, simul aneous s imula ion by all ou cy okines oge he e ealed a syn- e gis ic e ec esul ing in a highe inc ease in lac a e Fig. 3 Ch onic s imula ion by Th cells igge s a glycoly ic and p o- in lamma o y pheno ype in OASF. OASF we e cul u ed o a o al pe iod o 18 days unde ou di e en condi ions: The i s g oup was cul u ed wi hou s imula ion (w/o s im). The second g oup was s imula ed on d14 o cul u e (1s s im). The hi d g oup was i s s imula ed be ween d1 and d4, hen emained uns imula ed un il a second s imula ion on d14 (2nd s im). The ou h g oup was epea edly s imula ed be ween d1 and d12 and e-s imula ed on d14 (ch onic s im). On d18, he concen a ions o lac a e, IL-6 and MMP3 we e quan i ied o all ou g oups (n= 7). Resul s a e p esen ed as he mean ± SEM. S a is ical signi icances be ween he ch onically s imula ed g oup and he uns imula ed, he singly s imula ed and he e-s imula ed g oup a e shown. *p< 0.05, Wilcoxon signed- ank es K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 7 o 15 p oduc ion by bo h OASF and RASF han he one ob- se ed wi h he indi idual cy okines (Fig. 5a). Neu alizing cy okines o cy okine ecep o s by spe- ci ic an ibodies ha e p o en o be g ea ly e ec i e in he ea men o heuma ic diseases. In o de o de e mine whe he such biologics could ab oga e he up egula ion o ae obic glycolysis in Th cell-s imula ed SF, OASF we e incuba ed wi h ThCM in he p esence o di e en concen a ions o e ane cep (an i-TNFα), ocilizumab (an i-IL-6- ecep o ), secukinumab (an i-IL-17A) o cana- kinumab (an i-IL-1β), and he p oduc ion o lac a e was analysed on day 4. As depic ed in Fig. 5b, none o he bi- ologics caused a signi ican educ ion in lac a e p oduc- ion by OASF s imula ed wi h ThCM. Thus, p o- in lamma o y cy okines, especially IL-1β, can induce ae - obic glycolysis in SF. Howe e , a ge ing only one cy o- kine o cy okine ecep o by he biologics was no su icien o signi ican ly a ec he Th cell-media ed me abolic swi ch in SF. Inhibi ion o JAKs as well as glycoly ic enzymes bo h e icien ly block he Th cell-media ed swi ch owa ds a glycoly ic and in lamma o y pheno ype in SF Since he biologics a ge ing single cy okines we e ine i- cien in lowe ing he s imula o y e ec o ThCM on SF’s glycoly ic me abolism, we nex es ed whe he blocking in acellula cy okine signalling h ough he JAK pa h- way could mo e e icien ly block Th cell-media ed SF Fig. 4 S imula ion o SF by Th cells esul s in an enhanced exp ession o glycoly ic enzymes. OASF and RASF we e cul u ed unde es ing condi ions o unde s imula ion by ThCM and cells we e ha es ed on d4. aThe mRNA exp ession o HK2, LDH-A, PKM2 and PFKp we e de e mined by RT-PCR. Each ba indica es he mRNA exp ession o he co esponding gene as 2 −del aCT using β-ac in mRNA exp ession as e e ence (n= 6). bP o ein le els o HK2, LDH-A, PKM2 and PFKp we e quan i ied by wes e n blo . β-Ac in was used as a loading con ol. The depic ions a e ep esen a i e examples om one o h ee independen expe imen s. HK2, hexokinase 2; LDH-A, lac a e dehyd ogenase A; PKM2, py u a e kinase M2; PFKp, phospho uc okinase p. Da a a e p esen ed as he mean ± SEM. *p< 0.05, Mann-Whi ney U es and Wilcoxon signed- ank es K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 8 o 15 ac i a ion. Mos o he cy okines which we de ec ed in ThCM a e known o induce cy okine ecep o signalling ia he JAK-STAT pa hway, and s imula ion by soluble media o s eleased by ac i a ed Th cells s ongly induced phospho yla ion o STAT in OASF and RASF [28]. Fo his eason, SF we e s imula ed wi h ThCM in he p es- ence o absence o he JAKi ba ici inib o o aci inib. Re- ma kably, bo h ba ici inib and o aci inib signi ican ly diminished he p oduc ion o lac a e by SF s imula ed by ThCM in a dose-dependen manne (Fig. 6a). Addi ion- ally, ba ici inib signi ican ly ab oga ed he shi om oxi- da i e o glycoly ic glucose me abolism in SF. Impo an ly, in pa allel o hei e ec on he glycoly ic a e, bo h JAKi signi ican ly educed he sec e ion o IL- 6 by Th cell-s imula ed SF (Fig. 6b). Sec e ion o MMP3 was less a ec ed by JAKi, hough ba ici inib signi ican ly educed MMP3 exp ession by SF a he highes concen- a ion es ed (500 nM) (Fig. 6b). Fig. 5 E ec s o s imula ion wi h cy okines and blocking o cy okines on he glucose me abolism o SF. aOASF and RASF we e s imula ed wi h di e en concen a ions o IL-1β, IL-17A, TNFαand IFNγ, ei he indi idually o wi h all ou cy okines. A e 4 days o cul u e, he supe na an s we e ha es ed, and lac a e concen a ions we e measu ed by 1 H NMR spec oscopy (n= 6). bOASF we e cul u ed unde es ing condi ions o wi h s imula ion by ThCM in he p esence o absence o an i-TNFα(e ane cep ), an i-IL-6 ecep o ( ocilizumab), an i-IL-17A (secukinumab) and an i-IL-1β(canakinumab) a he h ee gi en concen a ions. Lac a e concen a ions we e quan i ied on d4 (n= 4). Da a a e shown as he mean ± SEM. *p< 0.05, Mann-Whi ney U es and Wilcoxon signed- ank es K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 9 o 15