Increase of aerobic glycolysis mediated by activated T helper cells drives synovial fibroblasts towards an inflammatory phenotype: new targets for therapy?
Abstract
Grant from Pfizer Pharma GmbH (LOT) and Open Access funding enabled and organized by Projekt DEAL.
Full text
RESEARCH ARTICLE Open Access
Inc ease o ae obic glycolysis media ed by
ac i a ed T helpe cells d i es syno ial
ib oblas s owa ds an in lamma o y
pheno ype: new a ge s o he apy?
Pe e K acskay
1
, Nina Yao
1
, Jü gen-Heinz Schno z
1
, Robe a Sca pone
1
, Rui de Albuque que Ca alho
2,3
,
Ka el D. Klika
4
, Wol gang Me k
1
, The esa T e e
1
, Hanns-Ma in Lo enz
1
and La s-Oli e Tykocinski
1*
Abs ac
Backg ound: A dys egula ed glucose me abolism in syno ial ib oblas s (SF) has been associa ed wi h hei
agg essi e pheno ype in heuma oid a h i is (RA). E en hough T helpe (Th) cells a e key e ec o cells in he
p opaga ion and exace ba ion o syno i is in RA, li le is known abou hei in luence on he me abolism o SF.
Thus, his s udy in es iga es he e ec o Th cells on he glucose me abolism and pheno ype o SF and how his is
in luenced by he blockade o cy okines, janus kinases (JAKs) and glycolysis.
Me hods: SF om pa ien s wi h RA o os eoa h i is (OA) we e cul u ed in he p esence o a s able glucose
iso opome ([U-
13
C]-glucose) and s imula ed wi h he condi ioned media o ac i a ed Th cells (ThCM). Glucose
consump ion and lac a e p oduc ion we e measu ed by p o on nuclea magne ic esonance (
1
H NMR)
spec oscopy. Cy okine sec e ion was quan i ied by ELISA. The exp ession o glycoly ic enzymes was analysed by
PCR, wes e n blo and immuno luo escence. JAKs we e blocked using ei he ba ici inib o o aci inib and glycolysis
by using ei he 3-b omopy u a e o FX11.
Resul s: Quiescen RASF p oduced signi ican ly highe le els o lac a e, in e leukin (IL)-6 and ma ix
me allop o einase (MMP) 3 han OASF. S imula ion by ThCM clea ly changed he me abolic p o ile o bo h RASF
and OASF by inducing a shi owa ds ae obic glycolysis wi h s ongly inc eased lac a e p oduc ion oge he wi h a
ise in IL-6 and MMP3 sec e ion. In e es ingly, ch onic s imula ion o OASF by ThCM igge ed an in lamma o y
pheno ype wi h signi ican ly inc eased glycoly ic ac i i y compa ed o uns imula ed, singly s imula ed o e-
s imula ed OASF. Finally, in con as o cy okine-neu alizing biologics, inhibi ion o JAKs o glycoly ic enzymes bo h
signi ican ly educed lac a e p oduc ion and cy okine sec e ion by Th cell-s imula ed SF.
(Con inued on nex page)
© The Au ho (s). 2021 Open Access This a icle is licensed unde a C ea i e Commons A ibu ion 4.0 In e na ional License,
which pe mi s use, sha ing, adap a ion, dis ibu ion and ep oduc ion in any medium o o ma , as long as you gi e
app op ia e c edi o he o iginal au ho (s) and he sou ce, p o ide a link o he C ea i e Commons licence, and indica e i
changes we e made. The images o o he hi d pa y ma e ial in his a icle a e included in he a icle's C ea i e Commons
licence, unless indica ed o he wise in a c edi line o he ma e ial. I ma e ial is no included in he a icle's C ea i e Commons
licence and you in ended use is no pe mi ed by s a u o y egula ion o exceeds he pe mi ed use, you will need o ob ain
pe mission di ec ly om he copy igh holde . To iew a copy o his licence, isi h p://c ea i ecommons.o g/licenses/by/4.0/.
The C ea i e Commons Public Domain Dedica ion wai e (h p://c ea i ecommons.o g/publicdomain/ze o/1.0/) applies o he
da a made a ailable in his a icle, unless o he wise s a ed in a c edi line o he da a.
* Co espondence: [email p o ec ed]
1
Depa men o Medicine V, Di ision o Rheuma ology, Uni e si y o
Heidelbe g, INF 410, 69120 Heidelbe g, Ge many
Full lis o au ho in o ma ion is a ailable a he end o he a icle
K acskay e al. A h i is Resea ch & The apy (2021) 23:56
h ps://doi.o g/10.1186/s13075-021-02437-7
(Con inued om p e ious page)
Conclusions: Soluble media o s eleased by Th cells d i e SF owa ds a glycoly ic and p o-in lamma o y pheno ype.
Ta ge ing o JAKs o glycoly ic enzymes bo h po en ly modula e SF’s glucose me abolism and dec ease he elease
o IL-6 and MMP3. Thus, manipula ion o glycoly ic pa hways could ep esen a new he apeu ic s a egy o
dec ease he p o-in lamma o y pheno ype o SF.
Keywo ds: Rheuma oid a h i is, Syno ial ib oblas s, Fib oblas -like syno iocy es, T lymphocy es, T helpe cells,
Me abolism, Glycolysis, Janus kinases, In lamma ion, T ansla ional esea ch
Backg ound
Rheuma oid a h i is (RA) is a sys emic au oimmune dis-
ease cha ac e ized by ch onic in lamma ion, ecu ing
syno i is and des uc ion o he ca ilage and bone [1,2].
The cha ac e is ic ans o ma ion o he syno ial mem-
b ane in o a des uc i e umou -likepannusisaccompan-
ied by a pe sis en in a-a icula in asion o immune cells.
Syno ial ib oblas s (SF), also known as ib oblas -like syno-
iocy es, a e he majo cell ype wi hin he hype plas ic
pannus and he main e ec o cells o join des uc ion. SF
o RA pa ien s (RASF) p esen an agg essi e pheno ype
wi h abno mally inc eased p oli e a ion, sec e ion o p o-
in lamma o y cy okines and issue-in asi e p ope ies [3–
5]. The abe an ib oblas pheno ype and he hypoxic and
nu ien -dep i ed mic o-en i onmen o he pannus a e
cha ac e is ics which a e also ound in solid umou s. Fo
umou cells, i is well known ha hey adap hei glucose
me abolism o mee he inc eased bioene ge ic and biosyn-
he ic demands in a umou mic o-en i onmen [6,7].
Al eady in 1924, Wa bu g showed ha malignan cells p o-
duce signi ican ly highe amoun s o lac a e han no mal
cells unde no moxic condi ions [8,9]. He s a ed ha up-
egula ion o ae obic glycolysis allowed malignan cells o
su i e he hypoxic condi ions p e ailing in highly p oli e -
a i e umou issues.
The e is g owing e idence la ely ha his well-desc ibed
Wa bu ge ec ,i.e. heme abolic swi ch om oxida i e
phospho yla ion owa ds glycolysis, is also a cha ac e is ic
ea u e o in lamed join s o RA pa ien s [10,11]. Se e al
s udies ha e demons a ed ha lac a e le els we e signi i-
can ly inc eased while glucose le els we e dec eased in syn-
o ial luid o in syno ial issue o RA pa ien s compa ed o
hose o os eoa h i is (OA) pa ien s o heal hy indi iduals
[12–15]. In he se um o RA pa ien s, an inc ease o bo h
glucose and lac a e le els has been desc ibed [16]. Using
luo odeoxyglucose-posi on emission omog aphy, he in-
c eased glucose up ake by cells o he pannus was able o be
imaged, sugges ing an enhanced glycoly ic ac i i y o RASF
and in ading immune cells [17,18]. Mo eo e , a signi ican
co ela ion be ween mi ochond ial dys unc ion, enhanced
ae obic glycolysis and he in lamma o y, des uc i e p ope -
ies o RASF has been desc ibed [19–23].
Al hough a dys egula ed glucose me abolism in RASF
has been sugges ed o play a c i ical ole in he
pa hogenesis o RA, e y li le is known abou he im-
pac o ac i a ed immune cells on he egula ion o he
glucose me abolism o SF. The associa ion o RA, espe-
cially in he mos e osi e o m, wi h speci ic HLA-DR al-
leles p o ides s ong e idence o a key ole o T helpe
(Th) cells in RA pa hogenesis and disease se e i y. T
lymphocy es in il a e he join s o RA pa ien s and con-
s i u e abou 30–50% o all cell ypes in he sub-lining
egion o syno ial issues. In his way, T cells and SF a e
in close con ac and s imula e each o he by di ec cell-
cell con ac o by he elease o soluble ac o s [24]. The
in e ac ion be ween Th17 cells and SF has been de-
sc ibed as a key mechanism o he de elopmen o syn-
o ial issue in lamma ion [25]. In e ac ion and ecip ocal
ac i a ion o Th cells and RASF ha e ecen ly been
shown o induce and ampli y in lamma o y esponses
and o esul in a me abolic shi owa ds glycolysis in
SF o mee he inc eased me abolic demand [26]. On he
o he hand, in e ac ion wi h Th cells induces immuno-
supp essi e unc ions o SF, a capaci y ha has been
shown o be educed in RASF compa ed o OASF [27,
28]. Al oge he , c oss- alk wi h Th cells clea ly a ec s
SF’s pheno ype and unc ion.
In his s udy, we in es iga ed he impac o Th cells on
he glucose me abolism and pheno ype o SF. Fu he ,
we compa ed he e ec o ch onic s imula ion wi h sin-
gle s imula ion and e-s imula ion by Th cells on SF. Fi-
nally, we analysed he po ency o cy okine-neu alizing
biologics and janus kinase inhibi o s (JAKi), used in he
ea men o in lamma o y heuma ic diseases like RA,
as well as o inhibi o s a ge ing glycoly ic enzymes in
limi ing he T cell-media ed induc ion o a glycoly ic
and in lamma o y pheno ype in SF. OASF ha e been de-
sc ibed o di e om RASF in many ways, e.g. OASF
a e less esis an o apop osis, ha e a di e en epigene ic
signa u e and do no possess an in insically ac i a ed,
agg essi e and in asi e pheno ype like RASF [29–31]. In
he p esen s udy, OASF we e used as a degene a i e
disease con ol o RASF.
Me hods
Cell isola ion and cul u e
SF om pa ien s wi h ei he OA o RA we e isola ed
om syno ial issues collec ed du ing diagnos ic
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 2 o 15
a h oscopy o he apeu ic join su ge y as desc ibed p e-
iously [28]. CD4
+
Th cells we e isola ed om hepa inized
enous blood o RA pa ien s o no mal heal hy dono s
(NHD) by densi y g adien cen i uga ion and sepa a ion
using he MojoSo human CD4 T cell isola ion ki (Bio-
Legend) acco ding o he manu ac u e ’sins uc ions
(pu i y ≥98%). All RA pa ien s ul illed he Ame ican Col-
lege o Rheuma ology/Eu opean League Agains Rheuma-
ism c i e ia o he classi ica ion o RA [32].
SF we e cul u ed in DMEM-F12 medium (Me ck) sup-
plied wi h 10% hea -inac i a ed oe al cal se um
(The mo Fishe Scien i ic). Passages 4–10 we e used o
expe imen s. Th cells we e s imula ed wi h an i-CD3
and an i-CD28 (bo h 1 μg/ml, The mo Fishe Scien i ic)
in glucose- ee RPMI-1640 medium (Biological Indus-
ies) supplemen ed wi h 10% oe al cal se um and he
s able glucose iso ope ace [U-
13
C]-glucose (2 g/l,
T ace ec). Th cell-condi ioned media (ThCM) we e
collec ed on day 4. Fo mos expe imen s, SF we e s im-
ula ed wi h ThCM dilu ed 1:5 in RPMI-1640 medium.
Hypoxic cul u e condi ions we e main ained using a
glo e box (Coylab) and an incuba o (He acell 150i,
The mo Fishe Scien i ic) wi h oxygen le el con ol. In
some expe imen s, SF we e s imula ed wi h di e en
concen a ions o ecombinan human in e leukin (IL)-
1β, IL-17A (bo h BioLegend), in e e on (IFN)γ(R&D
Sys ems) o umou nec osis ac o (TNF)α(Pep o ech).
Cy okines o cy okine ecep o s we e neu alized using
canakinumab (No a is), e ane cep (P ize ), secukinu-
mab (No a is) o ocilizumab (Roche). Janus kinases
(JAKs) we e a ge ed by ba ici inib (Ta ge Mol) o o a-
ci inib (P ize ). Hexokinase (HK) 2 was inhibi ed by 3-
b omopy u a e (3-B Pa) (Gen au ) and lac a e dehyd o-
genase (LDH)-A by FX11 (Me ck).
Cell su i al was de e mined by Annexin V and p opi-
dium iodide s aining and measu ed by low cy ome y
using a BD FACSCan o II analyse (BD Biosciences).
S au ospo in- ea ed cells (2 μM, 24 h) se ed as a posi-
i e con ol.
Analysis o lac a e and glucose le els by
1
H NMR
spec oscopy
SF we e cul u ed in he p esence o [U-
13
C]-glucose ei-
he wi h o wi hou s imula ion by ThCM. Cul u e su-
pe na an s we e ha es ed on day 4 and analysed using a
B uke A ance II spec ome e equipped wi h a 5-mm
indi ec de ec ion p obe (B uke BioSpin) ope a ing a
600 MHz o
1
H. The
1
H NMR spec a wi h wa e sup-
p ession using p esa u a ion we e acqui ed wi h 43k
poin s de ining a spec al wid h o 7.2 kHz using a 30°
adio equency pulse and a o al epe i ion ime o 10 s
o ensu e ull elaxa ion o he
1
H nuclei. Spec al ana-
lyses we e pe o med using NUTSp o™NMR so wa e
(Aco n NMR Inc.). Each ee induc ion decay was
mul iplied by a decaying exponen ial wi h a decay con-
s an o 0.2 Hz p io o Fou ie ans o ma ion. Fo
quan i ica ion, sodium uma a e (10 mM) dissol ed in a
0.2-M phospha e bu e solu ion p epa ed wi h D
2
O
(99.9%) was used as an in e nal s anda d.
Quan i ica ion o cy okine sec e ion
The concen a ions o IL-6, IL-8 and ma ix me allop o-
einase (MMP) 3 in cul u e supe na an s we e quan i ied
by enzyme-linked immunoso ben assay (ELISA) using
he Duo Se ELISA ki s (R&D Sys ems) o all cy okines
acco ding o he manu ac u e ’s ins uc ions. Cy okines in
he ThCM we e quan i ied using he LEGENDplex Hu-
man Th Cy okine Panel 12-plex assay ki (BioLegend).
In i o sc a ch mig a ion assay
To assess he mig a ion o SF in he p esence o absence
o s imula ion by soluble media o s eleased by ac i a ed
Th cells o ecombinan human TNFα, IL-17A o IFNγ
(10 ng/ml each, all Pep oTech), we pe o med an in i o
sc a ch assay as desc ibed [33].
RNA isola ion, cDNA ansc ip ion and quan i a i e RT-
PCR
The High Pu e RNA isola ion ki (Roche) was used o
isola e o al RNA. To al RNA was e e se ansc ibed
in o cDNA wi h he Quan iTec e e se ansc ip ion ki
(Qiagen). RT-PCRs we e pe o med using he Powe Up
SYBR G een mas e mix and a S epOnePlus sys em
(bo h Applied Biosys ems). The ollowing p ime s we e
u ilized: HK2—Fwd-AAGGCTTCAAGGCATCTG, e -
CCACAGGTCATCATAGTTCC; PFKp—Fwd-AGAT
CCATAAGGAGGCCGTG, e -AGAACGAAGGTCCT
CTGGTG; PKM2—Fwd-ATTATTTGAGGAACTCCG
CCGCCT, e -ATTCCGGGTCACAGCAATGATGG;
and LDH-A—Fwd-ACCCAGTTTCCACCATGATT, e -
CCCAAAATGCAAGGAACACT.
Wes e n blo analysis
Isola ion o o al cell ex ac s om SF was pe o med by
lysing cells in RIPA bu e (ccp o) con aining a p o ease
inhibi o cock ail (comple eMini, Boeh inge ) o 20 min
on ice. A e dilu ion in a loading bu e , p o ein samples
we e esol ed using s anda d SDS-PAGE and ans e ed
on o ni ocellulose memb anes. HK2, phospho uc oki-
nase (PFK)p, py u a e kinase M2 (PKM2) and LDH-A
we e de ec ed by co esponding an ibodies (CellSignal-
ing). β-Ac in was used as a loading con ol. Quan i ica-
ion was pe o med by densiome ic analysis using
ImageJ2.
Fluo escence mic oscopy
SF we e le o adhe e on glass co e slips and we e ei-
he s imula ed wi h ThCM o 4 days o le
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 3 o 15
uns imula ed. Cells we e ixed by pa a o maldehyde and
pe meabilized wi h e hanol. Fluo escen an ibody s ain-
ing was pe o med using an ibodies agains HK2
(eBioscience), PKM2 (CellSignaling) and Cy3-labelled
an i- abbi -IgG. Cell nuclei we e s ained wi h 4′,6-dia-
midino-2-phenylindole (DAPI). The analysis was pe -
o med a he Imaging Facili y o he Cen e o
Molecula Biology Heidelbe g (ZMBH) using an Olym-
pus IX81 mic oscope.
S a is ics
Resul s a e p esen ed as he mean ± SEM. The Mann-
Whi ney U es and he Wilcoxon signed- ank es we e
applied o unpai ed and pai ed, espec i ely, sample se s
using G aphPad P ism o s a is ical analysis. Values o p
less han 0.05 we e conside ed s a is ically signi ican .
Resul s
Ac i a ed Th cells elease media o s ha induce a
me abolic shi owa ds ae obic glycolysis in SF
In o de o in es iga e he in luence o Th cells on he
glucose me abolism o bo h OASF and RASF, SF we e
cul u ed in he p esence o a s able glucose iso ope
([U-
13
C]-glucose) ei he unde es ing condi ions o
s imula ed by ThCM. The amoun o [U-13C]-glucose
emaining and he glucose-de i ed [U-
13
C]-lac a e p o-
duced by he SF was measu ed using
1
H NMR spec os-
copy. This me hod allowed us o quan i y he
concen a ion o esidual, non-me abolized glucose in
he cul u e supe na an s as well as he concen a ion o
gene a ed and sec e ed lac a e as he p oduc o glycoly-
sis. By calcula ing he amoun o glucose ha was con-
sumed by SF, bu no me abolized in o lac a e, i was
possible o indi ec ly quan i y he le el o oxida i e glu-
cose me abolism. Figu e 1a shows ep esen a i e
1
H
NMR spec a o cul u e supe na an s om uns imula ed
SF and om SF s imula ed by ThCM. S imula ion wi h
ThCM esul ed in a dec ease o glucose and a clea in-
c ease o lac a e in SF cul u e supe na an s. Compa ing
OASF and RASF unde es ing condi ions, RASF showed
signi ican ly mo e lac a e p oduc ion and a signi ican ly
highe a io o glucose me abolized by ae obic glycolysis
e sus ha me abolized by oxida i e phospho yla ion
han OASF (Fig. 1b). S imula ion by condi ioned cul u e
medium om Th cells o RA pa ien s esul ed in a sig-
ni ican inc ease in lac a e p oduc ion and a signi ican
shi owa ds glycoly ic glucose me abolism by bo h
RASF and OASF (Fig. 1b). Howe e , in con as o es -
ing condi ions, no signi ican di e ence in lac a e p o-
duc ion was de ec ed be ween RASF and OASF unde
s imula ion wi h ThCM, al hough a end owa ds s ill
highe lac a e le els and glycoly ic a es in RASF could
be seen (Fig. 1b). Simila o he s imula ion by RA pa-
ien s’ThCM, s imula ion o OASF and RASF by
condi ioned cul u e medium om Th cells o heal hy
dono s esul ed in a s ong inc ease o lac a e p oduc-
ion by SF (Addi ional ile 1: Fig. S1). Since he e we e
no signi ican de ec able di e ences be ween he induc-
ion o glycolysis in SF by ThCM om he T cells o
heal hy indi iduals o RA pa ien s, all o he expe imen s
in his s udy we e ca ied ou wi h s imula ion o SF by
RA pa ien s’ThCM. As shown in Addi ional ile 2: Fig.
S2, he s imula o y e ec o ThCM on SF’s lac a e p o-
duc ion a es was dose-dependen .
Analysis o he cy okines p esen in he ThCM used o
s imula e he SF e ealed ha IFNγ ep esen ed he
highes con en o all he cy okines es ed (Add-
i ional ile 3: Fig. S3). Addi ionally, TNFα, IL-6, IL-9, IL-
22, IL-5, IL-13 and o a lesse ex en IL-17A and IL-10
we e also de ec ed. Howe e , a 151.07 ± 36.42 ng/ml,
he concen a ion o IFNγwas mo e han 25- old highe
han any o he o he cy okines (Addi ional ile 3: Fig.
S3).
Since hypoxia has been desc ibed as a cha ac e is ic
mic o-en i onmen al ea u e o in lamed join s o RA
pa ien s wi h a mean ambien oxygen ension o only
3.2% O
2
[34], we he e o e nex in es iga ed he in lu-
ence o hypoxic condi ions on he glucose me abolism o
SF. As expec ed, cul u e unde hypoxic condi ions (3%
O
2
) esul ed in an inc eased lac a e p oduc ion by bo h
OASF and RASF. Simila o wha had been obse ed
unde no moxic condi ions, RASF showed signi ican ly
highe lac a e p oduc ion han OASF unde hypoxia in
he absence o u he s imula ion (Addi ional ile 4: Fig.
S4). S imula ion by ThCM unde hypoxic condi ions
equally induced a signi ican and dose-dependen up eg-
ula ion o lac a e p oduc ion in bo h RASF and OASF.
Howe e , a u he shi om oxida i e owa ds glyco-
ly ic glucose me abolism could no be de ec ed in s imu-
la ed e sus un-s imula ed SF unde hypoxia
(Addi ional ile 4: Fig. S4). Toge he , hese esul s dem-
ons a e ha RASF displayed a highe basic a e o gly-
colysis unde es ing condi ions compa ed o OASF; bu
unde s imula ion by Th cells, OASF acqui ed a simila
high glycoly ic ac i i y as RASF. Mo eo e , he da a indi-
ca e ha pa icula ly RASF use glycolysis as a means o
ene gy p oduc ion unde hypoxic condi ions.
Soluble media o s eleased by ac i a ed Th cells induce a
p o-in lamma o y pheno ype in SF
To de e mine whe he ac i a ed Th cells also s imula ed
he de elopmen o a p o-in lamma o y p o ile in SF, we
analysed he sec e ion o IL-6, IL-8 and MMP3 by OASF
and RASF cul u ed unde es ing condi ions o unde
s imula ion by ThCM. In he absence o s imula ion,
RASF showed signi ican ly highe le els o IL-6 and
MMP3 sec e ion compa ed o OASF (Fig. 2a). S imula-
ion wi h ThCM s ongly augmen ed he sec e ion o IL-
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 4 o 15
6, IL-8 and MMP3 in bo h g oups. Cy okines IL-6 and
IL-8 can also be sec e ed by ac i a ed Th cells, howe e
only in much lowe amoun s compa ed o Th cell-
s imula ed SF as epo ed p e iously [27,28] and shown
in Addi ional ile 3: Fig. S3. The ThCM used he e o
s imula e SF only con ained app oxima ely 6 ng/ml IL-6
(6.04 ± 2.95 ng/ml). The e o e, he p opo ion o Th cell-
de i ed IL-6 and IL-8 in he supe na an s o ThCM-
s imula ed SF can be neglec ed.
To in es iga e he impac o s imula ion by Th cells on
he mig a ion o SF, we pe o med an in i o sc a ch
assay. No di e ence in he mig a o y capaci ies could be
de ec ed be ween OASF and RASF unde es ing condi-
ions. In e es ingly, unde s imula ion by ThCM, bo h
RASF and OASF displayed signi ican ly dec eased mig a-
ion a es compa ed o uns imula ed condi ions (Fig. 2b
and Addi ional ile 5: Fig. S5). Simila ly, s imula ion o
SF wi h a combina ion o IFNγ,TNFαand IL-17A also
s ongly educed hei mig a ion. This e ec was less
p onounced when he SF we e s imula ed by indi idual
cy okines alone (Addi ional ile 5: Fig. S5). Thus, media-
o s eleased by ac i a ed Th cells induced a s ong
me abolic shi owa ds glycolysis in SF in andem wi h
an augmen ed sec e ion o in lamma o y media o s and
educed mig a o y p ope ies.
Ch onic s imula ion by Th cells igge s a highly glycoly ic
and in lamma o y pheno ype in OASF
Fib oblas s ha e been desc ibed o play a c i ical ole in
he induc ion o a ch onic pe sis en in lamma ion in
RA, and s imula ion seems o p ime e en SF om non-
in lamed join s o a p o-in lamma o y memo y esponse
[35]. He e, we wan ed o in es iga e whe he a single
s imula ion o a ch onic s imula ion by Th cells p imes
Fig. 1 Th cells induce a me abolic shi owa ds ae obic glycolysis in SF. OASF (n= 12) and RASF (n= 12) we e cul u ed o 4 days in he p esence
o [U-
13
C]-glucose ei he unde es ing condi ions o s imula ed by condi ioned cul u e media o ac i a ed Th cells (ThCM). The amoun o
[U-
13
C]-glucose and [U-
13
C]-lac a e p oduced by he SF was measu ed using
1
H NMR spec oscopy. aRep esen a i e examples o
1
H NMR spec a
o SF s imula ed by ThCM ( ed) and uns imula ed SF (blue). bThe amoun o sec e ed [U-
13
C]-lac a e and he a io o [U-
13
C]-glucose me abolized
by glycolysis (Gly) and hose me abolized by oxida i e phospho yla ion (OXPHOS) was de e mined o SF cul u e supe na an s. Resul s a e
p esen ed as he mean ± SEM. *p< 0.05, **p< 0.01, Mann-Whi ney U es and Wilcoxon signed- ank es . w/o s im, wi hou s imula ion
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 5 o 15
he pheno ype and glucose me abolism o OASF. The e-
o e, OASF we e cul u ed unde ou di e en condi-
ions: The i s g oup was cul u ed wi hou s imula ion
o a o al pe iod o 18 days (uns imula ed). The second
g oup o OASF was s imula ed by ThCM on day 14 o
cul u e (p ima y s imula ion (1s s im)). The hi d g oup
was i s s imula ed be ween days 1 and 4 o cul u e,
hen washed and emained uns imula ed un il a second
s imula ion on day 14 ( e-s imula ion (2nd s im)). And
inally, he ou h g oup was epea edly s imula ed be-
ween days 1 and 12 and e-s imula ed on day 14 by
ThCM (ch onic s imula ion). On day 18, we quan i ied
he concen a ions o lac a e, IL-6 and MMP3 in he cul-
u e supe na an s o all ou g oups. As p esen ed in
Fig. 3, uns imula ed SF showed e y low lac a e p oduc-
ion and nea ly no IL-6 o MMP3 sec e ion. Single
s imula ion on day 14 esul ed in a sha p inc ease o lac-
a e and IL-6 p oduc ion and a mild up egula ion o
MMP3 sec e ion. Rema kably, p e-s imula ion and la e
e-s imula ion o SF did no induce a memo y esponse
wi h highe lac a e, IL-6 o MMP3 p oduc ion compa ed
o he singly s imula ed g oup. Howe e , ch onic s imu-
la ion o he SF esul ed in a signi ican ly inc eased se-
c e ion o lac a e, as well as o IL-6 and MMP3 (Fig. 3).
Hence, a epea ed s imula ion o OASF by Th cells, bu
no a single e-s imula ion, igge ed an agg essi e
pheno ype wi h signi ican ly highe p oduc ion o lac a e
and in lamma o y cy okines compa ed o once only
s imula ed OASF.
S imula ion o SF by Th cells enhance he exp ession o
glycoly ic enzymes
Since RASF displayed inc eased baseline le els o gly-
colysis unde es ing condi ions when compa ed o
OASF and s imula ion by ThCM boos ed he glycoly ic
ac i i y o bo h OASF and RASF, o u he elucida e he
ole o glycoly ic key egula o s in he enhanced glyco-
ly ic ac i i y o RASF and he shi in glucose me abol-
ism owa ds glycolysis upon s imula ion by Th cells, we
quan i ied he exp ession o HKII, PFKp, PKM2 and
Fig. 2 Media o s eleased by Th cells induce p o-in lamma o y cy okine exp ession by SF bu diminish hei mig a ion. Sec e ion o p o-
in lamma o y cy okines co ela es wi h enhanced glycoly ic ac i i y in SF. OASF and RASF we e cul u ed in he p esence o absence o ThCM. a
A e 4 days, he concen a ion o in e leukin (IL)-6, IL-8, and ma ix me allop o ease (MMP)3 wi hin he cul u e supe na an s was quan i ied by
ELISA (n= 10). bAn in i o sc a ch assay was pe o med o in es iga e he cell mig a ion o SF cul u ed wi h o wi hou ThCM (n= 6). Da a a e
p esen ed as he mean ± SEM. *p< 0.05, **p< 0.01, Mann-Whi ney U es and Wilcoxon signed- ank es
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 6 o 15
LDH-A in OASF and RASF unde es ing condi ions
and unde s imula ion by ThCM. E en hough he e was
mo e ae obic glycolysis in es ing RASF han in OASF,
we did no ind any di e ences in he mRNA and p o-
ein exp ession o he analysed glycoly ic enzymes be-
ween es ing OASF and RASF (Fig. 4a, b). S imula ion
wi h ThCM esul ed in a signi ican inc ease in he ex-
p ession o HK2 mRNA by bo h RASF and OASF com-
pa ed o uns imula ed condi ions. Fo PFKp, PKM2 and
LDH-A, a endency owa ds highe mRNA exp ession
upon s imula ion by ThCM could be obse ed (Fig. 4a).
Compa able esul s we e ob ained on he p o ein le el
by wes e n blo and immuno luo escence analysis (Fig. 4b
and Addi ional ile 6Fig. S6).
Ta ge ing pa icula cy okines by biologics is no
su icien o educe he Th cell-s imula ed glycolysis in SF
Ou da a p esen ed abo e showed ha bo h he p oduc-
ion o p o-in lamma o y cy okines and a me abolic shi
owa ds ae obic glycolysis we e induced in SF by ThCM
by soluble ac o s in a cell con ac -independen way. We
nex in es iga ed whe he cy okines known o play key
oles in he pa hogenesis o RA and o ha e he capaci y
o ac i a e SF, namely TNFα, IL-1βand IL-17A, and
IFNγ, which we ound in highes concen a ions in
ThCM, a e known o play a ole in he pa hogenesis o
RA o o he heuma ic diseases, alone o in combin-
a ion, a e able o induce he p oduc ion o lac a e by SF.
The e o e, OASF and RASF we e incuba ed wi h di e -
en concen a ions o ecombinan TNFα,IL-1β, IL-17A
and IFNγ, ei he indi idually o wi h all ou cy okines.
On day 4, he lac a e p oduc ion by he s imula ed SF
was quan i ied. As p esen ed in Fig. 5a, all indi idual cy-
okines induced a end owa ds an enhanced lac a e
p oduc ion by bo h OASF and RASF, a leas a he
highes concen a ions es ed. Howe e , only IL1-βhad
a signi ican and dose-dependen glycolysis-p omo ing
e ec on OASF and RASF. In addi ion, simul aneous
s imula ion by all ou cy okines oge he e ealed a syn-
e gis ic e ec esul ing in a highe inc ease in lac a e
Fig. 3 Ch onic s imula ion by Th cells igge s a glycoly ic and p o-
in lamma o y pheno ype in OASF. OASF we e cul u ed o a o al
pe iod o 18 days unde ou di e en condi ions: The i s g oup
was cul u ed wi hou s imula ion (w/o s im). The second g oup was
s imula ed on d14 o cul u e (1s s im). The hi d g oup was i s
s imula ed be ween d1 and d4, hen emained uns imula ed un il a
second s imula ion on d14 (2nd s im). The ou h g oup was
epea edly s imula ed be ween d1 and d12 and e-s imula ed on
d14 (ch onic s im). On d18, he concen a ions o lac a e, IL-6 and
MMP3 we e quan i ied o all ou g oups (n= 7). Resul s a e
p esen ed as he mean ± SEM. S a is ical signi icances be ween he
ch onically s imula ed g oup and he uns imula ed, he singly
s imula ed and he e-s imula ed g oup a e shown. *p< 0.05,
Wilcoxon signed- ank es
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 7 o 15
p oduc ion by bo h OASF and RASF han he one ob-
se ed wi h he indi idual cy okines (Fig. 5a).
Neu alizing cy okines o cy okine ecep o s by spe-
ci ic an ibodies ha e p o en o be g ea ly e ec i e in he
ea men o heuma ic diseases. In o de o de e mine
whe he such biologics could ab oga e he up egula ion
o ae obic glycolysis in Th cell-s imula ed SF, OASF
we e incuba ed wi h ThCM in he p esence o di e en
concen a ions o e ane cep (an i-TNFα), ocilizumab
(an i-IL-6- ecep o ), secukinumab (an i-IL-17A) o cana-
kinumab (an i-IL-1β), and he p oduc ion o lac a e was
analysed on day 4. As depic ed in Fig. 5b, none o he bi-
ologics caused a signi ican educ ion in lac a e p oduc-
ion by OASF s imula ed wi h ThCM. Thus, p o-
in lamma o y cy okines, especially IL-1β, can induce ae -
obic glycolysis in SF. Howe e , a ge ing only one cy o-
kine o cy okine ecep o by he biologics was no
su icien o signi ican ly a ec he Th cell-media ed
me abolic swi ch in SF.
Inhibi ion o JAKs as well as glycoly ic enzymes bo h
e icien ly block he Th cell-media ed swi ch owa ds a
glycoly ic and in lamma o y pheno ype in SF
Since he biologics a ge ing single cy okines we e ine i-
cien in lowe ing he s imula o y e ec o ThCM on SF’s
glycoly ic me abolism, we nex es ed whe he blocking
in acellula cy okine signalling h ough he JAK pa h-
way could mo e e icien ly block Th cell-media ed SF
Fig. 4 S imula ion o SF by Th cells esul s in an enhanced exp ession o glycoly ic enzymes. OASF and RASF we e cul u ed unde es ing
condi ions o unde s imula ion by ThCM and cells we e ha es ed on d4. aThe mRNA exp ession o HK2, LDH-A, PKM2 and PFKp we e
de e mined by RT-PCR. Each ba indica es he mRNA exp ession o he co esponding gene as 2
−del aCT
using β-ac in mRNA exp ession as
e e ence (n= 6). bP o ein le els o HK2, LDH-A, PKM2 and PFKp we e quan i ied by wes e n blo . β-Ac in was used as a loading con ol. The
depic ions a e ep esen a i e examples om one o h ee independen expe imen s. HK2, hexokinase 2; LDH-A, lac a e dehyd ogenase A; PKM2,
py u a e kinase M2; PFKp, phospho uc okinase p. Da a a e p esen ed as he mean ± SEM. *p< 0.05, Mann-Whi ney U es and Wilcoxon
signed- ank es
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 8 o 15
ac i a ion. Mos o he cy okines which we de ec ed in
ThCM a e known o induce cy okine ecep o signalling
ia he JAK-STAT pa hway, and s imula ion by soluble
media o s eleased by ac i a ed Th cells s ongly induced
phospho yla ion o STAT in OASF and RASF [28]. Fo
his eason, SF we e s imula ed wi h ThCM in he p es-
ence o absence o he JAKi ba ici inib o o aci inib. Re-
ma kably, bo h ba ici inib and o aci inib signi ican ly
diminished he p oduc ion o lac a e by SF s imula ed by
ThCM in a dose-dependen manne (Fig. 6a). Addi ion-
ally, ba ici inib signi ican ly ab oga ed he shi om oxi-
da i e o glycoly ic glucose me abolism in SF.
Impo an ly, in pa allel o hei e ec on he glycoly ic
a e, bo h JAKi signi ican ly educed he sec e ion o IL-
6 by Th cell-s imula ed SF (Fig. 6b). Sec e ion o MMP3
was less a ec ed by JAKi, hough ba ici inib signi ican ly
educed MMP3 exp ession by SF a he highes concen-
a ion es ed (500 nM) (Fig. 6b).
Fig. 5 E ec s o s imula ion wi h cy okines and blocking o cy okines on he glucose me abolism o SF. aOASF and RASF we e s imula ed wi h
di e en concen a ions o IL-1β, IL-17A, TNFαand IFNγ, ei he indi idually o wi h all ou cy okines. A e 4 days o cul u e, he supe na an s
we e ha es ed, and lac a e concen a ions we e measu ed by
1
H NMR spec oscopy (n= 6). bOASF we e cul u ed unde es ing condi ions o
wi h s imula ion by ThCM in he p esence o absence o an i-TNFα(e ane cep ), an i-IL-6 ecep o ( ocilizumab), an i-IL-17A (secukinumab) and
an i-IL-1β(canakinumab) a he h ee gi en concen a ions. Lac a e concen a ions we e quan i ied on d4 (n= 4). Da a a e shown as he mean ±
SEM. *p< 0.05, Mann-Whi ney U es and Wilcoxon signed- ank es
K acskay e al. A h i is Resea ch & The apy (2021) 23:56 Page 9 o 15