Full text
Fungal Gene ics and Biology 42 (2005) 319–327
www.else ie .com/loca e/y gbi
1087-1845/$ - see on ma e 2005 Else ie Inc. All igh s ese ed.
doi:10.1016/j. gb.2005.01.001
Iden iWca ion, cloning, and unc ional exp ession o h ee glu a hione
ans e ase genes om Aspe gillus umiga us
Clai e Bu ns1, Rachel Ge agh y1, Clai e Ne ille, Alan Mu phy,
Ke in Ka anagh, Sean Doyle¤
Na ional Ins i u e o Cellula Bio echnology, Depa men o Biology, Na ional Uni e si y o I eland, Maynoo h, Co. Kilda e, I eland
Recei ed 13 Oc obe 2004; accep ed 3 Janua y 2005
Abs ac
Analysis o he genome o he human pa hogen, Aspe gillus umiga us, e ealed he p esence o se e al pu a i e glu a hione ans-
e ase (GST) open eading ames. Th ee A. umiga us GST genes, e med gs A, B, and C, we e cloned and ecombinan p o eins
exp essed in Esche ichia coli. Func ional analysis o ecombinan gs A–C conW ms ha he enzymes exhibi GST ac i i y and glu a-
hione pe oxidase ac i i y. RT-PCR conW med low basal exp ession o gs A and gs C which was ma kedly up- egula ed (a leas 4£–
10£) in he p esence o ei he H2O2 o 1-chlo o-2,4-dini obenzene (CDNB). Gs B exp ession was only obse ed in he p esence o
CDNB. These esul s demons a e o he W s ime he exis ence o h ee unc ional GSTs in A. umiga us and s ongly sugges a ole
o hese enzymes in he esponse o he o ganism o bo h oxida i e s ess and xenobio ic p esence.
2005 Else ie Inc. All igh s ese ed.
Keywo ds: GST; MALDI-TOF; Xenobio ic esis ance; Oxida i e s ess; Fungal
1. In oduc ion
Aspe gillus umiga us is a human pa hogenic ungus
capable o inducing a ange o disease s a es in pa ien s
wi h p e-exis ing lung damage o immunosupp ession
ollowing o gan ansplan a ion (Daly and Ka anagh,
2001). Th ee o ms o aspe gillosis a e ecognised clini-
cally: sap ophy ic, alle gic, and in asi e, wi h he la e
o m ha ing a mo ali y a e o >90% in some pa ien
g oups (Denning, 1998). Con en ional he apy elies
upon he use o ampho e icin B and, mo e ecen ly, on
no el azole de i a i es and he echinocandin class o
an i- ungal agen s, bu mo ali y a es emain high. A.
umiga us displays he abili y o wi hs and a ack by
mac ophages and neu ophils and de elop in a po en-
ially hos ile en i onmen . Toxin-media ed inhibi ion o
oxida i e bu s in al eola mac ophages and polymo -
phonuclea leukocy es by conidia and hyphae is well
cha ac e ised (Be ou e al., 2002; Mi chell e al., 1997;
Mu yama e al., 1996). In addi ion, he physical size o
de eloping hyphae p e en phagocy osis by al eola
mac ophages and he e is eme ging e idence ha
A. umiga us may be able o ole a e en y o xenobio ics
as a esul o ampho e icin B ea men c ea ing
ape u es in he ungal cell memb ane (Ellis, 2002).
Glu a hione ans e ases (GST; EC 2.5.1.18) a e
dime ic phase II de oxiWca ion enzymes wi h he abili y o
conjuga e a b oad ange o po en ially ha m ul xenobio -
ics o glu a hione (GSH), he eby ende ing hem mo e
suscep ible o emo al om he cell. GSTs ha e also been
shown o exhibi GSH-dependen pe oxidase ac i i y and
hus may be in ol ed in esis ance o oxida i e s ess.
Cy osolic GSTs ha e been iden iWed in almos all o gan-
isms, wi h mammalian GSTs he mos clea ly cha ac e -
ised. These enzymes ha e been implica ed in pes icide
esis ance in plan s and insec s (Sheehan e al., 2001), and
¤Co esponding au ho . Fax: +353 1 7083845.
E-mail add ess: sean.doy[email p o ec ed] (S. Doyle).
1These au ho s con ibu ed equally o his wo k.
320 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327
some GST polymo phisms a e hough o al e cance
suscep ibili y in mammals (Hayes and Pul o d, 1995).
GSTs a e di ided in o se e al classes based upon sub-
s a e speciWci y, sequence simila i y (pa icula ly in he
N- e minal egion which is in ol ed in GSH binding),
immunological c oss- eac i i y and, whe e a ailable,
s uc u e simila i y. GST classes include , , , , , , ,
and classes, wi h insec speciWc ( and ⑀), plan speciWc
( and ) and bac e ial () classes also desc ibed (Sheehan
e al., 2001). In addi ion, i is likely ha many mo e classes
ha e been al eady cha ac e ised exis in he b oad ang-
ing GST ca ego y; o example, new p o ozoan and un-
gal GST classes ha e been p oposed (Cha e al., 2001;
Takada e al., 2004).
Un il ecen ly, ela i ely li le was known abou he
p esence and ole o GST in ungi, howe e i is now clea
ha GST iso o ms exis in a numbe o ungal species
including Schizosaccha omyces pombe, Aspe gillus nidu-
lans, Saccha omyces ce e isiae, Issa chenkia o ien alis,
Ya owia lipoly ica, Cunninghamella elegans, Muco ci ci-
nelloides, and Phane ochae e ch ysospo ium (Cha e al.,
2001; Choi e al., 1998, 2002; Dowd e al., 1997; Dowd and
Sheehan, 1999; Foley and Sheehan, 1998; F ase e al.,
2002; Kim e al., 2001; Tamaki e al., 1999; Shin e al.,
2002; Veal e al., 2002). Fungal GSTs exhibi diVe en ial
exp ession pa e ns, wi h some iso o ms shown o be
exp essed inducibly in he p esence o xenobio ics o oxi-
da i e s ess. Fo example, o wo GSTs iden iWed in I. o i-
en alis, only one was cons i u i ely exp essed, and bo h
we e induced in he p esence o o-dini obenzene (o-DNB)
(Choi e al., 1998). Th ee GSTs in S. pombe we e induced
by oxida i e s ess, and mu an s lacking gs 1+ and gs 2+
o gs 3+ we e mo e sensi i e o he p esence o he an i-
ungal d ug Xuconazole, he eby indica ing a ole o GST
in media ing an i- ungal d ug ole ance (Cho e al., 2002;
Kim e al., 2001; Shin e al., 2001; Veal e al., 2002).
The iden iWca ion o a unc ional he a class GST
(gene: gs A) in A. nidulans has u he elucida ed he ole
o GST in ungal me abolism. Gs A appea s o be up-
egula ed by he p esence o ei he 1-chlo o-2,4-dini o-
benzene (CDNB)2 o H2O2 in he cul u e medium and
may also play a ole in media ing hea y me al esis ance
in A. nidulans (F ase e al., 2002).
Gi en he signiWcance o A. umiga us as a human
pa hogen and he limi ed success o an i- ungal agen s o
ea aspe gillosis, pa icula ly in immunocomp omised
pa ien s, i is su p ising ha he pu a i e p esence and
ole o GST has me i ed li le a en ion. In addi ion, he
po en ial ole o ungal GST in allowing A. umiga us o
wi hs and neu ophil a ack may ep esen a key elemen
in he cell’s abili y o su i e in he hos and colonise
pulmona y issue. He e we desc ibe he iden iWca ion,
cloning, he e ologous exp ession and cha ac e isa ion o
h ee GST genes om A. umiga us. We also in es iga e
he esponse o GST gene exp ession ollowing exposu e
o A. umiga us o bo h CDNB and H2O2.
2. Expe imen al
2.1. Genomic DNA isola ion
Aspe gillus umiga us ATCC 26933 (ob ained om
he Ame ican Type Cul u e Collec ion, Ma yland, USA)
was used in his s udy. Aspe gillus cul u es we e g own in
5%( / ) e al cal se um in minimal essen ial medium
Eagle (MEM) (Sigma–Ald ich, Do se , UK) o 2 days
a 37 °C. Genomic DNA was isola ed as desc ibed by
Nicholson e al. (2001). B ieXy, ca. 4 g A. umiga us
mycelia we e c ushed in liquid N2 and suspended in
10 ml ex ac ion buVe (10mM T is–HCl, 10 mM
EDTA, 0.5% (w/ ) SDS pH 8.0). Phenol:chlo o o m:iso-
amyl alcohol (25:24:1, 10ml) was added o he mycelial
suspension and mixed gen ly o 30 min. Phases we e
sepa a ed by cen i uga ion a 5000g a 4°C. The aque-
ous laye was emo ed a esh ube and phenol ex ac-
ion epea ed un il he in e ace was clea . The Wnal
aqueous laye was ea ed wi h chlo o o m:isoamyl alco-
hol (24:1) and phases sepa a ed as be o e. The emaining
aqueous laye was ea ed wi h ibonuclease A (20 l;
10 mg ml¡1) a 37°C o 30 min, ollowed by phenol
ex ac ion, hen chlo o o m ex ac ion. The DNA was
p ecipi a ed om he aqueous laye wi h 2 olumes o
100% e hanol and 1/10 olume o LiCl (4 M) a ¡20 °C
o e nigh . DNA was eco e ed by cen i uga ion a
13,000g o 10 min. The pelle was washed wi h 70%( / )
e hanol, ai -d ied, and esuspended in 1 ml TE buVe
(10mM T is–HCl, 1mM EDTA, pH 8.0).
2.2. DNA sequence and bioin o ma ic analysis
All DNA sequence analysis was pe o med using a
Pe kin-Elme ABI P ism 310 gene ic analyse , comme -
cially by MWG Bio ech (Mil on Keynes, UK) o La k
Technologies (Essex, UK) and sequence simila i ies we e
de e mined using he BLAST algo i hm (www.ncbi.nlm.
nih.go /blas /bl2seq/bl2.h ml). Sequence alignmen s and
neighbo -joined phylogene ic ees we e gene a ed using
Clus alW (Thompson e al., 1994; h p://www.ebi.ac.uk/
clus alw). A boo s apping alue o 1000 was used, wi h
boo s apping pe cen ages no ed a ee b anch poin s.
T ees we e isualised in T ee iew (Page, 1996; h p://
axonomy.zoology.gla.ac.uk/ od/ od.h ml). P elimina y
sequence da a was also ob ained om The Ins i u e o
Genomic Resea ch websi e a h p://www. ig .o g.
Sequencing o A. umiga us genome is nea comple ion
wi h suppo om he Wellcome T us and NIH.
2Abb e ia ions used: CDNB, 1-chlo o-2,4-dini obenzene; DCNB,
1,2-dichlo o-4-ni obenzene; GST, glu a hione ans e ase; GSH, glu a-
hione; MALDI-TOF, ma ix assis ed lase deso p ion ionisa ion- ime
o Xigh ; MEM, minimal essen ial medium Eagle; CALM, calmodulin.
C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 321
2.3. PCR ampliWca ion
All PCR eagen s we e ob ained om Sigma–Ald ich.
PCR was pe o med using AccuTaq polyme ase wi h 1–
10 ng genomic DNA as empla e and 1.0 M each o o -
wa d and e e se p ime (Table 1) in a o al olume o
50 l. PCR condi ions we e as ollows: 95 °C dena u -
a ion o 5 min; (94°C dena u a ion o 30 s, 55 °C
annealing o 90 s, 72 °C ex ension o 60 s) £35 cycles;
68 °C ex ension o 7 min. Op imal cDNA ampliWca ion
was ound o equi e 45 cycles o PCR. PCR-ampliWed
DNA was elec opho esed on 1% (w/ ) aga ose con ain-
ing 0.5gml
¡1 o e hidium b omide o 30 min a 100 V.
Visualisa ion o amplicons was pe o med using an
‘Eagle-Eye II’ digi al s ill ideo sys em (S a agene, CA,
USA).
2.4. Cloning and exp ession o gs A, B, and C
The gs A sequence was ampliWed om cDNA and
he gs B/gs C sequences we e ampliWed om A. umiga-
us DNA, using p ime s inco po a ing e minal EcoRI
and Ps I si es o acili a e downs eam cloning
(Table 1). PCR p oduc s we e cloned in o he pCR2.1
cloning ec o (In i ogen, Ca lsbad, CA, USA) acco d-
ing o he manu ac u e ’s ins uc ions. gs A, gs B, and
gs C we e subsequen ly cloned in o he pP oEX-H a
exp ession ec o (In i ogen), which acili a es (His)6
aYni y ag in oduc ion, u ilising he enginee ed es ic-
ion si es. Liga ions we e pe o med using Quicks ick
ligase (Bioline, London, UK) acco ding o he manu ac-
u e ’s ins uc ions. pPXAgs A, pPXAgs B, and pPX-
Ags C, he esul an exp ession ec o s con aining gs A,
gs B, and gs C, espec i ely, we e indi idually ans-
o med in o E. coli s ain DH5 by elec opo a ion
acco ding o Dowe e al. (1988). Exp ession o all h ee
ecombinan GST p o eins was induced by he addi ion
o 0.6 mM isop opyl -D- hiogalac oside (IPTG) and
moni o ed by SDS–PAGE and Wes e n blo analysis.
Fo enzyme pu iWca ion, induced cells we e lysed by
incuba ion wi h lysozyme (90 gml
¡1) and sodium
deoxychola e (0.04% (w/ )), in he p esence o p o e-
ase inhibi o s (1 gml
¡1 leupep in and peps a in,
espec i ely, and 1 mM PMSF). Cell deb is was
emo ed by cen i uga ion a 10,000g o 10 min and N-
e minal (His)6- agged ecombinan p o eins we e pu i-
Wed om he supe na an by Ni–NTA ch oma og aphy
(Qiagen, Wes Sussex, UK) by elu ion wi h 250 mM
imidazole in 50mM sodium phospha e/300 mM NaCl.
Pu iWed GST p o eins we e dialysed ( wice; once o e -
nigh , and once o 4 h) agains phospha e-buVe ed
saline (PBS) con aining 0.02% (w/ ) sodium azide o
s o age a 4 °C. P o ein concen a ions we e de e mined
using he B ad o d me hod (B ad o d, 1976) wi h
bo ine se um albumin as a s anda d.
2.5. MALDI-TOF MS
Mass spec ome y was ca ied ou using an E an
MALDI-TOF mass spec ome e (Ame sham Biosci-
ences (Eu ope) GmbH, F eibu g, Ge many). P o ein
samples o pep ide mass de e mina ion we e ei he (i)
sepa a ed by SDS–PAGE and diges ed wi h ypsin o
(ii) ob ained ollowing in-solu ion enzyma ic diges ion
and deposi ed (1 l) wi h 1 l -cyano-4-hyd oxycinnam-
inic acid (4-HCCA; 5mg/200l 50%( / ) ace oni ile in
aqueous iXuo oace ic acid) on o mass spec ome y
slides and allowed o d y p io o delayed ex ac ion,
eXec on TOF analysis a 20 kV.
2.6. GST ac i i y assays
Glu a hione ans e ase ac i i y was de e mined
using me hods based on hose desc ibed (Habdous
e al., 2002; Habig and Jakoby, 1981) whe eby he
change in abso bance a 340 nm (A340 nm) was
eco ded, and enzyme ac i i y calcula ed as mic o-
moles CDNB u ilised/mg GST/min. Ac i i y wi h 1,2-
dichlo o-4-ni obenzene (DCNB) was pe o med a
345 nm in he same way as o CDNB, wi h some
excep ions; 100 mM phospha e buVe (pH 7.5), 100 mM
DCNB in 100% e hanol, and 50 mM GSH in phospha e
Table 1
Nucleo ide sequence o oligonucleo ide p ime s used o ampli y A ugs genes A–C om A. umiga us genomic DNA and cDNA, espec i ely
Nucleo ide sequence o con ol calmodulin p ime s (Rome o e al., 2003) a e also gi en. Oligonucleo ide p ime s we e designed based on sequence
da a ob ained om he A. umiga us genome sequencing eVo (h p://www. ig .o g). All A ugs o wa d p ime s (F1–F3) con ained a 5⬘ EcoRI
es ic ion si e, and e e se p ime s con ained 3⬘ Ps I si es, o acili a e di ec ional cloning in o pP oEx-H a.
Gene P ime s Sequence (5⬘–3⬘)
g
s A gs A-F GAGAGAATTCATGGCAAATAGACCTGATATTACACTG
gs A-R GAGACTGCAGATTAATGCTTCGCCTATTCG
g
s B gs B-F GAGAGAATTCATGTCTTTGAAGCCTATCGTC
gs B-R GAGACTGCAGTTACTTTTCCTGTGCGGC
g
s C gs C-F GAGAGAATTCATGCCGGACATCCAACCCATC
gs C-R GAGACTGCAGTCAGGTCGAGGGGAAGATGTC
Calmodulin LCALM CCGAGTACAAGGAAGCTTTCTC
Calmodulin RCALM GAATCATCTCGTCGACTTCGTCGTCAGT
322 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327
buVe we e used. Ac i i y wi h e hac ynic acid was
eco ded a 270 nm, using 100 mM phospha e buVe ,
pH 6.5, 20 mM e hac ynic acid in 100% e hanol, and
2.5 mM GSH. Glu a hione pe oxidase ac i i y was
de e mined as desc ibed (Veal e al., 2002). B ieXy, es
samples (100 l) we e mixed wi h 880 l o assay buVe
(50 mM po assium phospha e, pH 7.0, 1 mM EDTA,
1mM NaN
3, 0.2 mM NADPH, 1 U ml¡1 glu a hione
educ ase and 1 mM GSH) and incuba ed a 30 °C o
exac ly 5 min, a e which he mix u e was ans e ed
o a cu e e and 20 l o 69 mM cumene hyd ope oxide
added. The deple ion o NADPH was measu ed o e
3min a 340nm.
2.7. Induc ion o GST exp ession in A. umiga us and
analysis by RT-PCR
Aspe gillus umiga us ATCC 26933 was cul u ed,
wi h agi a ion, in 500 ml MEM + 5% ( / ) e al cal
se um a 37 °C o 47 h, be o e addi ion o ei he CDNB
(Wnal concen a ion: 200 M) o H2O2 (Wnal concen a-
ion: 5 mM). Aliquo s (50 ml) we e emo ed bo h p io
o induc ion and a 1, 2, and 3h pos -induc ion. A.
umiga us mycelia we e collec ed by Wl a ion, apidly
ozen in liquid ni ogen, and s o ed a ¡80 °C p io o
RNA ex ac ion. RNA was ex ac ed om A. umiga us
mycelia using he RNeasy plan mini ki (Qiagen).
Quan iWca ion o RNA was pe o med using To al Lab
so wa e (NonLinea Dynamics) o ensu e equal
amoun s o RNA we e used subsequen ly, and ca. 1g
RNA was used o cDNA syn hesis. RNA was ea ed
wi h DNase I (Sigma–Ald ich) p io o cDNA syn hesis
o emo e DNA con amina ion. cDNA syn hesis om
mRNA was pe o med using he Supe Sc ip ki (In i -
ogen) using oligo(dT) p ime s. Subsequen PCR o
GST cDNA was pe o med as desc ibed abo e. Con ol
PCRs we e pe o med wi h p ime s LCALM and
RCALM (Table 1) which ampli y 348 and 617 bp
egions om A. umiga us cDNA and genomic DNA,
espec i ely (Rome o e al., 2003). Densi iome ic quan-
iWca ion o PCR p oduc s was pe o med using Gene-
ools so wa e (Syngene).
3. Nomencla u e
In acco dance wi h ecommenda ions om he A.
umiga us sequencing g oup (h p://www.man.ac.uk), he
glu a hione ans e ase genes disclosed he e a e e med
gs A, gs B, and gs C and he co esponding p o eins
iden iWed as gs A, gs B, and gs C. In addi ion, as ecom-
mended, he co esponding S. pombe o hologs a e iden-
iWed as supe sc ip s as ollows: gs Ags 3, gs Bgs 1, and
gs Cgs 2. Finally, as ecommended, he h ee-le e p eWx
‘A u’, o A. umiga us gene iden iWca ion, has only been
used when necessa y.
4. Resul s and discussion
4.1. Cloning and sequence analysis o A. umiga us GST
open eading ames
Simila i y sea ching o he A. umiga us genome da a-
base wi h A. nidulans gs A (Genbank Accession No.
AAM48104; F ase e al., 2002) e ealed he p esence o
an A. umiga us GST (A ugs A) which, ollowing ampli-
Wca ion wi h p ime s gs A-F/R yielded a PCR p oduc
o 909bp when a empla e o A. umiga us genomic
DNA was used, and 762 bp when cDNA was employed;
sequence examina ion e ealed wo in ons o 95 and
52 bp p oximal o he 5⬘ end. The A. umiga us genome
da abase (h p://www. ig .o g) was also in e oga ed
wi h S. pombe p o ein sequences co esponding o GSTI
(Genbank Accession No. AAK77864; Cho e al., 2002)
and GSTII (GenBank Accession No. AAF21054; Kim e
al., 2001), and a numbe o GST-like open eading
ames we e e ealed which exhibi ed app oxima ely
30% sequence simila i y o he que y sequences. PCR
p ime s gs B-F/R and gs C-F/R (Table 1) we e designed
based on hese A. umiga us GST sequences and used o
ampli y open eading ames o 663 and 675 bp, espec-
i ely, om A. umiga us genomic DNA. Gs A, B, and C
open eading ames co esponding o p o ein sequences
shown in Fig. 1 we e cloned in o pP oEx-H a o ecom-
binan exp ession.
Cloned gs A, B, and C sequences we e compa ed wi h
he A. umiga us genome da abase; obse ed diVe ences
we e minimal, esul ing in ansla ed amino acid
sequences which exhibi ed 100% sequence iden i y o he
da abase o gs A and gs B. Gs C exhibi ed a single
amino acid diVe ence, which was a conse a i e change
om V (h p://www. ig .o g) o I (gs C sequence) a
posi ion 33. Gs C was independen ly cloned and
sequenced se e al imes, indica ing a ue polymo phism
a he han a sequence e o . F om he amino acid
sequence alignmen o gs A o C shown in Fig. 1, i is
appa en ha isola ed egions o iden i y exis be ween
all h ee p o eins h oughou hei en i e sequence, wi h
gs A appa en ly consis ing o a 30 amino acid C- e mi-
nal ex ension ela i e o gs B and C. Howe e , mo e
Fig. 1. Amino acid sequence alignmen o and gs A (254 aa), gs B (221
aa) and gs C (225 aa). Iden ical esidues a e highligh ed in black boxes
while hose esidues only common o wo sequences a e shaded g ey.
Gaps (–) a e in oduced o op imal alignmen . I appea s ha gs A
con ains a 30 amino acid C- e minal ex ension ela i e o bo h gs B
and C.
C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 323
c i e ia a e equi ed o conWden ly assign he GSTs o
his class, such as immunological c oss- eac i i y. As el-
a i ely ew ungal GSTs ha e been cha ac e ised, i is
diYcul o de e mine whe he hese enzymes a e homo-
logues o hose ound in o he o ganisms o a e ungal
speciWc. Cha e al. (2001), iden iWed a GST om Cun-
ninghamella elegans which bo e li le esemblance o
known classes, and a new ungal class was p oposed; i is
possible ha se e al classes a e ye o be disco e ed.
Fig. 2 shows he ela ionship be ween GSTs and
many o he ungal GST sequences cha ac e ised o da e.
I can be seen gs B and C a e mos closely ela ed o he
gs A enzymes om A. umiga us and A. nidulans, espec-
i ely. While S. pombe GST1 and 2 also exhibi signiW-
can ela edness o he GST p o eins om A. umiga us,
hose om I. o ien alis and Cu. elegans a e mo e dis-
an ly ela ed. When he h ee A. umiga us GST p o ein
sequences we e used in a gene al BLAST sea ch a h p:/
/www.ncbi.nlm.nih.go /en ez/, simila i ies o pu a i e
GST-like p o eins om se e al ungal species, which
ha e no been ully cha ac e ised, we e e ealed. Gs A
exhibi ed he highes simila i ies, indica ing ha his
GST may ha e de eloped p io o specia ion. No el
sequences iden iWed using gs A included a pu a i e GST
om he a ichoke pa hogen Bo yo inia uckeliana
(GenBank Accession No. AAG43132, 69% iden i y) and
pu a i e p o eins om he ice blas ungus Magnapo -
he g isea (GenBank Accession No. EAA55090, 58%
iden i y), Neu ospo a c assa (GenBank Accession No.
CAD36970, 58% iden i y), and he ce eal pa hogen Gib-
be ella zeae (GenBank Accession No. EAA71824, 49%
iden i y). Gs B and C also showed simila i y o he B.
uckeliana pu a i e GST, a he le el o 40% iden i y.
While gs B also exhibi s simila i y o he N. c assa p o-
ein men ioned p e iously (GenBank Accession No.
CAD36970, 44% iden i y) and gs C sha es simila i y
wi h he G. zeae p o ein (39% iden i y), he e is li le
c osso e be ween simila p o eins iden iWed by sea ch-
ing wi h gs A and wi h he o he wo A. umiga us GSTs.
Gs B and C, howe e , sha e simila i y wi h se e al o he
same p o eins, al hough hese a e less simila han he
gs A-like sequences. In addi ion, bo h gs B and gs C dis-
played some simila i y wi h he URE2 g oup o ni ogen
me abolism p o eins ha ha e been iden iWed om se -
e al Saccha omyces species (Fig. 2), bu which ha e no
been shown o exhibi GST ac i i y wi h CDNB (Rai
e al., 2003); his simila i y was no e iden wi h gs A.
URE2 om S. ce e isiae was shown o be in ol ed in
de ense agains hea y me al ions and oxida i e s ess
(Rai e al., 2003). Recen ly, a pu a i e GST sequence was
iden iWed om he A. umiga us genome as pa o a co-
egula ed gene clus e , which is pos ula ed as esponsible
o p oduc ion o glio oxin (Ga dine e al., 2004). While
his GST has no been cha ac e ised and is no he same
as any o he GSTs desc ibed he e, i sugges s a me a-
bolic ole o GSTs in A. umiga us, as has been pos u-
la ed in o he o ganisms (Hayes and Pul o d, 1995), and
also sugges s he e may be u he , as ye undisco e ed,
GSTs in his ungus.
Exp ession, pu iWca ion, and ac i i y analysis o
ecombinan GST p o eins
P o ein exp ession plasmids pPXAgs A, pPXAgs B,
and pPXAgs C, consis ing o he ec o pP oEx-H a
con aining he open eading ames o gs A (cDNA),
gs B, and gs C espec i ely, we e ans o med in o
E. coli DH5 and exp ession induced by he addi ion o
Fig. 2. Phylogene ic analysis o he h ee A. umiga us GST p o eins
compa ed o 11 o he cha ac e ised ungal GSTs. Sequences we e
aligned and a neighbo -joined ee gene a ed using Clus alW, wi h boo -
s apping o 1000. Pe cen age boo s apping alues a e shown a b anch
poin s. Sequence GenBank Accession numbe s a e as ollows: Cunning-
hamella elegans GST2, AAL02369; Cu. elegans GST1, AAL02368; S.
p
ombe GST2, AAF21054; S. pombe GST1, AAK77864; A. nidulans
GSTA, AAM48104; S. ce e isiae URE2, A39609; S. ce e isiae GSTI,
P40582; S. pombe GST3, AAK59430; S. ce e isiae GSTII, Q12390; I.
o ien alis GSTY1, BAA77459; and I. o ien alis GSTY2, S16178.
Fig. 3. SDS–PAGE and Wes e n blo analysis o ecombinan GST
exp ession in E. coli. Duplica e SDS–PAGE gels we e loaded as ol-
lows: M, p o ein size ma ke ; lane 1, uninduced E. coli ha bou ing
exp ession plasmid pPXAgs C; lane 2, E. coli ha bou ing exp ession
plasmid pPXAgs C induced wi h 0.6 mM IPTG; lane 3, insoluble p o-
eins ex ac ed om induced E. coli; lane 4, soluble p o eins ex ac ed
om induced E. coli; lane 5, (His)6-pu iWed ecombinan gs C (5 g);
lane 6, (His)6-pu iWed ecombinan gs B (5 g); and lane 7, (His)6-pu i-
Wed ecombinan gs A (4 g). One gel was Coomassie s ained (A) and
he o he was p obed wi h an i-(His)6 mu ine monoclonal an ibody o
iden i y ecombinan p o eins (B). Gs B was pu iWed in he same man-
ne as gs C. Bo h gs B and gs C we e de ec ed wi h an i-(His)6 mono-
clonal an ibody, bu no gs A. Howe e , he iden i y o his p o ein
was conW med by mass spec ome y.
324 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327
0.6mM IPTG (Fig. 3). All h ee ecombinan p o eins
we e p esen in cell lysa e supe na an s, indica ing solu-
bili y, and ecombinan gs B and gs C we e pu iWed
using he N- e minal (His)6- ag, wi h a yield o app oxi-
ma ely 17 and 18mg pe g am o E. coli cells cul u ed,
espec i ely (Fig. 3). De ec ion o ecombinan gs A
using he (His)6 ag was no possible, and la ge-scale
me al chela e aYni y ch oma og aphy was equi ed o
pu i y suYcien enzyme o ac i i y analysis (Fig. 3;
Table 2). Pu iWed ecombinan p o eins we e analysed
by MALDI-TOF MS and pep ides ( ollowing yp ic
diges ion) we e iden iWed co esponding o he heo e i-
cal amino acid sequence o all h ee p o eins whe eby 4/
83 pep ides (20% sequence co e age), 7/57 pep ides (34%
sequence co e age), and 4/46 pep ides (15% sequence
co e age) we e obse ed o ecombinan gs A, B, and
C, espec i ely. SDS–PAGE da a conW m molecula
masses o 26, 27, and 30kDa o gs A, B, and C, espec-
i ely (Fig. 3). These a e consis en wi h heo e ical
molecula masses o 28.99 and 28.72 kDa o he (His)6-
agged gs B and gs C p o eins, bu smalle han he heo-
e ical mass o 32.76 kDa o gs A. P o ein molecula
mass analysis ia FPLC gel Wl a ion ch oma og aphy
(Supe ose 6) conW med he dime ic s a us o pu iWed
gs B (56kDa) and C (61 kDa), espec i ely (da a no
shown). No binding o glu a hione–Sepha ose aYni y
columns was obse ed o any ecombinan GST (da a
no shown). Fu he mo e, a emp s o pu i y na i e gs A
o C om A. umiga us ex ac s by GSH aYni y ch oma-
og aphy we e unsuccess ul (da a no shown), which has
also been no ed in he pu iWca ion o some he a GST
enzymes (Hayes and Pul o d, 1995). C ys al s uc u es o
some he a GSTs ha e indica ed ha he GSH-binding
si e may be si ed u he inside he p o ein han in o he
classes o GST, and ha con en ional GSH-aYni y
ma ices may be unable o bind he ac i e si e (Hayes
and Pul o d, 1995).
The enzyma ic ac i i ies o pu iWed, ecombinan
gs A–C we e assessed wi h se e al subs a es. CDNB,
DCNB, and e hac ynic acid a e subs a es o glu a hi-
one ans e ase ac i i y, whe eas cumene hyd ope oxide
is a subs a e o glu a hione pe oxidase ac i i y (Veal
e al., 2002). Gs A–C exhibi ed low le el GST and glu a-
hione pe oxidase ac i i ies, which we e de ec able due o
he high concen a ions o ecombinan enzyme ob ained
(Table 2). Gs B exhibi ed a ou o six imes highe spe-
ciWc ac i i y agains CDNB han ei he gs A o C, espec-
i ely. No ac i i y was obse ed o ei he enzyme when
DCNB o e hac ynic acid we e used as subs a es. The
speciWc ac i i y obse ed agains cumene hyd ope oxide
was almos six imes highe o gs B hen gs A/C (Table
2). Al hough ela i ely lowe , he ac ual a io o ela i e
ac i i y agains CDNB was simila o ha p e iously
ound (Veal e al., 2002) whe eby S. pombe gs 1 showed
h ee imes g ea e ac i i y owa ds CDNB han gs 2.
Con e sely, he glu a hione pe oxidase ac i i y o S.
pombe gs 2 was abou wice ha obse ed o gs 1 albei
a a six imes (app ox.) lowe le el o ha ound o A.
umiga us gs B. GST speciWc ac i i y de e mina ions o
S. pombe gs 1 (Kim e al., 2001) we e ca ied ou on cell
lysa es using impu e gs 1, hus making exac compa ison
diYcul . Howe e , gs 1 ac i i y was de ec able agains
CDNB wi h no glu a hione pe oxidase ac i i y e iden .
S. pombe gs 2 also possesses glu a hione ans e ase
ac i i y, as measu ed by CDNB conjuga ion (Cho e al.,
2002). The speciWc ac i i ies o he A. umiga us GSTs a e
low in compa ison wi h o he cha ac e ised GSTs, how-
e e , any loss o ac i i y due o he p esence o he (His)6
ag is unlikely as TEV p o ease emo al o he (His)6 ag
( om gs C) did no esul in enhanced ac i i y (da a no
shown). Ul ima ely, ac i i y analysis o he na i e GSTs is
equi ed o ully assess ac i i y.
4.2. Induc ion o A. umiga us GST exp ession wi h
CDNB and H2O2
GSTs a e hough o be in ol ed in he esponse
agains ex e nal and cellula oxins, and may also aid he
cell when challenged by oxida i e s ess. A e ini ial
g ow h in he absence o ei he CDNB o H2O2, A. umig-
a us was u he cul u ed in he p esence o 200 M
CDNB o 5 mM H2O2 and exp ession le els o gs A,
gs B, and gs C de e mined by RT-PCR (Fig. 4). Mo e-
o e , he diVe ence in amplicon size o gs A can be seen
he eby conW ming he emo al o in onic sequence.
P ime s speciWc o he calmodulin gene (Rome o e al.,
2003) we e used o conW m absence o genomic DNA
and RNA equi alence be ween ime-poin s. Low basal
exp ession o gs A and gs C was de ec ed, bu gs B
exp ession was no de ec able unde basal condi ions.
Upon induc ion wi h CDNB, all h ee gs genes we e up-
egula ed wi hin one hou , wi h gs A showing a 10- old
induc ion (app oxima ely) and gs C showing a leas a 4-
old induc ion a all ime-poin s, and gs B exhibi ing only
weak induc ion, wi h a 20% d op in RNA exp ession a
Table 2
SpeciWc ac i i ies o pu iWed ecombinan gs A, gs B, and gs C wi h
bo h glu a hione ans e ase and glu a hione pe oxidase subs a es
GST ac i i y was assayed wi h CDNB, DCNB and e hac ynic acid,
and glu a hione pe oxidase ac i i y was assayed wi h cumene hyd o-
pe oxide. Uni s a e exp essed as mic omoles subs a e u ilised pe min-
u e. SpeciWc ac i i ies s a ed a e he a e age o W e eplica es and we e
co ec ed agains blank eac ions ha had been pe o med in iplica e.
N.D., no ac i i y de ec ed.
Subs a e SpeciWc ac i i y (U mg¡1) (§SD)
gs A gs B gs C
CDNB 0.004 §0.0001 0.025 §0.0028 0.006 §0.0005
DCNB N.D. N.D. N.D
E hac ynic acid N.D. N.D. N.D
Cumene
hyd ope oxide
0.019 §0.0009 0.145 §0.0088 0.025 §0.006
C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 325
3 h pos induc ion (Fig. 4A). This esul is qui e in e es -
ing as i is somewha a a iance wi h he abo e obse a-
ion ha gs B exhibi s g ea e ac i i y owa ds CDNB
han does gs A o gs C, howe e i is possible ha he
highe speciWc ac i i y o gs B may necessi a e p oduc-
ion o smalle amoun s o ac ual p o ein o conjuga e
a ailable CDNB. P e ious wo k, whe eby -galac osi-
dase exp ession was placed unde he con ol o he
ups eam egula o y egions associa ed wi h gs 1 and
gs 2 o S. pombe, has shown ha gs 1+ gene exp ession
was enhanced by me cu ic chlo ide and menadione (gen-
e a es supe oxide adicals), whe eas gs 2 exp ession was
only signiWcan ly induced by he p esence o o-dini o-
benzene (o-DNB) (Cho e al., 2002; Kim e al., 2001; Shin
e al., 2002). o-DNB also induces GST gene exp ession in
I. o ien alis (Tamaki e al., 1999).
In he wo k p esen ed he e, exposu e o cells o H2O2
did no esul in gs B induc ion. Howe e , weak induc-
ion o gs C was de ec ed wi hin 1 h pos -induc ion
(app ox. 3- old inc ease o e T0) which s abilised a 2
and 3 h (app ox. 7- old inc ease o e T0). In addi ion,
s ong exp ession o gs A a 1 h pos -induc ion was e i-
den (a leas 5- old inc ease) which appea ed o u he
inc ease a 2 h (app ox. 10- old inc ease o e T0) be o e
educing a 3 h pos -induc ion (app ox. 4.5- old wi h
espec o T0), possibly due o deple ion o added H2O2
(Fig. 4B). Gs B and gs C we e shown o be diVe en ially
inducible by H2O2, whe eby up- egula ion o gs C
exp ession only was obse ed. This indica es he possi-
bili y o diVe en oles o hese p o eins wi hin he
o ganism when subjec ed o en i onmen al s ess. P e i-
ous wo k has also indica ed ha exp ession o gs 1, as
well as gs 2, in S. pombe is induced by H2O2. This obse -
a ion sugges s po en ially diVe en mechanisms a e
in ol ed in he esponse o oxida i e s ess o bo h
o ganisms and ha he A. umiga us gs B plays a diVe -
en ole han gs 1 in S. pombe—an hypo hesis suppo ed
by g ea e sequence di e gence be ween gs B and C in A.
umiga us compa ed o he co esponding genes in S.
pombe (Fig. 2). I is in iguing ha gs B exp ession was
no induced in he p esence o H2O2, ye i exhibi ed he
g ea es glu a hione pe oxidase ac i i y agains cumene
hyd ope oxide. In i o, i is pos ula ed ha GST
enzymes may be in ol ed in de oxiWca ion o seconda y
oxida ion p oduc s p oduced by ini ial con e sion o
eac i e oxygen species and H2O2 by enzymes such as
glu a hione pe oxidase and supe oxide dismu ase
(Hayes and McLellan, 1999). These seconda y oxida ion
p oduc s include lipid and DNA oxida ion p oduc s,
simila o cumene hyd ope oxide, and i is possible ha
gs B exp ession is induced by he seconda y oxida ion
p oduc s a he han di ec ly by H2O2. Thus, a pu a i e
seconda y compound equi ed o induc ion o gs B
may no ha e been p oduced when H2O2 was used as he
induce . A. umiga us gs A was iden iWed ia homology
sea ching o he A. umiga us genome using A. nidulans
gs A. In ac , hese p o eins exhibi a e y high deg ee o
sequence simila i y (83%) which indica es ha hey may
sha e a common unc ion in bo h Aspe gillus spp. F ase
e al. (2002) ha e shown ha gs A encodes a GST which
is in ol ed in xenobio ic and me al ion esis ance in
A. nidulans. A. umiga us gs A was s ongly up- egula ed
in he p esence o bo h CDNB and H2O2. In addi ion,
gs A ha bou s sequences ups eam o he ini ial ATG
wi h simila i y o he xenobio ic (XRE) and an ioxidan
esponsi e elemen s (ARE) in ol ed in egula ion o
mammalian GSTs (Hayes and Pul o d, 1995; Rushmo e
e al., 1991; Rushmo e and Picke , 1993). Al hough such
esponsi e elemen s ha e no been demons a ed o be
unc ional in he egula ion o ungal GSTs o da e,
XRE and ARE ha e been iden iWed in he p omo e
egions o gs genes in S. ce e isiae (Choi e al., 1998).
DNA sequences om he A. umiga us genome (h p://
www. ig .o g) 2 kb ups eam o each gs gene we e exam-
ined o he consensus XRE (TNGCGTG) and ARE
(TGACNNNGC) egions. Se e al XRE and ARE-like
egions we e obse ed ups eam o all h ee gs genes.
Examina ion o ansc ip ional egula ion ia p omo e
analysis linked o a epo e gene would be necessa y o
conW m whe he hese esponsi e elemen s we e unc-
ional and in ol ed in egula ion o gene exp ession in
he p esence o CDNB and H2O2. The exp ession o all
h ee gs genes in esponse o o ganism exposu e o
CDNB and o gs A and C ollowing exposu e o
Fig. 4. RT-PCR o A. umiga us cDNA isola ed om cul u es induced
wi h ei he CDNB (A) o H2O2(B). A. umiga us RNA was isola ed
p io o induc ion (T0), 1 h pos -induc ion (T1), 2 h pos -induc ion (T2),
and 3 h pos -induc ion (T3). PCR was pe o med on cDNA using gs A,
B, and C speciWc p ime s and p ime s speciWc o he calmodulin gene
(CALM) (Rome o e al., 2003). Op imal cDNA ampliWca ion was
ound o equi e 45 cycles o PCR. Aga ose gels we e loaded as ol-
lows: M, DNA size ma ke ; T0; T1; T2; and T3; gDNA, genomic DNA
con ol; and H2O, no DNA con ol. Exp ession o all h ee gs genes
was obse ed when induced wi h CDNB, and induc ion o gs A and
g
s C only was seen wi h H2O2 induc ion.
326 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327
A. umiga us o H2O2 indica es a high likelihood ha
GSTs play a ole in he esponse o A. umiga us o bo h
xenobio ic p esence and oxida i e s ess and, as in o he
ungal species (Veal e al., 2002), may be in ol ed in
media ing an i- ungal d ug esis ance.
5. Summa y
Th ee p e iously uniden iWed open eading ames
encoding glu a hione ans e ases ha e been iden iWed in
A. umiga us, which a e ei he cons i u i ely exp essed
unde expe imen al condi ions employed (gs A and C) o
inducible in esponse o xenobio ic (gs A, B, and C) o
oxida i e s ess (gs A and C). Recombinan p o eins co -
esponding o all h ee genes ha e been exp essed and
enzyma ic ac i i y cha ac e is ic o glu a hione ans e ase
and glu a hione pe oxidase deWned. The a ailabili y o
his in o ma ion will acili a e u he explo a ion o he
possible ole(s) played by GST in xenobio ic ole ance and
media ing esponse o oxida i e s ess in A. umiga us.
6. Accession numbe s
Sequences o he h ee Aspe gillus umiga us glu a-
hione ans e ases desc ibed a e deposi ed in GenBank
unde Accession Nos. AY770045, AY770043, and
AY770044 (gs A o C) and AY770046 (gs A cDNA).
Acknowledgmen s
This wo k was unded unde he IRCSET/En e p ise
I eland Basic Resea ch G an P og amme and he I ish
Go e nmen P og amme o Resea ch in Thi d Le el
Ins i u ions. Rachel Ge agh y was unded by Dublin
Ci y Council s uden ship scheme, Clai e Ne ille was a
ecipien o a Daniel O’Connell Fellowship om NUI
Maynoo h. P elimina y sequence da a was ob ained
om The Ins i u e o Genomic Resea ch websi e a
h p://www. ig .o g. Sequencing o A. umiga us was
unded by he Na ional Ins i u e o Alle gy and In ec-
ious Disease U01 AI 48830 o Da id Denning and Wil-
liam Nie man, he Wellcome T us , and Fondo de
In es icagiones Sani a ias.
Re e ences
Be ou , S., Badoc, C., Mallie, M., Giamimis, J., Bas ide, J., 2002. Spo e
diVusa e isola ed om some s ains o Aspe gillus umiga us inhib-
i s phagocy osis by mu ine al eola mac ophages. FEMS Immunol.
Med. Mic obiol. 33, 101–106.
B ad o d, M., 1976. A apid and sensi i e me hod o he quan i a ion
o mic og am quan i ies o p o ein u ilizing he p inciple o p o-
ein-dye binding. Anal. Biochem. 72, 248–254.
Cha, C.J., Coles, B.F., Ce niglia, C.E., 2001. Pu iWca ion and cha ac e -
iza ion o a glu a hione S- ans e ase om he ungus Cunningham-
ella elegans. FEMS Mic obiol. Le . 203 (2), 257–261.
Cho, Y.W., Pa k, E.H., Fuchs, J.A., Lim, C.J., 2002. A second s ess-
inducible glu a hione S- ans e ase gene om Schizosaccha omyces
pombe. Biochim. Biophys. Ac a Gene S uc . Exp . 1574 (3), 399–
402.
Choi, J.H., Lou, W., Vancu a, A., 1998. A no el memb ane-bound glu-
a hione S- ans e ase unc ions in he s a iona y phase o he
yeas Saccha omyces ce e isiae. J. Biol. Chem. 273 (45), 29915–
29922.
Daly, P., Ka anagh, K., 2001. Pulmona y Aspe gillosis: clinical p esen-
a ion, diagnosis and he apy. B . J. Biomed. Sci. 58, 197–205.
Denning, D.W., 1998. In asi e aspe gillosis. Clin. In . Dis. 26, 781–805.
Dowd, C.A., Buckley, C.M., Sheehan, D., 1997. Glu a hione S- ans e -
ases om he whi e- o ungus, Phane ochae e ch ysospo ium. Bio-
chem. J. 324, 243–248.
Dowd, C.A., Sheehan, D., 1999. Va iable exp ession o glu a hione S-
ans e ase isoenzymes in he ungus, Muco ci cinelloides. FEMS
Mic obiol. Le . 170 (1), 13–17.
Dowe , W.J., Mille , J.F., Ragsdale, C.W., 1988. High-eYciency ans-
o ma ion o Esche ichia coli by high- ol age elec opo a ion.
Nucleic Acids Res. 16 (13), 6127–6145.
Ellis, D., 2002. Ampho e icin B: spec um and esis ance. J. An imic-
ob. Chemo he . 49, 7–10.
Foley, V., Sheehan, D., 1998. Glu a hione S- ans e ases o he yeas
Ya owia lipoly ica ha e unusually la ge molecula mass. Biochem.
J. 333, 839–845.
F ase , J.A., Da is, M.A., Hynes, M.J., 2002. A gene om Aspe gillus
nidulans wi h simila i y o URE2 o Saccha omyces ce e isiae
encodes a glu a hione S- ans e ase which con ibu es o hea y
me al and xenobio ic esis ance. Appl. En i on. Mic obiol. 68 (6),
2802–2808.
Ga dine , D.M., Cozijnsen, A.J., Wilson, L.M., Ped as, M.S.C., How-
le , B.J., 2004. The si odesmin biosyn he ic gene clus e o he plan
pa hogenic ungus Lep osphae ia maculans. Mol. Mic obiol. 53 (5),
1307–1318.
Habdous, M., Vincen -Vi y, M., Vis ikis, S., Sies , G., 2002. Rapid
spec opho ome ic me hod o se um glu a hione S- ans e ases
ac i i y. Clin. Chim. Ac a 326 (1-2), 131–142.
Habig, W.H., Jakoby, W.B., 1981. Assays o diVe en ia ion o glu a hi-
one-S- ans e ases. Me hods Enzymol. 77, 398–405.
Hayes, J.D., McLellan, L.I., 1999. Glu a hione and glu a hione-depen-
den enzymes ep esen a coo dina ely egula ed de ence agains
oxida i e s ess. F ee Radic. Res. 31 (4), 273–300.
Hayes, J.D., Pul o d, D.J., 1995. The glu a hione S- ans e ase supe -
gene amily: egula ion o GST and he con ibu ion o he isoen-
zymes o cance chemop o ec ion and d ug esis ance. C i . Re .
Biochem. Mol. Biol. 30 (6), 445–600.
Kim, H.G., Pa k, K.N., Cho, Y.W., Pa k, E.H., Fuchs, J.A., Lim, C.J.,
2001. Cha ac e iza ion and egula ion o glu a hione S- ans e ase
gene om Schizosaccha omyces pombe. Biochim. Biophys. Ac a
Gene S uc . Exp . 1520 (2), 179–185.
Mi chell, C.G., Sligh , J., Donaldson, K., 1997. DiVusible componen
om he spo e su ace o he ungus Aspe gillus umiga us which
inhibi s he mac ophage oxida i e bu s is dis inc om glio oxin
and o he hyphal oxins. Tho ax 52, 796–801.
Mu yama, T., Ami ani, R., Ikegami, Y., Awada, R., Lee, W.J., Kuze, F.,
1996. Supp essi e eVec s o Aspe gillus umiga us cul u e Wl a es on
human al eola mac ophages and polymo phonuclea leucocy es.
Eu . Respi . J. 9, 293–300.
Nicholson, T.P., Rudd, B.A.M., Dawson, M., Laza us, C.M., Simpson,
T.J., Cox, R.J., 2001. Design and u ili y o oligonucleo ide gene
p obes o ungal polyke ide syn hases. Chem. Biol. 8, 157–178.
Page, R.D.M., 1996. TREEVIEW: an applica ion o display phyloge-
ne ic ees on pe sonal compu e s. Compu . Appl. Biosci. 12, 357–
358.
C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 327
Rai, R., Ta e, J.J., Coope , T.G., 2003. U e2, a p ion p ecu so wi h
homology o glu a hione S- ans e ase, p o ec s Saccha omyces
ce e isiae cells om hea y me al ion and oxidan oxici y. J. Biol.
Chem. 278, 12826–12833.
Rome o, B., Tu ne , G., Oli as, I., Labo da, F., De Lucas, J.R., 2003.
The Aspe gillus nidulans alcA p omo e d i es igh ly egula ed
condi ional gene exp ession in Aspe gillus umiga us pe mi ing al-
ida ion o essen ial genes in his human pa hogen. Fungal Gene .
Biol. 40 (2), 103–114.
Rushmo e, T.H., Mo on, M.R., Picke , C.B., 1991. The an ioxidan
esponsi e elemen -ac i a ion by oxida i e s ess and iden iWca ion
o he DNA consensus sequence equi ed o unc ional ac i i y. J.
Biol. Chem. 266 (18), 11632–11639.
Rushmo e, T.H., Picke , C.B., 1993. Glu a hione S- ans e ases, s uc-
u e, egula ion, and he apeu ic implica ions. J. Biol. Chem. 268
(16), 11475–11478.
Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. S uc u e,
unc ion and e olu ion o glu a hione ans e ases: implica ions o
classiWca ion o non-mammalian membe s o an ancien enzyme
supe amily. Biochem. J. 360, 1–16.
Shin, Y.H., Pa k, E.H., Fuchs, J.A., Lim, C.J., 2002. Cha ac e iza ion,
exp ession and egula ion o a hi d gene encoding glu a hione
S- ans e ase om he Wssion yeas . Biochim. Biophys. Ac a Gene
S uc . Exp . 1577 (1), 164–170.
Takada, Y., Uda, K., Kawamu a, K., Ma suoka, T., 2004. Molecula
cloning and cha ac e iza ion o a no el glu a hione S- ans e ase
gene induced by ligh s imula ion in he p o ozoan Blepha isma
japonicum. FEMS Mic obiol. Le . 231 (2), 185–189.
Tamaki, H., Yamamo o, K., Kumagai, H., 1999. Exp ession o wo glu-
a hione S- ans e ase genes in he yeas Issa chenkia o ien alis is
induced by o-dini obenzene du ing cell g ow h a es . J. Bac e iol.
181 (9), 2958–2962.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W:
imp o ing he sensi i i y o p og essi e mul iple sequence align-
men h ough sequence weigh ing, posi ion-speciWc gap penal ies
and weigh ma ix choice. Nucleic Acids Res. 22 (22), 4673–4680.
Veal, E.A., Toone, W.M., Jones, N., Mo gan, B.A., 2002. Dis inc
oles o glu a hione S- ans e ases in he oxida i e s ess
esponse in Schizosaccha omyces pombe. J. Biol. Chem. 277 (38),
35523–35531.