Identification, cloning, and functional expression of three glutathione transferase genes from Aspergillus fumigatus

Fungal Gene ics and Biology 42 (2005) 319–327 www.else ie .com/loca e/y gbi 1087-1845/$ - see on ma e  2005 Else ie Inc. All igh s ese ed. doi:10.1016/j. gb.2005.01.001 Iden iWca ion, cloning, and unc ional exp ession o h ee glu a hione ans e ase genes om Aspe gillus umiga us Clai e Bu ns1, Rachel Ge agh y1, Clai e Ne ille, Alan Mu phy, Ke in Ka anagh, Sean Doyle¤ Na ional Ins i u e o Cellula Bio echnology, Depa men o Biology, Na ional Uni e si y o I eland, Maynoo h, Co. Kilda e, I eland Recei ed 13 Oc obe 2004; accep ed 3 Janua y 2005 Abs ac Analysis o he genome o he human pa hogen, Aspe gillus umiga us, e ealed he p esence o se e al pu a i e glu a hione ans- e ase (GST) open eading ames. Th ee A. umiga us GST genes, e med gs A, B, and C, we e cloned and ecombinan p o eins exp essed in Esche ichia coli. Func ional analysis o ecombinan gs A–C conW ms ha he enzymes exhibi GST ac i i y and glu a- hione pe oxidase ac i i y. RT-PCR conW med low basal exp ession o gs A and gs C which was ma kedly up- egula ed (a leas 4£– 10£) in he p esence o ei he H2O2 o 1-chlo o-2,4-dini obenzene (CDNB). Gs B exp ession was only obse ed in he p esence o CDNB. These esul s demons a e o he W s ime he exis ence o h ee unc ional GSTs in A. umiga us and s ongly sugges a ole o hese enzymes in he esponse o he o ganism o bo h oxida i e s ess and xenobio ic p esence.  2005 Else ie Inc. All igh s ese ed. Keywo ds: GST; MALDI-TOF; Xenobio ic esis ance; Oxida i e s ess; Fungal 1. In oduc ion Aspe gillus umiga us is a human pa hogenic ungus capable o inducing a ange o disease s a es in pa ien s wi h p e-exis ing lung damage o immunosupp ession ollowing o gan ansplan a ion (Daly and Ka anagh, 2001). Th ee o ms o aspe gillosis a e ecognised clini- cally: sap ophy ic, alle gic, and in asi e, wi h he la e o m ha ing a mo ali y a e o >90% in some pa ien g oups (Denning, 1998). Con en ional he apy elies upon he use o ampho e icin B and, mo e ecen ly, on no el azole de i a i es and he echinocandin class o an i- ungal agen s, bu mo ali y a es emain high. A. umiga us displays he abili y o wi hs and a ack by mac ophages and neu ophils and de elop in a po en- ially hos ile en i onmen . Toxin-media ed inhibi ion o oxida i e bu s in al eola mac ophages and polymo - phonuclea leukocy es by conidia and hyphae is well cha ac e ised (Be ou e al., 2002; Mi chell e al., 1997; Mu yama e al., 1996). In addi ion, he physical size o de eloping hyphae p e en phagocy osis by al eola mac ophages and he e is eme ging e idence ha A. umiga us may be able o ole a e en y o xenobio ics as a esul o ampho e icin B ea men c ea ing ape u es in he ungal cell memb ane (Ellis, 2002). Glu a hione ans e ases (GST; EC 2.5.1.18) a e dime ic phase II de oxiWca ion enzymes wi h he abili y o conjuga e a b oad ange o po en ially ha m ul xenobio - ics o glu a hione (GSH), he eby ende ing hem mo e suscep ible o emo al om he cell. GSTs ha e also been shown o exhibi GSH-dependen pe oxidase ac i i y and hus may be in ol ed in esis ance o oxida i e s ess. Cy osolic GSTs ha e been iden iWed in almos all o gan- isms, wi h mammalian GSTs he mos clea ly cha ac e - ised. These enzymes ha e been implica ed in pes icide esis ance in plan s and insec s (Sheehan e al., 2001), and ¤Co esponding au ho . Fax: +353 1 7083845. E-mail add ess: sean.doy[email p o ec ed] (S. Doyle). 1These au ho s con ibu ed equally o his wo k. 320 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 some GST polymo phisms a e hough o al e cance suscep ibili y in mammals (Hayes and Pul o d, 1995). GSTs a e di ided in o se e al classes based upon sub- s a e speciWci y, sequence simila i y (pa icula ly in he N- e minal egion which is in ol ed in GSH binding), immunological c oss- eac i i y and, whe e a ailable, s uc u e simila i y. GST classes include , , , , , , , and  classes, wi h insec speciWc ( and ⑀), plan speciWc ( and ) and bac e ial () classes also desc ibed (Sheehan e al., 2001). In addi ion, i is likely ha many mo e classes ha e been al eady cha ac e ised exis in he b oad ang- ing GST ca ego y; o example, new p o ozoan and un- gal GST classes ha e been p oposed (Cha e al., 2001; Takada e al., 2004). Un il ecen ly, ela i ely li le was known abou he p esence and ole o GST in ungi, howe e i is now clea ha GST iso o ms exis in a numbe o ungal species including Schizosaccha omyces pombe, Aspe gillus nidu- lans, Saccha omyces ce e isiae, Issa chenkia o ien alis, Ya owia lipoly ica, Cunninghamella elegans, Muco ci ci- nelloides, and Phane ochae e ch ysospo ium (Cha e al., 2001; Choi e al., 1998, 2002; Dowd e al., 1997; Dowd and Sheehan, 1999; Foley and Sheehan, 1998; F ase e al., 2002; Kim e al., 2001; Tamaki e al., 1999; Shin e al., 2002; Veal e al., 2002). Fungal GSTs exhibi diVe en ial exp ession pa e ns, wi h some iso o ms shown o be exp essed inducibly in he p esence o xenobio ics o oxi- da i e s ess. Fo example, o wo GSTs iden iWed in I. o i- en alis, only one was cons i u i ely exp essed, and bo h we e induced in he p esence o o-dini obenzene (o-DNB) (Choi e al., 1998). Th ee GSTs in S. pombe we e induced by oxida i e s ess, and mu an s lacking gs 1+ and gs 2+ o gs 3+ we e mo e sensi i e o he p esence o he an i- ungal d ug Xuconazole, he eby indica ing a ole o GST in media ing an i- ungal d ug ole ance (Cho e al., 2002; Kim e al., 2001; Shin e al., 2001; Veal e al., 2002). The iden iWca ion o a unc ional he a class GST (gene: gs A) in A. nidulans has u he elucida ed he ole o GST in ungal me abolism. Gs A appea s o be up- egula ed by he p esence o ei he 1-chlo o-2,4-dini o- benzene (CDNB)2 o H2O2 in he cul u e medium and may also play a ole in media ing hea y me al esis ance in A. nidulans (F ase e al., 2002). Gi en he signiWcance o A. umiga us as a human pa hogen and he limi ed success o an i- ungal agen s o ea aspe gillosis, pa icula ly in immunocomp omised pa ien s, i is su p ising ha he pu a i e p esence and ole o GST has me i ed li le a en ion. In addi ion, he po en ial ole o ungal GST in allowing A. umiga us o wi hs and neu ophil a ack may ep esen a key elemen in he cell’s abili y o su i e in he hos and colonise pulmona y issue. He e we desc ibe he iden iWca ion, cloning, he e ologous exp ession and cha ac e isa ion o h ee GST genes om A. umiga us. We also in es iga e he esponse o GST gene exp ession ollowing exposu e o A. umiga us o bo h CDNB and H2O2. 2. Expe imen al 2.1. Genomic DNA isola ion Aspe gillus umiga us ATCC 26933 (ob ained om he Ame ican Type Cul u e Collec ion, Ma yland, USA) was used in his s udy. Aspe gillus cul u es we e g own in 5%( / ) e al cal se um in minimal essen ial medium Eagle (MEM) (Sigma–Ald ich, Do se , UK) o 2 days a 37 °C. Genomic DNA was isola ed as desc ibed by Nicholson e al. (2001). B ieXy, ca. 4 g A. umiga us mycelia we e c ushed in liquid N2 and suspended in 10 ml ex ac ion buVe (10mM T is–HCl, 10 mM EDTA, 0.5% (w/ ) SDS pH 8.0). Phenol:chlo o o m:iso- amyl alcohol (25:24:1, 10ml) was added o he mycelial suspension and mixed gen ly o 30 min. Phases we e sepa a ed by cen i uga ion a 5000g a 4°C. The aque- ous laye was emo ed a esh ube and phenol ex ac- ion epea ed un il he in e ace was clea . The Wnal aqueous laye was ea ed wi h chlo o o m:isoamyl alco- hol (24:1) and phases sepa a ed as be o e. The emaining aqueous laye was ea ed wi h ibonuclease A (20 l; 10 mg ml¡1) a 37°C o 30 min, ollowed by phenol ex ac ion, hen chlo o o m ex ac ion. The DNA was p ecipi a ed om he aqueous laye wi h 2 olumes o 100% e hanol and 1/10 olume o LiCl (4 M) a ¡20 °C o e nigh . DNA was eco e ed by cen i uga ion a 13,000g o 10 min. The pelle was washed wi h 70%( / ) e hanol, ai -d ied, and esuspended in 1 ml TE buVe (10mM T is–HCl, 1mM EDTA, pH 8.0). 2.2. DNA sequence and bioin o ma ic analysis All DNA sequence analysis was pe o med using a Pe kin-Elme ABI P ism 310 gene ic analyse , comme - cially by MWG Bio ech (Mil on Keynes, UK) o La k Technologies (Essex, UK) and sequence simila i ies we e de e mined using he BLAST algo i hm (www.ncbi.nlm. nih.go /blas /bl2seq/bl2.h ml). Sequence alignmen s and neighbo -joined phylogene ic ees we e gene a ed using Clus alW (Thompson e al., 1994; h p://www.ebi.ac.uk/ clus alw). A boo s apping alue o 1000 was used, wi h boo s apping pe cen ages no ed a ee b anch poin s. T ees we e isualised in T ee iew (Page, 1996; h p:// axonomy.zoology.gla.ac.uk/ od/ od.h ml). P elimina y sequence da a was also ob ained om The Ins i u e o Genomic Resea ch websi e a h p://www. ig .o g. Sequencing o A. umiga us genome is nea comple ion wi h suppo om he Wellcome T us and NIH. 2Abb e ia ions used: CDNB, 1-chlo o-2,4-dini obenzene; DCNB, 1,2-dichlo o-4-ni obenzene; GST, glu a hione ans e ase; GSH, glu a- hione; MALDI-TOF, ma ix assis ed lase deso p ion ionisa ion- ime o Xigh ; MEM, minimal essen ial medium Eagle; CALM, calmodulin. C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 321 2.3. PCR ampliWca ion All PCR eagen s we e ob ained om Sigma–Ald ich. PCR was pe o med using AccuTaq polyme ase wi h 1– 10 ng genomic DNA as empla e and 1.0 M each o o - wa d and e e se p ime (Table 1) in a o al olume o 50 l. PCR condi ions we e as ollows: 95 °C dena u - a ion o 5 min; (94°C dena u a ion o 30 s, 55 °C annealing o 90 s, 72 °C ex ension o 60 s) £35 cycles; 68 °C ex ension o 7 min. Op imal cDNA ampliWca ion was ound o equi e 45 cycles o PCR. PCR-ampliWed DNA was elec opho esed on 1% (w/ ) aga ose con ain- ing 0.5gml ¡1 o e hidium b omide o 30 min a 100 V. Visualisa ion o amplicons was pe o med using an ‘Eagle-Eye II’ digi al s ill ideo sys em (S a agene, CA, USA). 2.4. Cloning and exp ession o gs A, B, and C The gs A sequence was ampliWed om cDNA and he gs B/gs C sequences we e ampliWed om A. umiga- us DNA, using p ime s inco po a ing e minal EcoRI and Ps I si es o acili a e downs eam cloning (Table 1). PCR p oduc s we e cloned in o he pCR2.1 cloning ec o (In i ogen, Ca lsbad, CA, USA) acco d- ing o he manu ac u e ’s ins uc ions. gs A, gs B, and gs C we e subsequen ly cloned in o he pP oEX-H a exp ession ec o (In i ogen), which acili a es (His)6 aYni y ag in oduc ion, u ilising he enginee ed es ic- ion si es. Liga ions we e pe o med using Quicks ick ligase (Bioline, London, UK) acco ding o he manu ac- u e ’s ins uc ions. pPXAgs A, pPXAgs B, and pPX- Ags C, he esul an exp ession ec o s con aining gs A, gs B, and gs C, espec i ely, we e indi idually ans- o med in o E. coli s ain DH5 by elec opo a ion acco ding o Dowe e al. (1988). Exp ession o all h ee ecombinan GST p o eins was induced by he addi ion o 0.6 mM isop opyl -D- hiogalac oside (IPTG) and moni o ed by SDS–PAGE and Wes e n blo analysis. Fo enzyme pu iWca ion, induced cells we e lysed by incuba ion wi h lysozyme (90 gml ¡1) and sodium deoxychola e (0.04% (w/ )), in he p esence o p o e- ase inhibi o s (1 gml ¡1 leupep in and peps a in, espec i ely, and 1 mM PMSF). Cell deb is was emo ed by cen i uga ion a 10,000g o 10 min and N- e minal (His)6- agged ecombinan p o eins we e pu i- Wed om he supe na an by Ni–NTA ch oma og aphy (Qiagen, Wes Sussex, UK) by elu ion wi h 250 mM imidazole in 50mM sodium phospha e/300 mM NaCl. Pu iWed GST p o eins we e dialysed ( wice; once o e - nigh , and once o 4 h) agains phospha e-buVe ed saline (PBS) con aining 0.02% (w/ ) sodium azide o s o age a 4 °C. P o ein concen a ions we e de e mined using he B ad o d me hod (B ad o d, 1976) wi h bo ine se um albumin as a s anda d. 2.5. MALDI-TOF MS Mass spec ome y was ca ied ou using an E an MALDI-TOF mass spec ome e (Ame sham Biosci- ences (Eu ope) GmbH, F eibu g, Ge many). P o ein samples o pep ide mass de e mina ion we e ei he (i) sepa a ed by SDS–PAGE and diges ed wi h ypsin o (ii) ob ained ollowing in-solu ion enzyma ic diges ion and deposi ed (1 l) wi h 1 l -cyano-4-hyd oxycinnam- inic acid (4-HCCA; 5mg/200l 50%( / ) ace oni ile in aqueous iXuo oace ic acid) on o mass spec ome y slides and allowed o d y p io o delayed ex ac ion, eXec on TOF analysis a 20 kV. 2.6. GST ac i i y assays Glu a hione ans e ase ac i i y was de e mined using me hods based on hose desc ibed (Habdous e al., 2002; Habig and Jakoby, 1981) whe eby he change in abso bance a 340 nm (A340 nm) was eco ded, and enzyme ac i i y calcula ed as mic o- moles CDNB u ilised/mg GST/min. Ac i i y wi h 1,2- dichlo o-4-ni obenzene (DCNB) was pe o med a 345 nm in he same way as o CDNB, wi h some excep ions; 100 mM phospha e buVe (pH 7.5), 100 mM DCNB in 100% e hanol, and 50 mM GSH in phospha e Table 1 Nucleo ide sequence o oligonucleo ide p ime s used o ampli y A ugs genes A–C om A. umiga us genomic DNA and cDNA, espec i ely Nucleo ide sequence o con ol calmodulin p ime s (Rome o e al., 2003) a e also gi en. Oligonucleo ide p ime s we e designed based on sequence da a ob ained om he A. umiga us genome sequencing eVo (h p://www. ig .o g). All A ugs o wa d p ime s (F1–F3) con ained a 5⬘ EcoRI es ic ion si e, and e e se p ime s con ained 3⬘ Ps I si es, o acili a e di ec ional cloning in o pP oEx-H a. Gene P ime s Sequence (5⬘–3⬘) g s A gs A-F GAGAGAATTCATGGCAAATAGACCTGATATTACACTG gs A-R GAGACTGCAGATTAATGCTTCGCCTATTCG g s B gs B-F GAGAGAATTCATGTCTTTGAAGCCTATCGTC gs B-R GAGACTGCAGTTACTTTTCCTGTGCGGC g s C gs C-F GAGAGAATTCATGCCGGACATCCAACCCATC gs C-R GAGACTGCAGTCAGGTCGAGGGGAAGATGTC Calmodulin LCALM CCGAGTACAAGGAAGCTTTCTC Calmodulin RCALM GAATCATCTCGTCGACTTCGTCGTCAGT 322 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 buVe we e used. Ac i i y wi h e hac ynic acid was eco ded a 270 nm, using 100 mM phospha e buVe , pH 6.5, 20 mM e hac ynic acid in 100% e hanol, and 2.5 mM GSH. Glu a hione pe oxidase ac i i y was de e mined as desc ibed (Veal e al., 2002). B ieXy, es samples (100 l) we e mixed wi h 880 l o assay buVe (50 mM po assium phospha e, pH 7.0, 1 mM EDTA, 1mM NaN 3, 0.2 mM NADPH, 1 U ml¡1 glu a hione educ ase and 1 mM GSH) and incuba ed a 30 °C o exac ly 5 min, a e which he mix u e was ans e ed o a cu e e and 20 l o 69 mM cumene hyd ope oxide added. The deple ion o NADPH was measu ed o e 3min a 340nm. 2.7. Induc ion o GST exp ession in A. umiga us and analysis by RT-PCR Aspe gillus umiga us ATCC 26933 was cul u ed, wi h agi a ion, in 500 ml MEM + 5% ( / ) e al cal se um a 37 °C o 47 h, be o e addi ion o ei he CDNB (Wnal concen a ion: 200 M) o H2O2 (Wnal concen a- ion: 5 mM). Aliquo s (50 ml) we e emo ed bo h p io o induc ion and a 1, 2, and 3h pos -induc ion. A. umiga us mycelia we e collec ed by Wl a ion, apidly ozen in liquid ni ogen, and s o ed a ¡80 °C p io o RNA ex ac ion. RNA was ex ac ed om A. umiga us mycelia using he RNeasy plan mini ki (Qiagen). Quan iWca ion o RNA was pe o med using To al Lab so wa e (NonLinea Dynamics) o ensu e equal amoun s o RNA we e used subsequen ly, and ca. 1g RNA was used o cDNA syn hesis. RNA was ea ed wi h DNase I (Sigma–Ald ich) p io o cDNA syn hesis o emo e DNA con amina ion. cDNA syn hesis om mRNA was pe o med using he Supe Sc ip ki (In i - ogen) using oligo(dT) p ime s. Subsequen PCR o GST cDNA was pe o med as desc ibed abo e. Con ol PCRs we e pe o med wi h p ime s LCALM and RCALM (Table 1) which ampli y 348 and 617 bp egions om A. umiga us cDNA and genomic DNA, espec i ely (Rome o e al., 2003). Densi iome ic quan- iWca ion o PCR p oduc s was pe o med using Gene- ools so wa e (Syngene). 3. Nomencla u e In acco dance wi h ecommenda ions om he A. umiga us sequencing g oup (h p://www.man.ac.uk), he glu a hione ans e ase genes disclosed he e a e e med gs A, gs B, and gs C and he co esponding p o eins iden iWed as gs A, gs B, and gs C. In addi ion, as ecom- mended, he co esponding S. pombe o hologs a e iden- iWed as supe sc ip s as ollows: gs Ags 3, gs Bgs 1, and gs Cgs 2. Finally, as ecommended, he h ee-le e p eWx ‘A u’, o A. umiga us gene iden iWca ion, has only been used when necessa y. 4. Resul s and discussion 4.1. Cloning and sequence analysis o A. umiga us GST open eading ames Simila i y sea ching o he A. umiga us genome da a- base wi h A. nidulans gs A (Genbank Accession No. AAM48104; F ase e al., 2002) e ealed he p esence o an A. umiga us GST (A ugs A) which, ollowing ampli- Wca ion wi h p ime s gs A-F/R yielded a PCR p oduc o 909bp when a empla e o A. umiga us genomic DNA was used, and 762 bp when cDNA was employed; sequence examina ion e ealed wo in ons o 95 and 52 bp p oximal o he 5⬘ end. The A. umiga us genome da abase (h p://www. ig .o g) was also in e oga ed wi h S. pombe p o ein sequences co esponding o GSTI (Genbank Accession No. AAK77864; Cho e al., 2002) and GSTII (GenBank Accession No. AAF21054; Kim e al., 2001), and a numbe o GST-like open eading ames we e e ealed which exhibi ed app oxima ely 30% sequence simila i y o he que y sequences. PCR p ime s gs B-F/R and gs C-F/R (Table 1) we e designed based on hese A. umiga us GST sequences and used o ampli y open eading ames o 663 and 675 bp, espec- i ely, om A. umiga us genomic DNA. Gs A, B, and C open eading ames co esponding o p o ein sequences shown in Fig. 1 we e cloned in o pP oEx-H a o ecom- binan exp ession. Cloned gs A, B, and C sequences we e compa ed wi h he A. umiga us genome da abase; obse ed diVe ences we e minimal, esul ing in ansla ed amino acid sequences which exhibi ed 100% sequence iden i y o he da abase o gs A and gs B. Gs C exhibi ed a single amino acid diVe ence, which was a conse a i e change om V (h p://www. ig .o g) o I (gs C sequence) a posi ion 33. Gs C was independen ly cloned and sequenced se e al imes, indica ing a ue polymo phism a he han a sequence e o . F om he amino acid sequence alignmen o gs A o C shown in Fig. 1, i is appa en ha isola ed egions o iden i y exis be ween all h ee p o eins h oughou hei en i e sequence, wi h gs A appa en ly consis ing o a 30 amino acid C- e mi- nal ex ension ela i e o gs B and C. Howe e , mo e Fig. 1. Amino acid sequence alignmen o and gs A (254 aa), gs B (221 aa) and gs C (225 aa). Iden ical esidues a e highligh ed in black boxes while hose esidues only common o wo sequences a e shaded g ey. Gaps (–) a e in oduced o op imal alignmen . I appea s ha gs A con ains a 30 amino acid C- e minal ex ension ela i e o bo h gs B and C. C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 323 c i e ia a e equi ed o conWden ly assign he GSTs o his class, such as immunological c oss- eac i i y. As el- a i ely ew ungal GSTs ha e been cha ac e ised, i is diYcul o de e mine whe he hese enzymes a e homo- logues o hose ound in o he o ganisms o a e ungal speciWc. Cha e al. (2001), iden iWed a GST om Cun- ninghamella elegans which bo e li le esemblance o known classes, and a new ungal class was p oposed; i is possible ha se e al classes a e ye o be disco e ed. Fig. 2 shows he ela ionship be ween GSTs and many o he ungal GST sequences cha ac e ised o da e. I can be seen gs B and C a e mos closely ela ed o he gs A enzymes om A. umiga us and A. nidulans, espec- i ely. While S. pombe GST1 and 2 also exhibi signiW- can ela edness o he GST p o eins om A. umiga us, hose om I. o ien alis and Cu. elegans a e mo e dis- an ly ela ed. When he h ee A. umiga us GST p o ein sequences we e used in a gene al BLAST sea ch a h p:/ /www.ncbi.nlm.nih.go /en ez/, simila i ies o pu a i e GST-like p o eins om se e al ungal species, which ha e no been ully cha ac e ised, we e e ealed. Gs A exhibi ed he highes simila i ies, indica ing ha his GST may ha e de eloped p io o specia ion. No el sequences iden iWed using gs A included a pu a i e GST om he a ichoke pa hogen Bo yo inia uckeliana (GenBank Accession No. AAG43132, 69% iden i y) and pu a i e p o eins om he ice blas ungus Magnapo - he g isea (GenBank Accession No. EAA55090, 58% iden i y), Neu ospo a c assa (GenBank Accession No. CAD36970, 58% iden i y), and he ce eal pa hogen Gib- be ella zeae (GenBank Accession No. EAA71824, 49% iden i y). Gs B and C also showed simila i y o he B. uckeliana pu a i e GST, a he le el o 40% iden i y. While gs B also exhibi s simila i y o he N. c assa p o- ein men ioned p e iously (GenBank Accession No. CAD36970, 44% iden i y) and gs C sha es simila i y wi h he G. zeae p o ein (39% iden i y), he e is li le c osso e be ween simila p o eins iden iWed by sea ch- ing wi h gs A and wi h he o he wo A. umiga us GSTs. Gs B and C, howe e , sha e simila i y wi h se e al o he same p o eins, al hough hese a e less simila han he gs A-like sequences. In addi ion, bo h gs B and gs C dis- played some simila i y wi h he URE2 g oup o ni ogen me abolism p o eins ha ha e been iden iWed om se - e al Saccha omyces species (Fig. 2), bu which ha e no been shown o exhibi GST ac i i y wi h CDNB (Rai e al., 2003); his simila i y was no e iden wi h gs A. URE2 om S. ce e isiae was shown o be in ol ed in de ense agains hea y me al ions and oxida i e s ess (Rai e al., 2003). Recen ly, a pu a i e GST sequence was iden iWed om he A. umiga us genome as pa o a co- egula ed gene clus e , which is pos ula ed as esponsible o p oduc ion o glio oxin (Ga dine e al., 2004). While his GST has no been cha ac e ised and is no he same as any o he GSTs desc ibed he e, i sugges s a me a- bolic ole o GSTs in A. umiga us, as has been pos u- la ed in o he o ganisms (Hayes and Pul o d, 1995), and also sugges s he e may be u he , as ye undisco e ed, GSTs in his ungus. Exp ession, pu iWca ion, and ac i i y analysis o ecombinan GST p o eins P o ein exp ession plasmids pPXAgs A, pPXAgs B, and pPXAgs C, consis ing o he ec o pP oEx-H a con aining he open eading ames o gs A (cDNA), gs B, and gs C espec i ely, we e ans o med in o E. coli DH5 and exp ession induced by he addi ion o Fig. 2. Phylogene ic analysis o he h ee A. umiga us GST p o eins compa ed o 11 o he cha ac e ised ungal GSTs. Sequences we e aligned and a neighbo -joined ee gene a ed using Clus alW, wi h boo - s apping o 1000. Pe cen age boo s apping alues a e shown a b anch poin s. Sequence GenBank Accession numbe s a e as ollows: Cunning- hamella elegans GST2, AAL02369; Cu. elegans GST1, AAL02368; S. p ombe GST2, AAF21054; S. pombe GST1, AAK77864; A. nidulans GSTA, AAM48104; S. ce e isiae URE2, A39609; S. ce e isiae GSTI, P40582; S. pombe GST3, AAK59430; S. ce e isiae GSTII, Q12390; I. o ien alis GSTY1, BAA77459; and I. o ien alis GSTY2, S16178. Fig. 3. SDS–PAGE and Wes e n blo analysis o ecombinan GST exp ession in E. coli. Duplica e SDS–PAGE gels we e loaded as ol- lows: M, p o ein size ma ke ; lane 1, uninduced E. coli ha bou ing exp ession plasmid pPXAgs C; lane 2, E. coli ha bou ing exp ession plasmid pPXAgs C induced wi h 0.6 mM IPTG; lane 3, insoluble p o- eins ex ac ed om induced E. coli; lane 4, soluble p o eins ex ac ed om induced E. coli; lane 5, (His)6-pu iWed ecombinan gs C (5 g); lane 6, (His)6-pu iWed ecombinan gs B (5 g); and lane 7, (His)6-pu i- Wed ecombinan gs A (4 g). One gel was Coomassie s ained (A) and he o he was p obed wi h an i-(His)6 mu ine monoclonal an ibody o iden i y ecombinan p o eins (B). Gs B was pu iWed in he same man- ne as gs C. Bo h gs B and gs C we e de ec ed wi h an i-(His)6 mono- clonal an ibody, bu no gs A. Howe e , he iden i y o his p o ein was conW med by mass spec ome y. 324 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 0.6mM IPTG (Fig. 3). All h ee ecombinan p o eins we e p esen in cell lysa e supe na an s, indica ing solu- bili y, and ecombinan gs B and gs C we e pu iWed using he N- e minal (His)6- ag, wi h a yield o app oxi- ma ely 17 and 18mg pe g am o E. coli cells cul u ed, espec i ely (Fig. 3). De ec ion o ecombinan gs A using he (His)6 ag was no possible, and la ge-scale me al chela e aYni y ch oma og aphy was equi ed o pu i y suYcien enzyme o ac i i y analysis (Fig. 3; Table 2). Pu iWed ecombinan p o eins we e analysed by MALDI-TOF MS and pep ides ( ollowing yp ic diges ion) we e iden iWed co esponding o he heo e i- cal amino acid sequence o all h ee p o eins whe eby 4/ 83 pep ides (20% sequence co e age), 7/57 pep ides (34% sequence co e age), and 4/46 pep ides (15% sequence co e age) we e obse ed o ecombinan gs A, B, and C, espec i ely. SDS–PAGE da a conW m molecula masses o 26, 27, and 30kDa o gs A, B, and C, espec- i ely (Fig. 3). These a e consis en wi h heo e ical molecula masses o 28.99 and 28.72 kDa o he (His)6- agged gs B and gs C p o eins, bu smalle han he heo- e ical mass o 32.76 kDa o gs A. P o ein molecula mass analysis ia FPLC gel Wl a ion ch oma og aphy (Supe ose 6) conW med he dime ic s a us o pu iWed gs B (56kDa) and C (61 kDa), espec i ely (da a no shown). No binding o glu a hione–Sepha ose aYni y columns was obse ed o any ecombinan GST (da a no shown). Fu he mo e, a emp s o pu i y na i e gs A o C om A. umiga us ex ac s by GSH aYni y ch oma- og aphy we e unsuccess ul (da a no shown), which has also been no ed in he pu iWca ion o some he a GST enzymes (Hayes and Pul o d, 1995). C ys al s uc u es o some he a GSTs ha e indica ed ha he GSH-binding si e may be si ed u he inside he p o ein han in o he classes o GST, and ha con en ional GSH-aYni y ma ices may be unable o bind he ac i e si e (Hayes and Pul o d, 1995). The enzyma ic ac i i ies o pu iWed, ecombinan gs A–C we e assessed wi h se e al subs a es. CDNB, DCNB, and e hac ynic acid a e subs a es o glu a hi- one ans e ase ac i i y, whe eas cumene hyd ope oxide is a subs a e o glu a hione pe oxidase ac i i y (Veal e al., 2002). Gs A–C exhibi ed low le el GST and glu a- hione pe oxidase ac i i ies, which we e de ec able due o he high concen a ions o ecombinan enzyme ob ained (Table 2). Gs B exhibi ed a ou o six imes highe spe- ciWc ac i i y agains CDNB han ei he gs A o C, espec- i ely. No ac i i y was obse ed o ei he enzyme when DCNB o e hac ynic acid we e used as subs a es. The speciWc ac i i y obse ed agains cumene hyd ope oxide was almos six imes highe o gs B hen gs A/C (Table 2). Al hough ela i ely lowe , he ac ual a io o ela i e ac i i y agains CDNB was simila o ha p e iously ound (Veal e al., 2002) whe eby S. pombe gs 1 showed h ee imes g ea e ac i i y owa ds CDNB han gs 2. Con e sely, he glu a hione pe oxidase ac i i y o S. pombe gs 2 was abou wice ha obse ed o gs 1 albei a a six imes (app ox.) lowe le el o ha ound o A. umiga us gs B. GST speciWc ac i i y de e mina ions o S. pombe gs 1 (Kim e al., 2001) we e ca ied ou on cell lysa es using impu e gs 1, hus making exac compa ison diYcul . Howe e , gs 1 ac i i y was de ec able agains CDNB wi h no glu a hione pe oxidase ac i i y e iden . S. pombe gs 2 also possesses glu a hione ans e ase ac i i y, as measu ed by CDNB conjuga ion (Cho e al., 2002). The speciWc ac i i ies o he A. umiga us GSTs a e low in compa ison wi h o he cha ac e ised GSTs, how- e e , any loss o ac i i y due o he p esence o he (His)6 ag is unlikely as TEV p o ease emo al o he (His)6 ag ( om gs C) did no esul in enhanced ac i i y (da a no shown). Ul ima ely, ac i i y analysis o he na i e GSTs is equi ed o ully assess ac i i y. 4.2. Induc ion o A. umiga us GST exp ession wi h CDNB and H2O2 GSTs a e hough o be in ol ed in he esponse agains ex e nal and cellula oxins, and may also aid he cell when challenged by oxida i e s ess. A e ini ial g ow h in he absence o ei he CDNB o H2O2, A. umig- a us was u he cul u ed in he p esence o 200 M CDNB o 5 mM H2O2 and exp ession le els o gs A, gs B, and gs C de e mined by RT-PCR (Fig. 4). Mo e- o e , he diVe ence in amplicon size o gs A can be seen he eby conW ming he emo al o in onic sequence. P ime s speciWc o he calmodulin gene (Rome o e al., 2003) we e used o conW m absence o genomic DNA and RNA equi alence be ween ime-poin s. Low basal exp ession o gs A and gs C was de ec ed, bu gs B exp ession was no de ec able unde basal condi ions. Upon induc ion wi h CDNB, all h ee gs genes we e up- egula ed wi hin one hou , wi h gs A showing a 10- old induc ion (app oxima ely) and gs C showing a leas a 4- old induc ion a all ime-poin s, and gs B exhibi ing only weak induc ion, wi h a 20% d op in RNA exp ession a Table 2 SpeciWc ac i i ies o pu iWed ecombinan gs A, gs B, and gs C wi h bo h glu a hione ans e ase and glu a hione pe oxidase subs a es GST ac i i y was assayed wi h CDNB, DCNB and e hac ynic acid, and glu a hione pe oxidase ac i i y was assayed wi h cumene hyd o- pe oxide. Uni s a e exp essed as mic omoles subs a e u ilised pe min- u e. SpeciWc ac i i ies s a ed a e he a e age o W e eplica es and we e co ec ed agains blank eac ions ha had been pe o med in iplica e. N.D., no ac i i y de ec ed. Subs a e SpeciWc ac i i y (U mg¡1) (§SD) gs A gs B gs C CDNB 0.004 §0.0001 0.025 §0.0028 0.006 §0.0005 DCNB N.D. N.D. N.D E hac ynic acid N.D. N.D. N.D Cumene hyd ope oxide 0.019 §0.0009 0.145 §0.0088 0.025 §0.006 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 325 3 h pos induc ion (Fig. 4A). This esul is qui e in e es - ing as i is somewha a a iance wi h he abo e obse a- ion ha gs B exhibi s g ea e ac i i y owa ds CDNB han does gs A o gs C, howe e i is possible ha he highe speciWc ac i i y o gs B may necessi a e p oduc- ion o smalle amoun s o ac ual p o ein o conjuga e a ailable CDNB. P e ious wo k, whe eby -galac osi- dase exp ession was placed unde he con ol o he ups eam egula o y egions associa ed wi h gs 1 and gs 2 o S. pombe, has shown ha gs 1+ gene exp ession was enhanced by me cu ic chlo ide and menadione (gen- e a es supe oxide adicals), whe eas gs 2 exp ession was only signiWcan ly induced by he p esence o o-dini o- benzene (o-DNB) (Cho e al., 2002; Kim e al., 2001; Shin e al., 2002). o-DNB also induces GST gene exp ession in I. o ien alis (Tamaki e al., 1999). In he wo k p esen ed he e, exposu e o cells o H2O2 did no esul in gs B induc ion. Howe e , weak induc- ion o gs C was de ec ed wi hin 1 h pos -induc ion (app ox. 3- old inc ease o e T0) which s abilised a 2 and 3 h (app ox. 7- old inc ease o e T0). In addi ion, s ong exp ession o gs A a 1 h pos -induc ion was e i- den (a leas 5- old inc ease) which appea ed o u he inc ease a 2 h (app ox. 10- old inc ease o e T0) be o e educing a 3 h pos -induc ion (app ox. 4.5- old wi h espec o T0), possibly due o deple ion o added H2O2 (Fig. 4B). Gs B and gs C we e shown o be diVe en ially inducible by H2O2, whe eby up- egula ion o gs C exp ession only was obse ed. This indica es he possi- bili y o diVe en oles o hese p o eins wi hin he o ganism when subjec ed o en i onmen al s ess. P e i- ous wo k has also indica ed ha exp ession o gs 1, as well as gs 2, in S. pombe is induced by H2O2. This obse - a ion sugges s po en ially diVe en mechanisms a e in ol ed in he esponse o oxida i e s ess o bo h o ganisms and ha he A. umiga us gs B plays a diVe - en ole han gs 1 in S. pombe—an hypo hesis suppo ed by g ea e sequence di e gence be ween gs B and C in A. umiga us compa ed o he co esponding genes in S. pombe (Fig. 2). I is in iguing ha gs B exp ession was no induced in he p esence o H2O2, ye i exhibi ed he g ea es glu a hione pe oxidase ac i i y agains cumene hyd ope oxide. In i o, i is pos ula ed ha GST enzymes may be in ol ed in de oxiWca ion o seconda y oxida ion p oduc s p oduced by ini ial con e sion o eac i e oxygen species and H2O2 by enzymes such as glu a hione pe oxidase and supe oxide dismu ase (Hayes and McLellan, 1999). These seconda y oxida ion p oduc s include lipid and DNA oxida ion p oduc s, simila o cumene hyd ope oxide, and i is possible ha gs B exp ession is induced by he seconda y oxida ion p oduc s a he han di ec ly by H2O2. Thus, a pu a i e seconda y compound equi ed o induc ion o gs B may no ha e been p oduced when H2O2 was used as he induce . A. umiga us gs A was iden iWed ia homology sea ching o he A. umiga us genome using A. nidulans gs A. In ac , hese p o eins exhibi a e y high deg ee o sequence simila i y (83%) which indica es ha hey may sha e a common unc ion in bo h Aspe gillus spp. F ase e al. (2002) ha e shown ha gs A encodes a GST which is in ol ed in xenobio ic and me al ion esis ance in A. nidulans. A. umiga us gs A was s ongly up- egula ed in he p esence o bo h CDNB and H2O2. In addi ion, gs A ha bou s sequences ups eam o he ini ial ATG wi h simila i y o he xenobio ic (XRE) and an ioxidan esponsi e elemen s (ARE) in ol ed in egula ion o mammalian GSTs (Hayes and Pul o d, 1995; Rushmo e e al., 1991; Rushmo e and Picke , 1993). Al hough such esponsi e elemen s ha e no been demons a ed o be unc ional in he egula ion o ungal GSTs o da e, XRE and ARE ha e been iden iWed in he p omo e egions o gs genes in S. ce e isiae (Choi e al., 1998). DNA sequences om he A. umiga us genome (h p:// www. ig .o g) 2 kb ups eam o each gs gene we e exam- ined o he consensus XRE (TNGCGTG) and ARE (TGACNNNGC) egions. Se e al XRE and ARE-like egions we e obse ed ups eam o all h ee gs genes. Examina ion o ansc ip ional egula ion ia p omo e analysis linked o a epo e gene would be necessa y o conW m whe he hese esponsi e elemen s we e unc- ional and in ol ed in egula ion o gene exp ession in he p esence o CDNB and H2O2. The exp ession o all h ee gs genes in esponse o o ganism exposu e o CDNB and o gs A and C ollowing exposu e o Fig. 4. RT-PCR o A. umiga us cDNA isola ed om cul u es induced wi h ei he CDNB (A) o H2O2(B). A. umiga us RNA was isola ed p io o induc ion (T0), 1 h pos -induc ion (T1), 2 h pos -induc ion (T2), and 3 h pos -induc ion (T3). PCR was pe o med on cDNA using gs A, B, and C speciWc p ime s and p ime s speciWc o he calmodulin gene (CALM) (Rome o e al., 2003). Op imal cDNA ampliWca ion was ound o equi e 45 cycles o PCR. Aga ose gels we e loaded as ol- lows: M, DNA size ma ke ; T0; T1; T2; and T3; gDNA, genomic DNA con ol; and H2O, no DNA con ol. Exp ession o all h ee gs genes was obse ed when induced wi h CDNB, and induc ion o gs A and g s C only was seen wi h H2O2 induc ion. 326 C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 A. umiga us o H2O2 indica es a high likelihood ha GSTs play a ole in he esponse o A. umiga us o bo h xenobio ic p esence and oxida i e s ess and, as in o he ungal species (Veal e al., 2002), may be in ol ed in media ing an i- ungal d ug esis ance. 5. Summa y Th ee p e iously uniden iWed open eading ames encoding glu a hione ans e ases ha e been iden iWed in A. umiga us, which a e ei he cons i u i ely exp essed unde expe imen al condi ions employed (gs A and C) o inducible in esponse o xenobio ic (gs A, B, and C) o oxida i e s ess (gs A and C). Recombinan p o eins co - esponding o all h ee genes ha e been exp essed and enzyma ic ac i i y cha ac e is ic o glu a hione ans e ase and glu a hione pe oxidase deWned. The a ailabili y o his in o ma ion will acili a e u he explo a ion o he possible ole(s) played by GST in xenobio ic ole ance and media ing esponse o oxida i e s ess in A. umiga us. 6. Accession numbe s Sequences o he h ee Aspe gillus umiga us glu a- hione ans e ases desc ibed a e deposi ed in GenBank unde Accession Nos. AY770045, AY770043, and AY770044 (gs A o C) and AY770046 (gs A cDNA). Acknowledgmen s This wo k was unded unde he IRCSET/En e p ise I eland Basic Resea ch G an P og amme and he I ish Go e nmen P og amme o Resea ch in Thi d Le el Ins i u ions. Rachel Ge agh y was unded by Dublin Ci y Council s uden ship scheme, Clai e Ne ille was a ecipien o a Daniel O’Connell Fellowship om NUI Maynoo h. P elimina y sequence da a was ob ained om The Ins i u e o Genomic Resea ch websi e a h p://www. ig .o g. Sequencing o A. umiga us was unded by he Na ional Ins i u e o Alle gy and In ec- ious Disease U01 AI 48830 o Da id Denning and Wil- liam Nie man, he Wellcome T us , and Fondo de In es icagiones Sani a ias. Re e ences Be ou , S., Badoc, C., Mallie, M., Giamimis, J., Bas ide, J., 2002. Spo e diVusa e isola ed om some s ains o Aspe gillus umiga us inhib- i s phagocy osis by mu ine al eola mac ophages. FEMS Immunol. Med. Mic obiol. 33, 101–106. B ad o d, M., 1976. A apid and sensi i e me hod o he quan i a ion o mic og am quan i ies o p o ein u ilizing he p inciple o p o- ein-dye binding. Anal. Biochem. 72, 248–254. Cha, C.J., Coles, B.F., Ce niglia, C.E., 2001. Pu iWca ion and cha ac e - iza ion o a glu a hione S- ans e ase om he ungus Cunningham- ella elegans. FEMS Mic obiol. Le . 203 (2), 257–261. Cho, Y.W., Pa k, E.H., Fuchs, J.A., Lim, C.J., 2002. A second s ess- inducible glu a hione S- ans e ase gene om Schizosaccha omyces pombe. Biochim. Biophys. Ac a Gene S uc . Exp . 1574 (3), 399– 402. Choi, J.H., Lou, W., Vancu a, A., 1998. A no el memb ane-bound glu- a hione S- ans e ase unc ions in he s a iona y phase o he yeas Saccha omyces ce e isiae. J. Biol. Chem. 273 (45), 29915– 29922. Daly, P., Ka anagh, K., 2001. Pulmona y Aspe gillosis: clinical p esen- a ion, diagnosis and he apy. B . J. Biomed. Sci. 58, 197–205. Denning, D.W., 1998. In asi e aspe gillosis. Clin. In . Dis. 26, 781–805. Dowd, C.A., Buckley, C.M., Sheehan, D., 1997. Glu a hione S- ans e - ases om he whi e- o ungus, Phane ochae e ch ysospo ium. Bio- chem. J. 324, 243–248. Dowd, C.A., Sheehan, D., 1999. Va iable exp ession o glu a hione S- ans e ase isoenzymes in he ungus, Muco ci cinelloides. FEMS Mic obiol. Le . 170 (1), 13–17. Dowe , W.J., Mille , J.F., Ragsdale, C.W., 1988. High-eYciency ans- o ma ion o Esche ichia coli by high- ol age elec opo a ion. Nucleic Acids Res. 16 (13), 6127–6145. Ellis, D., 2002. Ampho e icin B: spec um and esis ance. J. An imic- ob. Chemo he . 49, 7–10. Foley, V., Sheehan, D., 1998. Glu a hione S- ans e ases o he yeas Ya owia lipoly ica ha e unusually la ge molecula mass. Biochem. J. 333, 839–845. F ase , J.A., Da is, M.A., Hynes, M.J., 2002. A gene om Aspe gillus nidulans wi h simila i y o URE2 o Saccha omyces ce e isiae encodes a glu a hione S- ans e ase which con ibu es o hea y me al and xenobio ic esis ance. Appl. En i on. Mic obiol. 68 (6), 2802–2808. Ga dine , D.M., Cozijnsen, A.J., Wilson, L.M., Ped as, M.S.C., How- le , B.J., 2004. The si odesmin biosyn he ic gene clus e o he plan pa hogenic ungus Lep osphae ia maculans. Mol. Mic obiol. 53 (5), 1307–1318. Habdous, M., Vincen -Vi y, M., Vis ikis, S., Sies , G., 2002. Rapid spec opho ome ic me hod o se um glu a hione S- ans e ases ac i i y. Clin. Chim. Ac a 326 (1-2), 131–142. Habig, W.H., Jakoby, W.B., 1981. Assays o diVe en ia ion o glu a hi- one-S- ans e ases. Me hods Enzymol. 77, 398–405. Hayes, J.D., McLellan, L.I., 1999. Glu a hione and glu a hione-depen- den enzymes ep esen a coo dina ely egula ed de ence agains oxida i e s ess. F ee Radic. Res. 31 (4), 273–300. Hayes, J.D., Pul o d, D.J., 1995. The glu a hione S- ans e ase supe - gene amily: egula ion o GST and he con ibu ion o he isoen- zymes o cance chemop o ec ion and d ug esis ance. C i . Re . Biochem. Mol. Biol. 30 (6), 445–600. Kim, H.G., Pa k, K.N., Cho, Y.W., Pa k, E.H., Fuchs, J.A., Lim, C.J., 2001. Cha ac e iza ion and egula ion o glu a hione S- ans e ase gene om Schizosaccha omyces pombe. Biochim. Biophys. Ac a Gene S uc . Exp . 1520 (2), 179–185. Mi chell, C.G., Sligh , J., Donaldson, K., 1997. DiVusible componen om he spo e su ace o he ungus Aspe gillus umiga us which inhibi s he mac ophage oxida i e bu s is dis inc om glio oxin and o he hyphal oxins. Tho ax 52, 796–801. Mu yama, T., Ami ani, R., Ikegami, Y., Awada, R., Lee, W.J., Kuze, F., 1996. Supp essi e eVec s o Aspe gillus umiga us cul u e Wl a es on human al eola mac ophages and polymo phonuclea leucocy es. Eu . Respi . J. 9, 293–300. Nicholson, T.P., Rudd, B.A.M., Dawson, M., Laza us, C.M., Simpson, T.J., Cox, R.J., 2001. Design and u ili y o oligonucleo ide gene p obes o ungal polyke ide syn hases. Chem. Biol. 8, 157–178. Page, R.D.M., 1996. TREEVIEW: an applica ion o display phyloge- ne ic ees on pe sonal compu e s. Compu . Appl. Biosci. 12, 357– 358. C. Bu ns e al. / Fungal Gene ics and Biology 42 (2005) 319–327 327 Rai, R., Ta e, J.J., Coope , T.G., 2003. U e2, a p ion p ecu so wi h homology o glu a hione S- ans e ase, p o ec s Saccha omyces ce e isiae cells om hea y me al ion and oxidan oxici y. J. Biol. Chem. 278, 12826–12833. Rome o, B., Tu ne , G., Oli as, I., Labo da, F., De Lucas, J.R., 2003. The Aspe gillus nidulans alcA p omo e d i es igh ly egula ed condi ional gene exp ession in Aspe gillus umiga us pe mi ing al- ida ion o essen ial genes in his human pa hogen. Fungal Gene . Biol. 40 (2), 103–114. Rushmo e, T.H., Mo on, M.R., Picke , C.B., 1991. The an ioxidan esponsi e elemen -ac i a ion by oxida i e s ess and iden iWca ion o he DNA consensus sequence equi ed o unc ional ac i i y. J. Biol. Chem. 266 (18), 11632–11639. Rushmo e, T.H., Picke , C.B., 1993. Glu a hione S- ans e ases, s uc- u e, egula ion, and he apeu ic implica ions. J. Biol. Chem. 268 (16), 11475–11478. Sheehan, D., Meade, G., Foley, V.M., Dowd, C.A., 2001. S uc u e, unc ion and e olu ion o glu a hione ans e ases: implica ions o classiWca ion o non-mammalian membe s o an ancien enzyme supe amily. Biochem. J. 360, 1–16. Shin, Y.H., Pa k, E.H., Fuchs, J.A., Lim, C.J., 2002. Cha ac e iza ion, exp ession and egula ion o a hi d gene encoding glu a hione S- ans e ase om he Wssion yeas . Biochim. Biophys. Ac a Gene S uc . Exp . 1577 (1), 164–170. Takada, Y., Uda, K., Kawamu a, K., Ma suoka, T., 2004. Molecula cloning and cha ac e iza ion o a no el glu a hione S- ans e ase gene induced by ligh s imula ion in he p o ozoan Blepha isma japonicum. FEMS Mic obiol. Le . 231 (2), 185–189. Tamaki, H., Yamamo o, K., Kumagai, H., 1999. Exp ession o wo glu- a hione S- ans e ase genes in he yeas Issa chenkia o ien alis is induced by o-dini obenzene du ing cell g ow h a es . J. Bac e iol. 181 (9), 2958–2962. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: imp o ing he sensi i i y o p og essi e mul iple sequence align- men h ough sequence weigh ing, posi ion-speciWc gap penal ies and weigh ma ix choice. Nucleic Acids Res. 22 (22), 4673–4680. Veal, E.A., Toone, W.M., Jones, N., Mo gan, B.A., 2002. Dis inc oles o glu a hione S- ans e ases in he oxida i e s ess esponse in Schizosaccha omyces pombe. J. Biol. Chem. 277 (38), 35523–35531.