The isolation of microsatellite loci in the Mediterranean fruitfly Ceratitis capitata (Diptera: Tephritidae) using a biotin/streptavidin enrichment technique

Molecula Ecology No es (2001) 1 , 120–122 © 2001 Blackwell Science L d Blackwell Science, L d PRIMER NOTE The isola ion o mic osa elli e loci in he Medi e anean ui ly Ce a i is capi a a (Dip e a: Teph i idae) using a bio in/s ep a idin en ichmen echnique D. G. CASEY and A. M. BURNELL Ins i u e o Bioenginee ing & Ag oecology, Biology Depa men , Na ional Uni e si y o I eland, Maynoo h, Co. Kilda e, I eland Abs ac The Med ly ( Ce a i is capi a a ) is a polyphagous dip e an pes which has sp ead om No h A ica o he coun ies o he Medi e anean Basin and has also in aded opical and sub opical egions h oughou he wo ld. Colonizing popula ions ypically possess low le els o gene ic a iabili y. Mic osa elli es p o ide an e ec i e means o in es iga ing he popula ion s uc u e o such gene ically depaupe a e popula ions, howe e , mic osa elli e ma ke s adi ionally equi e a long phase o de elopmen in new axa. We used a bio in/ s ep a idin cap u e echnique o isola e mic osa elli es di ec ly om C. capi a a genomic DNA and we desc ibe he e he iden i ica ion o se en polymo phic mic osa elli e ma ke s in C. capi a a . Keywo ds : Ce a i is capi a a , en ichmen p o ocol, Med ly, mic osa elli e Recei ed 18 No embe 2000; e ision accep ed 4 Janua y 2001 The Medi e anean ui ly (Med ly) Ce a i is capi a a , a polyphagous mul i ol ine pes o g ea economic impo ance, in aded Spain om No h A ica o e 150 yea s ago (Hagen e al . 1981). The Med ly has since sp ead o mos o he coun ies o he Medi e anean Basin and has also colonized opical and sub opical egions h oughou he wo ld. To manage his pes , i is impo an o ind gene ic ma ke s sui able o de e mining he geog aphical o igin o C. capi a a popula ions in ading new a eas. Because o ounde e ec s and gene ic bo lenecks, colonizing popula ions ypically possess low le els o gene ic a iabili y. Mic osa elli es p o ide an e ec i e means o in es iga ing he popula ion s uc u e o such gene ically depaupe a e popula ions. We ha e used a bio in/s ep a idin cap u e echnique (Re se h e al . 1997; Ga dne e al . 1999) o isola e mic osa elli es di ec ly om C. capi a a genomic DNA and we ha e iden i ied se en polymo phic mic osa elli e ma ke s ha a e sui able o he analysis o he gene ic s uc u e and gene low s udies in C. capi a a popula ions. C. capi a a genomic DNA was isola ed using s anda d phenol/chlo o o m ex ac ion wi h RNase (20 µ g/mL) diges ion (Mania is e al . 1989). Fi e µ g o Med ly genomic DNA we e diges ed in a olume o 50 µ L wi h 10 uni s o Mbo I (P omega) o 5 h a 37 ° C, ollowed by hea inac i a- ion o Mbo I a 65 ° C o 30 min. The oligonucleo ides, linke A, 5 ′ -GGGTAGGATGGGGGATGGG-3 ′ (1.6 nmol) and linke B, 5 ′ -GATCCCCATCCCCCATCCTACCC-3 ′ (1.6 nmol) we e mixed and hea dena u ed o 5 min a 95 ° C in a o al olume o 60 µ L con aining 50 m m T is- ace a e pH 7.5, 10 m m magnesium ace a e, 50 m m po assium ace a e, and allowed o cool slowly o e nigh o oom empe a u e o gene a e he double-s anded Mbo I adap e . This adap e (0.53 nmole) was liga ed o 5 µ g o Mbo I diges ed genomic DNA in a olume o 100 µ L con aining 30 m m T is-HCl pH 7.8, 10 m m MgCl 2 , 1 m m ATP, 10 µ g bo ine se um albumin (P omega) and 40 uni s T4 DNA Ligase (P omega). Excess adap e molecules and low molecula weigh genomic DNA we e emo ed by cen i- uging he liga ion eac ion h ough a Mic on 50 il e (Amicon®) a 16 100 g o 30 s. Cleaned elu an was eco - e ed by in e ing he sample ese oi and spinning a 16 100 g o a u he 30 s in o a 1.5-mL ube. Adap e liga ed DNA was hyb idized o 1 µ g (15 nmol) o bio- inyla ed p obe in a o al olume o 100 µ L con aining 50 µ L o 2 × binding and washing (B & W) bu e (10 m m Co espondence: A. M. Bu nell. Fax: + 353 1 7083845; E-mail: [email p o ec ed] men_038. m Page 120 F iday, Augus 24, 2001 8:43 AM PRIMER NOTE 121 © 2001 Blackwell Science L d, Molecula Ecology No es , 1, 120–122 T is-HCl, pH 7.5; 1 m m EDTA, 2.0 m NaCl: Dynal). The bio ynla ed p obes used we e 5 ′ -(AC) 10 GAGC[Bio in]A- 3 ′ , 5 ′ -(AG) 10 GCAC[Bio in]A-3 ′ and 5 ′ -(TGC) 10 AGCG- [Bio in]A-3 ′ . Following hea dena u a ion o 5 min a 95 ° C, he hyb idiza ion mix u e was apidly cooled o he app op ia e hyb idiza ion empe a u e (AC 10 and AG 10 , 50 ° C; TGC 10 , 55 ° C). In a sepa a e ube 100 µ L o Dyna- beads® M-280 S ep a idin (Dynal®) we e washed h ee imes in 100 µ L o B & W bu e . The hyb idiza ion eac ion was added o he p epa ed bead mix and incuba ed wi h gen le agi a ion a he hyb idiza ion empe a u e o 30 min. The cap u ed agmen s we e washed h ee imes in 100 µ L o 1 × SSC a oom empe a u e ollowed by h ee washes in 100 µ L o 1 × SSC a 30 ° C. Cap u ed agmen s we e elu ed om he beads by hea ing o 5 min a 95 ° C and we e pu i ied using a Mic on 50 il e (Amicon®). The mic osa elli e en iched e en a e was polyme ase chain eac ion (PCR) ampli ied in a 50- µ L PCR eac ion con aining 1 × PCR bu e (P omega), 4 m m MgCl 2 , 10 m m dNTPs, 10 pmol o linke A and 1 uni o Taq polyme ase (P omega). PCR was ca ied ou in a Pe kin-Elme 2400 The mal cycle wi h one cycle o dena u ing a 94 ° C o 5 min ollowed by 35 cycles o 95 ° C o 45 s, 63 ° C o 45 s and 72 ° C o 90 s, ending wi h one cycle o 72 ° C o 10 min. PCR p oduc s we e cloned using he TOPO TA cloning sys em® (In i ogen). Recombinan clones we e es ed o mic osa elli e epea sequences by a h ee-p ime PCR ampli ica ion es (Ga dne e al . 1999). P oduc s om clones ha yielded wo o mo e bands in he h ee-p ime es we e pu i ied using he S a aP ep™ ki (S a agene) and we e sequenced on a ABI P ism® 310 Gene ic ana- lyse . The esul s o he h ee-p ime es s and DNA sequencing a e p esen ed in Table 1. PCR p ime s we e designed o eigh C. capi a a mic osa elli e loci and se en o hese loci we e polymo phic (Table 2). App oxima ely 20 indi iduals om i e C. capi a a popula ions we e Table 1 The esul s o he PCR h ee-p ime es s and DNA sequencing analyses on ecombinan clones o Ce a i is capi a a genomic DNA gene a ed using a bio in/s ep a idin magne ic en ichmen p o ocol P obe To al(AC)10 (AG)10 (TGC)10 No. o clones es ed in h ee-p ime PCR es 19 9 5 33 No. o clones yielding wo o mo e PCR bands 13 3 2 18 (54.5%) No o sequenced clones which con ained mic osa elli es* 13 3 2 18 (100%) *Recombinan clones which yielded wo o mo e bands in he h ee-p ime es we e sequenced. Table 2 Cha ac e is ics o se en mic osa elli e loci o Ce a i is capi a a Locus Mo i P ime sequence (5 ′− 3 ′ ). F: o wa d, R: e e se Size* (bp) Allele size ange (bp) T a ( ° C) D A H O H E GenBank Accession no. dccap1 ( CA ) 2 CTGC ( CA ) 4 F: ACATACACACTGACATCCGCTAAGT R: CCAATAACGACGACAATCACC 152 277–281 56 3 0.63 0.43 AF267491 dccap2 ( TGCCGC ) 2 ( TGC ) 11 CAC ( TGC ) 2 F: GCAACAACAAAGCAAAGCAA R: ATCGGGGTAACGGCTGAGTA 214 288–312 58 4 0.41 0.33 AF267489 dccap4 ( AT ) 4 ( CA ) 8 F: CTAGGGAACCCTGGGGGAGG R: CTTCCCTTTATGCCCGTATGTAT 184 284–344 58 4 0.51 0.45 AF267494 dccap5 ( AC ) 2 TA ( TG ) 3 AT ( TG ) 5 C ( TG ) 6 TC ( TG ) 3 F: GCAATGAAAGCAAGCAACAA R: GCCGTGAAAGGTGAATGAC 223 336–344 56 3 0.16 0.35 AF267287 dccap6 ( AT ) 2 AG ( AT )4(AC)2(AT)2(AC)3F: AGCCTGTTTTGACCAACGTC R: CGTCACTTAGCGGATGTTCAG 164 287–229 58 4 0.58 0.4 AF267493 dccap1.1 (TA)2TG(TA)2CATG(TA)2CAT(AC)2GTC(TG)4F: TGCCAATAACGACGAAATC R: AGCCGAAGAATTGGCATTTA 152 277–279 56 2 0.6 0.44 AF267492 dccap9 (TGCCGC)2(TGC)4TAC(TGC)2CGC(TGC)2F: AGTGTCTGAAAACACAACAGCAAC R: GTTGTATTGTTGCACGAGGATATG 239 306–324 58 4 0.5 0.46 AF267490 The locus name, epea mo i , p ime sequence, annealing empe a u e, sequenced allele size and GenBank accession no. o mic osa elli e loci isola ed a e gi en. The numbe o dis inc alleles (DA) and le els o he e ozygosi y (HO = obse ed p opo ion o he e ozygo es, HE = expec ed p opo ion o he e ozygo es) a e based on da a om 20 indi iduals om i e popula ions. men_038. m Page 121 F iday, Augus 24, 2001 8:43 AM 122 PRIMER NOTE © 2001 Blackwell Science L d, Molecula Ecology No es, 1, 120–122 assessed. Genomic DNA om single lies was isola ed using he DNeasy™ Tissue Ki (Qiagen). Mic osa elli e loci we e ampli ied in 25 µL PCR eac ions con aining 50 ng o C. capi a a genomic DNA, 1 × PCR bu e (P omega) (10 mm T is-HCl pH 8.3, 50 mm KCl), 2.5 mm MgCl2, 200 µm o each dNTP, 10 pmol o each p ime and 1 uni o Taq polyme ase (P omega). Ampli ica ions we e ca ied ou in a Pe kin-Elme 2400 The mal cycle wi h one cycle o dena u ing a 94 °C o 5 min ollowed by 35 cycles o 45 s a 95 °C, 45 s a he p ime -speci ic annealing empe a u e (Table 2), 72 °C o 90 s, ending wi h one cycle o 72 °C o 10 min. P oduc s we e elec opho esed on s anda d sequencing gels (6% ac ylamide, 8 m u ea, in 1 × TBE) and isualized using he Sil e Sequence™ DNA S aining Sys em (P omega). Analyses o gene ic di e si y we e ca ied ou using genepop so wa e (Raymond & Rousse 1995). Numbe s o dis inc alleles anged om one o ou pe locus wi h obse ed and expec ed he e ozygosi ies anging om 0.32 o 0.63 (Table 2). Null alleles we e iden i ied in he locus dccap5. The o e all gene ic di e si y (Nei 1987) ound in his s udy (GD = 0.51) is compa able wi h alues epo ed in Medi e anean C. capi a a popula ions by Bonizzoni e al. (2000). These se en mic osa elli e loci a e cu en ly being used o analyse gene low and mu a ion p ocesses in C. capi a a popula ions om he Medi e a- nean Basin. Acknowledgemen s We hank Michael Ga dne o p o iding a copy o his en ichmen p o ocol p io o publica ion, Unn Re se h o he linke sequence and Thomae Kakouli-Dau e o Ce a i is capi a a genomic DNA. The esea ch was suppo ed by he Eu opean Communi y (P ojec FAIRPL 96–1972). Re e ences Bonizzoni M, Malac ida AR, Gugliemino CR, Gomulski LM, Gaspe i G, Zheng L (2000) Mic osa elli e polymo phism in he Medi e anean ui ly Ce a i is capi a a. Insec Molecula Biology, 9, 251–261. Ga dne MG, Coope SJB, Bull CM, G an WN (1999) Isola ion o mic osa elli e loci om a social liza d Ege nia s okesii, using a modi ied en ichmen p ocedu e. Jou nal o He edi y, 90, 301–304. Hagen KS, William WW, Tassen RL (1981) Medi e anean ui ly: The wo s may be ye o come. Cali o nia Ag icul u e, 35, 5–7. Mania is T, F i sch EF, Samb ook J (1989) Molecula Cloning: a Labo a o y Manual. Cold Sp ing Ha bou Labo a o y P ess, New Yo k. Nei M (1987) Molecula E olu iona y Gene ics. Columbia Uni e si y P ess, New Yo k. Raymond M & Rousse F (1995) genepop (Ve sion 1.2): popula ion gene ics so wa e o exac es s and ecumenicism. Jou nal o He edi y, 86, 248–249. Re se h UH, Fangan BM, Jakobsen KS (1997) Hyb idisa ion cap u e o mic osa elli es di ec ly om genomic DNA. Elec o- pho esis, 18, 1519–1523. men_038. m Page 122 F iday, Augus 24, 2001 8:43 AM