Vi uses 2013, 5, 1719-1739; doi:10.3390/ 5071719
i uses
ISSN 1999-4915
www.mdpi.com/jou nal/ i uses
A icle
De elopmen o a Magne ic Elec ochemical Ba Code A ay o
Poin Mu a ion De ec ion in he H5N1 Neu aminidase Gene
Ludmila K ejco a 1, Da id Hynek 1,2, Pa el Kopel 1,2, Miguel Angel Me los Rod igo 1,2,
Voj ech Adam 1,2, Ja omi Hubalek 2,3, Pe Babula 2,4, Libuse T nko a 1,2,5 and Rene Kizek 1,2,*
1 Depa men o Chemis y and Biochemis y, Facul y o Ag onomy, Mendel Uni e si y in B no,
Zemedelska 1, B no CZ-613 00, Czech Republic; E-Mails: lidak ejco
[email protected] (L.K.);
[email p o ec ed] (D.H.); [email p o ec ed] (P.K.);
[email p o ec ed] (M.A.M.R.); [email p o ec ed] (V.A.);
[email protected] (L.T.)
2 Cen al Eu opean Ins i u e o Technology, B no Uni e si y o Technology, Technicka 3058/10,
B no CZ-616 00, Czech Republic; E-Mails: [email p o ec ed] (J.H.);
[email p o ec ed] (P.B.)
3 Depa men o Mic oelec onics, Facul y o Elec ical Enginee ing and Communica ion,
B no Uni e si y o Technology, Technicka 10, B no CZ-616 00, Czech Republic
4 Depa men o Na u al D ugs, Facul y o Pha macy, Uni e si y o Ve e ina y and Pha maceu ical
Sciences, Palackeho 1-3, B no CZ-612 42, Czech Republic
5 Depa men o Chemis y, Facul y o Science, Masa yk Uni e si y, Ko la ska 2, B no CZ-611 37,
Czech Republic
* Au ho o whom co espondence should be add essed; E-Mail: [email p o ec ed];
Tel.: +420-545-133-350; Fax: +420-545-212-044.
Recei ed: 17 May 2013; in e ised o m: 10 June 2013 / Accep ed: 1 July 2013 /
Published: 15 July 2013
Abs ac : Since i s i s o icial de ec ion in he Guangdong p o ince o China in 1996, he
highly pa hogenic a ian in luenza i us o H5N1 sub ype (HPAI H5N1) has epo edly
been he cause o ou b eaks in bi ds in mo e han 60 coun ies, 24 o which we e Eu opean.
The main issue is s ill o de elop e ec i e an i i al d ugs. In his case, single poin
mu a ion in he neu aminidase gene, which causes esis ance o an i i al d ug and is,
he e o e, subjec ed o many s udies including ou s, was obse ed. In his s udy, we
de eloped magne ic elec ochemical ba code a ay o de ec ion o single poin mu a ions
(misma ches in up o ou nucleo ides) in H5N1 neu aminidase gene. Pa amagne ic
pa icles Dynabeads® wi h co alen ly bound oligo (dT)25 we e used as a ool o isola ion
OPEN ACCESS
Vi uses 2013, 5 1720
o complemen a y H5N1 chains (H5N1 Zhejin, China and Aichi). Fo de ec ion o H5N1
chains, oligonucleo ide chains o leng hs o 12 (+5 adenine) o 28 (+5 adenine) bp labeled
wi h quan um do s (CdS, ZnS and/o PbS) we e used. Indi idual p obes hyb idized o
a ge molecules speci ically wi h e iciency highe han 60%. The ob ained signals
iden i ied mu a ions p esen in he sequence. Sugges ed expe imen al p ocedu e allows
ob aining u he in o ma ion om he edox signals o nucleic acids. Mo eo e , he used
biosenso exhibi s sequence speci ici y and low limi s o de ec ion o subnanog am
quan i ies o a ge nucleic acids.
Keywo ds: ol amme y; highly pa hogenic in luenza; an i i al esis ance; pa amagne ic
pa icles; hyb idiza ion; quan um do s; au oma ed sepa a ion; elec ochemis y
1. In oduc ion
Highly pa hogenic a ian in luenza A (HPAI), sub ype H5N1, ep esen s a h ea o he human
popula ion [1]. While espi a o y symp oms and e e a e ypical signs o in luenza, H5N1 has a high
incidence o neu ological sequelae in many animal species and spo adically in humans, bu i
ep esen s a con inuous dange o global pandemic associa ed wi h high mo ali y [2,3]. HPAI i uses
ha e caused millions o dea hs in domes ic poul y, and hund eds o dea hs in humans [4]. Ci cula ing
o in luenza i uses in wild animals poses he isk o human heal h [5,6]. Humans can be in ec ed also
by animal sub ypes, such as a ian in luenza i us H5N1 and H9N2 and swine in luenza i us H1N1
and H3N2 [7–9]. The p ima y isk ac o o human in ec ion appea s o be di ec o indi ec exposu e
o in ec ed li e o dead animals o con amina ed en i onmen s [10]. H5N1 occu s in wo dis inc
pa ho ypes in bi d popula ion, seasonal low pa hogenic a ian in luenza (LPAI), and highly pa hogenic
a ian in luenza (HPAI) [11–14]. LPAI may become HPAI o poul y h ough mu a ions a e
in oduc ion om wild bi ds o poul y, bu only wo sub ypes (H5 and H7) can become HPAI [15–17].
These i uses may esul in 100% mo ali y wi hin a suscep ible poul y species [16]. The mechanism
o mu a ion o LPAI o HPAI is based on passage in suscep ible animals, ypically poul y du ing
se e al mon hs. New gene a ed HPAI i us has b oken ou in locks o poul y as so as in wild bi ds,
and caused de as a ion wi h huge economic and ecologic impac [3,18]. HPAI poses isk no only o
bi ds, he e we e also epo ed spo adic human in ec ions wi h low mo bidi y bu high mo ali y,
nea ly 60% [19–21].
HPAI is no capable o d ople in ec ion om human o human. Fo his eason, sp ead o H5N1
i us in he human popula ion is limi ed [22]. The e is a conce n ha H5N1 may ob ain his abili y and
become pose a po en ial pandemic haza d o public heal h wo ldwide [23–27]. In luenza i uses can
de elop esis ance o pha macological mechanism o neu aminidase inhibi o s (NAIs) ha is based on
he loss o binding a ini y o hese d ugs. An i i al esis ance in in luenza may no de elop en i ely
du ing ea men bu also some imes ansmi widely o eplace suscep ible s ains in he absence o
d ug p essu e [28]. Recen ly, di e en au ho s showed di e en me hods o de e mina ion o
mu a ions in H5N1. Spa se lea ning me hod was de eloped o iden i y an igenici y-associa ed si es in
highly pa hogenic H5N1 in luenza i us HA based on immunologic da a se s [29]. The analysis o
Vi uses 2013, 5 1721
comple e genome sequences, gene ic e olu ion and phylogene ic analyses showed ha he sequence
analysis o H5N1 in luenza i us displayed he d ug- esis an mu a ions in he ma ix p o ein and NA
genes [30]. This ac is impo an o be e unde s anding he p e alence and adap a ion o H5N1
in luenza i uses in di e en coun ies [31,32]. The con inuous mu a ions in NA gene gi e ise
o a g ea necessi y o moni o i s sequence o de ec ion o any possibili ies o d ug esis ance in
H5N1 [33–36].
The cu en s udy was a ge ed o de ec possible mu a ions in NA gene o bo h diagnosis
and ea men pu poses. Neu aminidase inhibi o s esis ance is based on single-poin mu a ions o
neu aminidase gene (H 275 Y) [37,38]. Ou choice o h ee a ious gene sequences o neu aminidase
o H5N1 in luenza was based on his assump ion. The e was chosen sec ions, in which he sequences
di e ed om each o he . This way was conside ed as a model o poin mu a ion. Fu he , we
epo mul i- a ge de ec ion o poin mu a ion in H5N1 NA gene. As a model eal sample RNA
oligonucleo ide (RNA ODN) labeled wi h CdS was es ed. Isola ion and de ec ion was ca ied ou
unde condi ions op imized by labeled DNA oligonucleo ide. In addi ion, we desc ibed hyb idiza ion
assay based on au oma ic isola ion by modi ied pa amagne ic pa icles (MPs). Isola ed a ge molecule
labeled by quan um do s (QDs) was de ec ed by elec ochemical analysis.
2. Expe imen al Sec ion
2.1. Chemicals
All used chemicals in ACS pu i y we e pu chased om Sigma Ald ich (Sigma-Ald ich, S . Louis,
MO 3050 Sp uce S ., S . Louis, MO 63103, USA) unless no ed o he wise. S ock solu ions we e
p epa ed wi h ACS wa e . The pH alue was measu ed using inoLab Le el 3 (Wissenscha lich-
Technische We ks a en GmbH; Weilheim, Ge many). Deionized wa e unde wen demine aliza ion
by e e se osmosis using Aqua Osmo ic 02 (Aqua Osmo ic, Tisno , Czech Republic) and was
subsequen ly pu i ied using Millipo e RG (MiliQ wa e , 18 MΏ, Millipo e Co p., Bille ica, MA 3050
Sp uce S ., S . Louis, MO 63103, USA). Deionized wa e was used o insing, washing and
bu e p epa a ion.
2.2. P epa a ion o QDs (CdS, PbS and ZnS)
All chemicals we e pu chased om Sigma-Ald ich (S . Louis, MO, USA) and used wi hou u he
pu i ica ion. CdS quan um do s (QDs) we e p epa ed wi h a sligh ly modi ied me hod published
in [39]. B ie ly, cadmium ni a e e ahyd a e Cd(NO3)2 · 4H2O (0.0309 g, 0.1 mM) was dissol ed in
ACS wa e (25 mL). 3-me cap op opionic acid (35 µL, 0.4 mM) was slowly added o s i ed solu ion.
A e wa ds, pH was adjus ed o 9.11 wi h 1 M ammonia solu ion (NH4OH, 1.5 mL). Sodium sulphide
nanohyd a e Na2S · 9H2O (0.0240 g, 0.1 mM) in 23 mL o ACS wa e was pou ed in o he i s
solu ion wi h igo ous s i ing. Ob ained yellow solu ion was s i ed o 1 h. ZnS QDs we e p epa ed
simila ly o CdS QDs; zinc ni a e hexahyd a e Zn(NO3)2·6H2O (0.0298 g, 0.1 mM) was used in he
p epa a ion. Colo less solu ion was ob ained.
PbS QDs we e p epa ed by modi ied me hod o Hennequin [40]. Lead ace a e ihyd a e
Pb(OAc)2·3H2O (0.0379 g, 0.1 mM) was dissol ed in ACS wa e (25 mL). 3-me cap op opionic acid
Vi uses 2013, 5 1722
(60 µL, 0.69 mM) was slowly added o s i ed solu ion. Whi e p ecipi a e, which disappea ed a e
addi ion o 3.8 mL o 1 M ammonia solu ion (pH 9.88), was o med. Sodium sul ide nonahyd a e
Na2S · 9H2O (0.0120 g, 0.05 mM) in 21.2 mL o ACS wa e was added unde igo ous s i ing. Colo
o solu ion was b own. All QDs solu ions we e s o ed in da k a 4 °C p io o use.
2.3. Labeling o In luenzas’ De i ed DNA and RNA Oligonucleo ides wi h QDs (CdS, PbS and ZnS)
P obes we e ound in he GenBank da abase a NCBI ([41], Tables 1,2) and syn hesized by
Sigma-Ald ich. The numbe o Zhejiang, China and Aichi ODN we e DQ643810, EU263982, and
AB684120, espec i ely. B ie ly, ODN-SH (DNA o RNA) (100 µL, 100 µg.mL−1) was mixed wi h a
solu ion o NPs (100 µL, 100 µg.mL−1). This mix u e was shaken o 24 h a oom empe a u e (Vo ex
Genie2, Scien i ic Indus ies, 70 O ille D i e, Bohemia, NY, USA). Subsequen ly, solu ion was
dialyzed agains 2000 ML o miliQ wa e (24 h, 4 °C) using a Millipo e memb ane il e 0.025 µm
VSWP. Du ing dialysis he sample was dilu ed o 800 µL. Dilu ed sample was concen a ed o he inal
olume o 500 µL on a cen i uge il e de ice Amicon Ul a 3k (Millipo e, Me ck Millipo e
Headqua e s 290 Conco d Road, Bille ica, MA 01821, USA). Cen i uge 5417R (Eppendo ,
Hambu g, Ge many) was se o he ollowing pa ame e s: 15 min, 4,500 pm, 15 °C.
Table 1. P obes and a ge DNA oligonucleo ides de i ed om in luenza gene o neu aminidase.
P obe
Ta ge
Zhejiang 5´ TCTGCATTCCAA AAAAA 3´
Zhejiang 5´ TTGGAATGCAGA (Th) 3´
China 5´ TCTGCATTCCAG AAAAA 3´
China 5´ CT GGAATGCAGA (Th) 3´
Aichi 5´ CCTGCATTCCAT AAAAA 3´
Aichi 5´ ATGGAATGCAGG (Th) 3´
Zhejiang 5´ TCTGCATTCCAAGTGGGAGCATGAGATGAAAAA 3´
Zhejiang 5´ CATCTCATGCTCCCACTTGGAATGCAGA (Th) 3´
China 5´ TCTGCATTCCAGATGGGAGCATGAGATGAAAAA 3´
China 5´ CATCTCATGCTCCCATCTGGAATGCAGA (Th) 3´
Aichi 5´ CCTGCATTCCATATGGGAGCATGAGATAAAAAA 3´
Aichi 5´ TATCTCATGCTCCCATATGGAATGCAGG (Th) 3´
Red highligh ed nucleo ides ep esen a poin mu a ion in he gene o H5N1 in luenza o neu aminidase.
Table 2. P obes and a ge RNA oligonucleo ides de i ed om in luenza gene o neu aminidase.
P obe
Ta ge
China 5´ UCUGCAUUCCAG AAAAA 3´
China 5´ CU GGAAUGCAGA (Th) 3´
China 5´ UCUGCAUUCCAGAUGGGAGCAUGAGAUGAAAAA 3´
China 5´ CAUCUCAUGCUCCCAUCUGGAAUGCAGA (Th) 3´
2.4. Cha ac e iza ion o ODN-QDs by MALDI-TOF/TOF
The ODN-SH-QDs we e cha ac e ized using MALDI-TOF/TOF mass spec ome e B uke
Ul a lex eme (B uke Dal onik GmbH, B emen, Ge many) equipped wi h a lase ope a ing a
wa eleng h o 355 nm wi h an accele a ing ol age o 25 kV, cooled wi h ni ogen and a maximum
ene gy o 50.4 µJ wi h epe i ion a e 2,000 Hz in e lec o and posi i e mode, and wi h so wa e o
da a acquisi ion and p ocessing o mass spec a lexCon ol and lexAnalysis Ve sion 3.4.
3-hyd oxypicolinic acid (3-HPA) was used as a ma ix. The ma ix 3-HPA was dissol ed in ACS
wa e o he concen a ion o 25 mg.mL–1 and 10 mg.mL–1 diammonium ci a e (DAC) was added.
Mix u e was ho oughly o exed o 2 min a oom empe a u e. Wo king s anda d solu ions we e
p epa ed daily by dilu ion o he s ock solu ions. The samples we e p epa ed by dissol ing wi h ACS
Vi uses 2013, 5 1723
wa e . 1 µL o ma ix was applied on he ancho chip a ge pla e (B uke ) and d ied unde a mosphe ic
p essu e and oom empe a u e. 1 µL oligo sample a a concen a ion o 40 µg.mL–1 was applied on op
o his hin laye and d ied unde a mosphe ic p essu e and oom empe a u e. A mix u e o oligo
calib a ions s anda d (15-me , 20-me and 25-me ) was used o calib a ion o he ins umen .
2.5. Au oma ic Isola ion o ODN-QDs
Au oma ic pipe ing s a ion EP Mo ion 5075 (Eppendo , Ge many) wi h o iginal de ices
(mic opla e holde , ips holde , ips (1,000, 300, 50 μL), ack ubes, ese oi holde , con aine o used
ips, he mo adap e , PCR pla e 96, magne ic adap e ) was used o he ully au oma ed a ge nucleic
acids isola ion p ocess (Figu e 1). Volume o 10 µL o Dynabeads® Oligo (dT)25 (In i ogen, Oslo)
was dispensed in selec ed wells in he pla e (PCR 96, Eppendo , Ge many). Pla e was subsequen ly
ans e ed o he magne and MPs s o ing solu ion was aspi a ed o was e. Subsequen ly, beads we e
u he washed h ee imes wi h 20 µL o phospha e bu e I (pH 6.5, 0.1 M NaCl + 0.05 M Na2HPO4
+ 0.05 M NaH2PO4). The i s hyb idiza ion was he nex s ep. 10 µL o polyA-modi ied an i-sense
oligonucleo ides and 10 µL o hyb idiza ion bu e (0.1 M phospha e bu e , 0.6 M guanidinium
hiocyna e, 0.15 M T is, pH 7.5) we e added in each well and hen he pla e was incuba ed (15 min, 25
°C, mixing). This p ocedu e was ollowed by a washing ( h ee imes) wi h 20 µL o phospha e bu e
I. The second hyb idiza ion was he nex s ep. 10 µL o QDs-labeled oligonucleo ide and 10 µL o
hyb idiza ion bu e (0.1 M phospha e bu e , 0.6 M guanidinium hiocyna e, 0.15 M T is, pH = 7.5)
we e added o selec ed wells and he pla e was incuba ed (15 min, 25 °C, mixing). This p ocedu e was
ollowed by washing ( h ee imes) wi h 20 µL o phospha e bu e I. Then, 30 µL o elu ion solu ion
(phospha e bu e II 0.2 M NaCl + 0.1 M Na2HPO4 + 0.1 M NaH2PO4) was added in o selec ed wells
and pla e was subsequen ly incuba ed (5 min, 85 °C, mixing). A e he elu ion s ep, he pla e was
ans e ed o he magne , and he p oduc om selec ed wells was ans e ed o sepa a e wells a e
120 s o elu ion s ep. This isola ion assay was desc ibed p e iously [42–45].
2.6. Elec ochemical Me hod o De ec ion o CA and Me al Peak o ODN-QDs
Elec ochemical analyses we e pe o med using a 663 VA S and (Me ohm, He isau, Swi ze land)
and a s anda d cell wi h h ee elec odes. I was equipped wi h a s anda d cell consis ing o h ee
elec odes, a cooled sample holde and a measu emen cell se a 4 °C (Julabo F25, JulaboDE,
Seelbach, Ge many). The h ee-elec ode sys em consis ed o a hanging me cu y d op elec ode
(HMDE) wi h a d op a ea o 0.4 mm2 as he wo king elec ode, a Ag/AgCl/3M KCl e e ence
elec ode and a pla inum elec ode ac ing as he auxilia y. VA Da abase 2.2 by Me ohm was used o
da a acquisi ion and subsequen analysis. Ace a e bu e (0.2 M CH3COOH + 0.2 M CH3COONa,
pH 5.0) was used as a backg ound elec oly e. Measu emen s we e ca ied ou a oom empe a u e.
The analyzed samples we e deoxygena ed p io o measu emen s by pu ging wi h a gon (99.999%)
sa u a ed wi h wa e o 120 s. GPES 4.9 so wa e was employed o da a p ocessing.
Cy osine-adenine educ ion (CA peak) was de ec ed by squa e wa e ol amme y coupled wi h
adso p i e ans e echnique (AdTS SWV) [45–50]. The pa ame e s o he elec ochemical de e mina ion
we e as i ollows: ini ial po en ial 0 V; end po en ial –1.85 V; equency 80 Hz; po en ial s ep
0.005 V; ampli ude 0.025 V. Time o accumula ion was op imized.
Vi uses 2013, 5 1724
Figu e 1. Scheme o ully au oma ed pa amagne ic pa icles (MPs)-based isola ion
ollowed by elec ochemical de ec ion o a ge ODN labeled wi h QDs. As a a ge , h ee
di e en ODNs de i ed om poin -mu a ed neu aminidase gene o in luenza H5N1 we e
used. (i) Co alen binding be ween oligo (dT)25 and an i-sense sequence o di e en
H5N1-de i ed ODNs; (ii) Ta ge in luenza ODNs labeled wi h QDs (China ODN wi h
CdS, Aichi wi h PbS and Zhejiang wi h ZnS); (iii) Hyb idiza ion be ween an i-sense
sequence bound o MPs and a ge sequence labeled wi h QDs; (i ) Isola ion o a ge
sequence ODN-QDs and elu ion om MPs (elu ion empe a u e 85 °C); ( ) Elec ochemical
de ec ion o ODN-QDs complex, ODN (CA peak) was measu ed by adso p i e ans e
echnique coupled wi h squa e wa e ol amme y (AdTS SWV) and me al pa o QDs (Cd,
Pb and Zn peak) was measu ed by di e en ial pulse anodic s ipping ol amme y (DPASV).
Me al pa o he ODN-QDs complex was de ec ed by di e en ial pulse anodic s ipping ol amme y
(DPASV). In his case he pa ame e s o elec ochemical de e mina ion we e as i ollows: Cd (ini ial
po en ial –0.9 V; end po en ial –0.45 V, deposi ion po en ial –0.9 V); Zn (ini ial po en ial –1.2 V; end
po en ial –0.85 V, deposi ion po en ial –1.2 V); Pb (ini ial po en ial –0.6 V; end po en ial –0.25 V,
deposi ion po en ial –0.6 V); o he s pa ame e s we e same: equilib a ion ime 5 s; modula ion ime
0.06; ime in e al 0.2 s; po en ial s ep 0.002 V; modula ion ampli ude 0.025. Time o accumula ion
was op imized.
2.7. Desc ip i e S a is ics
Da a we e p ocessed using MICROSOFT EXCELs (USA) and STATISTICA.CZ Ve sion 8.0
(Czech Republic). The esul s a e exp essed as mean ±SD unless no ed o he wise. S a is ical
signi icances o he di e ences we e de e mined using STATISTICA.CZ. Di e ences wi h p < 0.05
we e conside ed signi ican and we e de e mined by using o one way ANOVA es (pa icula ly
Sche e es ), which was applied o means compa ison.
Vi uses 2013, 5 1725
3. Resul s and Discussion
De ec ion o a speci ic nucleic acid (NA) sequence is one o he mos impo an ma ke s o clinical
medicine. Knowledge o a speci ic sequence o nucleic acid may be applied in mode n he apeu ic
app oaches [51,52]. Based on hese ac s, i is clea ha he e is a plen y o me hods ha ha e been
sugges ed o NA analysis. Elec ochemical me hods a e especially impo an due o low cos s,
apidi y, simplici y, and especially selec i i y o speci ic NA sequences. Ou sys em o isola ion and
de ec ion equi es less han one hou o one sample de e mina ion. Due his ac i is ob ious ha i is
e y quick way o de e mina ion opposi e he o he me hods. Nanopa icles-based elec ochemical NA
analysis ep esen s an impo an ool in he de ec ion o speci ic NA sequences [53]. In addi ion, using
nanopa icles p o ides us he possibili y o use no only elec ochemis y bu also spec ome y.
Mo eo e , nanopa icles ha e ound applica ion as oligonucleo ide labels o elec ochemical de ec ion
o i uses. Sun e al. used lead sul ide (PbS) nanopa icles as oligonucleo ide labels o elec ochemical
de ec ion o he 35 S p omo e om cauli lowe mosaic i us (CaMV) sequence [54]. Quan um
do s (QDs)-labeled RNA oligonucleo ide was used by Roh e al. o de ec ion o hepa i is C
i us nons uc u al p o ein 5B (NS5B) [55]. In his s udy, magne ic pa icles wi h co alen ly
boundoligooligo(dT)25 we e used as a ool o isola ion o complemen a y H5N1 chains (H5N1 Zhejin,
China and Aichi, Figu e 1). Fo de ec ion o he isola ed H5N1 chains, we used oligonucleo ide chains
o leng hs o 12 (+5 adenine) o 28 (+5 adenine) bp labeled wi h quan um do s (CdS, ZnS and/o PbS,
Figu e 1). The scheme o he isola ion and de ec ion is shown in Figu e 1.
3.1. Cha ac e iza ion o DNA Oligonucleo ide Labeled wi h QDs (CdS, PbS and ZnS) by
MALDI-TOF/TOF
MALDI-TOF/TOF was used o cha ac e ize mass spec a o ODN-QDs in 3-hyd oxypicolinic acid
(3-HPA) and diammonium ci a e as a ma ix o es ing he binding o H5N1 neu aminidase gene wi h
quan um do s (CdS, ZnS and/o PbS). The spec a o each labeled ODN wi h di e en QDs a e shown
in Figu e 2. The signals shown in Figu e 2 we e assigned as ollows: (A) [ODN]+ o m/z 3,938.7
co esponding o unlabeled and [ODN/CdS]+ o m/z 4,050.8 co esponding o labeled complex wi h
CdS in China H5N1 neu aminidase gene, (B) [ODN]+ o m/z 3,993.1 co esponding o unlabeled and
[ODN/PbS]+ o m/z 4,200.1 co esponding o labeled complex wi h PbS in Aichi H5N1 neu aminidase
gene and (C) [ODN]+ o m/z 3,864.2 co esponding o unlabeled and [ODN/ZnS]+ o m/z 3,954.3
co esponding o labeled wi h ZnS in Zhejiang H5N1 neu aminidase gene. I is e iden ha he
sugges ed labeling o di e en ODNs wi h QDs was ca ied ou co ec ly, as i is shown in Figu e 1.
3.2. Scheme o Fully Au oma ed MPs Isola ion Followed by Elec ochemical De ec ion o Ta ge ODN
Labeled wi h QDs
Nanopa icles ha e ound hei applica ion in he apid and simple isola ion o nucleic acids om
a ious biological ma ixes. Magne ic nanopa icles ep esen an especially impo an imp o emen in
hese echniques due o e y easy manipula ion [56,57]. Howe e , da a abou applica ion o NPs in
isola ion o i al nucleic acid a e e y limi ed. An i-sense oligonucleo ides specific o conse ed
egion o AIV PA p o ein o H5N1 a ian influenza i us we e used by Zhang e al. [58]. Ne e heless,
Vi uses 2013, 5 1726
he au ho s ocused on he an i i al p ope ies o hese an i-sense oligonucleo ides. In his s udy, we
designed he p o ocol o mul i- a ge isola ion and de ec ion o ODNs molecules (de i ed om
neu aminidase gene o in luenza H5N1) labeled wi h QDs. The i s s ep consis ed o hyb idiza ion
(co alen binding) o he complemen a y an i-sense sequence modi ied wi h he polyA sequence on
MPs modi ied wi h he polyT sequence (Figu e 1i). This s ep was ollowed by in luenza ODNs
labeling wi h QDs. China ODNs (sho and long) was labeled wi h CdS, Aichi wi h PbS and Zhejiang
wi h ZnS (Figu e 1ii) Hyb idiza ion be ween an i-sense and a ge ODN-QDs was he mos impo an
s ep (Figu e 1iii). This s ep was he subjec o s udy o e ec s o hyb idiza ion empe a u e and leng h
o a ge ODN(s)-QDs on he hyb idiza ion, espec i ely he yield o isola ed molecules. ODN-QDs
elu ion was he las s ep o he isola ion ( empe a u e 85 °C, Figu e 1i ). The isola ion p ocess was
ollowed by elec ochemical de ec ion o ODN-QDs complex. Two ol amme y me hods we e used.
ODN (CA peak) was de e mined by squa e wa e ol amme y coupled wi h he adso p i e ans e
echnique (AdTS SWV) and me al peak (Cd, Pb and Zn) was de e mined by di e en ial pulse anodic
s ipping ol amme y (DPASV), as i is shown in Figu e 1 . Time o accumula ion ( A) o bo h
me hods was op imized.
Figu e 2. MALDI-TOF/TOF mass spec a o oligonucleo ide (ODN) de i ed om H5N1
gene o neu aminidase labeled wi h QDs (CdS, PbS and ZnS). (A) Spec a o ODN and
ODN labeled wi h CdS in China H5N1 sequence; (B) spec a o ODN and ODN labeled
wi h PbS in Aichi H5N1 sequence; and (C) spec a o ODN and ODN labeled wi h ZnS in
Zhejiang H5N1 in luenza i us. 3-hyd oxypicolinic acid (3-HPA) and diammonium ci a e
we e used as ma ix.
3.3. Op imiza ion o AdTS SWV and DPASV Me hod
Time o accumula ion ( A) was op imized o de ec ion o lead(II), cadmium(II) and zinc(II) ions
using DPASV (Figu e 3A–C, espec i ely). Di e en accumula ion imes (30, 60, 120, 240, 360, 480
Vi uses 2013, 5 1727
and 600 s) we e es ed. Heigh o me al peak o ODN-QDs inc eased linea ly up o 600 s, bu he ime
o accumula ion o 300 s was selec ed due o he ime consuming measu emen s a A longe han
300 s. Time o accumula ion ( A) was op imized also in he case o CA peak de ec ion in a ious
ODN-QDs complexes o med om Pb, Cd and Zn (Figu e 3D–F, espec i ely). Tes ed ime in e als
we e 0, 30, 60, 90, 120, 180 and 240 s. Time o accumula ion 120 s was chosen as an op imal A as he
highes peak a he lowes ime o accumula ion.
Figu e 3. Op imiza ion o elec ochemical de e mina ion. The in luence o ime o
accumula ion on he heigh s o me al and CA peaks. (A–C) Dependence o ela i e
heigh o me al peak (%) on he ime o accumula ion o ODN(s) labeled wi h QDs;
(D–E) Dependence o ela i e heigh o CA peak (%) on he ime o accumula ion o
ODN(s) labeled by QDs. In he op imiza ion s ep, hese ODN(s) labeled wi h QDs we e
used: (A+D) Aichi (Ai) was labeled wi h PbS (Ai 1 is sho ODN–12 nucleo ides, Ai 2 is
long ODN–28 nucleo ides), (B+E) China (Ch) was labeled wi h CdS (Ch 1 is sho
ODN–12 nucleo ides, Ch 2 is long ODN–28 nucleo ides), (C+D) Zhejiang (Zh) was
labeled wi h ZnS (Zh 1 is sho ODN–12 nucleo ides, Zh 2 is long ODN–28 nucleo ides).
DPASV was used o de e mine me al, pa ame e s we e as i ollows: ini ial po en ial
–1.2 V (Zn), –0.8 V (Cd), –0.65 V (Pb); end po en ial –0.9 V (Zn), –0.5 V (Cd), –0.3 V
(Pb), deposi ion po en ial –1.2 V (Zn), –0.8 V (Cd), –0.65 V (Pb); equilib a ion ime 5 s;
modula ion ime 0.06 s; ime in e al 0.2 s; po en ial s ep 0.002 V; modula ion ampli ude
0.025 V. Op imized pa ame e was ime o accumula ion (a o h): a 30 s, b 60 s, c 120 s, d
240 s, e 360 s, 480 s, g 600 s, h 700 s. AdTS SWV me hod was used o de e mine CA
peak, pa ame e s we e as i ollows: pu ge ime 60 s, ini ial po en ial –1.85 V; end po en ial
0 V; equency 100 Hz; po en ial s ep 0.005 V; ampli ude 0.025 V. Op imized pa ame e
was ime o accumula ion (a o g): a 0 s, b 30 s, c 60 s, d 90 s, e 120 s, 180 s, g 240 s.
Vi uses 2013, 5 1734
Figu e 7. (A) The e ec o he RNA-ODN leng h on he numbe o hyb idized molecules.
Two long a ie ies o China RNA ODN sequences we e es ed due o CA and Cd peak
de ec ion. Sho RNA ODN sequence was hyb idized a 25 °C and long RNA ODN
sequence was hyb idized a 50 °C; (B) Pe cen age o signal in ensi y o he long ODN
sequence ela ed o he sho ODN sequence de ec ed due o CA and Cd peak o RNA and
DNA ODN sequence.
4. Conclusions
Mu a ions o he in luenza i us in combina ion wi h he global inc easing o he use o
an i-in luenza speci ic d ugs allows o he selec ion o an i i al d ug- esis an i uses. The e o e,
he e is impe a i e o ha e as e and mo e sensi i e assays o de ec ion o an i i al d ug- esis an
s ains o he in luenza i us. New assays a e impo an o he su eillance o HPAI H5N1 and o
decisions o use speci ic an i i al d ugs in he ea men o human pa ien s suspec ed o su e ing om
H5N1 in luenza. In his s udy, we demons a e me hods o mul i- a ge de ec ion o NAIs- esis an
in luenza sub ypes. This mul i a ge ba code assay is based on he elec ochemical analysis o
isola ed a ge molecules labeled wi h QDs. Based on p e iously published pape s [42,43], we
designed and op imized hyb idiza ion assay o mul i- a ge isola ion and de ec ion o in luenza H5N1
neu aminidase gene, espec i ely poin -mu a ed neu aminidase gene. These poin mu a ions a e
esponsible o he esis ance o NAIs. Re ealing NAIs’ esis ance is impo an o a ge ed and
success ul ea men o se e e human in luenza cases, and o p e en ing he occu ence o se e e
in luenza disease, especially HPAI H5N1.
Acknowledgmen s
Financial suppo om NanoBioTECell GA CR P102/11/1068, NanoBioMe alNe
CZ.1.07/2.4.00/31.0023 and IGA IP16/2013 is g ea ly acknowledged.
Con lic o In e es
The au ho s decla e no con lic o in e es .
Vi uses 2013, 5 1735
Re e ences and No es
1. Shoham, D. In luenza ype A i us: An ou s andingly p o ean pa hogen and a po en modula
weapon. C i . Re . Mic obiol. 2013, 39, 123–138.
2. Plou de, J.R.; Pyles, J.A.; Lay on, R.C.; Vaughan, S.E.; Tippe , J.L.; Ha od, K.S. Neu o i ulence
o H5N1 in ec ion in e e s is media ed by mul i ocal eplica ion in dis inc pe missi e neu onal
cell egions. PLoS One 2012, 7, 1–11.
3. Gilbe , M.; Jambal, L.; Ka esh, W.B.; Fine, A.; Shiilegdamba, E.; Dulam, P.; Sodnomda jaa, R.;
Ganzo ig, K.; Ba chuluun, D.; Tse eenmyadag, N.; e al. Highly pa hogenic a ian in luenza i us
among wild bi ds in mongolia. PLoS One 2012, 7, 1–9.
4. Wei, K.F.; Chen, Y.F.; Chen, J.; Wu, L.J.; Xie, D.X. E olu ion and adap a ion o hemagglu inin
gene o human H5N1 in luenza i us. Vi us Genes 2012, 44, 450–458.
5. Abdelwhab, E.M.; Ha ez, H.M. Insigh in o al e na i e app oaches o con ol o a ian in luenza
in poul y, wi h emphasis on highly pa hogenic H5N1. Vi uses 2012, 4, 3179–3208.
6. Zhang, J.F. Ad ances and u u e challenges in ecombinan adeno i al ec o ed H5N1 in luenza
accines. Vi uses 2012, 4, 2711–2735.
7. Weinheime , V.K.; Beche , A.; Tonnies, M.; Holland, G.; Kneppe , J.; Baue , T.T.; Schneide , P.;
Neudecke , J.; Rucke , J.C.; Szymanski, K.; e al. In luenza A i uses a ge ype II pneumocy es
in he human lung. J. In ec . Dis. 2012, 206, 1685–1694.
8. Chen, F.; Yan, Z.Q.; Liu, J.; Ji, J.; Chang, S.; Liu, D.; Qin, J.P.; Ma, J.Y.; Bi, Y.Z.; Xie, Q.M.
Phylogene ic analysis o hemagglu inin genes o 40 H9N2 sub ype a ian in luenza i uses
isola ed om poul y in China om 2010 o 2011. Vi us Genes 2012, 45, 69–75.
9. Zhao, J.Q.; Wang, X.; Ragupa hy, V.; Zhang, P.H.; Tang, W.; Ye, Z.P.; Eichelbe ge , M.;
Hewle , I. Rapid de ec ion and di e en ia ion o swine-o igin in luenza A i us (H1N1/2009)
om o he seasonal in luenza A i uses. Vi uses 2012, 4, 3012–3019.
10. Albe s, B. INTRODUCTION H5N1. Science 2012, 336, 1521–1521.
11. Takekawa, J.Y.; P osse , D.J.; Newman, S.H.; Bin Muza a , S.; Hill, N.J.; Yan, B.P.;
Xiao, X.M.; Lei, F.M.; Li, T.X.; Schwa zbach, S.E.; e al. Vic ims and ec o s: Highly pa hogenic
a ian in luenza H5N1 and he ecology o wild bi ds. A ian Biol. Res. 2010, 3, 51–73.
12. Leung, Y.H.C.; Cheung, P.; Zhang, L.J.; Wu, Y.O.; Chow, K.C.; Ho, C.K.; Chow, C.K.; Ng, C.F.;
Li, B.; Tsang, C.L.; e al. In luenza i uses in wild bi ds in Hong Kong, 2003–2010. In luenza
O he Respi . Vi uses 2011, 5, 77–78.
13. Capua, I.; Alexande , D.J. Ecology, epidemiology and human heal h implica ions o a ian
in luenza i uses: Why do we need o sha e gene ic da a? Zoonoses Public Heal h 2008, 55, 2–15.
14. Neumann, G.; Chen, H.; Gao, G.F.; Shu, Y.L.; Kawaoka, Y. H5N1 in luenza i uses: Ou b eaks
and biological p ope ies. Cell Res. 2010, 20, 51–61.
15. B ags ad, K.; Jo gensen, P.H.; Handbe g, K.; Hamme , A.S.; Kabell, S.; Fomsgaa d, A. Fi s
in oduc ion o highly pa hogenic H5NI a ian in luenza A i uses in wild and domes ic bi ds in
Denma k, No he n Eu ope. Vi ol. J. 2007, 4, 1–10.
16. Rebel, J.M.J.; Pee e s, B.; Fij en, H.; Pos , J.; Co nelissen, J.; Ve elde, L. Highly pa hogenic o
low pa hogenic a ian in luenza i us sub ype H7N1 in ec ion in chicken lungs: Small di e ences
in gene al acu e esponses. Ve . Res. 2011, 42, 1–11.
Vi uses 2013, 5 1736
17. Comin, A.; Klinkenbe g, D.; Ma angon, S.; To an, A.; S egeman, A. T ansmission dynamics o
low pa hogenici y a ian in luenza in ec ions in Tu key locks. PLoS One 2011, 6, 1–9.
18. Kabi , S.M.L. A ian lu (H5N1): Th ea o “global pandemic” is g owing and i ’s impac on he
de eloping coun ies’ economy. A . J. Mic obiol. Res. 2010, 4, 1192–1194.
19. Yamada, S.; Suzuki, Y.; Suzuki, T.; Le, M.Q.; Nidom, C.A.; Sakai-Tagawa, Y.; Mu amo o, Y.;
I o, M.; Kiso, M.; Ho imo o, T.; e al. Haemagglu inin mu a ions esponsible o he binding o
H5N1 in luenza A i uses o human- ype ecep o s. Na u e 2006, 444, 378–382.
20. Fauci, A.S.; Collins, F.S. Bene i s and isks o in luenza esea ch: lessons lea ned. Science 2012,
336, 1522–1523.
21. Nguyen, T.; Ri aille , P.; Da is, C.T.; Hoa, D.T.; Balish, A.; Dang, N.H.; Jones, J.; Vui, D.T.;
Simpson, N.; Huong, N.T.; e al. E olu ion o highly pa hogenic a ian in luenza (H5N1) i us
popula ions in Vie nam be ween 2007 and 2010. Vi ology 2012, 432, 405–416.
22. Tang, D.J.; Lam, Y.M.; Siu, Y.L.; Lam, C.H.; Chu, S.L.; Pei is, J.S.M.; Buchy, P.; Nal, B.;
B uzzone, R. A single esidue subs i u ion in he ecep o -binding domain o H5N1 hemagglu inin
is c i ical o packaging in o pseudo yped len i i al pa icles. PLoS One 2012, 7, 1–12.
23. Pa k, A.W.; Glass, K. Dynamic pa e ns o a ian and human in luenza in eas and sou heas Asia.
Lance In ec . Dis. 2007, 7, 543–548.
24. Rao, S.S.; S yles, D.; Kong, W.; And ews, C.; Go es, J.P.; Nabel, G.J. A gene-based a ian
in luenza accine in poul y. Poul . Sci. 2009, 88, 860–866.
25. Webs e , R.G.; Go o ko a, E.A. Focus on esea ch: H5N1 in luenza–Con inuing e olu ion and
sp ead. N. Engl. J. Med. 2006, 355, 2174–2177.
26. Pei is, J.S.M.; de Jong, M.D.; Guan, Y. A ian in luenza i us (H5N1): A h ea o human heal h.
Clin. Mic obiol. Re . 2007, 20, 243–267.
27. Uyeki, T.M.; B esee, J.S. De ec ing human- o-human ansmission o a ian in luenza a (H5N1).
Eme g. In ec . Dis. 2007, 13, 1969–1970.
28. Hayden, F.G.; de Jong, M.D. Eme ging in luenza an i i al esis ance h ea s. J. In ec . Dis. 2011,
203, 6–10.
29. Cai, Z.P.; Duca ez, M.F.; Yang, J.L.; Zhang, T.; Long, L.P.; Boon, A.C.; Webby, R.J.; Wan, X.F.
Iden i ying an igenici y-associa ed si es in highly pa hogenic H5N1 in luenza i us hemagglu inin
by using spa se lea ning. J. Mol. Biol. 2012, 422, 145–155.
30. Zhao, G.; Zhong, L.; Lu, X.L.; Hu, J.; Gu, X.B.; Kai, Y.; Song, Q.Q.; Sun, Q.; Liu, J.B.;
Peng, D.X.; e al. Cha ac e isa ion o a highly pa hogenic H5N1 clade 2.3.2 in luenza i us
isola ed om swans in Shanghai, China. Vi us Genes 2012, 44, 55–62.
31. Nidom, C.A.; Yamada, S.; Nidom, R.V.; Rahmawa i, K.; Alamudi, M.Y.; Kholik; Ind asa i, S.;
Haya i, R.S.; Ho imo o, K.I.; Kawaoka, Y. Gene ic cha ac e iza ion o H5N1 in luenza i uses
isola ed om chickens in Indonesia in 2010. Vi us Genes 2012, 44, 459–465.
32. Huang, K.; Zhu, H.V.; Fan, X.H.; Wang, J.; Cheung, C.L.; Duan, L.; Hong, W.S.; Liu, Y.M.;
Li, L.F.; Smi h, D.K.; e al. Es ablishmen and lineage eplacemen o H6 in luenza i uses in
domes ic ducks in Sou he n China. J. Vi ol. 2012, 86, 6075–6083.
33. Miyoshi-Akiyama, T.; Akasaka, Y.; Oogane, T.; Kondo, Y.; Ma sushi a, T.; Funa ogawa, K.;
Ki ikae, T. De elopmen and e alua ion o a line p obe assay o apid yping o in luenza i uses
and de ec ion o he H274Y mu a ion. J. Vi ol. Me hods 2012, 185, 276–280.
Vi uses 2013, 5 1737
34. Redlbe ge -F i z, M.; Abe le, S.W.; S assl, R.; Popow-K aupp, T. Rapid iden i ica ion o
neu aminidase inhibi o esis ance mu a ions in seasonal in luenza i us A(H1N1), A(H1N1)2009,
and A(H3N2) sub ypes by mel ing poin analysis. Eu . J. Clin. Mic obiol. In ec . Dis. 2012, 31,
1593–1601.
35. Bao, J.R.; Hua d, T.K.; Pisci elli, A.E.; Tummala, P.R.; Aleemi, V.E.; Coon, S.L.; Mas e , R.N.;
Lewinski, M.A.; Cla k, R.B. Re e se- ansc ip ion polyme ase chain eac ion/py osequencing o
cha ac e ize neu aminidase H275 esidue o in luenza A 2009 H1N1 i us o apid and speci ic
de ec ion o he i al osel ami i esis ance ma ke in a clinical labo a o y. Diagn. Mic obiol.
In ec . Dis. 2011, 71, 396–402.
36. Deng, Y.M.; Caldwell, N.; Hu , A.; Shaw, T.; Kelso, A.; Chidlow, G.; Williams, S.; Smi h, D.;
Ba , I. A compa ison o py osequencing and neu aminidase inhibi ion assays o he de ec ion o
osel ami i - esis an pandemic in luenza A(H1N1) 2009 i uses. An i i . Res. 2011, 90, 87–91.
37. Leang, S.K.; Deng, Y.M.; Shaw, R.; Caldwell, N.; Iannello, P.; Komadina, N.; Buchy, P.;
Chi aganpi ch, M.; Dwye , D.E.; Fagan, P.; e al. In luenza an i i al esis ance in he Asia-Paci ic
egion du ing 2011. An i i . Res. 2013, 97, 206–210.
38. Chai a , K.; Ta ning, J.; Whi e, N.J.; Lindega dh, N. Pha macokine ic p ope ies o an i-in luenza
neu aminidase inhibi o s. J. Clin. Pha macol. 2013, 53, 119–139.
39. Li, H.; Shih, W.Y.; Shih, W.H. Syn hesis and cha ac e iza ion o aqueous ca boxyl-capped CdS
quan um do s o bioapplica ions. Ind. Eng. Chem. Res. 2007, 46, 2013–2019.
40. Hennequin, B.; Tu yanska, L.; Ben, T.; Bel an, A.M.; Molina, S.I.; Li, M.; Mann, S.; Pa ane, A.;
Thomas, N.R. Aqueous nea -in a ed luo escen composi es based on apo e i in-encapsula ed
PbS quan um do s. Ad . Ma e . 2008, 20, 3592–3596.
41. Genbank. A ailable online: h p://www.ncbi.nlm.nih.go /genbank/ (accessed on 1 July 2013).
42. K ejco a, L.; Huska, D.; Hynek, D.; Kopel, P.; Adam, V.; Hubalek, J.; T nko a, L.; Kizek, R.
Using o pa amagne ic mic opa icles and quan um do s o isola ion and elec ochemical
de ec ion o in luenza i uses’ speci ic nucleic acids. In . J. Elec ochem. Sci. 2013, in p ess.
43. K ejco a, L.; Hynek, D.; Kopel, P.; Adam, V.; Hubalek, J.; T nko a, L.; Kizek, R., Pa amagne ic
pa icles isola ion o in luenza oligonucleo ide labelled wi h CdS QDs. Ch oma og aphia 2013,
76, 355–362.
44. Huska, D.; Adam, V.; Babula, P.; T nko a, L.; Hubalek, J.; Zehnalek, J.; Ha el, L.; Kizek, R.
Mic o luidic obo ic de ice coupled wi h elec ochemical senso ield o handling o
pa amagne ic mic o-pa icles as a ool o de e mina ion o plan mRNA. Mic ochim. Ac a 2011,
173, 189–197.
45. Huska, D.; Hubalek, J.; Adam, V.; Vaj , D.; Ho na, A.; T nko a, L.; Ha el, L.; Kizek, R.
Au oma ed nucleic acids isola ion using pa amagne ic mic opa icles coupled wi h
elec ochemical de ec ion. Talan a 2009, 79, 402–411.
46. K ejco a, L.; Dospi o a, D.; Ry olo a, M.; Kopel, P.; Hynek, D.; K izko a, S.; Hubalek, J.;
Adam, V.; Kizek, R. Pa amagne ic pa icles coupled wi h an au oma ed low injec ion analysis as
a ool o in luenza i al p o ein de ec ion. Elec opho esis 2012, 33, 3195–3204.
Vi uses 2013, 5 1738
47. Zi ka, O.; K izko a, S.; K ejco a, L.; Hynek, D.; Gumulec, J.; Masa ik, M.; Socho , J.; Adam, V.;
Hubalek, J.; T nko a, L.; e al. Mic o luidic ool based on he an ibody-modi ied pa amagne ic
pa icles o de ec ion o 8-hyd oxy-2'-deoxyguanosine in u ine o p os a e cance pa ien s.
Elec opho esis 2011, 32, 3207–3220.
48. P asek, J.; Huska, D.; Jasek, O.; Zajicko a, L.; T nko a, L.; Adam, V.; Kizek, R.; Hubalek, J.
Ca bon composi e mic o- and nano- ubes based elec odes o de ec ion o nucleic acids.
Nanoscale Res. Le . 2011, 6, 1–5.
49. Huska, D.; Zi ka, O.; K ys o o a, O.; Adam, V.; Babula, P.; Zehnalek, J.; Ba usek, K.;
Beklo a, M.; Ha el, L.; Kizek, R. E ec s o cadmium(II) ions on ea ly soma ic emb yos o
No way sp uce s udied by using elec ochemical echniques and nuclea magne ic esonance.
In . J. Elec ochem. Sci. 2010, 5, 1535–1549.
50. Chomoucka, J.; D bohla o a, J.; Masa ik, M.; Ry olo a, M.; Huska, D.; P asek, J.; Ho na, A.;
T nko a, L.; P o aznik, I.; Adam, V.; e al. Nano echnologies o socie y. New designs and
applica ions o nanosenso s and nanobiosenso s in medicine and en i onmen al analysis. In . J.
Nano echnol. 2012, 9, 746–783.
51. Be on, M.; Tu elli, P.; T ono, D.; S ein, C.A.; Allemann, E.; Gu ny, R. Inhibi ion o HIV-1 in
cell cul u e by oligonucleo ide-loaded nanopa icles. Pha m. Res. 2001, 18, 1096–1101.
52. Schneide , T.; Becke , A.; Ringe, K.; Reinhold, A.; Fi sching, R.; Sabel, B.A. B ain umo
he apy by combined accina ion and an isense oligonucleo ide deli e y wi h nanopa icles.
J. Neu oimmunol. 2008, 195, 21–27.
53. Cai, H.; Zhu, N.N.; Jiang, Y.; He, P.G.; Fang, Y.Z. Cu@Au alloy nanopa icle as oligonucleo ides
labels o elec ochemical s ipping de ec ion o DNA hyb idiza ion. Biosens. Bioelec on. 2003,
18, 1311–1319.
54. Sun, W.; Zhong, J.H.; Qin, P.; Jiao, K. Elec ochemical biosenso o he de ec ion o cauli lowe
mosaic i us 35 S gene sequences using lead sul ide nanopa icles as oligonucleo ide labels.
Anal. Biochem. 2008, 377, 115–119.
55. Roh, C.; Lee, H.Y.; Kim, S.E.; Jo, S.K. A highly sensi i e and selec i e i al p o ein de ec ion
me hod based on RNA oligonucleo ide nanopa icle. In . J. Nanomed. 2010, 5, 323–329.
56. Bandyopadhyay, A.; Cha e jee, S.; Sa ka , K. Rapid isola ion o genomic DNA om E. coli XL1
Blue s ain app oaching ba e magne ic nanopa icles. Cu . Sci. 2011, 101, 210–214.
57. T ach o a, S.; Kaman, O.; Spano a, A.; Ve e ka, P.; Polle , E.; Ri ich, B. Silica-coa ed
La0.75S 0.25MnO3 nanopa icles o magne ically d i en DNA isola ion. J. Sep. Sci. 2011, 34,
3077–3082.
58. Zhang, T.; Zhao, P.S.; Zhang, W.; Liang, M.; Gao, Y.W.; Yang, S.T.; Wang, T.C.; Qin, C.;
Wang, C.Y.; Xia, X.Z. An isense oligonucleo ide inhibi s a ian in luenza i us H5N1 eplica ion
by single chain an ibody deli e y sys em. Vaccine 2011, 29, 1558–1564.
59. Malecka, K.; G abowska, I.; Radecki, J.; S achy a, A.; Go a-Sochacka, A.; Si ko, A.; Radecka, H.
Vol amme ic de ec ion o a speci ic DNA sequence o a ian in luenza i us H5N1 using
HS-ssDNA p obe deposi ed on o gold elec ode. Elec oanalysis 2012, 24, 439–446.
60. Ganbold, E.O.; Kang, T.; Lee, K.; Lee, S.Y.; Joo, S.W. Agg ega ion e ec s o gold nanopa icles
o single-base misma ch de ec ion in in luenza A (H1N1) DNA sequences using luo escence and
Raman measu emen s. Colloid Su . B-Bioin e aces 2012, 93, 148–153.
Vi uses 2013, 5 1739
61. Liu, X.G.; Cheng, Z.Q.; Fan, H.; Ai, S.Y.; Han, R.X. Elec ochemical de ec ion o a ian in luenza
i us H5N1 gene sequence using a DNA ap ame immobilized on o a hyb id nanoma e ial-modi ied
elec ode. Elec ochim. Ac a 2011, 56, 6266–6270.
62. Lai, W.A.; Lin, C.H.; Yang, Y.S.; Lu, M.S.C. Ul asensi i e and label- ee de ec ion o
pa hogenic a ian in luenza DNA by using CMOS impedime ic senso s. Biosens. Bioelec on.
2012, 35, 456–460.
63. Tian, J.P.; Zhao, H.M.; Liu, M.; Chen, Y.Q.; Quan, X. De ec ion o in luenza A i us based on
luo escence esonance ene gy ans e om quan um do s o ca bon nano ubes. Anal. Chim. Ac a
2012, 723, 83–87.
64. Chung, D.J.; Kim, K.C.; Choi, S.H. Elec ochemical DNA biosenso based on a idin-bio in
conjuga ion o in luenza i us ( ype A) de ec ion. Appl. Su . Sci. 2011, 257, 9390–9396.
65. Fan, H.; Ju, P.; Ai, S.Y. Con ollable syn hesis o CdSe nanos uc u es wi h unable mo phology
and hei applica ion in DNA biosenso o A ian In luenza Vi us. Sens. Ac ua o B-Chem. 2010,
149, 98–104.
66. Adam, V.; Huska, D.; Hubalek, J.; Kizek, R. Easy o use and apid isola ion and de ec ion
o a i al nucleic acid by using pa amagne ic mic opa icles and ca bon nano ubes-based
sc een-p in ed elec odes. Mic o luid. Nano luid. 2010, 8, 329–339.
67. Chen, X.J.; Xie, H.; Seow, Z.Y.; Gao, Z.Q. An ul asensi i e DNA biosenso based on
enzyme-ca alyzed deposi ion o cup ic hexacyano e a e nanopa icles. Biosens. Bioelec on.
2010, 25, 1420–1426.
68. Lim, S.H.; Buchy, P.; Ma dy, S.; Kang, M.S.; Yu, A.D.C. Speci ic nucleic acid de ec ion using
pho ophysical p ope ies o quan um do p obes. Anal. Chem. 2010, 82, 886–891.
69. Tam, P.D.; Hieu, V.N.; Chien, N.D.; Le, A.T.; Tuan, M.A. DNA senso de elopmen based on
mul i-wall ca bon nano ubes o label- ee in luenza i us ( ype A) de ec ion. J. Immunol.
Me hods 2009, 350, 118–124.
70. Kim, S.A.; Kim, S.J.; Lee, S.H.; Pa k, T.H.; Byun, K.M.; Kim, S.G.; Shule , M.L. De ec ion o
a ian in luenza-DNA hyb idiza ion using wa eleng h-scanning su ace plasmon esonance
biosenso . J. Op . Soc. Ko ea 2009, 13, 392–397.
© 2013 by he au ho s; licensee MDPI, Basel, Swi ze land. This a icle is an open access a icle
dis ibu ed unde he e ms and condi ions o he C ea i e Commons A ibu ion license
(h p://c ea i ecommons.o g/licenses/by/3.0/).