Regulation of the OsNHX1 Gene Expression: Identification and Characterization of Novel Transcription Factors

Regula ion o he OsNHX1 Gene Exp ession: Iden i ica ion and Cha ac e iza ion o No el T ansc ip ion Fac o s Diego Melo Almeida Disse a ion p esen ed o ob ain he Ph.D deg ee in Biochemis y Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa Oei as, June, 2016 Wo k pe o med a : Supe iso s: D . Nelson José Madei a Saibo Head o he Plan Gene Regula ion labo a o y (ITQB NOVA) P incipal In es iga o P o . D . M. Ma ga ida Oli ei a Head o GPlan S Uni (ITQB NOVA) Associa e P o esso wi h Habili a ion (Ag egação) a ITQB NOVA D . Glenn B. G ego io C op B eeding Manage a Swee and Waxy Co n. San Ra ael, Philippines. Fo me senio scien is and plan b eede a In e na ional Rice Resea ch Ins i u e (IRRI). Los Baños, Philippines. Genomics o Plan S ess Uni Ins i u o de Tecnologia Química e Biológica An ónio Xa ie Uni e sidade No a de Lisboa A . Da República 2780-157 Oei as Po ugal In e na ional Rice Resea ch Ins i u e Plan B eeding, Gene ics, and Bio echnology Di ision Los Baños Philippines Aos meus pais e i mã, pelo incen i o e amo incondicional que semp e le am-me a segui em en e. Equipped wi h his i e senses, man explo es he uni e se a ound him and calls he ad en u e Science. Edwin Powell Hubble (29 h No embe 1889 – 28 h Sep embe 1953) XIV g G am g Rela i e cen i ugal o ce GFP G een luo escen p o ein gs S oma al Conduc ance GUS β-glucu onidase h Hou H2O2 Hyd ogen pe oxide H Ho deum ulga e L. In Ipomea nil IRRI In e na ional Rice Resea ch Ins i u e KDa KiloDal on Kg Kilog am Km Michaelis–Men en cons an L Li e LUC Luci e ase M Mola i y m Mass Mb Mega base pai µCi Mic oCu ie µg Mic og am µL Mic oli e µM Mic omola min Minu e mL Milili e mM Milimola mRNA Message Ribonucleic Acid MYC Myelocy oma osis Oncogene MYB Myeloblas osis Oncogene m35S Minimal 35S p omo e XV NIN Nodule Incep ion ng Nanog am NLS Nuclea Localiza ion Signal NSCC Non Selec i e Ca ion Channels Os O yza sa i a PCNA P oli e a ing Cell Nuclea An igen PCR Polyme ase Chain Reac ion PEG Polye hylene Glycol PPM Pa s pe Million PM Plasma Memb ane PVC P e acuola compa men QTL Quan i a i e T ai Locus RIL Recombinan Inb ed Line RNA Ribonucleic Acid ROS Reac i e Oxygen Species pm Ro a ions pe minu e RT Room empe a u e RT-PCR Re e se T ansc ip ion – PCR RT-qPCR Quan i a i e Real-Time RT-PCR RWC Rela i e Wa e Con en s Second Sc Saccha omyces ce e isiae SD S anda d De ia ion SDS-PAGE Sodium Dodecyl Sul a e – Polyac ylamide Gel Elec opho esis SE S anda d E o SES S anda d E alua ion Sco e SOS Sal O e ly Sensi i e Ta T i icum aes i um XVI T-DNA T ans e -DNA TF T ansc ip ion Fac o TGN T ans-Golgi Ne wo k TRX Thio edoxin V Vi is ini e a Y1H Yeas -One-Hyb id XVII SUMMARY Fo hal o he wo ld´s popula ion, ice is li e. This ce eal c op is conside ed an impo an s aple ood wo ldwide, and mo e han h ee billion people coun on i o 50-80% o hei daily calo ie in ake. Soil salini y is a majo en i onmen al cons ain o c op p oduc ion, esul ing in conside able yield losses a ound he globe e e y yea . Acco ding o he Food and Ag icul u e O ganiza ion (FAO), in 2008 o e 6% o wo ld's o al land and o e 20% o i iga ed land we e a ec ed by high le els o sal . I iga ed land is only 15% o cul i a ed land, bu i p oduces one hi d o he wo ld’s ood, aising awa eness abou salini y as a se ious p oblem o c op p oduc i i y. Rice like as mos c ops is e y sensi i e o sal , showing sal s ess symp oms and educed yield a ela i ely low soil salini y le els (≈ 40 mM NaCl). Among he ag onomically impo an ce eals, ice shows he highes sensi i i y o sal . Howe e , some deg ee o geno ype ole ance o sal s ess is a ailable in ice ge mplasm. To cope wi h sal s ess condi ions, plan s e ol ed se e al and di e se esponse mechanisms. One o hese mechanisms is issue ole ance, in which high sal concen a ion is ound in lea es bu is compa men alized, especially in he acuole, educing he dele e ious e ec o Na+ in he cy osol and d i ing wa e up ake o cells. Ca ion/H+ an ipo e s media e he anspo o Na+ in o he acuole. This Na+/H+ exchange is media ed by membe s o a amily o anspo e s e e ed o as K+,Na+/H+ an ipo e s (NHX- ype). Among hem, NHX1 is he mos abundan and he bes cha ac e ized membe . Se e al s udies ha e shown ha NHX1 o e exp ession leads o imp o ed sal and d ough s ess ole ance in a ious plan species. Gi en ha ansc ip ion ac o s (TFs) can ac as mas e egula o s o di e en cellula p ocesses, hey a e p omising candida es o modi ying complex ai s in c op plan s, such as sal s ess ole ance. Ne e heless, NHX1 ansc ip ional egula ion unde sal s ess is poo ly unde s ood. The main objec i e o ou s udy was he iden i ica ion and unc ional cha ac e iza ion o TFs egula ing OsNHX1 exp ession unde sal s ess in a sal ole an ice geno ype. Ini ially, we ca ied ou he iden i ica ion o a sal s ess XVIII ole an ice geno ype in which he egula ion o he OsNHX1 gene exp ession in esponse o sal s ess could be ele an o he sal s ess ole ance a seedling s age. Among he se en ice geno ypes analyzed, we ha e selec ed Hasawi, which showed a s ong sal s ess ole ance and high OsNHX1 esponsi eness o sal s ess. Using he Yeas -One-Hyb id (Y1H) sys em o sc een a sal -induced ice cDNA exp ession lib a y om Hasawi, i e TFs belonging o h ee dis inc amilies we e iden i ied as binding o OsNHX1 p omo e : one TCP (OsPCF2), one CPP (OsCPP5) and h ee NIN-likes (OsNIN-like 2, OsNIN-like 3 and OsNIN-like 4). T ansac i a ion ac i i y assays pe o med in A abidopsis and ice p o oplas s showed ha OsPCF2 and OsNIN-like 4 a e ac i a o s o he OsNHX1 gene exp ession, while OsCPP5 and OsNIN-like 2 ac as ep esso s. The ansac i a ion ac i i y o OsNIN-like 3 needs o be u he in es iga ed. When we analyzed he ansc ip le els o hese TFs in ice seedlings subjec ed o abio ic s ess condi ions, i was obse ed ha all o hem a e ea ly egula ed by bo h sal s ess and PEG-simula ed d ough , especially in oo s. The exp ession o OsPCF2 in oo s unde sal s ess and he OsNIN-like 4 in oo s subjec ed o PEG we e mainly up- egula ed in Hasawi, indica ing ha hese TFs may be associa ed wi h he sal and d ough s ess ole ance obse ed in Hasawi. Analyses o he ice NHX- ype gene p omo e s showed ha OsPCF1 and OsPCF2 (bo h TFs a e TCP class I) binding mo i s we e o e - ep esen ed in he p omo e o all OsNHX genes. Using an Elec opho e ic Mobili y Shi Assay (EMSA), we showed ha bo h OsPCF1 and OsPCF2 p o eins bind o all OsNHX gene p omo e s. In addi ion, a genome-wide sea ch iden i ied TCP class I binding mo i s in he p omo e egion o 3.089 ice genes. Among hese genes, en (OsAKT2, OsKAT2, OsKAT3, OsKC1.2, OsALMT1, OsVHA-a1, OsVHA-a2, OsVHA-a3, OsVHA-F, and OsPIP1;1) a e somehow ela ed o s oma al ape u e. We showed ha OsPCF2 binds o he espec i e cis- egula o y elemen s p esen in he p omo e s o all hese genes. In addi ion, a ice T-DNA inse ion line o OsPCF2 (gene knockou ) e ealed a gene al down- egula ion o mos o he OsPCF2 a ge s, educ ion in K+ con en in shoo s and oo s, educed s oma al XIX conduc ance o wa e apou unde ligh condi ions as well as educed sal s ess ole ance. Mo eo e , we obse ed ha OsPCF2 seems o be pos ansla ionally egula ed by H2O2, hus modula ing i s binding o he OsNHX1 p omo e . This wo k allowed he iden i ica ion o i e no el TFs binding o he p omo e o OsNHX1, which is known o ha e a ole con olling plan cell u go and expansion, hus media ing abio ic s ess e ec s on plan de elopmen . Fu he cha ac e iza ion o hese TFs will help us o be e unde s and hei unc ion and i will un eil no el a ge s o imp o emen o plan abio ic s ess ole ance and de elopmen al modula ion. XX XXI SUMÁRIO Pa a me ade da população mundial, o a oz é ida. Es e ce eal é conside ado um alimen o essencial em odo o mundo. Mais de ês mil milhões de pessoas dependem di e amen e do a oz pa a sa is aze ce ca de 50-80% da sua inges ão diá ia de calo ias. A salinização dos solos é um dos maio es obs áculos ambien ais que limi a a p odução ag ícola, esul ando em pe das signi ica i as na p odu i idade a ní el mundial. De aco do com a O ganização das Nações Unidas pa a Alimen ação e Ag icul u a (FAO), em 2008 mais de 6% da á ea cul i ada mundial o al e mais de 20% das supe ícies i igadas es a am a e adas pela salinidade. As supe ícies i igadas ep esen am apenas 15% das e as cul i adas, mas p oduzem um e ço dos alimen os a ní el mundial. Es es núme os despe am uma maio sensibilização pa a o g a e p oblema da salinidade dos solos na p odu i idade de di e sas cul u as. O a oz, assim como a maio ia das cul u as ce ealí e as, é sensí el à salinidade e ap esen a sin omas de s ess salino e edução na p odução em solos com ela i amen e baixa salinidade (≈ 40 mM NaCl). En e os ce eais de maio in e esse ag onómico, o a oz é o mais sensí el à salinidade. No en an o, alguns genó ipos de a oz ap esen am um maio g au de ole ância à salinidade. Pa a lida com a ele ada salinidade, as plan as desen ol e am mui os e a iados mecanismos, sendo a ole ância ao ní el dos ecidos um deles. Nes e caso, as olhas ap esen am uma ele ada concen ação de sal, mas es e es á compa imen ado no acúolo, eduzindo os e ei os ne as os do Na+ no ci osol e p omo endo a abso ção de água pa a as células. Os an i-po ado es ca ião/H+ medeiam o anspo e de Na+ pa a o acúolo. O anspo e Na+/H+ en e o ci osol e o acúolo é mediado po memb os da amília de anspo ado es e e idos como an i-po ado es K+,Na+/H+ ( ipo NHX). En e es es anspo ado es, o NHX1 é o memb o mais abundan e e melho ca ac e izado. Além disso, á ios es udos demos a am que a sob e- exp essão do NHX1 conduz a um aumen o da ole ância aos s esses salino e híd ico, em á ias espécies de plan as. O a o dos a o es de ansc ição (FT) a ua em como egulado es cha e em mui os p ocessos celula es, o que az deles XXII bons candida os pa a egula ca ac e ís icas complexas em plan as, como po exemplo a ole ância ao s ess salino. No en an o, a egulação ansc icional do NHX1 em espos a ao s ess salino es á longe de se bem conhecida. O obje i o p incipal des e es udo oi a iden i icação e ca ac e ização uncional de FT que se ligam ao p omo o do OsNHX1 p o enien e de um genó ipo de a oz ole an e à ele ada salinidade. Inicialmen e, es e p ojec o isou a iden i icação de um genó ipo de a oz ole an e ao s ess salino em que a espos a do OsNHX1 ao s ess salino pudesse se ele an e pa a a ole ância da plan a. En e os se e genó ipos de a oz analisados selecionámos o genó ipo Hasawi, pois ap esen ou uma acen uada ole ância ao s ess salino assim como uma ele ada indução do gene OsNHX1 pelo mesmo s ess. U ilizando o sis ema Yeas -One-Hyb id (Y1H) pa a aze a iagem de uma biblio eca de exp essão de cDNA de a oz, genó ipo Hasawi, induzido pelo s ess salino, iden i icámos cinco FT, pe encen es a ês amílias dis in as, que se ligam ao p omo o do OsNHX1 de Hasawi: um TCP (OsPCF2), um CPP (OsCPP5) e ês NIN-Like (OsNIN-like 2, OsNIN-like 3 e OsNIN-like 4). Obse ámos que alguns des es FT uncionam como ep esso es (OsCPP5, OsNIN-like 2) e ou os como a i ado es da ansc ição (OsPCF2, OsNIN-like 4). A a i idade ansc icional do OsNIN-like 3 necessi a se mais in es igada. Quando analisámos o ní el de ansc ição dos FTs em plân ulas de a oz subme idas a condições de s ess abió ico, obse ou-se que a exp essão génica de odos os FT é apidamen e modulada pelo s ess salino e híd ico (induzido po a amen o com PEG), especialmen e nas aízes. A exp essão de OsPCF2 pelo s ess salino, nas aízes, e do OsNIN-like 4 pelo PEG, nas aízes, o am p incipalmen e sob e induzidos em Hasawi ( ole an e ao s ess salino e híd ico), indicando que es es FTs podem es a associada na ole ância ao sal e seca obse ados em Hasawi. A análise da egião p omo o a dos genes NHX de a oz e elou que os mo i os de ligação pa a o OsPCF1 e OsPCF2 (FTs TCP classe I), encon am-se sob e- ep esen ados no p omo o de odos os genes OsNHX. U ilizando o XXIII Elec opho e ic Mobili y Shi Assay (EMSA) mos ámos que as p o eínas OsPCF1 e OsPCF2 in e agem com odos os mo i os iden i icados. Além disso, uma análise in silico a odo o genoma do a oz pe mi iu iden i ica locais de ligação pa a FT da amília TCP classe I na egião p omo o a de 3.089 genes. En e es es genes, dez (OsAKT2, OsKAT2, OsKAT3, OsKC1.2, OsALMT1, OsVHA-a1, a2-OsVHA, OsVHA-A3, OsVHA-F e OsPIP1; 1) es ão, de alguma manei a, elacionados com a abe u a dos es omas. A ligação da p o eína OsPCF2 aos p omo o es des es genes oi demos ada po EMSA. A análise de uma linha mu an e de a oz com inse ção de T-DNA (knockou pa a o gene OsPCF2) e elou uma edução gene alizada da exp essão génica dos al os do OsPCF2, edução do eo de K+ nas pa es aé eas e aízes, edução na condu ância es omá ica em condições de luz e edução da ole ância ao s esse salino. Pa a além disso, e i icámos que a ligação do OsPCF2 ao p omo o do OsNHX1 pa ece se egulada po modi icações pós- aducionais induzidas pelo H2O2. Es e abalho pe mi iu a iden i icação de cinco FT que se ligam ao p omo o do OsNHX1, o qual em sido desc i o como endo uma unção na egulação da u gescência e expansão celula das plan as, mediando assim o desen ol imen o das plan as em espos a aos s esses abió icos. Es udos adicionais de ca ac e ização uncional des es FT, i ão e ela possi elmen e no os al os pa a o aumen o da ole ância das plan as aos s esses abió icos e modulação do seu desen ol imen o. Gene al In oduc ion and Resea ch Objec i es 4 han 96% o he wo ld’s ice consump ion (IRRI, 2013; USDA, 2012). Fo he majo i y o he de eloping coun ies, ice a ailabili y means ood secu i y which is closely connec ed o poli ical s abili y (B adshe , 2008; FAO, 2011). The ask o p oducing addi ional ice o mee he expec ed demands o people poses a majo challenge; o e e y one billion people added o he wo ld’s popula ion, i is es ima ed ha mo e 100 million ons o ice (paddy) ha e o be p oduced annually (IRRI, 2013). This means an e o o o e all inc ease in ice p oduc ion o 26% in he nex 20 yea s, which mus be achie ed in a mo e e icien and en i onmen al- iendly sys em, using ewe esou ces (land, wa e , labo , e c.). To mee his goal, high yield geno ypes be e adap ed o ad e se en i onmen al condi ions a e needed, while limi ing yield losses. This is no possible wi hou a comp ehensi e unde s anding o he mechanisms con olling plan g ow h, de elopmen and en i onmen al s ess adap a ion (B adshe , 2008; FAO, 2011; IRRI, 2013; Papademe iou, 2000). Many plan biology s udies use A abidopsis haliana as model sys em. Howe e , A abidopsis is no he bes model o monoco s, and ou main s aple ood c ops, such as whea , ice, and maize, a e all monoco s. In addi ion, dico yledons (dico s) and monoco s a e signi ican ly dis inc in many aspec s o hei de elopmen (Izawa and Shimamo o, 1996). In spi e o being a c op species, ice has also eme ged as a model o ganism o plan molecula biology s udies, and he main easons o his a e: i is ela i ely small, compa ed o o he monoco s, and i has a ully sequenced genome (390 Mb); ools o unc ional genomic analysis, T-DNA inse ional mu an lib a ies a e a ailable, and he p oduc ion o ansgenic plan s is ela i ely easy, as compa ed o o he ce eals, due o highly e icien ans o ma ion p o ocols (Nishimu a e al., 2006; Shimamo o and Kyozuka, 2002). SALT STRESS EFFECTS ON PLANT GROWTH AND YIELD Soil salini y is a majo en i onmen al cons ain o c op p oduc ion, esul ing in billion dolla s losses in c op p oduc ion a ound he globe e e y yea Chap e I 5 (Munns, 2005; Munns and Tes e , 2008; Shabala and Cuin, 2008). Sal s ess a ec s o e 6% o he wo ld’s o al land a ea, mos o his sal a ec ed land has a isen om na u al causes, including ain all, windblown sal om ocean, sunamis, and ock wea he ing. Apa om na u al causes, soil saliniza ion is commonly associa ed o i iga ion p ac ices, such as he use o wa e wi h high sal concen a ion, o land cleaning by emo al o deep oo ed ege a ion o eplaced wi h shallow- oo ed plan s ha use less wa e , lea ing mo e wa e o pass h ough soil o g oundwa e , aising he wa e able and b inging sal o he su ace whe e i can be le behind as he wa e e apo a es (Ab ol e al., 1988). These Man-made ac ions led o a signi ican ly inc ease in sal a ec ed ag icul u e cul i a ed land. Cu en ly i is es ima ed ha 20% o he o al i iga ed land is sal - a ec ed. Gi en ha i iga ed land p oduces a leas wice mo e han ain- ed land and is esponsible o one hi d o he wo ld’s ood p oduc ion, i aises awa eness o salini y as a se ious p oblem o c op p oduc i i y (Munns, 2005; Munns and Tes e , 2008). High soil salini y is a condi ion cha ac e ized by a high concen a ion o soluble sal s, in which NaCl is he mos soluble and widesp ead sal . Soils a e classi ied as saline when he elec ical conduc i i y (EC) is 4 dS/m (≈ 40 mM NaCl) o mo e, which signi ican ly educes g ow h and yield o mos c ops. Rice as well as mos c op plan s a e glycophy es and show sal s ess symp oms and educed yield e en when he EC is lowe han 4.0 dS/m. Among ce eal c ops, ice is he mos sal sensi i e one (Munns and Tes e , 2008). The salini y h eshold o ice is 3.0 dS/m wi h a 12% educ ion in yield, pe dS/m, beyond his h eshold (Gao e al., 2007). Howe e , some deg ee o geno ype ole ance o sal s ess ole ance is a ailable in ice ge mplasm. Among 180.000 ice geno ypes sc eened by he In e na ional Rice Resea ch Ins i u e (IRRI), 17% had accep able ole ance a an EC o 10 dS/m a seedling s age (G ego io e al., 2002). Sal s ess a ec s plan s in wo dis inc phases. The i s phase is he osmo ic e ec ; independen o he accumula ion o sal in he shoo . Sal s dissol ed in he soil solu ion lowe he wa e po en ial, making he wa e up ake Gene al In oduc ion and Resea ch Objec i es 6 om oo s he modynamically un a o able, which induces wa e de ici (Pa do, 2010; Roy e al., 2014). Wa e de ici is apidly ansmi ed (wi hin minu es) om oo s o shoo s causing in acellula u go educ ion and dec eased cell expansion (Munns, 2005; Munns and Tes e , 2008). This signal also p omo es he biosyn hesis o abscisic acid (ABA), which will induce s oma al closu e and consequen ly educ ion in anspi a ional wa e loss (Munns, 2005; Munns and Tes e , 2008; Roy e al., 2014). Lowe s oma al conduc ance leads o a lowe ca bon assimila ion, biomass p oduc ion and dec eased yield. The second phase o salini y is ionic speci ic; his is due o he accumula ion o oxic concen a ions o sodium (Na+) and/o chlo ide (Cl-) ions, especially in he olde lea es, inducing issue nec osis and ea ly lea senescence (Roy e al., 2014). Fo mos plan species Na+ appea s o each a oxic concen a ion ea lie han Cl- (Tes e and Da enpo , 2003), and o ice (Chi Lin and Huei Kao, 2001; Tsai e al., 2004) Na+ has been shown o be he p ima y oxic ion. Fu he mo e, osmo ic and ionic s ess dis u b ae obic me abolism and induce he accumula ion o eac i e oxygen species (ROS) beyond he plan ’s capaci y o cellula oxidan de oxi ica ion, which in u n nega i ely a ec s cellula s uc u es and me abolism (Cha es and Oli ei a, 2004; Cha es e al., 2009). A dele e ious e ec imposed by sal s ess, du ing he second phase, is ions imbalance (Munns and Tes e , 2008). Po assium (K+) is an essen ial mac onu ien ha plays impo an unc ions ela ed o enzyme ac i a ion, osmo ic adjus men and u go gene a ion, egula ion o memb ane po en ial, and cy oplasma ic pH homeos asis (Ba agán e al., 2012; PPI, 1998). Due o simila i y in physicochemical p ope ies be ween Na+ and K+ (i.e., ionic adius and ion hyd a ion ene gy), he o me compe es wi h K+ o majo binding si es in key me abolic p ocesses in he cy oplasm, such as enzyma ic eac ions, p o ein syn hesis and ibosome unc ions (PPI, 1998; Ma schne , 1995). Na+ inhibi s enzyme ac i i y o many o hese enzymes ha equi e K+ o unc ioning (Duggleby and Dennis, 1973). Wi h o e 50 di e en cy oplasmic enzymes being ac i a ed by K+, dis up ion o he K+ homeos asis leads o se e e me abolism Chap e I 7 impai men , bo h in oo and lea issues (PPI, 1998; Ma schne , 1995). I has been sugges ed ha o plan su i al unde sal s ess, i is essen ial o main ain a high K+ concen a ion while keeping a low concen a ion o Na+ in he cy osol, esul ing in a high cy osolic K+/Na+ a io. The es ic ion o Na+ accumula ion in shoo s unde sal s ess has been epo ed as co ela ing wi h he sal s ess ole ance o ice (Lu s e al., 1996) and maize (Zea mays L.) (Tes e and Da enpo , 2003). SODIUM UPTAKE FROM SOIL, SENSING AND SIGNALING MECHANISMS The eno mous nega i e memb ane po en ial ac oss he plasma memb ane o plan s oo cells (nega i e inside) a o he passi e anspo o Na+ in o he cells, and especially so when he sodium concen a ion inc eases in he soil solu ion. In con as , Na+ e lux (i.e., emo al om he cell) is no passi e and equi es ene gy expendi u e (Maa huis e al., 2014). The majo pa hway o passi e Na+ en y in o oo cells a high soil salini y is media ed by a amily o Non Selec i e Ca ion Channels (NSCCs amily), bu hei molecula iden i y emains unknown (Blumwald e al., 2000; K onzucke and B i o, 2011) (Fig. 1). In addi ion o he Na+ low ac oss cellula memb anes o en e he oo s (symplas low), i has been epo ed ha , a leas in some species, in e up ions in he endode mis (passage cells) allow he mo emen o wa e and solu es (i.e., Na+) h ough he cell wall and in e cellula spaces. This ype o anspo , o he xylem s eam, wi hou c ossing he plasma memb ane is e e ed as “apoplas low” (K onzucke and B i o, 2011; Yeo e al., 1987) (Fig. 1). Caspa ian s ips and sube ine laye s in he oo endode m and exode mal laye s p o ide some ba ie o apoplas low (Yeo e al., 1987). In many plan species, such as ice, he apoplas low is conside ed o be he majo po o Na+ en y (≈ 50% o o al Na+ up ake) (Yeo e al., 1987), especially a high salini y le els, and is esponsible o a signi ican amoun o Na+ anspo ed o he shoo (K onzucke and B i o, 2011; Yeo e al., 1987). Na+ ions aken up by he oo s a e hen anspo ed o shoo s ia xylem essels by bulk low (Fig. 1). This is d i en by wa e anspi a ion om lea es Gene al In oduc ion and Resea ch Objec i es 8 c ea ing ensions in he oo xylem, which p o ides he majo o ce o mo e wa e om oo s o up o he shoo s (Nobel, 2009) (Fig. 1). Sodium has also a s ong inhibi o y e ec on K+ up ake by cells, p obably by inhibi ing K+ anspo e s, such as AKT1 (hype pola iza ion-ac i a ed inwa d‐ ec i ying K+ channel), a majo playe in K+ acquisi ion by plan s (Fuchs e al., 2005; Hi sch e al., 1998), and HAK5 (ca ie - ype HUP/HAK/KT anspo ) (Nie es-Co dones e al., 2010), bo h p esen in he plasma memb ane o oo cells. Addi ionally, memb ane depola iza ion caused by la ge cy osolic Na+ in lux esul s in inc eased K+ e lux possible h ough depola iza ion-ac i a ed ou wa d‐ ec i ying K+ channels (e.g., GORK) (Adams and Shin, 2014) and NSCCs (Sun e al., 2009). Ve y li le is known abou how Na+ is sensed in mos cellula sys ems. In heo y, Na+ can be sensed ei he be o e o a e en y he cell, o bo h. Ex acellula Na+ may be sensed by a memb ane ecep o , whe eas in acellula Na+ may be sensed ei he by memb ane p o eins o by any o he many Na+ sensi i e enzymes in he cy oplasm (Conde e al., 2011). The plasma memb ane Na+/H+ an ipo e SOS1 (Sal O e ly Sensi i e 1) has been desc ibed as a possible Na+ senso (Shi e al., 2000). I s anspo ac i i y is essen ial o Na+ e lux om cells (Quin e o e al., 2002), bu i s unusually long cy oplasma ic ail is hough o be in ol ed in Na+ sensing (Shi e al., 2000) (Fig. 3). Howe e , his mechanism i is no ully clea . In plan cells, Ca2+ ac s as a second messenge connec ing a wide ange o ex acellula s imuli wi h a ious in acellula esponses (Conde e al., 2011). Sal s ess o igina es a as and ansien inc ease in ee cy osolic Ca2+, likely eleased om he acuole (Po osin e al., 2009), ha is decoded by Ca2+ senso s such as calmodulin (CaM), calcineu in B-like p o eins (CBLs) and CBL-in e ac ing p o ein kinases (CIPKs). When ac ing as a CBL-CIPK complex, hese Ca+ senso s a e o en designed as calcium-dependen p o ein kinases (CDPKs) (Conde e al., 2011; Yang and Poo aiah, 2003). Cy osolic Ca2+ senso s in u n igge many signal ansduc ion pa hways, in ol ed in he egula ion o ion channels ac i i y Chap e I 9 (e.g,. NSCCs a e s ongly blocked by ex e nal Ca+2), as well as enzyma ic ac i i y and gene ansc ip ion, ending up in ion homeos asis (Adams and Shin, 2014; Conde e al., 2011; Ma inez-A ienza e al., 2007; Pa do and Quin e o, 2002; Yamaguchi e al., 2005). MECHANISMS OF SALT TOLERANCE Sal s ess equen ly a ec s plan habi a s and many species e ol ed a ied mechanisms o dealing wi h i . These mechanisms o sal ole ance can be classi ied in o h ee main ca ego ies. The i s one is osmo ic s ess ole ance, which is egula ed by is egula ed by long dis ance signals ha educe shoo g ow h (Roy e al., 2014) and in ol es biosyn hesis and accumula ion o compa ible solu es o main ain wa e up ake (Peleg e al., 2011). Ano he mechanism is ion exclusion, in which Na+ anspo educes he accumula ion o oxic Na+ wi hin lea es. This sys em ope a es by con olling he Na+ loading o he xylem and Na+ e ie al om he xylem, be o e eaching he shoo pho osyn he ic issues (Fig. 1). Finally, he hi d mechanism is issue ole ance, in which high sal concen a ion is ound in lea es, bu Na+ is compa men alized a he cellula and in acellula le el (especially in he acuole) educing he dele e ious e ec o Na+ in he cy osol and d i ing wa e up ake o cells (Fig. 1) (Munns and Tes e , 2008). In mos cases, he plan sal s ess ole ance elies on he h ee mechanisms oge he , a he han only one mechanism is pa icula (Munns and Tes e , 2008; Pi es e al., 2015; Roy e al., 2014). SODIUM TRANSPORTERS AND PLANTS SALT STRESS TOLERANCE The s udy o sal s ess ole ance in plan s usually ocuses on he con ol o Na+ mo emen , namely on: Na+ exclusion in oo s, Na+ long dis ance anspo , and Na+ compa men aliza ion a bo h cellula and issue le el (Conde e al., 2011; Munns, 2005; Roy e al., 2014). These p ocesses a e media ed by memb ane anspo e s eason why he manipula ion o hei ac i i y has an eno mous po en ial o imp o e plan pe o mance unde sal s ess (B ini and Khaled., 2012). Gene al In oduc ion and Resea ch Objec i es 10 He e, we ocus on he speci ic memb ane anspo e s desc ibed as in ol ed in he abo e ou lined ole ance p ocesses. In con as o animal cells, highe plan s do no ha e Na+-ATPases o Na+/K+-ATPases and ely on H+-ATPases and H+- py ophospha ases (PPases) o c ea e a p o on-mo i e o ce necessa y o d i e Na+ anspo ac oss memb anes (Conde e al., 2011). The plasma memb ane localized SOS1 (Ji e al., 2013; Ma inez-A ienza e al., 2007) and he acuole memb ane ( onoplas ) localized NHX1 (Fukuda e al., 2011; Jiang e al., 2010) a e wo Ca ion/H+ an ipo e s in ol ed in Na+ exclusion back o he soil and in K+-Na+ compa men aliza ion in he acuole. In addi ion, membe s o he HKT1 amily o HKTs (high a ini y po assium anspo e s) a e in ol ed in he con ol o Na+ long dis ance anspo by eabso p ion o Na+ om he xylem sap in o he oo cells, p e en ing he la ge accumula ion o Na+ in he abo e-g ound issues (Rus e al., 2004) (Fig. 1). I is no ewo hy ha HKT1 Na+ exclusion mechanism om he anspi a ion s eam has been equen ly indica ed as a s ong ai in sal ole ance o di e en ce eals, such as ice (Ren e al., 2005) and du um whea (T i icum u gidum L. subsp. du um) (James e al., 2006). In he ollowing sec ions, he ole ha di e en Na+ anspo e s and H+- pumps play in plan sal s ess esponse is discussed. Chap e I 11 Figu e 1. Summa y diag am showing key plasma and onoplas memb ane anspo e s, channels and pumps media ing Na+ and K+ homeos asis in plan s unde sal s ess (adap ed om Roy e al. 2014). Na+ ions en e he cells ia Non Selec i e Ca ion Channels (NSCCs), likely o he ca ion anspo e s (no shown) and h ough he cell wall and in e cellula spaces (apoplas low – ed a ow). The Na+/H+ an ipo e SOS1 ex udes Na+ a he oo soil in e ace, hus educing he Na+ ne in lux o Na+. A he xylem pa enchyma cells, HKT1-like p o eins e ie e Na+ om he xylem sap he eby es ic ing he amoun o Na+ eaching he pho osyn he ic issues. To ansloca e Na+ back o he oo , ions unloaded om xylem may be anspo ed in o phloem ia addi ional HKT1-like p o ein. In addi ion, HKT1-like p o eins also load Na+ in o shoo phloem and hen Na+ is ans e ed in o oo s ia downs eam o phloem, p e en ing Na+ accumula ion in shoo s. SOS1, xylem pa enchyma cells localized, is also sugges ed o media e Na+ e lux om xylem essels unde high salini y. Incoming Na+, in oo and shoo s, is s o ed in he la ge cen al acuole by onoplas localized NHX exchange s (NHX1-4). Plasma memb ane (PM) H+-ATPase (P-ATPase), PM H+-PPase (PM-PPase), onoplas H+-ATPase (V-ATPase) and onoplas H+-PPase (V-PPase) gene a e elec ochemical po en ial g adien o seconda y ac i e anspo . H+-Pumps and he plan sal s ess esponse P o on g adien s a e c ucial o he anspo o ions and solu es ac oss he di e en plan cell memb anes. Th ee p ima y p o on anspo p o eins a e ound in plan cells: (1) plasma memb ane (PM) and (2) acuola H+-ATPases, which couple ATP hyd olysis wi h p o on anspo , and (3) PM and acuola H+- PPase, which couple py ophospha e hyd olysis wi h p o on anspo (Fuglsang e Gene al In oduc ion and Resea ch Objec i es 12 al., 2010; Gaxiola e al., 2007). In plan cells, H+-ATPase and H+-PPase a e majo componen s o he acuole memb ane (Sil a and Ge ós, 2009). The H+-Pumps gene a e an elec ochemical po en ial g adien ac oss memb anes, which is he mo i e o ce o a la ge se o seconda y anspo s. 1- Plasma memb ane H+-ATPase The PM H+-ATPase belongs o a class known as P- ype ATPases (P- ATPases), and is encoded by a la ge gene amily (Fuglsang e al., 2010; Gaxiola e al., 2007). The pump is o med by a single subuni p o ein, which con ains en ans-memb ane helices and a la ge cy oplasma ic domain (Fuglsang e al., 2010). A abidopsis and ice genomes encode ele en and en P-ATPases, espec i ely (A ango e al., 2003; Axelsen and Palmg en, 2001). The p o on mo i e o ce c ea ed by P-ATPases is la gely esponsible o an inside nega i e po en ial ac oss he plasma memb ane, which is essen ial o oo nu ien up ake, s oma al ape u e, phloem loading, and cell g ow h (Blumwald e al., 2000; Gaxiola e al., 2007; Mansou , 2014). Besides egula ion o many physiological p ocesses, he P-ATPases ha e a c i ical ole in plan adap a ion o sal s ess condi ions. Highe P-ATPases ac i i y unde sal s ess condi ions epola izes he NaCl-induced depola iza ion o PM. This esponse has been s ongly associa ed wi h sal s ess ole ance (Mansou , 2014). The main enance o he PM po en ial unde sal s ess h ough P-ATPases ac i i y has a g ea e ec on educ ion o Na+ in lux ia depola iza ion-ac i a ed NSCCs and K+ e lux ia KORs and NSCCs, which help o es o e highe K+/Na+ le els (Sun e al., 2009). Also, P-ATPases highe ac i i y unde s ess ene gizes he ac i e anspo ha exclude Na+ om oo cells, a p ocess dependen on he SOS1 Na+/H+ an ipo e (Gaxiola e al., 2007). Fu he mo e, i was epo ed ha highe ac i a ion o P-ATPases is o en ound in halophy es and sal ole an geno ypes, which may co ela e wi h sal s ess ole ance (Mansou , 2014). Fo ins ance, in ice callus lines, a highe ac i a ion o P-ATPases occu ed in sal - ole an lines as compa ed o less ole an ones (Pons e al., 2011). Chap e I 13 The sal -dependen ac i a ion o PM H+-pump is associa ed wi h inc eased le els o gene exp ession as well as pos - ansla ional modi ica ions o he enzyme p esen in a p eexis ing pool (Gaxiola e al., 2007; Mansou , 2014). Howe e , i is likely ha mos egula ion o he pump ac i i y occu s a he pos - ansla ional le el (Fuglsang e al., 2010; Gaxiola e al., 2007). The pump ac i i y can be modula ed by phospho yla ion/dephospho yla ion o he penul ima e a.a. esidue o he cy oplasma ic C- e minus domain, a h eonine esidue. The phospho yla ed h eonine esidue p omo es binding o he ac i a ing 14-3-3 p o ein (Fuglsang e al., 2010). S oma al ape u e in ol es egula ion o osmo ic p essu e wi hin he gua d cells, a p ocess powe ed by P-ATPases ac i i y and esponsi e o a wide a ie y o ex e nal signals (Gaxiola e al., 2007). Blue ligh pe cep ion in gua d cells is media ed by pho o opins, which in i ia e a signal ansduc ion signal pa hway ha in ol es an ups eam p o ein phospha ase I and a downs eam p o ein kinase ha phospho yla es he penul ima e C- e minus a.a. esidue o he P-ATPase (Gaxiola e al., 2007; Takemiya e al., 2006). Unde d ough and sal s ess condi ions, s oma al closu e is induced by ABA h ough a mechanism ha in ol es p oduc ion o hyd ogen pe oxide (H2O2) and dephospho yla ion o he P- ATPases (Gaxiola e al., 2007; McAinsh e al., 1996; Zhang e al., 2001). 2- Vacuola H+-ATPase Among he h ee p o on-pumps ound in plan cells, he acuola H+- ATPase (V-ATPase) is he mos complex one (Gaxiola e al., 2007). The V- ATPase was i s ound associa ed wi h he endomemb ane sys em whe e i acidi ies and gene a es a p o on o ce mo i e wi hin di e se cell compa men s (e.g., acuole, endoplasmic e iculum and ans-Golgi ne wo k) (Ra ajczak, 2000). Howe e , V-ATPases ha e also been associa ed wi h cell plasma memb ane (Hani zsch e al., 2007). The abili y o he V-ATPase o main ain he cy osolic pH homeos asis and o acidi y he endomemb ane compa men s is c ucial du ing essen ial p ocesses, such as cell g ow h and elonga ion (Hani zsch e al., 2007). Gene al In oduc ion and Resea ch Objec i es 20 The SOS pa hway is no limi ed o he h ee main p o eins, as i in e ac s wi h o he s ess ela ed p o eins. A SOS3 homolog SOS3-LIKE Calcium Binding P o ein8 (SCABP8/CBL10) in e ac s wi h SOS2 o o m an al e na i e p o ein kinase complex ha egula es SOS1 ac i i y in he plasma memb ane in esponse o sal s ess, mainly in shoo s; while SOS3 unc ions p ima ily in he oo (Quan e al., 2007) (Fig. 3). SOS2 phospho yla es CBL10 in a Ca2+ independen manne upon sal s ess, and his phospho yla ion s abilizes he SOS2-CBL10 complex associa ion wi h he plasma memb ane and inc eases SOS1 an ipo e ac i i y (Hasegawa, 2013; Kim e al., 2007; Quan e al., 2007). Abscisic acid insensi i e (ABI2) in e ac s wi h SOS2 o p e en SOS3 binding o SOS2 and kinase ac i a ion. Such ABI2-SOS2 in e ac ion may ep esen an in eg a ing node be ween sal s ess and ABA signaling (Hasegawa, 2013; Oh a e al., 2003). The SOS pa hway may also egula e he Na+ acuola compa men aliza ion. In e ac ion o SOS2-CBL10 may esul in localiza ion o he kinase complex a he acuola memb ane whe e i is possibly in ol ed in he egula ion o Na+/H+ exchange a he onoplas , p esumably by egula ion o NHX an ipo e ac i i y (Kim e al., 2007; Qiu e al., 2004). Howe e , o da e no NHX an ipo e has been shown o be di ec ly egula ed by SOS2 and/o by he SOS2- complex. In addi ion, SOS2 has been sugges ed o egula e he V-ATPase ac i i y. SOS2 was ound o in e ac wi h he B1 and B2 subuni s o he V-ATPase in he absence o CBL p o eins, and onoplas esicles om he A abidopsis sos2- 2 mu an showed educed ATPase and H+- ansloca ion ac i i ies (Ba elli e al., 2007). Po assium homeos asis has also been shown o be modula ed by he SOS signaling pa hway. The CIPK23 di ec ly phospho yla es and ac i a es he AKT1 K+ channel a he plasma memb ane, signi ican ly inc easing he K+ up ake unde low-K+ s ess (Pa do, 2010; Ren e al., 2013). Fu he mo e, he p o ein CBL10 has been indica ed o di ec ly in e ac wi h AKT1 channel, nega i ely egula ing i s ac i i y in oo s in a CIPK-independen way (Ren e al., 2013). I is well known ha plan sal s ess ole ance is closely ela ed o main enance o Chap e I 21 high K+/Na+ cy osolic a io unde s ess (Tes e and Da enpo , 2003). The possibili y ha CBL10 unc ions as an in e connec ing egula o o SOS1 and AKT1 may indica e ha CBL10 plays a c ucial ole in ion homeos asis (K+/Na+) unde sal s ess by egula ing bo h Na+ and K+ up ake/exclusion (Ren e al., 2013). HKTs and he plan sal s ess esponse Ano he impo an de e minan o sal s ess ole ance in plan s is he ac i i y o he HKT (high a ini y po assium anspo e ) p o eins (Munns and Tes e , 2008; Roy e al., 2014). The HKT amily is qui e di e se, and his di e si y e lec s hei la ge ampli ude o unc ions (Almeida e al., 2013; Munns and Tes e , 2008; Roy e al., 2014). The HKT amily is di ided in wo dis inc classes acco ding o hei anspo cha ac e is ics. The main dis inguishing ea u e is he a.a. sequence ha cons i u es he i s po e domain (PD) (Pla en e al., 2006). Membe s o class I anspo e s (HKT1) ha e a se ine (S), o ming an S-G-G-G mo i , whe e mos o he membe s o class II (HKT2) ha e a G in he posi ion occupied by he S in class I anspo e s, o ming a G-G-G-G mo i (Mase e al., 2002). The p esence o ei he S o G a his posi ion is c i ical o K+ speci ici y o he anspo e . The p esence o a S is cha ac e ized by a p e e ence o Na+ conduc ance o e o he ca ions (HKT1), whe eas he p esence o a G is cha ac e ized by anspo o Na+ and/o K+ depending on he ex e nal concen a ions o hese wo ions (HKT2) (K onzucke and B i o, 2011; Pla en e al., 2006). Howe e , he e a e no able excep ions, in pa icula HKT2;1 om ce eals, in which he G has e e ed o S (K onzucke and B i o, 2011), bu i has been clea ly shown o be in ol ed in media ing Na+ and K+ en y in o oo s (K onzucke and B i o, 2011; Munns and Tes e , 2008). The main ole o HKT1 is belie ed o be Na+ e ie al om he anspi a ion s eam a oiding he o e accumula ion o Na+ in he pho osyn he ic issues. Gene al In oduc ion and Resea ch Objec i es 22 HKT1 amily The bes cha ac e ized membe o HKTs class I is A HKT1;1 om A abidopsis. Dis up ion o A HKT1;1, he only membe o HKT amily in A abidopsis, caused a highe accumula ion o Na+ in he shoo s bu educed concen a ion in oo s, wi h li le e ec on he ne Na+ up ake (K onzucke and B i o, 2011; Pa do, 2010; Rus e al., 2004). A HKT1;1 is p e e en ially exp essed in he plasma memb ane o xylem pa enchyma cells and phloem cells o bo h oo and lea es, whe e i is sugges ed o egula e he Na+ dis ibu ion be ween oo s and shoo s (K onzucke and B i o, 2011; Pa do, 2010) (Fig. 1). Two complemen a y unc ions o A HKT1;1 ha e been p oposed. In he phloem eci cula ion model, A HKT1;1 loads Na+ in o shoo phloem cells o be ans e ed o oo s ia he downwa d s eam, p e en ing Na+ o e accumula ion in he shoo . Howe e , he o e all Na+ e ansloca ion po en ial ia phloem should no exceed 10%, o less o he o al shoo Na+ load in he xylem anspi a ion s eam (Be homieu e al., 2003). Ano he unc ion o A HKT1;1 is o unload Na+ om he ascending xylem sap, he eby es ic ing he amoun o Na+ eaching he pho osyn he ic issues and suppo ing sal s ess ole ance. Analysis o se e al QTLs o sal ole ance in ice (K onzucke and B i o, 2011; Ren e al., 2005) and whea (By e al., 2007; James e al., 2006; K onzucke and B i o, 2011) has p o ided u he e idence o he impo ance o HKT class 1 genes in con olling Na+ accumula ion in lea es upon sal s ess. In ice, QTL analyzes showed ha highe shoo K+ con en o he sal - ole ance indica geno ype, Nona Bok a, coseg ega ed wi h an allelic a ian o SKC1 (Shoo K+ Con en 1) wi h highe ac i i y as compa ed o ha o he sal -sensi i e japonica geno ype, Koshihika i (Ren e al., 2005). SCK1, now e e ed o as OsHKT1;5 (OsHKT8) is a plasma memb ane, K+ independen , and Na+ selec i e anspo e ha is p e e en ially exp essed in he pa enchyma cells su ounding xylem essels (Almeida e al., 2013; Pa do, 2010; Ren e al., 2005). The Nona Bok a OsHKT1;5 has ou amino acids di e en om he Koshihika i p o ein, and his di e ence has been associa ed wi h g ea e Na+ anspo e ac i i y and inc eased abili y o Chap e I 23 main enance o K+/Na+ homeos asis unde sal s ess (Ren e al., 2005). Rice con ains ou mo e HKT1 membe s in he genome, OsHKT1;1, OsHKT1;2, OsHKT1;3, OsHKT1;4 (Almeida e al., 2013; Co sa is e al., 2012; Ren e al., 2005). OsHKT1;1 was ound o encode a Na+ anspo e exp essed in oo s (epide mis, exode mis and co ex di e en ia ed in o ae enchyma) and in shoo s is exp essed in bulli o m cells and ascula issues (Almeida e al., 2013). Rega ding OsHKT1;2 no in o ma ion is a ailable. OsHKT1;3 is likely o encode a Na+ anspo e mainly exp essed in he shoo s (bulli o m cells and ascula issues, bo h xylem and phloem), bu was also ound in he oo s (co ex and in he ascula issues o he s ele) (Almeida e al., 2013). OsHKT1;4 gene exp ession is up- egula ed in he lea shea hs unde sal s ess (Co sa is e al., 2012) and encodes h ee di e en splice o ms, iden i ied in bo h ice geno ypes Pokkali (sal - ole an ) and Nipponba e (sal -suscep ible). All OsHKT1;4 spliced o ms a e ansla ed in o p o ein, ne e heless only he longe splicing o m seems o be ansla ed in o a unc ional p o ein (Co sa is e al., 2012). In e es ingly, Pokkali is able o main ain a much highe a io o unc ional OsHKT1;4 ansc ip s in younge lea shea hs as compa ed o Nipponba e. In addi ion, ansc ip le els o he unc ional ansc ip s we e in e sely co ela ed wi h he indi idual lea blade Na+ concen a ion in bo h geno ypes (Co sa is e al., 2012). A his poin i seems ha he longe OsHKT1;4 splicing o m is he key anspo e con olling he shea h- o- blade ans e o Na+ in ice shoo s (Co sa is e al., 2012). In whea , QTL analyses using du um whea (T i icum u gidum L. subsp. du um), b eeding Line 149, led o he iden i ica ion o wo loci, Nax1, and Nax2, which dec eased Na+ accumula ion in he lea blade (By e al., 2007; James e al., 2006; K onzucke and B i o, 2011). In addi ion, he b ead whea (T i icum aes i um), which is an allohexaploid (2n = 6s = 42, genome AABBDD), was ound o be mo e sal ole an han he allo e aploid pas a whea (AABB genomes). I was shown ha he D genome ca ies a locus (Kna1) esponsible o main enance o high K+/Na+ a io du ing sal s ess jus i ying he sal ole ance o b ead whea (By e al., 2007; Dubco sky e al., 1996; K onzucke and B i o, 2011). The Gene al In oduc ion and Resea ch Objec i es 24 p ocess con olled by Nax2 and Kna1 locus educes ne oo xylem loading o Na+, while he Nax1 locus educes Na+ accumula ion in he lea blade by es ic ing Na+ loading in o oo xylem and pa i ioning Na+ in o he lea shea h (Hasegawa, 2013; James e al., 2006). Using high- esolu ion mapping Nax1 and Nax2 we e iden i ied as membe s o he HKT1;4 gene amily and Kna1 as membe o he HKT1;5 gene amily. Because bo h Nax genes o igina ed om a whea ela i e, T i icum monococcum, ha was c ossed wi h a du um whea , hey we e named TmHKT1;4-A2 and TmHKT1;5-A, espec i ely. The Nax2 egion o he b eeding Line 149 was ound o co espond o he Kna1 egion o he b ead whea and Kna1 was named TaHKT1;5-D (Almeida e al., 2013). Nax1 and Nax2 genes do no exis in mode n b ead o du um whea geno ypes, and in og ession o Nax1 o Nax2 in o b ead whea led o educed lea blade Na+ accumula ion and inc eased lea blade Na+ exclusion ela i e o he pa en espec i ely. The combina ion o Nax1 and Nax2 u he dec eased Na+ accumula ion in he lea blade (James e al., 2011), showing ha hese genes clea ly ha e simila unc ions as A HKT1;1 in A abidopsis and OsHKT1;5 and OsHKT1;4 in ice (Almeida e al., 2013; James e al., 2006; Ren e al., 2005). Mo eo e , ield ails unde high saline soils wi h du um whea ca ying he Nax2 gene caused a 25% inc ease in g ain yield and educed Na+ accumula ion in lag lea as compa ed o a nea isogenic line wi hou he Nax2 locus (Munns e al., 2012). Nax2 was exp essed in pe icycle and xylem pa enchyma cells whe e he p o ein is loca ed and is in ol ed in unloading Na+ om xylem essels and acili a ing shoo exclusion (James e al., 2006; Munns e al., 2012). Al oge he , hese esul s indica e ha HKT1-media ed Na+ exclusion om shoo is an e ec i e mechanism o enhancing sal s ess ole ance in c op plan s. Conce ning HKT1 ansc ip ional egula ion, some ansc ip ional egula o y elemen s ha e been iden i ied in he A HKT1 p omo e . The andem epea egions (R1 and R2) ound in he dis al A HKT1 p omo e egion loca ed abou 3.9 kb ups eam o he ansla ional s a codon we e esponsible o exp ession o A HKT1 in oo s (Baek e al., 2011; Rus e al., 2004). The ATG- Chap e I 25 closes epea sequence R2 ac s as an enhance elemen o A HKT1 exp ession. I s inac i a ion caused educed A HKT1 exp ession in oo and highe Na+ accumula ion in shoo (Baek e al., 2011; Rus e al., 2004). The A HKT1 p omo e con ains a highly me hyla ed GC egion (250 bp) a 2.6 kb ups eam o he ansla ional s a codon. In e es ing, me hyla ion in he lea is highe han in oo s, which sugges s ha highe me hyla ion in his p omo e egion is equi ed o main ain A HKT1 exp ession a low le els and pe haps in a co ec pa e n o exp ession in he di e en issues (Baek e al., 2011). Fu he mo e, his egion con ains a pu a i e small RNA a ge si e, which was sugges ed o be in ol ed in me hyla ion guided by small RNAs (Baek e al., 2011). HKT2 amily HKTs class 2 a e gene ally ound in monoco yledonous species and no HKT class 2 homologs ha e been iden i ied in dico yledonous species (Adams and Shin, 2014; Pla en e al., 2006). Fou HKT class 2 membe s ha e been cha ac e ized in de ail: OsHKT2;1 and OsHKT2;2 in ice, TaHKT2;1 in whea , and H HKT2,1 in ba ley (Ho deum ulga e L.). These anspo e s ha e common p ope ies hough o be sha ed by all HKT2 class 2 membe s, such as a ole in Na+ up ake om ex e nal medium unde K+ limi ing condi ions (Almeida e al., 2013). The wo cha ac e ized ice membe s o he HKT amily, OsHKT2;1 and OsHKT2;2, ha e been epo ed o media e Na+ up ake om soil unde K+ limi ing condi ions. OsHKT2;1 gene exp ession is induced by K+ de iciency (Ho ie e al., 2001; Yao e al., 2010). OsHKT2;1 is an a ypical HKT class 2 which has an S esidue in he i s PD and media es high-a ini y Na+ up ake. Howe e , OsHKT2;1 can also media e K+ anspo depending on he ex e nal concen a ion o bo h Na+ and K+ (Almeida e al., 2013; Jabnoune e al., 2009; Yao e al., 2010). In oo s, OsHKT2;1 is exp essed in he pe iphe al laye s (epide mis, exode mis and co ex di e en ia ed in o ae enchyma). In he s ele i is manly exp essed in he phloem and in he shoo s i is exp essed in bulli o m cells and ascula issues, bo h xylem and phloem (Jabnoune e al., 2009). OsHKT2;1 is known o be highly Gene al In oduc ion and Resea ch Objec i es 26 in ol ed in “nu i ional” abso p ion o Na+ and i s ele ance in Na+ up ake du ing sal s ess may be limi ed since i has a mic omola a ini y o Na+ and i s ac i i y is apidly down egula ed a high Na+ concen a ion. In e es ingly, RNA le els o a leas h ee o he OsHKTs genes ha e been shown o be inhibi ed by ex e nal Na+ concen a ion as low as 30 mM (Ho ie e al., 2001). On he o he hand, OsHKT2;2 ha e only been ound in he sal - ole an Nona Bok a and Pokkali geno ypes, being absen in he ice sensi i e Nipponba e which sugges s ha he p esence o OsHKT2;2 is an e olu iona y ad an age o sal - ole an geno ypes (Almeida e al., 2013; Ho ie e al., 2001). OsHKT2;2 is exp essed in oo s among o he issues and anspo ing bo h Na+ and K+, bu unde salini y only Na+ is anspo ed (Kade e al., 2006). O he OsHKTs class 2 membe s ha e also been iden i ied (OsHKT2;2/1, OsHKT2;3, OsHKT2;4), howe e hese will be no desc ibed. Fo u he in o ma ion, see Almeida e al. (2013) and K onzucke e al. (2011). In whea , TaHKT2;1 seems o ha e a unc ion in oo Na+ in lux simila o he ice OsHKT2;1 (Ho ie e al., 2009). TaHKT2;1 is exp essed in he oo co ex, and is induced by K+ de iciency. In plan a, TaHKT2;1 has been sugges ed o ha e a ole in Na+ anspo wi h a possible ole in oo Na+ up ake, hough TaHKT2;1 was also epo ed o anspo K+ (Almeida e al., 2013). In ba ley, a ela i e sal - ole an species, H HKT2;1 is p e e en ially exp essed in oo co ex and o a much lowe le el in lea blade and shea hs, and i is induced by K+ de iciency in oo s and shoo s and by high Na+ concen a ion in shoo s. H HKT2;1 media es bo h Na+ and K+ anspo (Almeida e al., 2013; Mian e al., 2011). T ansgenic ba ley lines o e -exp essing H HKT2;1 esul s in highe Na+ concen a ion in xylem, enhanced ansloca ion o Na+ o shoo s and highe Na+ accumula ion in he lea es han he non- ans o med plan s, suppo ing he hypo hesis ha his anspo e is able o media e oo Na+ up ake (Mian e al., 2011). Mo eo e , ansgenic plan s showed a signi ican inc ease in shoo K+ con en in plan s g owing in limi ing K+ condi ions, sugges ing ha H HKT2;1 may Chap e I 27 also play a ole in K+ abso p ion o e-abso p ion a e y low K+ concen a ions (Mian e al., 2011). NHX1 and he plan sal s ess esponse A he cellula le el, high amoun s o Na+ can be ole a ed by in acellula pa i ioning so ha concen a ion in he cy oplasm is kep as low as 10-30 mM (Munns and Tes e , 2008). This s a egy can be applied by plan s o he alle ia ion o excessi e cy osolic Na+, by seques a ing Na+ in o acuole, which ypically makes up o 80-90% o he cell olume. O he o ganelles, such as endossomal compa men s, plas ids and mi ochond ia, may also accumula e Na+ and hus con ibu e o he o e all subcellula Na+ seques a ion (Zhu, 2003). The acuola seques a ion o Na+ ha occu s in all issues is no only impo an o Na+ de oxi ica ion in he cy osol, bu i is also a c i ical mechanism o osmo ic adjus men o main ain wa e up ake om saline solu ions (Bassil e al., 2012; Munns and Tes e , 2008; Zhu, 2003). Inc eased acuola Na+ concen a ion would also equi e a coo dina ed inc ease in he osmo ic p essu e o he o he subcellula componen s, including cy osol, o main ain he osmo ic p essu e and he eby he olume. This can be achie ed by an inc ease in he K+ concen a ion o a sub- oxic le el, as well as by he syn hesis and accumula ion o compa ible solu es (e.g., p oline, suc ose, glycine be aine, e c.). Ne e heless, he la e ep esen s a majo d awback due o he high ene ge ic cos associa ed wi h solu es syn hesis (Maa huis e al., 2014; Munns and Tes e , 2008). The onoplas con ols he mo emen o ino ganic and o ganic solu es o and om he cy oplasm h ough a wide ange o pumps, ca ie s and ion channels (Conde e al., 2011). Ca ion/H+ an ipo e s media e he anspo o Na+ in o he acuole, d i en by he elec ochemical g adien o p o ons gene a ed by he V-ATPase and V-PPase enzymes (Bassil and Blumwald, 2014; Jiang e al., 2010). This Na+/H+ exchange is media ed by membe s o a amily o anspo e s e e ed o as Na+/H+ an ipo e s (NHXs) in plan s o Na+/H+ exchange (NHEs) in animals Gene al In oduc ion and Resea ch Objec i es 28 (Bassil and Blumwald, 2014; Jiang e al., 2010). In addi ion, plan NHX an ipo e s media e bo h Na+/H+ and K+/H+ exchange, he e o e a ec ing bo h salini y ole ance and K+ nu i ion (Leidi e al., 2010; Venema e al., 2002). Di e si y o plan NHX an ipo e s Plan s NHXs belong o a la ge supe - amily o mono alen ca ion/p o on an ipo e s (CPAs) made up o wo subg oups, CPA1 and CPA2. The CPA2 amily includes membe s o he less known Ca ion/H+ Exchanges (CHXs) and K+ e lux an ipo e s (KEA). The CPA1 amily includes membe s o he NHX- ype, which a e ubiqui ous in all euka yo ic o ganisms (Bassil e al., 2012; Rod iguez-Rosales e al., 2009). In A abidopsis, NHX- ype an ipo e amily membe s comp ises eigh membe s ha a e di ided in wo dis inc classes; wo di e gen membe s loca ed a he plasma memb ane (SOS1/A NHX7 and A NHX8); and six in acellula membe s loca ed ei he a he onoplas (A NHX1-A NHX4) o he endosomal memb ane (Golgi, ans-Golgi ne wo k and p e acuola compa men s) (Bassil e al., 2012; Regue a e al., 2015; Rod iguez-Rosales e al., 2009). In ice, six NHX- ype an ipo e amily membe s we e iden i ied as belonging o wo dis inc classes wi h di e en cellula localiza ions: one in he plasma memb ane (SOS1) (Ma inez-A ienza e al, 2007); and i e in acellula membe s ha a e ei he in he onoplas , OsNHX1 o OsNHX4, o in he p e acuola compa men OsNHX5 (Fukuda e al., 2011) (Fig. 1 and 3). In A abidopsis, he mos abundan membe s o NHX- ypes a e A NHX1 and A NHX2, accoun ing o a signi ican amoun o he K+-Na+/H+ an ipo ac i i y in onoplas esicles (Ba agán e al., 2012). Plan issue localiza ion. A NHX1 and 2 a e exp essed in oo s and shoo s. A NHX5 is also ound in hese wo issues bu a low abundance, whe eas A NHX3 ansc ip is p esen p edominan ly in oo s (Yokoi e al., 2002). A NHX4 has been epo ed o be mainly p esen in ma u e pollen and seeds (Rod iguez- Rosales e al., 2009). Fu he s udies using p omo e -GUS exp ession showed ha A NHX1 is exp essed a all de elopmen al s ages and h oughou he A abidopsis plan excep he oo ip. High le els o A NHX1 exp ession we e also Chap e I 29 obse ed in lo al issue (sepals and in pollens wi hin an he s), and in cells closely associa ed o he ascula issue in lea es and in lo escence s em (Shi and Zhu, 2002). High ansc ip le els we e specially obse ed in gua d cells, sugges ing ha A NHX1 plays a ole in pH egula ion and/o K+ homeos asis in hese specialized cells (Shi and Zhu, 2002). A NHX2, 5 and 6 show highe ansc ip le els in gua d cells as compa ed o su ounding mesophyl cells (Rod iguez- Rosales e al., 2009). In ice, he le el o OsNHX1, 2, 3 and 5 ansc ip s was highe in lag lea shea hs, and hose o OsNHX1, 2 and 5 we e highe in panicles (Fukuda e al., 2011). A p omo e -GUS usion s udy showed ha OsNHX1 and 5 we e exp essed in he s ele, he eme ging pa o la e al oo s, he basal pa o he seedling shoo , and he ascula bundle (Fukuda e al., 2011). In addi ion, each p omo e -GUS had a singula exp ession pa e n. Simila ly o A NHX1, OsNHX1 was shown o be localize in gua d cells, as well as in ichomes, whe eas OsNHX5 was only localized in he oo ip and pollen g ains (Fukuda e al., 2011; Shi and Zhu, 2002). NHX gene exp ession unde s ess condi ions In A abidopsis seedlings, A NHX1 and 2 we e shown o be induced by sal s ess (NaCl), hype osmo ic s ess (manni ol) and ABA ea men , whils A NHX5 was only induced by sal s ess (NaCl) (Yokoi e al., 2002). In ice seedlings, sal s ess (NaCl), hype osmo ic s ess (manni ol), and ABA ea men inc eased he ansc ip le els o OsNHX1, 2, 3 and 5 (Fukuda e al., 2011). These epo s show ha NHXs genes a e componen s o he plan sal s ess esponse. In e es ingly, ea men wi h high KCl induced he exp ession o OsNHX1 and 2 (Fukuda e al., 2011), and A NHX1 (Yokoi e al., 2002). A NHX1 and 2 we e induced by ABA bu no by NaCl in he ABA-de icien aba2-1 mu an , showing ha NaCl induc ion o hese membe s depends on ABA signaling (Yokoi e al., 2002). A NHX1 and 2 p omo e sequences do no ha e ABA- esponsi e elemen s (ABRE). Ne e heless, he p omo e o each gene con ains MYC/MYB cis- egula o y elemen s, sugges ing ha A NHX1 and 2 a e ou pu s o he ABA- Gene al In oduc ion and Resea ch Objec i es 36 and V-PPase. I esicula pH we e solely egula ed by he ca ion o V-ATPase, he esicula luminal pH could each a pH below 3. The e o e, esicula pH homeos asis is egula ed by he ac i e H+ anspo media ed by he H+-pumps and by luminal H+ leaks, hus es ablishing he op imal endossomal pH (Bassil e al., 2012). In yeas , he unc ion o ScNHX1 seems o be ela ed o i s in ol emen in p o ein so ing h ough endossomal pH egula ion (B e e al., 2005; Rod iguez- Rosales e al., 2009). Dis up ion o ScNHX1 blocked a icking ou he Golgi/PVC (p e acuola compa men ) (Bowe s e al., 2000). The mu an had also acidic cy oplasm and acuole, as well as g ow h sensi i i y o acid media. In addi ion, p o ein p ocessing and mis-so ing also occu ed because ~ 35% o he newly syn hesized soluble acuola p o ein ca boxypep idase Y (CPY) was sec e ed o he apoplas (Bassil e al., 2012; Bowe s e al., 2000). In plan s, he mos di ec e idence demons a ing a equi emen o endossomal NHX an ipo e s in esicula a icking was gene a ed using null mu an s lacking bo h endossomal A NHX5 and 6 (Bassil e al., 2011b; Regue a e al., 2015). A NHX5 and 6 eside in Golgi, ans-Golgi ne wo k, and p e acuola compa men s (Regue a e al., 2015). Plan s lacking bo h A NHX5 and 6 displayed se e e educed g ow h (mainly due o educed cell expansion), wi h smalle and ewe cells, and inc eased sensi i i y o sal s ess. In addi ion, a icking o CPY was mis-so ed o he apoplas in he nhx5nhx6 mu an , in a simila pheno ype epo e o ScNHX1 dis up ion (Bassil e al., 2012; Bassil e al., 2011b; Bowe s e al., 2000). In a mo e ecen epo Regue a e al. (2015) ully cha ac e ized he nhx5nhx6 mu an . The wo k showed ha A NHX5 and A NHX6 a e c ucial o main enance o endomemb ane luminal pH and suppo s he concep ha p ope acuola a icking equi es endomemb ane pH homeos asis. In addi ion, ansc ip ional p o ile analyses o he A abidopsis nhx1 mu an e ealed changes in exp ession o a signi ican numbe o genes encoding p o eins associa ed wi h in a esicula a icking, a icking o he nucleus, and Golgi p ocessing. This indica es ha , simila o wha was epo ed o he yeas o holog Nhx1p (Ali e al., 2004), A NHX1 plays an impo an ole in p o ein Chap e I 37 a icking and a ge ing, p obably ia egula ion o he in a esicula pH (So osan o e al., 2004). La e , Hamaji e al. (2009) epo ed ha NHX1 is p esen in esicles in he cy oplasm o sal - ea ed cells, sugges ing ha a leas unde sal s ess, NHX1 may ha e a unc ion in esicula a icking. Collec i ely, hese epo s indica e ha endossomal NHX- ype an ipo e s a e c i ical egula o s o endossomal a icking likely by con olling he endossomal pH. T ansc ip ional egula ion Al hough mul iple unc ional s udies on NHX- ype p o ein, especially NHX1, ha e been ca ied ou , he de ails o how NHX1 is ansc ip ionally egula ed emain poo ly explo ed. Adle e al. (2010) epo ed ha he NHX1 om he ela i ely sal - ole an c op, suga bee (Be a ulga is L.) is egula ed unde sal s ess by a MYB ansc ip ion ac o (s), which could no be iden i ied. Despi e Figu e 3. Summa y diag am o an hypo he ical A abidopsis cell indica ing subcellula localiza ions, unc ions, and egula ions o NHXs an ipo e s (NHX1-6), plasma memb ane H+- ATPase (P-ATPase), onoplas memb ane H+-ATPase (V-ATPase), onoplas memb ane H+- PPase (V-PPase) and SOS1 (adap ed om Bassil e al. 2012). T ans-Golgi ne wo k (TGN), and p e acuola compa men (PVC). Gene al In oduc ion and Resea ch Objec i es 38 ice impo ance, only one s udy epo ed he iden i ica ion o a TF in e ac ing wi h he OsNHX1 p omo e . Using a ch oma in immunop ecipi a ion assay, OsbZIP71 TF was iden i ied by Liu e al. (2014) as di ec ly binding o he OsNHX1 p omo e . I was shown ha OsbZIP71 gene exp ession was s ongly induced by d ough , polye hylene glycol (PEG), and ABA ea men s, bu ep essed by sal ea men . T ansgenic ice lines o e exp essing OsbZIP71 (p35S::OsbZIP71) showed imp o ed ole ance o d ough , sal and PEG-simula ed d ough s esses, sugges ing ha OsbZIP71 plays an impo an ole in ABA-media ed d ough and sal ole ance in ice (Liu e al., 2014). Howe e , he au ho s did no show whe he he iden i ied TF is ele an o OsNHX1 ac i a ion unde s ess. RESEARCH OBJECTIVES The cons an p essu e o a g owing wo ld popula ion in combina ion wi h he inc easing p oblem o salinized land a eas, specially i iga ed a eas, make he de elopmen o sal - ole an geno ypes an impo an goal. The success ul de elopmen o sal - ole an c ops depends on he knowledge ga he ed conce ning sal s ess esponsi e genes, such as OsNHX1. Al hough impo an in o ma ion abou NHX1 unc ion has been ga he ed in he las yea s, only wo epo s add essing he NHX1 ansc ip ional egula ion unde sal s ess ha e been published. In o de o be e unde s and OsNHX1 ansc ip ional egula ion unde sal s ess, his wo k aims o iden i y and unc ionally cha ac e ize no el TFs egula ing OsNHX1 exp ession unde sal s ess in a sal - ole an ice geno ype. To add ess his main goal, he wo k plan was di ided in se e al asks. The i s ask was he iden i ica ion o a sal - ole an ice geno ype in which OsNHX1 esponse unde sal s ess could be associa ed o he ole ance a he seedling s age. The second ask was he cons uc ion o a sal -induced cDNA exp ession lib a y using he selec ed sal - ole an geno ype, which was sc eened using a Yeas -One-Hyb id (Y1H) sys em, leading o he iden i ica ion o no el TFs binding Chap e I 39 o OsNHX1 p omo e . The hi d ask was o unc ionally cha ac e ize he inden i ied TFs. REFERENCES Ab ol I.P., Yada J.S.P.I, Massoud F.I. (1988) Sal -a ec ed Soils and Thei Managemen . FAO soils bulle in, 39. Food & Ag icul u e O g. Adams E., Shin R. (2014) T anspo , signaling, and homeos asis o po assium and sodium in plan s. J In eg Plan Biol 56:231-49. DOI: 10.1111/jipb.12159. Adle G., Blumwald E., Ba -Z i D. (2010) The suga bee gene encoding he sodium/p o on exchange 1 (B NHX1) is egula ed by a MYB ansc ip ion ac o . Plan a 232:187-95. DOI: 10.1007/s00425-010-1160- 7. Aha on G., S., Apse M., P., Duan S., Hua X., Blumwald E. (2003) Cha ac e iza ion o a amily o acuola Na+/H+ an ipo e s in A abidopsis haliana. Plan and Soil 253:245-256. DOI: 10.1023/A:1024577205697. Alexande sson E., Saalbach G., La sson C., Kjellbom P. (2004) A abidopsis plasma memb ane p o eomics iden i ies componen s o anspo , signal ansduc ion and memb ane a icking. Plan Cell Physiol 45:1543-56. DOI: 10.1093/pcp/pch209. Ali R., B e C.L., Mukhe jee S., Rao R. (2004) Inhibi ion o sodium/p o on exchange by a Rab-GTPase-ac i a ing p o ein egula es endosomal a ic in yeas . J Biol Chem 279:4498-506. DOI: 10.1074/jbc.M307446200. Almeida P., Ka schnig D., de Boe A.H. (2013) HKT anspo e s-S a e o he a . In J Mol Sci 14:20359-85. DOI:10.3390/ijms141020359. And és Z., Pe ez-Ho maeche J., Leidi E.O., Schlucking K., S einho s L., McLachlan D.H., Schumache K., He he ing on A.M., Kudla J., Cube o B., Pa do J.M. (2014) Con ol o acuola dynamics and egula ion o s oma al ape u e by onoplas po assium up ake. P oc Na l Acad Sci U S A 111:E1806-14. DOI: 10.1073/pnas.1320421111. Apse M.P., So osan o J.B., Blumwald E. (2003) Vacuola ca ion/H+ exchange, ion homeos asis, and lea de elopmen a e al e ed in a T-DNA inse ional mu an o A NHX1, he A abidopsis acuola Na+/H+ an ipo e . Plan J 36:229-39. DOI: 10.1046/j.1365-313X.2003.01871.x. Apse M.P., Aha on G.S., Snedden W.A., Blumwald E. (1999) Sal ole ance con e ed by o e exp ession o a acuola Na+/H+ an ipo in A abidopsis. Science 285:1256-8. DOI: 10.1126/science.285.5431.1256. A ango M., Ge audan F., Ou a ole M., Bou y M. (2003) The plasma memb ane p o on pump ATPase: he signi icance o gene sub amilies. Plan a 216:355-65. DOI: 10.1007/s00425-002-0856-8. Gene al In oduc ion and Resea ch Objec i es 40 Axelsen K.B., Palmg en M.G. (2001) In en o y o he supe amily o P- ype ion pumps in A abidopsis. Plan Physiol 126:696-706. DOI: 10.1104/pp.126. 2.696. Baek D., Jiang J., Chung J.S., Wang B., Chen J., Xin Z., Shi H. (2011) Regula ed A HKT1 gene exp ession by a dis al enhance elemen and DNA me hyla ion in he p omo e plays an impo an ole in sal ole ance. Plan Cell Physiol 52:149-61. DOI: 10.1093/pcp/pcq182. Ba agán V., Leidi E.O., And és Z., Rubio L., De Luca A., Fe nandez J.A., Cube o B., Pa do J.M. (2012) Ion exchange s NHX1 and NHX2 media e ac i e po assium up ake in o acuoles o egula e cell u go and s oma al unc ion in A abidopsis. Plan Cell 24:1127-42. DOI: 10.1105/ pc.111.095273. Bassil E., Blumwald E. (2014) The ins and ou s o in acellula ion homeos asis: NHX- ype ca ion/H+ anspo e s. Cu Opin Plan Biol 22:1-6. DOI: 10.1016/j.pbi.2014.08.002. Bassil E., Coku A., Blumwald E. (2012) Cellula ion homeos asis: eme ging oles o in acellula NHX Na+/H+ an ipo e s in plan g ow h and de elopmen . J Exp Bo 63:5727-40. DOI: 10.1093/jxb/e s250. Bassil E., Tajima H., Liang Y.C., Oh o M.A., Ushijima K., Nakano R., Esumi T., Coku A., Belmon e M., Blumwald E. (2011a) The A abidopsis Na+/H+ an ipo e s NHX1 and NHX2 con ol acuola pH and K+ homeos asis o egula e g ow h, lowe de elopmen , and ep oduc ion. Plan Cell 23:3482-97. DOI: 10.1105/ pc.111.089581. Bassil E., Oh o M.A., Esumi T., Tajima H., Zhu Z., Cagnac O., Belmon e M., Peleg Z., Yamaguchi T., Blumwald E. (2011b) The A abidopsis in acellula Na+/H+ an ipo e s NHX5 and NHX6 a e endosome associa ed and necessa y o plan g ow h and de elopmen . Plan Cell 23:224-39. DOI: 10.1105/ pc.110.079426. Ba elli G., Ve slues P.E., Agius F., Qiu Q., Fujii H., Pan S., Schumake K.S., G illo S., Zhu J.K. (2007) SOS2 p omo es sal ole ance in pa by in e ac ing wi h he acuola H+-ATPase and up egula ing i s anspo ac i i y. Mol Cell Biol 27:7781-90. DOI: 10.1128/MCB.00430-07. Be homieu P., Coneje o G., Nubla A., B ackenbu y W.J., Lambe C., Sa io C., Uozumi N., Oiki S., Yamada K., Cellie F., Gos i F., Simonneau T., Essah P.A., Tes e M., Ve y A.A., Sen enac H., Casse F. (2003) Func ional analysis o A HKT1 in A abidopsis shows ha Na+ eci cula ion by he phloem is c ucial o sal ole ance. EMBO J 22:2004-14. DOI: 10.1093/emboj/cdg207. Beyenbach K.W., Wieczo ek H. (2006) The V- ype H+ ATPase: molecula s uc u e and unc ion, physiological oles and egula ion. J Exp Biol 209:577-89. DOI: 10.1242/jeb.02014. Blumwald E., Aha on G.S., Apse M.P. (2000) Sodium anspo in plan cells. Biochim Biophys Ac a 1465:140-51. DOI: 10.1016/S0005- 2736(00)00135-8. Chap e I 41 Bowe s K., Le i B.P., Pa el F.I., S e ens T.H. (2000) The sodium/p o on exchange Nhx1p is equi ed o endosomal p o ein a icking in he yeas Saccha omyces ce e isiae. Mol Biol Cell 11:4277-94. DOI: 10.1091/mbc.11.12.4277. B adshe K. (2008) High Rice Cos C ea ing Fea s o Asia Un es . The New Yo k Times. B e C.L., Tukaye D.N., Mukhe jee S., Rao R. (2005) The yeas endosomal Na+- K+/H+ exchange Nhx1 egula es cellula pH o con ol esicle a icking. Mol Biol Cell 16:1396-405. DOI: 10.1091/mbc.E04-11-0999. B ini F., Khaled. M. (2012) Ion anspo e s and abio ic s ess ole ance in plan s. ISRN Molecula Biology 12. DOI: 10.5402/2012/927436. B ini F., Hanin M., Mezghani I., Be kowi z G.A., Masmoudi K. (2007) O e exp ession o whea Na+/H+ an ipo e TNHX1 and H+- py ophospha ase TVP1 imp o e sal - and d ough -s ess ole ance in A abidopsis haliana plan s. J Exp Bo 58:301-8. DOI: 10.1093/jxb/e l251. By C.S., Pla en J.D., Spielmeye W., James R.A., Lagudah E.S., Dennis E.S., Tes e M., Munns R. (2007) HKT1;5-like ca ion anspo e s linked o Na+ exclusion loci in whea , Nax2 and Kna1. Plan Physiol 143:1918-28. DOI: 10.1104/pp.106.093476. Cha es M.M., Oli ei a M.M. (2004) Mechanisms unde lying plan esilience o wa e de ici s: p ospec s o wa e -sa ing ag icul u e. J Exp Bo 55:2365- 84. DOI: 10.1093/jxb/e h269. Cha es M.M., Flexas J., Pinhei o C. (2009) Pho osyn hesis unde d ough and sal s ess: egula ion mechanisms om whole plan o cell. Ann Bo 103:551-60. DOI: 10.1093/aob/mcn125. Chi Lin C., Huei Kao C. (2001) Rela i e impo ance o Na+, Cl−, and abscisic acid in NaCl induced inhibi ion o oo g ow h o ice seedlings. Plan and Soil 237:165-171. DOI: 10.1023/A:1013321813454. Chou a M., Rebai A. (2005) Iden i ica ion and cha ac e iza ion o new membe s o acuola H+-Py ophospha ase amily om O yza sa i a genome. Russian Jou nal o Plan Physiology 52:821-825. DOI: 10.1007/s11183-005-0121- 7. Chung J.S., Zhu J.K., B essan R.A., Hasegawa P.M., Shi H. (2008) Reac i e oxygen species media e Na+-induced SOS1 mRNA s abili y in A abidopsis. Plan J 53:554-65. DOI: 10.1111/j.1365-313X.2007.03364.x. Conde A., Cha es M.M., Ge ós H. (2011) Memb ane anspo , sensing and signaling in plan adap a ion o en i onmen al s ess. Plan Cell Physiol 52:1583-602. DOI: 10.1093/pcp/pc 107. Co sa is O., Ple D., Shi ley N., Tes e M., H mo a M. (2012) A wo-s aged model o Na+ exclusion in ice explained by 3D modeling o HKT anspo e s and al e na i e splicing. PLoS ONE 7:e39865. DOI: 10.1371/jou nal.pone.0039865. Cuin T.A., Bose J., S e ano G., Jha D., Tes e M., Mancuso S., Shabala S. (2011) Assessing he ole o oo plasma memb ane and onoplas Na+/H+ Gene al In oduc ion and Resea ch Objec i es 42 exchange s in salini y ole ance in whea : in plan a quan i ica ion me hods. Plan Cell En i on 34:947-61. DOI: 10.1111/j.1365- 3040.2011.02296.x. Da enpo R.J., Munoz-Mayo A., Jha D., Essah P.A., Rus A., Tes e M. (2007) The Na+ anspo e A HKT1;1 con ols e ie al o Na+ om he xylem in A abidopsis. Plan Cell En i on 30:497-507. DOI: 10.1111/j.1365- 3040.2007.01637.x. D ozdowicz Y.M., Kissinge J.C., Rea P.A. (2000) AVP2, a sequence-di e gen , K+-insensi i e H+- ansloca ing ino ganic py ophospha ase om A abidopsis. Plan Physiol 123:353-62. DOI: 10.1104/pp.123.1.353. Dubco sky J., Ma ia G.S., Eps ein E., Luo M.C., D o ak J. (1996) Mapping o he K+/Na+ disc imina ion locus Kna1 in whea . Theo Appl Gene 92:448-54. DOI: 10.1007/BF00223692. Duggleby R.G., Dennis D.T. (1973) Py u a e kinase, a possible egula o y enzyme in highe plan s. Plan Physiol 52:312-7. DOI: 10.1104/pp.52.4. 312. FAO. (2011) The 2007-08 Rice P ice C isis, in: E. a. S. Pe spec i es (Ed.). Fuchs I., S ölzle S., I ashikina N., Hed ich R. (2005) Rice K+ up ake channel OsAKT1 is sensi i e o sal s ess. Plan a 221:212-221. DOI: 10.1007/s00425-004-1437-9. Fuglsang A.T., Paez-Valencia J., Gaxiola R.A. (2010) Plan P o on Pumps: Regula o y Ci cui s In ol ing H+-ATPase and H+-PPase, in: M. Geisle and K. Venema (Eds.), T anspo e s and Pumps in Plan Signaling, Sp inge Be lin Heidelbe g, Be lin, Ge many. pp. 39-64. DOI: 10.1007/978-3-642-14369-4_2. Fukuda A., Nakamu a A., Ha a N., Toki S., Tanaka Y. (2011) Molecula and unc ional analyses o ice NHX- ype Na+/H+ an ipo e genes. Plan a 233:175-88. DOI: 10.1007/s00425-010-1289-4. Fukuda A., Nakamu a A., Tagi i A., Tanaka H., Miyao A., Hi ochika H., Tanaka Y. (2004) Func ion, in acellula localiza ion and he impo ance in sal ole ance o a acuola Na+/H+ an ipo e om ice. Plan Cell Physiol 45:146-59. DOI: 10.1093/pcp/pch014. Gao J.P., Chao D.Y., Lin H.X. (2007) Unde s anding abio ic s ess ole ance mechanisms: Recen s udies on s ess esponse in ice. Jou nal o In eg a i e Plan Biology 49:742–750. DOI: 10.1111/j.1744- 7909.2007.00495.x. Gaxiola R.A., Palmg en M.G., Schumache K. (2007) Plan p o on pumps. FEBS Le 581:2204-14. DOI: 10.1016/j. ebsle .2007.03.050. G ego io G.B., Senadhi a D., Mendoza R.D., Manigbas N.L., Roxas J.P., Gue a C.Q. (2002) P og ess in b eeding o salini y ole ance and associa ed abio ic s esses in ice. Field C ops Resea ch 76:91–101. DOI: 10.1016/S0378-4290(02)00031-X. Hamaji K., Nagi a M., Yoshida K., Ohnishi M., Oda Y., Uemu a T., Goh T., Sa o M.H., Mo i a M.T., Tasaka M., Hasezawa S., Nakano A., Ha a-Nishimu a Chap e I 43 I., Maeshima M., Fukaki H., Mimu a T. (2009) Dynamic aspec s o ion accumula ion by esicle a ic unde sal s ess in A abidopsis. Plan Cell Physiol 50:2023-33. DOI: 10.1093/pcp/pcp143. Hanana M., Cagnac O., Yamaguchi T., Hamdi S., Gho bel A., Blumwald E. (2007) A g ape be y (Vi is ini e a L.) ca ion/p o on an ipo e is associa ed wi h be y ipening. Plan Cell Physiol 48:804-11. DOI:10.1093/pcp/pcm048. Hani zsch M., Schni ze D., Seidel T., Golldack D., Die z K.J. (2007) T ansc ip le el egula ion o he acuola H+-ATPase subuni iso o ms VHA-a, VHA-E and VHA-G in A abidopsis haliana. Mol Memb Biol 24:507-18. DOI: 10.1080/09687680701447393. Hasegawa P.M. (2013) Sodium (Na+) homeos asis and sal ole ance o plan s. En i onmen al and Expe imen al Bo any 92:19–31. DOI: 10.1016/j.en expbo .2013.03.001. He C., Yan J., Shen G., Fu L., Holaday A.S., Auld D., Blumwald E., Zhang H. (2005) Exp ession o an A abidopsis acuola sodium/p o on an ipo e gene in co on imp o es pho osyn he ic pe o mance unde sal condi ions and inc eases ibe yield in he ield. Plan Cell Physiol 46:1848-54. DOI: 10.1093/pcp/pci201. Hi sch R.E., Lewis B.D., Spalding E.P., Sussman M.R. (1998) A ole o he AKT1 po assium channel in plan nu i ion. Science 280:918-21.DOI: 10.1126/science.280.5365.918. Ho ie T., Hause F., Sch oede J.I. (2009) HKT anspo e -media ed salini y esis ance mechanisms in A abidopsis and monoco c op plan s. T ends Plan Sci 14:660-8. DOI: 10.1016/j. plan s.2009.08.009. Ho ie T., Yoshida K., Nakayama H., Yamada K., Oiki S., Shinmyo A. (2001) Two ypes o HKT anspo e s wi h di e en p ope ies o Na+ and K+ anspo in O yza sa i a. Plan J 27:129-38. DOI: 10.1046/j.1365- 313x.2001.01077.x. PPI - Po ash and Phospah e Ins i u e (1998) Po assium o ag icul u e. Be e c ops wi h plan ood. Vol: 32, Nº3. IRRI. (2013) Rice almanac, 4 h edi ion. GRiSP (Global Rice Science Pa ne ship) In e na ional Rice Resea ch Ins i u e, Los Baños, Philippines. Izawa T., Shimamo o K. (1996) Becoming a model plan : he impo ance o ice o plan science. T ends in Plan Science 1:95–99. DOI: h p://dx.doi.o g/10.1016/S1360-1385(96)80041-0. Jabnoune M., Espeou S., Mieule D., Fizames C., Ve deil J.L., Coneje o G., Rod iguez-Na a o A., Sen enac H., Guide doni E., Abdelly C., Ve y A.A. (2009) Di e si y in exp ession pa e ns and unc ional p ope ies in he ice HKT anspo e amily. Plan Physiol 150:1955-71. DOI: 10.1104/pp.109.138008. James R.A., Da enpo R.J., Munns R. (2006) Physiological cha ac e iza ion o wo genes o Na+ exclusion in du um whea , Nax1 and Nax2. Plan Physiol 142:1537-47. DOI: 10.1104/pp.106.086538. Gene al In oduc ion and Resea ch Objec i es 44 James R.A., Blake C., By C.S., Munns R. (2011) Majo genes o Na+ exclusion, Nax1 and Nax2 (whea HKT1;4 and HKT1;5), dec ease Na+ accumula ion in b ead whea lea es unde saline and wa e logged condi ions. J Exp Bo 62:2939-47. DOI: 10.1093/jxb/e 003. Ji H., Pa do J.M., Ba elli G., Van Oos en M.J., B essan R.A., Li X. (2013) The Sal O e ly Sensi i e (SOS) pa hway: Es ablished and eme ging oles. Mol Plan 6:275-86. DOI: 10.1093/mp/ss 017. Jiang X., Leidi E.O., Pa do J.M. (2010) How do acuola NHX exchange s unc ion in plan sal ole ance? Plan Signal Beha .:792–795. DOI: 10.4161/psb.5.7.11767. Kade M.A., Seidel T., Golldack D., Lindbe g S. (2006) Exp essions o OsHKT1, OsHKT2, and OsVHA a e di e en ially egula ed unde NaCl s ess in sal -sensi i e and sal - ole an ice (O yza sa i a L.) cul i a s. J Exp Bo 57:4257-68. DOI: 10.1093/jxb/e l199. Kim B.G., Waad R., Cheong Y.H., Pandey G.K., Dominguez-Solis J.R., Schul ke S., Lee S.C., Kudla J., Luan S. (2007) The calcium senso CBL10 media es sal ole ance by egula ing ion homeos asis in A abidopsis. Plan J 52:473-84. DOI: 10.1111/j.1365-313X.2007.03249.x. Ki sch M., An Z., Vie eck R., Low R., Rausch T. (1996) Sal s ess induces an inc eased exp ession o V- ype H+-ATPase in ma u e suga bee lea es. Plan Mol Biol 32:543-7. DOI: 10.1007/BF00019107. Klychniko O.I., Li K.W., Lill H., de Boe A.H. (2007) The V-ATPase om e iola ed ba ley (Ho deum ulga e L.) shoo s is ac i a ed by blue ligh and in e ac s wi h 14-3-3 p o eins. J Exp Bo 58:1013-23. DOI:10.1093/jxb/e l261. K onzucke H.J., B i o D.T. (2011) Sodium anspo in plan s: A c i ical e iew. New Phy ol 189:54-81. DOI: 10.1111/j.1469-8137.2010.03540.x. Leidi E.O., Ba agán V., Rubio L., El-Hamdaoui A., Ruiz M.T., Cube o B., Fe nandez J.A., B essan R.A., Hasegawa P.M., Quin e o F.J., Pa do J.M. (2010) The A NHX1 exchange media es po assium compa men a ion in acuoles o ansgenic oma o. Plan J 61:495-506. DOI: 10.1111/j.1365-313X.2009.04073.x. Liu C., Mao B., Ou S., Wang W., Liu L., Wu Y., Chu C., Wang X. (2014) OsbZIP71, a bZIP ansc ip ion ac o , con e s salini y and d ough ole ance in ice. Plan Mol Biol 84:19-36. DOI: 10.1007/s11103-013- 0115-3. Lu s S., Kine J.M., Bouha mon J. (1996) E ec s o sal s ess on g ow h, mine al nu i ion and p oline accumula ion in ela ion o osmo ic adjus men in ice (O yza sa i a L.) cul i a s di e ing in salini y esis ance Plan G ow h Regula ion 19:207-218. DOI: 10.1007/BF00037793. Maa huis F.J., Ahmad I., Pa ish an J. (2014) Regula ion o Na+ luxes in plan s. F on Plan Sci 5:467. DOI: 10.3389/ pls.2014.00467. Maeshima M. (2000) Vacuola H+-py ophospha ase. Biochim Biophys Ac a 1465:37-51. DOI: 10.1016/S0005-2736(00)00130-9. Chap e I 45 Mansou M.M. (2014) The plasma memb ane anspo sys ems and adap a ion o salini y. J Plan Physiol 171:1787-800. DOI: 10.1016/j.jplph.2014.08.016. Ma schne H. (1995) Mine al nu i ion o highe plan s. Annals o Bo any Company 78:527-528. DOI: 10.1006/anbo.1996.0155. Ma inez-A ienza J., Jiang X., Ga ciadeblas B., Mendoza I., Zhu J.K., Pa do J.M., Quin e o F.J. (2007) Conse a ion o he sal o e ly sensi i e pa hway in ice. Plan Physiol 143:1001-12. DOI: 10.1104/pp.106.092635. Ma inie e A., Bassil E., Jublanc E., Alcon C., Regue a M., Sen enac H., Blumwald E., Pa is N. (2013) In i o in acellula pH measu emen s in obacco and A abidopsis e eal an unexpec ed pH g adien in he endomemb ane sys em. Plan Cell 25:4028-43. DOI: 10.1105/ pc.113.116897. Mase P., Hosoo Y., Goshima S., Ho ie T., Eckelman B., Yamada K., Yoshida K., Bakke E.P., Shinmyo A., Oiki S., Sch oede J.I., Uozumi N. (2002) Glycine esidues in po assium channel-like selec i i y il e s de e mine po assium selec i i y in ou -loop-pe -subuni HKT anspo e s om plan s. P oc Na l Acad Sci U S A 99:6428-33. DOI: 10.1073/pnas.082123799. Ma sumo o H., Chung G.C. (1988) Inc ease in p o on- anspo ac i i y o onoplas esicles as an adap i e esponse o ba ley oo s o NaCl s ess. Plan Cell Physiol 29:1133-1140. McAinsh M.R., Clay on H., Mans ield T.A., He he ing on A.M. (1996) Changes in S oma al Beha io and Gua d Cell Cy osolic F ee Calcium in Response o Oxida i e S ess. Plan Physiol 111:1031-1042. DOI: 10.1104/pp.111. 4.1031. Mian A., Oomen R.J., Isayenko S., Sen enac H., Maa huis F.J., Ve y A.A. (2011) O e -exp ession o an Na+-and K+-pe meable HKT anspo e in ba ley imp o es sal ole ance. Plan J 68:468-79. DOI: 10.1111/j.1365- 313X.2011.04701.x. Mi suda N., Isono T., Sa o M.H. (2003) A abidopsis CAMTA amily p o eins enhance V-PPase exp ession in pollen. Plan Cell Physiol 44:975- 81.DOI: 10.1093/pcp/pcg137. Mi suda N., Hisabo i T., Takeyasu K., Sa o M.H. (2004) VOZ; isola ion and cha ac e iza ion o no el ascula plan ansc ip ion ac o s wi h a one- zinc inge om A abidopsis haliana. Plan Cell Physiol 45:845-54. DOI: 10.1093/pcp/pch101. Mi sudaa N., Enamib K., Naka ac M., Takeyasuc K., Sa ob M.H. (2001) No el ype A abidopsis haliana H+-PPase is localized o he Golgi appa a us. FEBS Le e s 488:29–33. DOI: 10.1016/S0014-5793(00)02400-5. Munns R. (2005) Genes and sal ole ance: b inging hem oge he . New Phy ologis 167:645–663. DOI: 10.1111/j.1469-8137.2005.01487.x. Munns R., Tes e M. (2008) Mechanisms o salini y ole ance. Annu Re Plan Biol 59:651-81. DOI: 10.1146/annu e .a plan .59.032607.092911. Munns R., James R.A., Xu B., A hman A., Conn S.J., Jo dans C., By C.S., Ha e R.A., Tye man S.D., Tes e M., Ple D., Gilliham M. (2012) Whea g ain Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 52 TABLE OF CONTENTS – CHAPTER II Abs ac .............................................................................................................. 53 In oduc ion ......................................................................................................... 54 Ma e ial and Me hods ......................................................................................... 57 Pheno yping o sal s ess ole ance ................................................................ 57 Re e se ansc ip ion- Real-Time PCR (RT-qPCR).......................................... 58 Accession numbe s .......................................................................................... 59 Resul s ................................................................................................................. 59 Pheno yping sal s ess ole ance a seedling s age ......................................... 59 Pheno yping sal s ess ole ance a ep oduc i e s age. ................................. 65 Exp ession p o ile o OsNHX1 on selec ed ice geno ypes subjec ed o sal s ess ................................................................................................................ 67 Discussion ........................................................................................................... 69 Acknowledgmen s ............................................................................................. 76 Re e ences .......................................................................................................... 76 Supplemen al Da a.............................................................................................. 81 Chap e III 53 ABSTRACT Sal s ess is one o he mos impo an en i onmen al s esses limi ing p o i able c op p oduc ion wo ldwide. Rice (O yza sa i a) is he mos impo an ce eal c op ega ding human nu i ion and calo ic in ake. I is a s aple ood o mo e han 50% wo ld popula ion. I s p oduc ion is, howe e , highly a ec ed by sal s ess, as ice is he mos sal suscep ible ce eal c op. Vacuola compa men aliza ion o Na+ is an impo an mechanism used by plan s o cope wi h sal s ess, and NHX1 (K+-Na+/H+ an ipo e ) plays an impo an ole anspo ing K+ and/o Na+ in o he acuole o sal s ess alle ia ion. In his wo k, se en ice geno ypes, om he In e na ional Rice Resea ch Ins i u e (IRRI) ge mplasm collec ion, showing di e en deg ees o sal s ess ole ance, we e selec ed o co ela e hei ole ance wi h he con ibu ion o he OsNHX1 o he sal s ess esponse. In ice, sal suscep ibili y a ies conside ably along he de elopmen al s ages. Gi en ha ea ly seedling and panicle ini ia ion ( ep oduc i e) s ages a e he mos sal sensi i e, he di e en ice geno ypes we e cha ac e ized, conce ning hei ole ance o sal s ess (NaCl), a hese s ages. A seedling s age, di e en pa ame e s we e analyzed ( isual sco ing, d y biomass, K+-Na+ and chlo ophyll con en , osmo ic po en ial), and geno ypes we e classi ied as ollows: Sal -suscep ible (IR 29), Sal -mode a ely ole an (IR 64 and IR52724- 2B-6-2B-1-1 “Sal 024”), and sal - ole an (NDR-312-2, Hasawi, IR66946-3R-178- 1-1 “FL 478” and Pokkali [access. 108921]). The same ice geno ypes we e also used o s udy he ansc ip le el o he di e en OsNHX1 splicing o ms in esponse o sal s ess condi ions. In addi ion, he absolu e quan i ica ion o he OsNHX1 splicing o ms ansc ip s in each ice geno ype was pe o med. Unexpec edly, he sal -suscep ible and sal -mode a ely ole an geno ypes showed highe OsNHX1 gene induc ion, unde sal s ess, han he sal - ole an geno ypes. The absolu e quan i ica ion o OsNHX1 ansc ip s could explain pa o hese esul s, as di e en geno ypes showed dis inc amoun o ansc ip s. A ep oduc i e s age, sal s ess p o ed o be ex emely ha m ul o ice p oduc ion, bu wi h no co ela ion wi h ole ance a he seedling s age. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 54 INTRODUCTION Sal s ess is one o he mos impo an en i onmen al s esses limi ing p o i able c op p oduc ion wo ldwide. App oxima ely 20% o o al i iga ed a eas in he wo ld a e a ec ed by soil saliniza ion, which is indeed a se ious p oblem o ag icul u e, as i iga ed soils ep esen one hi d o he wo ld’s ood p oduc ion (2008; Roy e al., 2014). Sal s ess is a condi ion cha ac e ized by a high soil concen a ion o soluble sal s, which a e domina ed by Na+ and Cl- ions, wi h an elec ical conduc i i y (EC) highe han 4 dS/m, equi alen o app oxima ely 40 mM NaCl (Munns and Tes e , 2008). Sal s ess appea s o a ec wo plan p ocesses, wa e ela ion and ionic ela ion. Du ing ini ial exposu e, high concen a ions o sal s in he soil make wa e up ake by oo s mo e di icul , leading o wa e s ess, which in u n educes lea expansion. Du ing long- e m exposu e o sal s ess, plan s expe ience ionic s ess. Sal s accumula e in excess in plan cells, leading o dis up ion o in acellula ion homeos asis, memb ane dys unc ion and inhibi ion o me abolic ac i i y, esul ing in g ow h inhibi ion and yield educ ion (Gao e al., 2007; Munns and Tes e , 2008). Mo eo e , high le els o sal s inside he plan s impai e icien up ake o o he nu ien s, which can esul in nu ien imbalance (Silbe bush e al., 2005). Fo mos species, Na+ appea s o each oxic concen a ion be o e Cl− does, so mos s udies ha e ocused on Na+ oxici y (Munns and Tes e , 2008). Na+ oxici y is la gely ela ed o he compe i ion be ween Na+ and K+ o he binding si es ha a e c ucial o me abolic p ocesses and ha Na+ canno ul ill co ec ly. Thus, o a oid Na+ oxici y, plan s mus ha e a high K+/Na+ a io (Blumwald, 2000; Jeschke, 1984). Plan s de eloped many mechanisms o ole a e sal s ess. These mechanisms all in o h ee main ca ego ies. 1- Tole ance o osmo ic s ess, igge ed be o e Na+ accumula ion; 2- Ion exclusion, oo anspo p ocesses ha educe Na+ high oxic accumula ion wi hin lea es 3- Tissue ole ance, accumula ion o high Na+ concen a ion in o lea es, equi ing Chap e III 55 compa men aliza ion o Na+ a he cellula and in acellula le el o a oid oxic concen a ions wi hin he cy oplasm (Munns and Tes e , 2008). Rice (O yza sa i a) is he mos impo an ce eal c op o human nu i ion and calo ic in ake. I is a s aple ood o mo e han 50% o he wo ld popula ion, p o iding abou one i h o he o al calo ies consumed wo ldwide. Among ce eals, ice p oduces mo e ood ene gy and p o ein supply pe hec a e han maize and whea , espec i ely he i s and he second mos globally p oduced ce eals. Hence, despi e he wa e equi emen s, ice can suppo mo e people pe uni o land han he wo o he ce eals (Lock, 2002). Rice, like mos o g ain c ops is a glycophy e and shows sal s ess symp oms and educed yield e en when he EC is as low as 4.0 dS/m. Indeed, Ascha e al. (2001) epo ed ha ice is in ac mo e sal s ess suscep ible han p e iously p edic ed, ield-g own i iga ed ice geno ypes showed losses up o 1 /ha pe uni EC, when g own unde EC le els >2 dS/m. Ne e heless, di e en ice geno ypes g ea ly di e in hei abili y o su i e, g ow and yield unde salini y condi ions (Zeng e al., 2003). Rice sal s ess ole ance a ies along i s li e cycle. Du ing ea ly seedling s age (2-3 lea s age) and ep oduc i e s age (panicle ini ia ion) ice is e y sal s ess-sensi i e (Pea son e al., 1996). Ve y poo co ela ion exis s be ween ole ance a seedling and ep oduc i e s ages (Heenan e al., 1998). Unde sal s ess, i is i al o plan cells o main ain a low concen a ion o Na+ in he cy osol while keeping a high concen a ion o K+, esul ing in a high K+/Na+ cy osolic a io (Blumwald, 2000; Jeschke, 1984). Plan acuoles can occupy as much as 95% o he olume o ma u e cells, and Na+ seques a ion in o ha o ganelle is an e icien mechanism o educe he cy osolic Na+ concen a ion (Yamaguchi and Blumwald, 2005). Fu he mo e, seques a ion o Na+ ions in he acuole p o ides addi ional osmo icum o wa e up ake and u go main enance unde s ess (Djanagui aman e al., 2012). This s a egy is highly e ec i e o plan cells o cope wi h sal s ess (Apse e al., 1999; Fukuda e al., 2004; Fukuda, 1998; Tes e and Da enpo , 2003). The candida e p o ein o anspo Na+ in o he acuole is he onoplas Na+/H+-an ipo e (NHX- ypes), which is no only Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 56 speci ic o Na+ ca ions, bu also K+ (Kinclo a-Zimme manno a e al., 2004). Besides hei unc ion on Na+ compa men a ion, NHX anspo e s a e also c i ical egula o s o K+ and pH homeos asis and ha e impo an oles, depending on hei cellula localiza ion, in he gene a ion o u go ha d i es cell expansion, s oma a ape u e, and he e o e plan g ow h, as well as esicula a icking (And és e al., 2014, Bassil and Blumwald, 2014; Bassil e al.,2011b; Ba agán e al., 2012; Regue a e al., 2015). In ice, in acellula NHX- ype amily an ipo e is cons i u ed by i e NHX genes (OsNHX1 o OsNHX5) (Fukuda e al., 2011). Among hese, OsNHX1 is he mos s udied. Exp ession o OsNHX1 is induced by ea men wi h sal s ess, hype osmo ic s ess, and ABA (Fukuda e al., 2011). The impo an ole played by NHX1 in sal -s ess ole ance has been e ealed by he ansgenic plan s o e exp essing NHX1 (Bassil e al., 2011; Fukuda e al., 2004; Liu e al., 2010; Oh a e al., 2002; Xiao e al., 2008; Xuea e al., 2004; Zhang and Blumwald, 2001). Sodium acuola seques a ion has been sugges ed an e icien s a egy o p omo e sal ole ance (Blumwald, 2000; Jeschke, 1984). In addi ion, biochemical analyzes pe o med by S aal e al. (1991) p o ided e idences ha he sal s ess ole an Plan ago ma i ima and he sal s ess suscep ible Plan ago media plan s g ea ly di e on onoplas Na+/H+ an ipo e ac i i y unde sal s ess. The sal -suscep ible plan s showed no ac i a ion o onoplas Na+/H+ an ipo e unde sal s ess, sugges ing ha Na+ seques a ion in o acuole could be he cause o he di e ence in sal ole ance. The e o e, in his wo k, we aimed o con ibu e o unde s and he molecula egula ion o acuola K+-Na+ compa men a ion unde sal s ess, using ice as a model. Acco dingly ou s udies we e di ec ed o he iden i ica ion o sal - ole an ice geno ypes in which OsNHX1 gene exp ession could possibly be associa ed wi h he sal s ess ole ance, and he use o hose lines o iden i y OsNHX1 ansc ip ional egula o s. Chap e III 57 MATERIAL AND METHODS Pheno yping o sal s ess ole ance Se en ice (O yza sa i a L.) geno ypes we e selec ed by In e na ional Rice Resea ch Ins i u e (IRRI): IR 29; IR 64; Sal 024 (IR52724-2B-6-2B-1-1); NDR-312-2; Hasawi; FL 478 (IR66946-3R-178-1-1) and Pokkali (Acess.108921). The selec ed geno ypes we e pheno yped o salini y ole ance a seedling and ep oduc i e s ages as p e iously desc ibed by G ego io e al. (1997) wi h mino modi ica ions. Pheno yping a seedling s age and ep oduc i e s age expe imen included a con ol and a sal s ess ea men , wi h he p esence o h ee check geno ypes: Sal -suscep ible: IR 29, sal -mode a ely ole an : IR 64 and sal - ole an : Pokkali in all con aine s. A seedling s age, sal s ess imposi ion was pe o med 11 days a e sowing, by supplemen ing SNAP solu ion (San os and Ocampo, 2005) wi h NaCl (EC = 12 dS/m ≈ 120 mM NaCl). S ess ea men s we e imposed ou hou s a e dawn. In he con ol ays, no sal was added. The expe imen was conduc ed in a phy o on main ained a app oxima ely 29 ºC/22 ºC day/nigh wi h 70% ela i e humidi y and na u al ligh (IRRI-Philippines d y season). Tes geno ypes we e isually a ed o inju y symp oms a 15 days a e ini ial saliniza ion using a 3–7 scale acco ding o G ego io e al. (1997) (See Supplemen al Table 1). A e 15 days o sal imposi ion, we e alua ed se e al pa ame e s on shoo s, such as K+ and Na+ con en , osmo ic po en ial, biomass (d y weigh ), chlo ophyll a, b and o al. The de e mina ion o Na+ and K+ con en in shoo s was pe o med by ex ac ing bo h ions in ace ic acid (0.1 N) o e nigh a 80 °C. The Na+ and K+ con en in he ex ac we e de e mined using a lame pho ome e (model 420; She wood Scien i ic, Camb idge, UK). Lea osmo ic po en ial was es ima ed in 10 µl o lea juice ex ac using a Vap o Osmome e 5520 (Wesco Inc., Logan, UT). Biomass was ob ained om d y shoo s. Chlo ophyll a, b and o al we e de e mined by ex ac ing eeze-d ied shoo s in 80% ace one o e nigh , and eadings we e ca ied ou using UV Spec opho ome e (UV-1800; Shimadzu, Kyo o, Japan). Visual sal s ess inju y was e alua ed in a leas h ee Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 58 independen expe imen s, o bo h con ol and sal s ess condi ions. K+ and Na+ con en , osmo ic po en ial, biomass (d y weigh ), chlo ophyll a, b and o al we e e alua ed om one expe imen , o bo h con ol and sal s ess condi ions. Th ee plan s pe geno ype we e used o biomass, whils o all o he pa ame e s; we used a leas i e plan s pe geno ype, o bo h con ol and sal s ess condi ions. A ep oduc i e s age, sal s ess imposi ion was pe o med wo weeks be o e lowe ing ime o each geno ype and hold un il ha es ing he seeds, by supplemen ing SNAP solu ion (San os and Ocampo, 2005) wi h NaCl (EC = 10 dS/m ≈ 100 mM NaCl). In he con ol con aine , no sal was added. The expe imen was conduc ed in a g eenhouse unde na u al ligh condi ions (IRRI- Philippines d y season). A e ha es ing, we e alua ed g ain yield (g ams seeds mass pe plan ) and yield componen s ( illed g ain numbe and spikele s numbe pe plan ). One expe imen was pe o med, and ou plan s pe geno ype we e analyzed in sal s ess o con ol condi ions. Re e se ansc ip ion- eal ime PCR (RT-qPCR) Exp ession analyses o OsNHX1 ansc ip s we e pe o med in ice seedlings (11 days a e sowing) om di e en geno ypes subjec o sal s ess ea men s 12 dS/m (≈ 120 mM NaCl). S ess ea men s we e imposed ou hou s a e dawn. Samples we e collec ed a di e en ime-poin s, immedia ely ozen in liquid ni ogen, and kep a -80 ºC un il RNA ex ac ion. One expe imen was pe o med, and eigh plan s we e collec ed pe ime poin . See pheno yping o sal s ess ole ance a Ma e ial and Me hods o de ails. OsNHX1 encodes h ee splicing o ms, splicing o m 1.1, splicing o m 1.2 and splicing o m 1.3. Splicing o ms 1.1 and 1.2 we e analyzed oge he (He e a e splicing o m 1.1/1.2) (Fo OsNHX1 gene s uc u e see Supplemen al Fig. 1). To al RNA om shoo s was ex ac ed using TRIzol-Reagen (In i igen, MA, USA), ollowing he manu ac u e ’s ins uc ions. Fi s s and cDNA was syn hesized om 4 µg o al RNA using an ancho ed-oligo-(dT)18 p ime acco ding Chap e III 59 o he manu ac u e ’s ins uc ions om he T ansc ip o High Fideli y cDNA Syn hesis Ki (Roche, Basel, Swi ze land). The cDNA was ampli ied using he SYBR G een PCR Mas e Mix (Roche, Basel, Swi ze land) on Ligh Cycle 480 Real-Time PCR Sys em (Roche, Basel, Swi ze land). qPCR unning condi ions we e as ollows: one cycle a 95 °C o 5 min and 45 cycles o ampli ica ion a 95 °C o 10 s, 58–60 °C o 10 s and 72 °C o 10 s. The Ubiqui in-conjuga ing enzyme E2 (OsUBC2q) and/o Euka yo ic elonga ion ac o 1-α (OseEF-1α) ice genes we e used as an in e nal con ol o no malize he ela i e mRNA le el o OsNHX1 splicing o ms ansc ip s. C alues we e calcula ed om means o h ee echnical eplica es and he ela i e quan i ica ion o gene exp ession/ ansc ip s was calcula ed wi h kine ic PCR e iciency co ec ion using he compa a i e C me hod (2(-ΔΔC )) o de e mine he ela i e exp ession o ansc ip s ela i e o endogenous con ol(s) (OsUBC2q and/o OseEF-1α). Ampli ica ion o speci ic a ge gene was pe o med wi h gene-speci ic p ime se desc ibed in Supplemen al Table 1. A dissocia ion kine ic analysis (mel ing cu e) was pe o med a he end o he expe imen o check he speci ici y o annealing. Accession numbe s Sequence da a om his a icle can be ound in he Rice Genome Anno a ion P ojec da a lib a ies unde Locus numbe s: OsNHX1 (Os07g47100), OsUBC2q (Os02g42314), eEF-1α (Os03g08020). RESULTS Pheno yping sal s ess ole ance a seedling s age To cha ac e ize he sal s ess ole ance a seedling s age o FL 478, Hasawi, NDR-312-2 and Sal 024 geno ypes, a modi ied S anda d E alua ion Sco e (SES) o isual sal s ess inju y was applied as p e iously desc ibed by G ego io e al. (1997). Pheno yping a seedling s age included a con ol and a sal s ess ea men , wi h he p esence o h ee check geno ypes: Sal -suscep ible: IR 29, sal -mode a ely ole an : IR 64 and sal - ole an : Pokkali. A he end o he sal Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 60 Geno ype SES IR 29 7 IR 64 5 Sal 024 5 NDR-312-2 3 Hasawi 3 FL 478 3 Pokkali 3 ea men plan s we e isual sco ed, by he modi ied SES me hod (G ego io e al., 1997). Appling his me hod seedlings we e classi ied be ween 3 up o 7 (Supplemen al Table 1). Sal - ole an ypes we e sco ed 3, meaning nea ly no mal g ow h, bu lea ips o ew lea es whi ish and olled. Sal suscep ible ypes we e sco ed 7, meaning cessa ion o g ow h; mos o lea es d y and some plan s dying. By sco ing ou geno ypes we could disc imina e sal - ole an (SES = 3): Pokkali, FL 478, Hasawi, NDR-312-2; Sal -mode a ely ole an (SES = 5): Sal 024, IR 64 and Sal -suscep ible (SES = 7): IR 29 (Table 1). Figu e 1 shows sal s ess isual inju ies e ec s on selec ed geno ypes. Sal - ole an geno ypes we e able o suppo salini y in a mo e e icien way, showing less sal s ess symp oms. On he o he hand, he sal -suscep ible geno ype IR 29 was se e ally a ec ed by sal . Indeed, he sal s ess applied was almos le hal o his geno ype. IR 29 showed se e e biomass educ ion (53.00%) and mos lea es we e hea ily d ied. Pokkali was he ice geno ype less a ec ed by sal . Table 1. Visual sco ing (SES) om selec ed ice geno ypes. Ele en-day-old seedlings we e subjec ed o sal s ess (EC = 12 dS/m, ≈ 120 mM o NaCl) o 15 days. Seedlings we e classi ied be ween 3 up o 7. SES 3 is assigned o sal - ole an ype and SES 7 is assigned o sal -suscep ible ype. Chap e III 61 The biomass o Pokkali was no se e ely a ec ed (30.84% educ ion), compa ed wi h o he geno ypes and seedlings only showed some lea ips whi ish and olled. Fo he emaining geno ypes, biomass educ ion unde sal s ess was: IR 29 (53.69%), IR 64 (45.29%), Sal 024 (59.64%), NDR-312-2 (58.11%), Hasawi (65.65%), FL 478 (46.59%) (Fig. 2). In e es ingly, he biomass o wo sal ole an geno ypes (Hasawi and NDR-312-2) was se e ely a ec ed by sal s ess, showing no co ela ion be ween sal ole ance and biomass conse a ion. Figu e 1. Visual e ec s o salini y on 11-day-old selec ed ice seedlings subjec ed o sal s ess (EC = 12 dS/m, ≈ 120 mM o NaCl) o o con ol condi ions (no sal applied) o 15 days. A he le side o each image he e a e wo seedlings unde con ol condi ions. A he igh side o each image he e a e wo seedlings unde sal s ess condi ions. Images we e g ouped acco ding o salini y ole ance. The mos suscep ible geno ype is on op. A he base a e he mos ole an geno ypes. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 68 Chap e III 69 DISCUSSION Sal s ess is one o he mos impo en i onmen al ac o s limi ing ice yield in p oduc ion a eas (Zeng and Shannon, 2000). I a ec s plan s in di e en ways, such as osmo ic s ess, speci ic ion oxici y and/o nu i ional diso de s. Sal s ess ole ance in ol es a complex o esponses a molecula , cellula , me abolic, physiological, and whole-plan le el. The eby, sal s ess ole ance is desc ibed as a polygenic ai (Munns and Tes e , 2008). S anda d E alua ion Sco e (SES) o isual symp oms o sal s ess inju ies on geno ypes subjec ed o sal ea men allowed dis inguishing be ween sal s ess suscep ible, mode a ely ole an and ole an geno ypes. The sal - suscep ible geno ype IR 29 showed ea ly senescence, clo osis and se e e lea nec oses on old lea es. On o he hand, ole an geno ypes (e.g., Pokkali) we e able o wi hs and s ess in a mo e e icien way, showing less sal s ess symp oms. Sal s ess educed he biomass, shoo leng h and lea a ea o he Figu e 6. Analysis o he OsNHX1 gene exp ession in selec ed ice geno ypes subjec ed o sal s ess. RT-qPCR analysis shows old-change in ansc ip le el in shoo s. Ele en-day-old seedlings we e subjec ed o sal s ess (EC = 12 dS/m, ≈ 200 mM o NaCl) o o con ol condi ions (no sal added) o 0, 30 min, 2, 4, 8, 12, 24, 48h, 7 and 15d (s a ing 4 h a e dawn). Da a om samples 0, 30 min, 2, 4 and 8 h we e no malized using each cul i a and OsNHX1 splicing o m ela i e mRNA le el a 0 min as a e e ence. Da a om samples 12, 24, 48 h and 15 d we e no malized using each cul i a and OsNHX1 splicing o m ela i e mRNA le el a 12, 24, 48 h and 15 d unde con ol condi ions as a e e ence, espec i ely. OsNHX1 gene encodes h ee splicing o ms, splicing o m 1.1, splicing o m 1.2 and splicing o m 1.3. Splicing o ms 1.1 and 1.2 we e analyzed oge he (Splicing o m 1.1/1.2). Ubiqui in-conjuga ing Enzyme E2 was used as housekeeping gene o no maliza ion. Values a e means ± SD (n = 3). Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 70 se en ice geno ypes analyzed. Biomass educ ion unde sal s ess was no co ela ed wi h sal s ess ole ance measu ed by SES sco e. NRD-312-2 and Hasawi, sal - ole an geno ypes, showed highe biomass educ ion as compa ed wi h he suscep ible and mode a ely ole an geno ypes. In ag eemen , Pi es e al. (2015) ound no di ec associa ion be ween g ow h educ ion and sal s ess ole ance. The biomass educ ion obse ed unde sal s ess migh be due o combina ion o slowe g ow h a e as a esul o osmo ic s ess, and inhibi ion o pho osyn hesis as a esul o di ec e ec s o ion oxici y on pho osyn he ic appa a us o indi ec e ec s as a esul o a educ ion in sink capaci y (Mo adi and Ismail, 2007). Sal s ess symp oms, such as old lea es ea ly senescence, lea chlo osis and nec osis has been epo ed o be co ela ed wi h high concen a ion o Na+ and/o deple ion o K+ (Ho ie e al., 2012). Salini y e ec s on ion up ake ha e been in es iga ed in many species including ice, and es ic ion o Na+ accumula ion in shoo s unde sal s ess has been epo ed o be co ela ed wi h ice su i al (Lu s e al., 1996). In addi ion, acquisi ion and main enance o K+ unde sal s ess was ound o ha e a g ea impac on plan s ess ole ance. I has been sugges ed ha main enance o a high cy osolic K+/Na+ a io is c ucial o sal s ess ole ance in glycophy e plan s, such as ice (Asch e al., 2000; Blumwald, 2000; Senadhi a, 1993; Yamaguchi and Blumwald, 2005). This is in ag eemen wi h ou s udies. K+/Na+ a ios we e lowe in suscep ible and mode a ely ole an (IR 29, IR 64 and Sal 024) and highe in ole an geno ypes (NDR-312-2, Hasawi, FL 478 and Pokkali). The suscep ible and mode a ely ole an geno ypes unde s udy showed highe Na+ shoo con en unde sal s ess, as compa ed wi h con ol condi ions, gene ally no accompanied by an inc ease in K+ con en (Supplemen al Fig. 2). Indeed, K+ con en in IR 29 dec eased unde sal s ess (Supplemen al Fig. 2). In con as , ole an geno ypes showed lowe Na+ shoo con en , gene ally accompanied by inc eased K+ up ake (Supplemen al Fig. 2). I seems ha ole an geno ypes end o a oid Na+ up ake. Pokkali and FL 478 showed he highes inc eased in K+ up ake and lowe Na+ Chap e III 71 accumula ion unde sal s ess. A majo QTL o sal s ess ole ance a seedling s age was mapped o he sho a m o ch omosome 1 using a ecombinan inb ed line (RIL) popula ion de eloped om an IR 29 x Pokkali c oss. In Pokkali seedlings unde sal s ess, Sal ol QTL was ound o be he majo playe con olling high K+ abso p ion, low Na+ abso p ion, and high K+/Na+ a io (G ego io e al., 1997; Thomson e al., 2010). The sal s ess ole ance obse ed o Pokkali and FL 478 (RIL de i ed om IR 29 x Pokkali c oss) is mainly due o a igh con ol o Na+ up ake, accompanied by inc eased up ake o K+, hus sus aining a high K+/Na+ a io. The eby, hese geno ypes may be ela i ely less s essed a he cellula le el compa ed o o he geno ypes unde sal s ess, which leads o educed sal s ess symp oms. Sal s ess dec eases wa e po en ial o he soil solu ion. This can e e se he osmo ic g adien be ween he inside and he ou side o oo cell, hus gene a ing wa e e lux (dehyd a ion) (Ho ie e al., 2012). Plan osmo ic po en ial becomes mo e nega i e wi h inc ease in salini y (Khanab e al., 1999). Ou esul s showed ha he osmo ic po en ial o all geno ypes dec eased unde sal s ess o e con ol. Howe e , ole an geno ypes showed a lowe dec ease in osmo ic po en ial han suscep ible and mode a ely ole an geno ypes. NDR-312-2 was he only excep ion om ole an geno ypes, showing a high dec ease in osmo ic po en ial unde s ess, simila o he osmo ic po en ial dec ease obse ed o mode a ely ole an geno ypes. Osmo ic adjus men has long been epo ed as a manne by which highe plan s adap o salini y (Ho ie e al., 2012). Osmo ic adjus men by means o solu e accumula ion inside he cell is essen ial o educe he cellula osmo ic po en ial agains an osmo ic g adien c ea ed be ween oo cells and ou -side saline solu ion, which likely es o e wa e up ake by he oo s (Ho ie e al., 2012). Ino ganic ion accumula ion in he cy osol (mainly K+) and in he acuole (Na+, especially in sal ole an geno ypes) a e also ound o be impo an o he osmo ic adjus men o plan cells (Ho ie e al., 2012). In addi ion o ion accumula ion o cellula osmo ic adjus men , ce ain o ganic me aboli es o low molecula weigh a e known o accumula e in he cy osol unde sal /osmo ic Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 72 s ess condi ions. Such compounds a e collec i ely known as compa ible solu es. Compa ible solu es a e small molecules ha ac as osmoly es and help o ganisms su i e ex eme s ess condi ions (e.g., sal and osmo ic s ess). Examples include be aines, amino acids, and suga s. These molecules accumula e in cells and balance he osmo ic di e ence be ween he cell's su oundings and he cy osol. Compa ible solu es a e also epo ed o s abilize p o eins and cell memb anes agains he dena u ing e ec o s ess condi ions on cellula unc ions (Ho ie e al., 2012). P oline is a compa ible solu e epo ed o accumula e in ice unde sal and osmo ic s ess, and posi i ely implica ed on s ess ole ance (Shobba e al., 2010). I has been sugges ha p oline accumula ion unde sal s ess is a consequence o he ionic componen o sal s ess (Shobba e al., 2010). Shobba e al. (2010) epo ed ha p oline and Na+ accumula ion in shoo s o IR 29 we e highe han FL 478 when subjec ed o sal s ess. The highe dec ease in osmo ic po en ial obse ed in suscep ible and mode a ely ole an geno ypes unde s ess a e likely o be ela ed wi h uncon olled Na+ aise in shoo s (Supplemen al Fig. 2), which may also induce highe p oline accumula ion as a consequence o cell ion oxici y. NDR-32-2 highe dec ease in osmo ic po en ial unde s ess may also be due highe Na+ accumula ion, and possibly p oline con en . Unde sal s ess, suscep ible and mode a ely ole an geno ypes could no sus ain ion homeos asis (K+ and Na+). These geno ypes showed highe shoo Na+ accumula ion (Supplemen al Fig. 2), which may lead o ion oxici y and he espec i e sal s ess symp oms obse ed in lea es. The di ec e ec o ions on pho osyn hesis has been epo ed as be main cause o g ow h e a da ion in plan s subjec ed o 12 dS/m sal s ess (Dionisio-Sese and Tobi a, 1988). Suscep ible and mode a ely ole an geno ypes, likely accumula ed highe Na+ concen a ions in pho osyn he ic lea es, esul ing in massi e biomass educ ion in hese geno ypes. In addi ion, high Na+ accumula ion supp ess K+ up ake (Ho ie e al., 2012). K+ is an essen ial co ac o o many enzymes loca ed in he cy osol, and Na+ is no able o eplace i s biochemical unc ion (Munns and Tes e , 2008). Chap e III 73 K+ is also an impo an ion o osmo ic adjus men (Bassil and Blumwald, 2014). High Na+ accumula ion ollowed by educ ion o diminished inc ease in K+ concen a ion epo ed in suscep ible and mode a ely ole an geno ypes, p obably causes educ ion in plan abili y o osmo ic adjus men , leading o highe decline in osmo ic po en ial, which may also con ibu ed o g ow h educ ion. Among he ole an geno ypes, Hasawi d ama ically es ained g ow h unde sal s ess, which could be a way o p e en excessi e Na+ up ake. Sal ol QTL was no de ec ed in Hasawi, a leas a he same ch omosome 1 posi ion ound in Pokkali and FL 478 (Bimpong e al., 2014). This indica es he exis ence o new mechanisms unde lying salini y ole ance beyond he K+-Na+ up ake con ol. No in o ma ion ega ding he p esence o Sal ol QTL in NDR-312-2 is a ailable. Rice is sal s ess ulne able du ing ea ly seedling (2-3 lea s age) and ep oduc i e (panicle ini ia ion) s ages, wi h conside able impac s on su i al and g ain yield, espec i ely. P edic ion o he sal s ess ole ance a seeding s age is quicke in e ms o ime and esou ces han ep oduc i e s age and wi hou c op es ablishmen he e would be no g ain yield (Asch e al., 2000). Howe e , poo co ela ion exis s be ween hese wo s ages (Heenan e al., 1998). The ep oduc i e s age is a c i ical s age as i ul ima ely de e mines inal g ain yield. Sal s ess a ep oduc i e s age showed o be ex emely se e e o ice p oduc ion and no co ela ed wi h sal s ess ole ance measu ed as SES sco e a seedling s age a all geno ypes. Sal s ess is known o a ec ice yield componen s ela ed o inal g ain yield. Sal s ess also causes delayed eme gence o panicle and lowe ing ime and dec eases seed se h ough educed pollen iabili y (Zeng and Shannon, 2000b). Ou esul s showed ha sal s ess, 10 dS/m (EC), se e ally educed g ain yield (g ams o seeds pe plan ) and yield componen s ( illed g ain numbe and spikele s numbe pe plan ). Lowe educ ion o g ain yield in IR 29 and IR 64 is possibly a consequence o lowe educ ion in illed g ain numbe pe plan epo ed in hese geno ypes. This may indica e a highe pollen iabili y and/o highe ecep i i y o he s igma ic su ace unde s ess (Zeng and Shannon, 2000). In ole an geno ypes, opposi e esul s we e Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 74 ob ained; highe educ ion o g ain yield as a possible consequence o highe educ ion in illed g ain numbe pe plan . Among he ole an geno ypes, Hasawi showed he s onges educ ion o g ain yield and illed g ain numbe pe plan . The delay in lowe ing associa ed wi h his geno ype migh be esponsible o he weakes g ain yield pe o mance in sal s ess. Longe ime o lowe ing means longe exposi ion o pollen o sal oxici y, leading o s e ili y. Ye , he p e ious hypo heses may no be alid o all geno ypes. Unde sal s ess, i is c i ical o plan cells o keep a low Na+ le els while main aining high K+ le els in he cy osol, esul ing in a high K+/Na+ a io ha is a o able o cellula homeos asis (Ho ie e al., 2012). Na+ compa men a ion in acuoles is an e icien mechanism o educe cy osolic Na+ concen a ion, while p o iding addi ional osmo icum o wa e up ake and u go main enance (Djanagui aman e al., 2012). This unc ion has been a ibu ed o onoplas localized NHX- ype an ipo e s (Apse and Blumwald, 2002; Blumwald, 2000). The impo ance o OsNHX1 p o ein in sal s ess ole ance has been epo ed by plan s o e exp essing OsNHX1 (Chen e al., 2007; Fukuda e al., 2004). OsNHX1 gene unde goes al e na i e splicing, gi ing aise o h ee ansc ip iso o ms. In e es ingly, he mos ole an geno ypes did no show s ong induc ions o any OsNHX1 splice o m. Unde sal s ess, OsNHX1 splicing o ms we e only sligh ly egula ed (up o down) in Pokkali and FL 478. Possibly due o high K+/Na+ a io in shoo issue, i may be ela i ely less s essed a cellula le el, as compa ed o IR 29, and hus ha e a limi ed ansc ip ome esponse, as sugges ed by Walia e al. (2005). The highe OsNHX1 splicing o ms ansc ip le els obse ed in Pokkali and FL 478 unde con ol condi ions, as compa ed o he o he geno ypes (Supplemen al Fig. 4), is a possible s a egy o adap a ion o sal s ess. Kuma i e al. (2009) sugges ed ha cons i u i e o e exp ession o sal s ess ela ed genes appea s o be he c ucial de e minan o sal s ess ole ance, which could allow ole an geno ypes o espond o s ess wi hou much al e a ion in ansc ip p o ile du ing he ini ial phase o s ess. Sal 024 and NDR-312-2 geno ypes showed he highes induc ion o all OsNHX1 splicing o ms, ollowed by IR 64 and Chap e III 75 Hasawi induc ion. NDR-312-2 showed he lowes amoun o OsNHX1 ansc ip s le els unde con ol condi ions (Supplemen al Fig. 4), which migh be associa ed o he s ong gene ac i a ion unde s ess. Sal 024, IR 64 and Hasawi did no show, in gene al, low basal le els o OsNHX1 ansc ip s (Supplemen al Fig. 4). Ne e heless, hese geno ypes p esen ed s ong OsNHX1 ac i a ion unde sal s ess. This indica es ha in hese geno ypes, NHX1 may ha e a key ole in sal s ess esponse. Pi es e al. (2015) epo ed ha ice exhibi s all h ee mechanisms o esponse o sal s ess ( ole ance o osmo ic s ess, ion exclusion and issue ole ance) and no mechanism is p e e en ially used. High OsNHX1 induc ion epo ed in Sal 024 and IR 64 unde s ess is no su icien o p omo e ole ance pe se, likely due lack o o he sal ole an mechanisms. In Hasawi, high OsNHX1 induc ion unde s ess sugges s ha i s ole ance is suppo ed in pa by K+-Na+ compa men aliza ion unde s ess. The K+-Na+ acuola anspo migh be egula ed by he combina o y e ec o each indi idual OsNHX1 splicing o m. Splicing o ms 1.1 and 1.2 codes o same p o ein. Ye , splicing o m 1.2 has an inse ion (in on) in he 5' UTR egion o he gene, which is absen in splicing o m 1.1 and 1.3 and migh be ela ed wi h enhanced mRNA and p o ein le els (Chung e al., 2006). Se e al cis- egula o y elemen s a e in oduced by he e ained in on sequence (no shown) [P edic ed by Plan Pan: Plan P omo e analysis na iga o so wa e (Chang e al., 2008)]. No ewo hy, IR 29, Sal 024, NDR-312-2 and Hasawi showed highes splicing o m 1.2 old induc ion when compa ed wi h splicing o m 1.1/1.2 old induc ion unde s ess. Splicing o m 1.3 encodes a unca ed p o ein, which lacks i s C- e minus [p edic ed by TMHMM Se e . 2.0. (K ogh e al., 2001)]. Yamaguchi e al. (2003) epo ed ha A NHX1 C- e minus appea ed o be in ol ed in de e mina ion o he ion selec i i y. Dele ion o he C- e minus esul ed in a d ama ic inc ease in he ela i e a e o Na+/H+ o e K+/H+ anspo . In addi ion, Yamaguchi e al. (2005) inden i ied a calmodulin-like p o ein 15 (A CaM15), which in e ac wi h A NHX1 C- e minus modi ying A NHX1 Na+-K+ selec i i y. Induc ion o he na u al unca ed o m o OsNHX1, splicing o m 1.3, Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 76 unde s ess may be a egula o y mechanism by which he ion selec i i y o OsNHX1 is ansc ip ional egula ion, adding ano he le el o egula ion. In conclusion, sal s ess se e ally a ec ed all ice geno ypes, ei he a he seedling o he ep oduc i e s ages al hough no co ela ion was ound be ween he s ess ole ance a bo h s ages. A seedling s age, he main enance o a high K+/Na+ a io was a good indica o o sal s ess ole ance. A ep oduc i e s age, delay in lowe ing can lead o a d ama ically educ ion on g ain yield. Among he a ge ed ice geno ypes, Hasawi s ood ou o sal ole ance, showing high OsNHX1 ansc ip le els in con ol condi ions and high OsNHX1 induc ion unde sal s ess. Howe e , he expe imen al condi ions used and he esul s ob ained did no allow de e mining he con ibu ion o OsNHX1 o sal ole ance in he a ge ice geno ypes. ACKNOWLEDGMENTS Diego M. Almeida pe o med he expe imen al wo k wi h he collabo a ion o Aiza Nai een, Jun ey Amas and Anice a Ba e o who con ibu ed o he sal s ess assays. The planning o he esea ch wo k and discussion o esul s was ca ied ou by Diego M. Almeida, Glenn B. G ego io, Nelson Saibo and M. Ma ga ida Oli ei a. We would like o hank Sónia Neg ão o he ad ices ega ding he ice sal s ess sc eening. REFERENCES And és Z., Pe ez-Ho maeche J., Leidi E.O., Schlucking K., S einho s L., McLachlan D.H., Schumache K., He he ing on A.M., Kudla J., Cube o B., Pa do J.M. (2014) Con ol o acuola dynamics and egula ion o s oma al ape u e by onoplas po assium up ake. P oc Na l Acad Sci U S A 111:E1806-14. DOI:10.1073/pnas.1320421111. Apse M.P., Blumwald E. (2002) Enginee ing sal ole ance in plan s. Cu Opin Bio echnol 13:146-50. DOI: S0958166902002987. Apse M.P., Aha on G.S., Snedden W.A., Blumwald E. (1999) Sal ole ance con e ed by o e exp ession o a acuola Na+/H+ an ipo in A abidopsis. Science 285:1256-8. DOI: 10.1126/science.285.5431.1256. Chap e III 77 Asch F., Dingkuhn M., Dö ling K., Miezan K. (2000) Lea K+/Na+ a io p edic s salini y induced yield loss in i iga ed ice. Euphy ica 113:109-118. DOI: 10.1023/A:1003981313160. Ascha F., Wope eisb M.C.S. (2001) Responses o ield-g own i iga ed ice cul i a s o a ying le els o loodwa e salini y in a semi-a id en i onmen . Field C ops Resea ch 70:127–137. DOI: 10.1016/S0378- 4290(01)00128-9. Bassil E., Blumwald E. (2014) The ins and ou s o in acellula ion homeos asis: NHX- ype ca ion/H+ anspo e s. Cu Opin Plan Biol 22:1-6. DOI:10.1016/j.pbi.2014.08.002. Bassil E., Oh o M.A., Esumi T., Tajima H., Zhu Z., Cagnac O., Belmon e M., Peleg Z., Yamaguchi T., Blumwald E. (2011) The A abidopsis in acellula Na+/H+ an ipo e s NHX5 and NHX6 a e endosome associa ed and necessa y o plan g ow h and de elopmen . Plan Cell 23:224-39. DOI: 10.1105/ pc.110.079426. Bimpong I.K., Manneh B., El-Namaky R., Diaw F., Amoah N.K.A., Sanneh B., Ghislain K., Sow A., Singh R.K., G ego io G.B., Bizimana J.B., Wope eis M. (2014) Mapping QTLs ela ed o sal ole ance in ice a he young seedling s age using 384-plex single nucleo ide polymo phism SNP, ma ke se s. Molecula Plan B eeding 5. DOI: 10.5376/mpb.2014.05.009. Blumwald E. (2000) Sodium anspo and sal s ess ole ance in plan s. Cu en Opinion in Cell Biology 12:431–434. DOI: 10.1016/S0005- 2736(00)00135-8. Chang W.C., Lee T.Y., Huang H.D., Huang H.Y., Pan R.L. (2008) Plan PAN: Plan p omo e analysis na iga o , o iden i ying combina o ial cis- egula o y elemen s wi h dis ance cons ain in plan gene g oups. BMC Genomics 9:561. DOI: 10.1186/1471-2164-9-561. Chen M., Chen Q.-J., Niu X.-G., Zhang R., Lin H.-Q., Xu C.-Y., Wang X.-C., Wang G.-Y., Chen J. (2007) Exp ession o OsNHX1 gene in maize con e s sal ole ance and p omo es plan g ow h in he ield. Plan Soil En i on. 53:490–498. Chung B.Y., Simons C., Fi h A.E., B own C.M., Hellens R.P. (2006) E ec o 5' UTR in ons on gene exp ession in A abidopsis haliana. BMC Genomics 7:120. DOI: 10.1186/1471-2164-7-120. Dionisio-Sese M.L., Tobi a S. (1988) An ioxidan esponses o ice seedlings o salini y s ess. Plan Science 135:1–9. DOI: 10.1016/S0168- 9452(98)00025-9. Djanagui aman M., P asad P.V.V. (2012) E ec s o Salini y on Ion T anspo , Wa e Rela ions and Oxida i e Damage, in: SPRINGER-VERLAG NEW YORK INC. (Ed), Ecophysiology And Responses O Plan s Unde Sal S ess, Sp inge , New Yo k, NY, USA. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 84 CATTGATCAGGCTGCTGCTA AGGAGAATGCAGGGACTTTG CGGGAATTGTCGAATTAGGC AGCGAGATTTCCGCCGCA CATCTTACTGCAACCTATGC TAGGGTGAGAATTCAGACATG TTGCATTCTCTATTCCTGAGCA CAGGCAAATCTCACCTGTCTT TGGTGACCAAGATCGACAGA GCATCACCGTTCTTGAGGA Gene Splicing o m(s) P ime Sequence 5'-3' OsUBC2q 1.1/1.2 1.1 OseEF-1α OsNHX1 1.1/1.2 1.2 1.3 Supplemen al Table 2. Oligonucleo ide sequenced used in he gene exp ession s udies. Chap e III 85 Chap e III Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 86 TABLE OF CONTENTS – CHAPTER III Abs ac .............................................................................................................. 87 In oduc ion ......................................................................................................... 88 Ma e ial and Me hods ......................................................................................... 91 Plan ma e ials and abio ic s ess ea men s ................................................... 91 Re e se ansc ip ion-Real-Time PCR (RT-qPCR) .......................................... 91 cDNA exp ession lib a y cons uc ion ............................................................... 92 Cons uc ion o yeas bai s ains ...................................................................... 92 Yeas -One-Hyb id sc eening and alida ion ..................................................... 93 Yeas cell spo ing ............................................................................................ 93 Plasmid cons uc ion ........................................................................................ 94 T ansac i a ion ac i i y assays using A abidopsis p o oplas s ......................... 95 T ansac i a ion ac i i y assays using ice p o oplas s ...................................... 96 Sub-cellula localiza ion .................................................................................... 97 Accession numbe s .......................................................................................... 97 Resul s ................................................................................................................. 98 OsNHX1 is di e en ially exp essed in ice geno ypes wi h con as ing sal s ess ole ance ................................................................................................ 98 Iden i ica ion o ansc ip ion ac o s binding o he OsNHX1 gene p omo e . .. 99 Cellula localiza ion o he TFs iden i ied as binding o OsNHX1 p omo e .... 102 T ansac i a ion ac i i y o TFs iden i ied as binding o OsNHX1 p omo e ..... 103 Exp ession o he TF genes in ice seedlings subjec ed o sal o PEG- simula ed d ough s ess ................................................................................ 106 Discussion ......................................................................................................... 111 Acknowledgmen s ........................................................................................... 118 Re e ences ....................................................................................................... 119 Supplemen al Da a............................................................................................ 126 Chap e III 87 ABSTRACT OsNHX1 is he mos abundan K+-Na+/H+ an ipo e localized in he onoplas and i s gene exp ession is induced by sal , d ough and ABA. To in es iga e how OsNHX1 is ansc ip ionally egula ed in esponse o sal s ess in a sal - ole an ice geno ype (Hasawi), a sal -s ess-induced cDNA exp ession lib a y was cons uc ed and subsequen ly sc eened using he Yeas -One-Hyb id (Y1H) sys em and he OsNHX1 p omo e as bai . Fi e ansc ip ion ac o s (TFs) belonging o h ee dis inc TF amilies: one TCP (OsPCF2), one CPP (OsCPP5) and h ee NIN-like (OsNIN-like 2, OsNIN-like 3 and OsNIN-like 4) we e iden i ied as binding o OsNHX1 p omo e . T ansac i a ion ac i i y assays pe o med in A abidopsis and ice p o oplas showed ha OsPCF2 and OsNIN-like 4 a e ac i a o s o he OsNHX1 gene exp ession, while OsCPP5 and OsNIN-like 2 ac as ep esso s. The ansac i a ion ac i i y o OsNIN-like 3 needs o be u he in es iga ed. Gene exp ession s udies showed ha OsNHX1 ansc ip le el is highly induced by sal and PEG-simula ed d ough s ess in bo h shoo s and oo s in bo h Nipponba e and Hasawi. Ne e heless, OsNHX1 seems o play a pa icula ole in shoo s in esponse o d ough . Mos o he TFs binding o OsNHX1 p omo e showed a modes ansc ip ional egula ion unde s ess condi ions, howe e , in esponse o mos o he condi ions s udied, he OsPCF2 was induced ea lie han OsNHX1, indica ing ha OsPCF2 may ac i a e OsNHX1 gene exp ession. In addi ion, al hough he OsNHX1 esponse o sal and PEG- simula ed d ough s ess in ei he shoo s o oo s was qui e simila in bo h ice geno ypes (Nipponba e and Hasawi), he exp ession o OsPCF2 in oo s unde sal s ess and he OsNIN-like 4 in oo s subjec ed o PEG we e mainly up- egula ed in Hasawi, indica ing ha hese TFs may be associa ed wi h he sal and d ough s ess ole ance obse ed in Hasawi. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 88 INTRODUCTION Soil salini y, p edominan ly in he o m o sodium chlo ide (NaCl), is one o he mos se e e en i onmen al p oblems a ec ing c op p oduc ion, pa icula ly in i iga ed a eas, whe e as much as one hi d o he wo ld’s ood p oduc ion akes place. Wo ldwide, soil saliniza ion a ec s a leas 20% o all i iga ed lands, wi h some es ima es going up o 50%, and i is expec ed o inc ease due o clima e changes and imp ope i iga ion p ac ices (Michael and And é, 2002; Roy e al., 2014); wi h an es ima ed global cos o ag icul u e o abou 12 $US billion pe yea (Michael and And é, 2002). Soil salini y a ec s plan g ow h in wo di e en phases. In he i s phase, called osmo ic phase, high concen a ion o sal s in he soil leads o lowe soil wa e po en ial and consequen ly educed plan abili y o ake up wa e . This phase s a s apidly, wi hin minu es, upon oo exposi ion o high sal concen a ion. Such phase, which is independen o ion accumula ion, leads o a educed cell expansion in oo ip and young lea es, and causes s oma a closu e (Munns and Tes e , 2008; Roy e al., 2014). The second phase, ion dependen , s a s wi h a slow accumula ion o oxic Na+ wi hin he lea es, leading o cell inju y and u he educed g ow h (Munns and Tes e , 2008). Plan s ha e de eloped many mechanisms o ole a e sal s ess. These mechanisms can be o ganized in h ee dis inc ypes: (1) osmo ic s ess ole ance, which is sugges ed o be con olled by long dis ance ho monal signals; (2) ion exclusion, whe e Na+ anspo p ocesses educe he accumula ion o oxic Na+ wi hin oo s and lea es; and (3) issue ole ance, accumula ion o high Na+ concen a ion in o lea es, which equi es compa men aliza ion o Na+ a he cellula and in acellula le el (especially in he acuole) o a oid a high concen a ion o Na+ wi hin he cy oplasm (Munns and Tes e , 2008). Compa men a ion o Na+ ions in o he acuole also p o ides addi ional osmo icum o wa e up ake and u go main enance (Djanagui aman e al., 2012) NHX- ype an ipo e s a e known o ca alyze he ca ion/H+ exchange ac oss memb anes (Bassil and Blumwald, 2014; Jiang e al., 2010). T adi ionally, Chap e III 89 he unc ion o onoplas localized NHX- ype has been a ibu ed o Na+ compa men aliza ion in o he acuole. Howe e , ecen e idences sugges ed ha he biological ole o NHX- ype localized in he onoplas ( acuole memb ane) is a beyond Na+ compa men aliza ion. These p o eins a e c i ical egula o s o K+ and pH homeos asis and ha e impo an oles, depending on hei cellula localiza ion, in he gene a ion o u go , d i ing cell expansion, s oma a mo emen , and he e o e plan g ow h, as well as esicula a icking (And és e al., 2014, Bassil and Blumwald, 2014; Bassil e al.,2011b; Ba agán e al., 2012; Regue a e al., 2015). The i s plan acuole K+-Na+/H+ an ipo e iden i ied was he A NHX1 gene cloned om A abidopsis haliana (Gaxiola e al., 1999). A abidopsis con ains eigh membe s o NHX- ype an ipo e s amily belonging o h ee subclasses wi h dis inc localiza ions: wo in he plasma memb ane (SOS1/A NHX7 and A NHX8) and six in acellula membe s ha a e ei he in he onoplas , A NHX1 up o A NHX4, o in he p e acuola compa men (Golgi, ans-Golgi ne wo k and p e acuola compa men s), A NHX5 and A NHX6 (Bassil e al., 2012; Regue a e al., 2015; Rod iguez-Rosales e al., 2009). In ice, six NHX- ype an ipo e amily membe s we e iden i ied as belonging o h ee subclasses wi h di e en cellula localiza ions: one in he plasma memb ane (SOS1) (Ma inez-A ienza e al, 2007) and i e in acellula membe s ha a e ei he in he onoplas , OsNHX1 o OsNHX4, o in he p e acuola compa men OsNHX5 (Fukuda e al., 1999; Fukuda e al., 2011). OsNHX1 and A NHX1 a e he mos abundan acuola K+- Na+/H+ an ipo e s in ice and A abidopsis, espec i ely, and hei ansc ip le els a e induced by sal (NaCl and KCl), hype osmo ic s ess and abscisic acid (ABA) ea men (Fukuda e al., 2011; Yokoi e al., 2002). I has also been shown ha NHX1 o e exp ession leads o imp o ed sal and d ough s ess ole ance in many plan species ( Liu e al., 2010; Oh a e al., 2002; Xiao e al., 2008; Xuea e al., 2004; Zhang and Blumwald, 2001) and ha NHX1 and NHX2 a e essen ial o K+ homeos asis (And és e al., 2014; Ba agán e al., 2012). In addi ion, i was epo ed ha single knockou s nhx1 o nhx2 do no show a s ong de elopmen al pheno ype, bu he double knockou nhx1 nhx2 esul s in se e e de elopmen al Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 90 de ec s (Apse e al., 2003; Ba agán e al., 2012; Bassil e al., 2011a; So osan o e al., 2004) indica ing ha NHX1 and NHX2 a e essen ial playe s in plan de elopmen and ha e edundan unc ions. Plan esponse and adap a ion o ex eme en i onmen al condi ions (e.g., sal and d ough s ess) a e associa ed wi h changes in he concen a ion and dis ibu ion o signalling molecules [e.g., suga s, ho mones, eac i e oxygen species (ROS)] and wi h apid changes on gene exp ession pa e ns [e.g., genes encoding ansc ip ion ac o s (TFs)] (San os e al., 2011). Despi e mul iple unc ional s udies add essing he NHX1 biological ole in plan g ow h and sal /d ough s ess ole ance (And és e al., 2014; Ba agán e al., 2012; Bassil e al., 2011a; Leidi e al., 2010; Xuea e al., 2004), only wo s udies ha e epo ed NHX1 ansc ip ional egula o s (Adle e al., 2010; Liu e al., 2014). Liu e al. (2014) iden i ied OsbZIP71 TF as being able o a ge OsNHX1 p omo e in i o and Adle e al. (2010) iden i ied a MYB cis- egula o y elemen in ol ed in he ac i a ion o he NHX1 exp ession in Be a ulga is (suga bee ) upon sal and d ough s esses. Rice is one o he mos economically impo an ce eal c op wo ldwide and is highly sensi i e o sal s ess (Munns and Tes e , 2008). Rice yield can be educed when i g ows unde elec ical conduc i i y (EC) as low as 3 dS/m, (≈ 30 mM NaCl) (Gao e al., 2007). In ice, he mechanisms o sal s ess adap a ion ha e been cha ac e ized by Pi es e al. (2015). Unde s anding he molecula mechanisms unde lying ice espond o sal s ess may p o ide ools o he de elopmen o sal - ole an ice geno ypes. In his s udy, using a Yeas -One-Hyb id (Y1H) sys em, we iden i ied i e ice TFs, om h ee dis inc TF amilies, binding o he OsNHX1 p omo e . The genes encoding hese TFs we e ound o be di e en ially egula ed by di e en abio ic s ess condi ions and o ha e di e en ansac i a ion ac i i ies, indica ing di e en oles in OsNHX1 egula ion. . Chap e III 91 MATERIAL AND METHODS Plan ma e ials and abio ic s ess ea men s Rice (O yza sa i a L.) geno ypes IR 29, Nipponba e, Hasawi and Pokkali we e subjec ed o sal s ess ea men s as desc ibed in (Almeida e al., 2016). A e 12 days g owing in Yoshida´s solu ion (Yoshida e al., 1976), ice seedlings we e subjec ed o 12 dSm-1 o 20 dSm-1 (≈ 120 mM and 200 mM o NaCl, espec i ely). Fo PEG ea men , 12-day-old Hasawi seedlings g own in Yoshida´s solu ion we e ans e ed o Yoshida´s solu ion supplemen ed wi h 30% PEG (6000). S ess ea men s we e imposed h ee hou s a e he beginning o pho ope iod. Samples we e collec ed a di e en ime-poin s, immedia ely ozen in liquid ni ogen, and kep a -80 ºC un il RNA ex ac ion. One expe imen was pe o med, and eigh plan s we e collec ed pe ime poin . Shoo s and oo s we e collec ed sepa a ely. Re e se ansc ip ion- eal ime PCR (RT-qPCR) Gene exp ession analyses o OsNHX1 and newly iden i ied TF genes we e pe o med in shoo s and oo s o ice seedlings, sepa a ely. To al RNA was ex ac ed om shoo s and oo s independen ly using RNeasy Plan Mini ki (Qiagen, Cou aboeu , F ance), ollowing he manu ac u e ’s ins uc ions. To elimina e he esidual genomic DNA p esen in he samples, RNA was ea ed wi h TURBO DNA- ee ki (Ambion, TX, USA) acco ding o he manu ac u e ’s ins uc ions. Fi s s and cDNA was syn hesized om 4 µg o al RNA using an ancho ed-oligo-(dT)18 p ime acco ding o he manu ac u e ’s ins uc ions om he T ansc ip o High Fideli y cDNA Syn hesis Ki (Roche, Basel, Swi ze land). The cDNA was ampli ied using he SYBR G een PCR Mas e Mix (Roche, Basel, Swi ze land) on he Ligh Cycle 480 Real-Time PCR Sys em (Roche, Basel, Swi ze land) using he gene speci ic p ime s desc ibed in Supplemen al able 4. qPCR unning condi ions we e as ollows: one cycle a 95 °C o 5 min and 45 cycles o ampli ica ion a 95 ºC o 10 s, 58–60 ºC o 10 s and 72 ºC o 10 s. The Ubiqui in-conjuga ing enzyme E2 (OsUBC2q) and/o he Euka yo ic elonga ion Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 92 ac o 1-α (OseEF-1α) ice genes we e used as an in e nal con ol o no malize he exp ession da a o each gene. C alues we e calcula ed om means o h ee echnical eplica es and he ela i e quan i ica ion o gene exp ession/ ansc ip s was calcula ed wi h kine ic PCR e iciency co ec ion using he compa a i e C me hod (2(-ΔΔC )) o de e mine he ela i e exp ession o ansc ip s ela i e o endogenous con ol(s) (OsUBC2q and/o OseEF-1α). A dissocia ion kine ic analysis (mel ing cu e) was pe o med a he end o he expe imen o check he speci ici y o annealing. cDNA exp ession lib a y cons uc ion To al RNA was isola ed om shoo s and oo s (sepa a ely) om Hasawi ice seedlings, subjec ed o 0, 15, 30 min, 2, 4, 8 o 12 hou s o sal s ess ea men (EC = 12 dSm-1 ≈ 120mM o NaCl), using he TRIzol me hod as desc ibed by he manu ac u e (In i ogen, CA, USA). A e mRNA pu i ica ion wi h he PolyAT ac mRNA Isola ion Sys em III (P omega, WI, USA), cDNA was syn hesized using 5 µg pu i ied mRNA (3.33 µg shoo mRNA and 1.66 µg oo mRNA) acco ding o he Hyb iZAP-2.1XR cDNA syn hesis ki manual (S a agene, CA, USA). The sal -induced cDNA exp ession lib a y was cons uc ed using he Hyb iZAP-2.1 ec o acco ding o he manu ac u e ’s ins uc ions. A e in i o excision and ampli ica ion o he excised phagemid, he cDNA lib a y was used o ans o m he yeas bai s ains. Cons uc ion o yeas bai s ains Yeas s ain Y187 (Clon ech, CA, USA) was used o gene a e di e en bai s ains con aining agmen s o he OsNHX1 p omo e d i ing he epo e gene His3. The OsNHX1 p omo e egion, up o 1.858 pb ups eam o he ansla ional s a codon, was di ided in i e o e lapping agmen s (See Supplemen al Fig. 4 o schema ic ep esen a ion and Supplemen al Table 5 o oligonucleo ides used o ampli y each agmen ). Each agmen was cloned in o he Xba I-Spe I es ic ion si es o he ec o pINT1-HIS3 and in eg a ed in o he Chap e III 93 Y187 yeas s ain (Ouwe ke k and Meije , 2001). OsNHX1 p omo e agmen s we e cloned ups eam o he His3 epo gene. Because some p omo e agmen s allow leaky exp ession o His3 epo gene, leading o yeas bai g ow h in medium lacking his idine, a 3-amino-1,2,4- iazole (3-AT) i a ion was pe o med o assess he minimal concen a ion o 3-AT equi ed o each p omo e agmen sequence. 3-AT is a compe i i e inhibi o o he His3 enzyme and will supp ess i s ac i i y (Ouwe ke k and Meije , 2001). Bai s ains we e i a ed in yeas Comple e Minimal medium lacking His idine (CM-His) and supplemen ed wi h inc easing concen a ions o 3-AT, up o 50 mM. Yeas ans o ma ion was pe o med using he li hium ace a e PEG me hod as desc ibed by Ouwe ke k and Meije (2001). Yeas -One-Hyb id sc eening and alida ion Yeas bai s ains we e ans o med wi h 1 µg o he cDNA exp ession lib a y. Fo each p omo e agmen , o e one million yeas colonies we e sc eened in CM-His supplemen ed wi h 5 o 50 mM 3-AT, as p e iously desc ibed (Ouwe ke k and Meije , 2001). The iden i ied clones we e e-s eaked on CM-His supplemen ed wi h 3-AT, o con i m g ow h. In o de o iden i y he p o ein in e ac ing wi h he bai in he Y1H sc eening, he plasmids om yeas colonies ha con inue o g ow h a e e-s eaking we e ampli ied by di ec PCR and sequenced, using speci ic p ime s o he cDNA lib a y plasmid (Supplemen al Table 6). Sequences we e used o sea ch o homology in he ice genome, using he BLAST algo i hm. Plasmids encoding ansc ip ion ac o s we e isola ed om yeas colonies and ampli ied in E. coli o e-sequence and e- ans o m in o all ou bai s ains o con i m binding speci ici y. Yeas cell spo ing Yeas bai s ains used in he Y1H sc eening we e ans o med wi h he indi idual plasmids encoding a ansc ip ion ac o , as desc ibed (Ouwe ke k and Meije , 2001), and g own on solid yeas Comple e Minimal medium supplemen ed Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 100 Fig. 2. T ansc ip ion ac o s iden i ied as binding o OsNHX1 p omo e . A - Schema ic ep esen a ion o OsNHX1 p omo e , di ided in o i e agmen s (F1, F2, F3, F4 and F5) used as bai s o Y1H sc eening. ATG is he ansla ion s a codon o OsNHX1. O al shapes ep esen TFs iden i ied as binding o he OsNHX1 p omo e agmen s. G ey- TCP, Black- CPP, Whi e- OsNIN-like. The TFs posi ions on he scheme do no ep esen he exac binding si es on OsNHX1 p omo e . The numbe s below he agmen s ep esen hei leng h. B - Schema ic ep esen a ion o he p o ein domains and loca ion in each TF. agmen s o he OsNHX1 p omo e ups eam he HIS3 epo e gene, which was hen ans o med in o yeas . The i e o e lapping agmen s (F1, F2, F3, F4 and F5) anged om 271 o 492 pb in size (Fig. 2A). The i e bai s ains (each agmen co esponds o one yeas bai s ain) we e used o sc een he ice sal s ess induced cDNA lib a y. Fo each bai s ain, a leas one million clones we e sc eened leading o he iden i ica ion o i e TFs binding o OsNHX1 p omo e . The iden i ied TFs belong o h ee dis inc TF gene amilies: one TCP, one CPP and h ee NIN-like amily (Table 1). Rela i e binding posi ion o he iden i ied TFs on he OsNHX1 p omo e is illus a ed in Figu e 2A. TCP was ound as binding o agmen F2 (-232 o -503 pb be o e ATG), CPP and A B Chap e III 101 Bai P omo e agmen leng h Gene locus Conse ed domain(s) TF Name Numbe o imes iden i ied in sc eening F2 -232pb o -503pb Os08g43160 TCP OsPCF2 6 Os05g43380 CXC OsCPP5 2 Os04g41850 RWP-RK PB1 OsNIN-like 2 1 Os01g13540 RWP-RK PB1 OsNIN-like 3 3 Os11g16290 RWP-RK PB1 OsNIN-like 4* 7 F3 F4 -457pb o -949pb -906pb o -1393pb one NIN-like we e ound o bind o agmen F3 (-457 o -949 pb be o e ATG) and wo NIN-like we e ound o bind o agmen F4 (-906 o -1396 pb be o e ATG). No TFs we e ound o bind o agmen F5. I was no possible o sc een agmen F1 as he leaky exp ession obse ed o he HIS3 epo e gene was impossible o con ol wi h 3-Amino-1,2,4- iazole (3-AT). The iden i ied TFs we e named acco ding o p e ious s udies: TCP (OsPCF2) (Kosugi and Ohashi, 1997), CPP (OsCPP5) (Yang e al., 2008), NIN-like (NIN-like 2, NIN-like 3) (Schause e al., 2005). Since Os11g16290 had no been p e iously epo ed, he e we named NIN- like 4 (Table 1). Table 1 shows he numbe o each agmen used as bai , he leng h o he p omo e agmen , he gene locus, he conse ed domain(s), he TF name, and he numbe o imes ha each iden i ied TF was ound in he Y1H sc eening. P o ein domain(s) o each iden i ied TF is shown in Figu e 2B. OsPCF2 p o ein has a TCP domain close o he N- e minus. OsCPP5 has, a he N- e minus, wo simila Cys eine- ich domains e med CXC ha a e sepa a ed by a sho in e - domain egion. The h ee NIN-like TF p o eins ha e highly simila domain s uc u es, all showing RWP-RK and PB1 domains close o he C- e minus. Table 1. T ansc ip ion ac o s iden i ied as binding o OsNHX1 p omo e and espec i e binding egion. TFs we e g ouped in h ee gene amilies acco ding o hei conse ed domains, TCP, CXC and RWP-RK PB1. TFs we e named acco ding o he s udies epo ed in he indica ed publica ions. *Os11g16290 had no been p e iously epo ed, he e we named NIN-like4. Gene locus is indica ed acco ding o he Rice Genome Anno a ion P ojec Da abase and Resou ce (Ouyang e al., 2007). Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 102 Fig. 3. Analysis o TF–OsNHX1 p omo e binding speci ici y and s eng h. All he ou yeas bai s ains used in he Y1H sc eening (F2, F3, F4 and F5) we e ans o med wi h all he iden i ied TF (pAD-GAL4-2.1::TF ec o s). CM+His indica es yeas Comple e Minimal medium supplemen ed wi h His idine, CM-His+3-AT indica es yeas Comple e Minimal medium lacking His idine and supplemen ed wi h inc easing amoun o 3- Amino-1,2,4- iazole (3-AT), a compe i i e inhibi o o he His3 epo gene p oduc . 3-AT concen a ions o 5, 10, 20, 30, 40, 50, 60 and 70 mM we e used. To u he alida e he in e ac ion be ween he TF p o ein and he OsNHX1 gene p omo e and o analyze hei speci ici y and binding s eng h, each bai s ain (F2, F3, F4, and F5) was ans o med wi h all he di e en TFs iden i ied (pAD-GAL4-2.1::TF) and g own unde di e en concen a ions o 3-AT. Di ec Yeas -One-Hyb id assays showed ha all iden i ied TFs only ac i a ed he exp ession o he His3 epo e gene when his was d i en by he p omo e agmen o iginally used as bai in he Y1H sc eenings (Fig. 3). OsPCF2 only binds o agmen F2 and shows he s onges binding ac i i y, allowing he espec i e yeas bai o g ow h up o 70 mM o 3-AT. Bo h OsCPP5 and NIN-like 2 bind speci ically o agmen F3, while NIN-like 3 and NIN-like 4 bo h bind speci ically o agmen F4. Cellula localiza ion o he TFs iden i ied as binding o OsNHX1 p omo e Nuclea localiza ion signals (NLS) we e p edic ed o each TF using cNLS Mappe (Kosugi e al., 2009) (Supplemen al Table 1). To de e mine he sub- cellula localiza ion o he iden i ied TFs, he plasmid 35S::GFP::TF was Chap e III 103 ansien ly ans o med in o onion epide mal cells. A e 24 h incuba ion, he GFP luo escence in onion cells ans o med wi h 35S::GFP (con ol) was de ec ed h oughou he cell (Fig. 4), bu in onions cells ans o med wi h 35S::GFP::OsPCF2 (Fig. 4) and 35S::GFP::OsCPP5 (Fig. 4) he GFP signal was clea ly es ic ed o he nucleus. Rega ding he 35S::GFP::NIN-like2, 35S::GFP::NIN-like 3 and 35S::GFP::NIN-like 4 ans o med onion cells, he signal we e de ec ed in he nucleus, bu also in he cy osol (Fig. 4). In o de o in es iga e whe he he cy osolic localiza ion was due o ni ogen s a a ion and/o i i could unde go e-localiza ion upon sal s ess, we ea ed he cells wi h 200 mM o KNO3 o 200 mM NaCl, bu i did no al e 35S::GFP::NIN-likes signal loca ion (da a no shown). T ansac i a ion ac i i y o he TFs iden i ied as binding o OsNHX1 p omo e The TF ansac i a ion ac i i y was assessed in ansien exp ession analyses in A abidopsis and ice p o oplas s. To assess TF ansac i a ion ac i i y, A abidopsis p o oplas s we e ans o med wi h he di e en epo e Fig. 4. Sub-cellula localiza ion o he iden i ied TFs. Onion epide mal cells we e bomba ded wi h 35S::GFP::TF o 35S::GFP and obse ed unde di e en ligh ields. A ow on b igh - ield indica es nucleus posi ion. Me ged images we e p epa ed wi h Image J so wa e. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 104 plasmids pLUCm35GUS-p omOsNHX1, each cons uc con aining a di e en OsNHX1 p omo e agmen : F2, F3 o F4, alone o in combina ion wi h he e ec o plasmid (con aining he TF d i en by he 35S p omo e ) (Fig. 5A). The exp ession o he GUS epo e gene was ound o be ep essed when OsCPP5 o OsNIN-like 2 e ec o plasmids we e co- ans ec ed wi h he espec i e epo e plasmids, e ealing ha bo h TFs ac as ep esso s (Fig. 5B). On he o he hand, he epo e gene was ac i a ed in he p esence o OsPCF2, OsNIN-like 3 o OsNIN-like 4, indica ing ha hese TFs ac as ac i a o s (Fig. 5B). To analyse he TF ansac i a ion ac i i y in ice p o oplas s, hese we e ans o med wi h he e ec o plasmid (con aining he TF d i en by he 35S p omo e ) and he ansc ip le el o he endogenous OsNHX1 assessed by RT- qPCR. When he OsCPP5, OsNIN-like 2 and OsNIN-like 3 TFs we e o e - exp essed in ice p o oplas s he ansc ip le el o OsNHX1 was down- egula ed (Fig. 5C), indica ing ha OsCPP5, OsNIN-like 2 and OsNIN-like 3 ac as ep esso s. On he o he hand, ice p o oplas s o e -exp essing OsPCF2 o OsNIN-like 4 showed an induced OsNHX1 gene exp ession, indica ing ha OsPCF2 o OsNIN-like 4 ac as ac i a o s. The ansc ip le el o he TFs o e - exp essed in ice p o oplas was also de e mined (Supplemen al Fig. 2A). In o de o in es iga e how he TFs binding o he some p omo e agmen ac oge he , we ha e ans o med ice p o oplas s wi h OsCPP5 plus OsNIN-like 2 (binding o agmen F3) and OsNIN-like 3 plus OsNIN-like 4 (binding o agmen F4). Co- ans o ma ion o OsCPP5 and OsNIN-like 2 esul ed in an OsNHX1 down- egula ion simila o ha obse ed o he indi idual TFs (Fig. 5 D), indica ing ha hey do ha e an addi i e e ec . Co- ans o ma ion o OsNIN-like 3 and OsNIN-like 4 did no al e OsNHX1 gene exp ession (Fig. 5D), indica ing ha hei opposi e ansac i a ion ac i i y (ac i a o s ep esso ) esul s in a non e ec . When ice p o oplas s we e co- ans o med wi h wo TFs, he ansc ip le el ob ained o each TF was also de e mined (Supplemen al Fig. 2B). A C Chap e III 105 Fig 5. T ansac i a ion ac i i y o he i e TFs iden i ied as binding o he OsNHX1 p omo e . A- Cons uc s used o he ansac i a ion assays. E ec o cons uc s used co espond o he TF coding egion unde he con ol o he ull CaMV35S p omo e . Repo e cons uc s con ain he GUS gene d i en by he minimal CaMV 35S p omo e (m35S) plus he agmen o he OsNHX1 p omo e (p omOsNHX1) used as bai in he Y1H sc eening (F2, F3 o F4). The LUC gene exp ession unde he con ol o he ull 35S p omo e was used o no malize GUS exp ession le els; B- T ansac i a ion ac i i y assays pe o med in A abidopsis p o oplas s and shown as a GUS/LUC ac i i y a io o OsPCF2, OsCPP5 and he h ee OsNIN-like genes (2, 3 and 4). A abidopsis p o oplas s we e ans o med wi h he espec i e TF and epo e s cons uc ions. Ba s indica e GUS/LUC a io ± SD (n = 3); C - Analysis o OsNHX1 gene exp ession in ice p o oplas s ansien ly o e exp essing indi idual TFs, using he e ec o cons uc ions shown in panel A; D- Analysis o OsNHX1 gene exp ession in ice p o oplas s ansien ly o e exp essing TF combina ions: OsCPP5 + OsNIN-like 2 and OsNIN-like 3 + OsNIN-like 4 TFs. In bo h C and D, we ha e compa ed OsNHX1 gene exp ession in ans o med p o oplas s (OX-TF) e sus non- ans o med p o oplas s. Ubiqui in-conjuga ing enzyme E2 and Euka yo ic elonga ion ac o 1-α we e used as housekeeping genes o no maliza ion. Values a e means ± SD (n = 3). *Di e ences be ween epo and epo plus e ec o cons uc (B), and non- ans o med and OX-TF (C-D), wi hin same analyzed gene, a e s a is ically signi ican ( - es , p < 0.05). B D A B C B 35S::OsPCF2 35S::OsCPP5 35S::OsNIN-like 2 35S::OsNIN-like 3 35S::OsNIN-like 4 pLUCm35GUS-p omOsNHX1(F2/F3/F4) E ec o cons uc Repo cons uc A C B B A C B C Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 106 Exp ession o he TF genes in ice seedlings subjec ed o sal o PEG-simula ed d ough s ess To in es iga e whe he he i e iden i ied TFs ha e a ole on plan sal s ess esponse, we analyzed he exp ession p o ile o OsNHX1 and TF encoding genes in wo ice geno ypes wi h con as ing sal s ess ole ance, Nipponba e (sal -suscep ible) (Fe dose e al., 2009) and Hasawi (sal - ole an ) (Zhang e al., 2012), subjec ed o sal s ess ea men . OsNHX1 was highly induced unde sal s ess, in bo h geno ypes in ei he shoo s o oo s (Fig. 6). In shoo s, OsNHX1 exp ession was sligh ly highe induced in Hasawi as compa ed o Nipponba e, eaching a peak a 2 h and 4 h a e s ess ini ia ion, espec i ely (Fig. 6). In oo s, ac i a ion o OsNHX1 gene exp ession was singula o each geno ype; in Nipponba e, OsNHX1 was ea ly induced by s ess, and he high OsNHX1 ansc ip le el was de ec ed up o 4 h a e s ess, whe eas in Hasawi OsNHX1 was g adually induced du ing he s ess, eaching a peak also a 4 h (Fig. 6). In e es ingly, OsNHX1 ansc ip le el shows a s ess-dose-dependen exp ession pa e n; s onge sal s ess condi ions lead o a highe OsNHX1 ansc ip le el induc ion (200 mM NaCl in Fig. 6 as compa ed o 120 mM in Fig. 1). Conce ning he gene exp ession o he TFs in shoo s, mos TF genes we e no clea ly egula ed unde sal s ess (Fig. 6). The excep ion was OsPCF2, which was up- egula ed a 15 min and 30 min and hen a down egula ion was obse ed in bo h ice a ie ies. In con as , in oo s, mos TFs we e clea ly up- egula ed unde sal s ess in bo h geno ypes (Fig. 6). In bo h Nipponba e and Hasawi he TF genes we e induced a an ea ly s age, howe e while in Nipponba e he highe gene exp ession le el was de ec ed up o 2 - 4 h a e s ess, in Hasawi TF gene exp ession eached a peak a 30 min and hen a p og essi e down- egula ion was obse ed o mos genes (Fig. 6). In e es ingly, OsPCF2 esponse unde sal s ess was geno ype speci ic. OsPCF2 was highly induced in Hasawi oo s unde s ess, while in Nipponba e he TF ansc ip le el was no al e ed unde sal s ess (Fig. 6). I is wo h no ing ha in oo s he cons i u i e le els o OsNHX1 Chap e III 107 and TF (wi h he excep ion o OsPCF2) ansc ip s a e highe in Hasawi as compa ed o Nipponba e (Supplemen al Fig. 3). This may explain why he up- egula ion o OsNHX1 ansc ip le el in oo s 15 min a e ea men was s onge in Nipponba e. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 108 In o de o u he cha ac e ize he unc ion o he iden i ied TFs, we ha e also analyzed he exp ession p o ile o OsNHX1 and TF genes in Nipponba e (d ough -suscep ible) (Degenkolbe e al., 2009) and Hasawi (d ough - ole an ) (Zhang e al., 2012) geno ypes unde PEG-simula ed d ough s ess (Fig. 7). OsNHX1 was highly induced by PEG, in bo h geno ypes in ei he shoo s o oo s (Fig. 7). In shoo s, he OsNHX1 ansc ip le el up- egula ion was highe in Nipponba e han in Hasawi, in bo h cases eaching a peak a 4 h a e s ess ini ia ion (Fig. 7). In oo s, OsNHX1 ansc ip le el was up egula ed a leas up o 8 h a e ea men and his up- egula ion was also highe in Nipponba e han in Hasawi (Fig. 7). I is no ewo hy ha PEG ea men showed s onge OsNHX1 induc ion han sal s ess, ei he in shoo s o oo s in bo h geno ypes analysed (Fig. 6 and Fig. 7). In addi ion, he OsNHX1 ansc ip le el up- egula ion by PEG in he shoo s (as compa ed o oo s) was pa icula ly high in bo h geno ypes, indica ing ha OsNHX1 may play an impo an ole in he shoo esponse o PEG- simula ed d ough s ess. Fig. 6. Analysis o gene exp ession in wo ice geno ypes, Nipponba e (sal -suscep ible) and Hasawi (sal - ole an ) subjec ed o sal s ess. The exp ession o he genes OsNHX1, OsPCF2, OsCPP5, OsNIN-like 2, OsNIN-like 3, and OsNIN-like 4 was analyzed in oo s and shoo s by RT-qPCR. Twel e-day-old seedlings we e subjec ed o sal s ess (EC = 20 dS/m, ≈ 200 mM o NaCl) o con ol condi ions (no sal added) o 0, 15, 30 min, 2, 4, o 8 h (s a ing 3 h a e he beginning o he pho ope iod). Ubiqui in-conjuga ing enzyme E2 and Euka yo ic elonga ion ac o 1-α we e used as housekeeping genes o no maliza ion. Values a e means ± SD (n = 3). C C D Chap e III 109 Rega ding gene exp ession in Hasawi shoo s unde PEG ea men , TF genes we e weakly induced (OsPCF2, OsNIN-like 4 and OsCPP5) o no clea ly egula ed (OsNIN-like 2 and OsNIN-like 3) (Fig. 7). OsPCF2, OsNIN-like 4 and OsCPP5 eached an up- egula ion peak, a 30 min, 2 h and 8 h a e s ess ini ia ion, espec i ely (Fig. 7). In Nipponba e shoo s, PEG ea men highly induced mos TF genes, which eached an ac i a ion peak 4 h a e s ess ini ia ion (Fig. 7). The excep ion was OsPCF2, which was weakly up- egula ed a 15 and 30 min a e s ess ini ia ion and hen down- egula ed, simila o wha was obse ed in Hasawi shoo s (Fig. 7). Conce ning he TF gene exp ession in Hasawi oo s unde PEG ea men , mos o he TF genes we e sligh ly down- egula ed a 15 min and 30 min a e hype osmo ic s ess ini ia ion (Fig. 7). The excep ion was OsNIN-like 4, which was highly up- egula ed by PEG, eaching a peak a 30 min a e s ess ini ia ion (Fig. 7). In he oo s o Nipponba e, hype osmo ic s ess did no clea ly egula e mos o TF genes (Fig. 7). The excep ions we e OsNIN-like 4 and OsPCF2, which we e sligh ly up- egula ed, eaching a peak a 30 min and 4 h a e he s ess ini ia ion, espec i ely (Fig. 7). Al hough, unde con ol condi ions (Supplemen al Fig. 3), OsNIN-like 4 ansc ip le el is highe in Hasawi as compa ed o Nipponba e, and i s up- egula ion unde hype osmo ic s ess was highe in Hasawi han Nipponba e (Fig. 7). Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 116 oo s. The OsPCF2 gene was highly induced by sal s ess in Hasawi oo s, bu in Nipponba e i was no egula ed by sal s ess. This esul sugges s ha OsPCF2 esponse unde sal s ess may be associa ed wi h Hasawi sal s ess ole ance. The ansc ip le el o OsNHX1 and TF genes was also analyzed in Nipponba e and Hasawi seedlings subjec ed o PEG-simula ed d ough s ess. T ea men wi h PEG highly inc eased he ansc ip le els o OsNHX1 in shoo s and oo s o bo h geno ypes. Howe e , he ansc ip le el o mos TFs binding o OsNHX1 p omo e was no clea ly modula ed by PEG, sugges ing a mode a e ole o hese TFs egula ing OsNHX1 gene exp ession in esponse o PEG-simula ed d ough . Ne e heless, we canno ule ou ha hese TFs a e egula ed a a pos - ansla ional le el. The excep ion was OsNIN-like 4, which was highly induced by PEG in Hasawi oo s, bu in Nipponba e i was only weakly up- egula ed. This esul sugges s ha OsNIN-like 4 may be associa ed wi h Hasawi d ough s ess ole ance. Globally, we can say ha he mos s iking ansc ip ional egula ion o he TFs binding o OsNHX1 was obse ed in oo s o bo h geno ypes subjec ed o sal s ess. Gi en he ansac i a ion ac i i y o he TFs binding o he OsNHX1 p omo e , hei gene exp ession pa e n did no always co ela e wi h he OsNHX gene exp ession. Ne e heless, his appa en lack o co ela ion does no mean ha hey a e no impo an o OsNHX1 gene exp ession, as hey a e no he only playe s. In euka yo es, egula ion o gene exp ession by ansc ip ion ac o s equi es coo dina ed in e ac ions o mul iple TFs, ch oma in modi ie s, and co ac o p o eins, which bind oge he and assemble upon he egula o y egions o DNA o egula e ansc ip ion (Fedo o a and Zink, 2008). Iden i ica ion o o he p o eins in e ac ing wi h hese TFs is essen ial o be e unde s and OsNHX1 ansc ip ional egula ion unde s ess. The induc ion o OsNHX1 ansc ip le els unde sal s ess was obse ed o be dose-dependen . T ea men wi h 200 mM NaCl [≈ -1000 KPa solu e po en ial, Maggio e al. (2006)] has a much s onge e ec on he induc ion o OsNHX1 ansc ip le el han wi h 120 mM NaCl [≈ -600 KPa solu e po en ial, Maggio e al. (2006)]. This ag ees wi h p e ious epo s (Fukuda e al., 2011) and Chap e III 117 sugges s ha highe OsNHX1 ansc ip ional esponse obse ed unde s onge sal s ess ea men may be associa ed wi h an inc eased osmo ic s ess e ec . Ne e heless, highe OsNHX1 ansc ip le el due o inc eased Na+ concen a ion canno be uled ou . The ea ly TF up egula ion unde sal s ess in oo s, wi hin 15 min, may no be associa ed wi h he osmo ic e ec , as he hype osmo ic s ess ea ly down- egula ed mos o TF ansc ip s in Hasawi o did no clea ly egula e TF ansc ip s in Nipponba e. Excep ionally, OsNIN-like 4 ansc ip s we e ea ly up- egula ed in Hasawi and Nipponba e oo s unde hype osmo ic s ess, wi hin 15 min and 30min, espec i ely. In his case, he OsNIN-like 4 ea ly induc ion unde sal s ess may be associa ed wi h he osmo ic e ec . The ac ha OsNHX1 gene exp ession is modula ed by salini y and PEG sugges s ha ansc ip ional egula ion o his gene is a componen o he plan s ess esponse. Analysis o he OsNHX1 p omo e om Hasawi (up o 1.858 pb om ups eam o he ansla ional s a codon) un eiled se e al ABA- esponsi e elemen s (ABREs) as well as MYC/MYB (myelocy oma osis/myeloblas osis oncogenes) in e ac ing elemen s (Supplemen al Table 3). ABA was shown o induce OsNHX1 gene exp ession (da a no shown). So a , only wo publica ions epo ed NHX1 ansc ip ional egula o s (Adle e al., 2010; Liu e al., 2014). OsbZIP71 was iden i ied by Liu e al. (2014) in sea ches using he plan ansc ip ion ac o da abases (plan db.cbi.pku.edu.cn) and shown o di ec ly in e ac wi h OsNHX1 p omo e in i o. OsbZIP71 gene exp ession was shown o be induced by d ough as well as by PEG-simula ed d ough , bu ep essed by sal ea men . Adle e al. (2010) iden i ied a MYB cis- egula o y elemen in ol ed in he ac i a ion o Be a ulga is (suga bee ) NHX1 exp ession upon sal and d ough s esses. The na u e o he MYB p o ein(s) ha modula e he ac i i y o B NHX1 is ye o be desc ibed. Despi e se e al ABREs and MYC/MYB-in e ac ing elemen s p esen in OsNHX1 p omo e (Supplemen al Table 3) we nei he iden i ied OsbZIP71 no a MYB TF. The ac ha OsbZIP71 is ep essed by sal s ess (Liu e al., 2014) and since a sal -induced cDNA exp ession lib a y was used in ou Y1H sc eening may explain why OsbZIP71 was no iden i ied in ou Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 118 s udies. Rega ding he MYC/MYB-in e ac ing elemen s, hey a e also p esen in he OsNHX1 p omo e , howe e , and ega dless ou sa u a ed Y1H sc eenings, we did no iden i y any MYB TF. Unde d ough and sal s ess condi ions, NHX1 may play a p o ec i e ole h ough he acuole compa men aliza ion o K+ and/o Na+, a oiding oxic K+/Na+ a ios in he cy osol while acqui ing solu es o osmo ic wa e up ake (Leidi e al. 2010; Bassil and Blumwald 2014; Jiang e al., 2010). The biological ole o he iden i ied TFs egula ing OsNHX1 migh be associa ed wi h he main unc ion o NHX1, gene a ion o u go o d i e cell expansion. A abidopsis class I TCPs (A TCP14, A TCP15 and A TCP20) ha e been sugges ed o play a ole in cell di ision, g ow h and expansion (Manasse o e al., 2013). Al hough only a ew NIN- like TFs ha e been unc ionally cha ac e ized, A NIN-like 7 has been shown o be a posi i e egula o o NO-3 anspo e s. NO3- is equi ed o main enance o cha ge balance and o ac as osmoly e in ol ed in cell u go gene a ion and main enance (Cas aings e al., 2009; Ta a es e al., 2011). Also, he A TSO1 p o ein (CPP amily) has been associa ed o cell di ision and cell expansion by a unclea mechanism (Hause e al., 2000). Globally, he TFs iden i ied in his wo k may be pa o a complex ne wo k con olling plan cell u go and expansion, hus media ing abio ic s ess e ec s on plan g ow h and de elopmen . ACKNOWLEDGMENTS Diego M. Almeida pe o med he expe imen al wo k. The planning o he esea ch wo k and discussion o esul s was done by Diego Almeida, Glenn B. G ego io, Nelson Saibo and M. Ma ga ida Oli ei a. We would like o hank Tânia Se a and Tiago Lou enço o ad ice ega ding Y1H sys em and M. Cecília Almadanim o he ad ice ega ding p o ein localiza ion. Chap e III 119 REFERENCES Adle G., Blumwald E., Ba -Z i D. (2010) The suga bee gene encoding he sodium/p o on exchange 1 (B NHX1) is egula ed by a MYB ansc ip ion ac o . Plan a 232:187-95. DOI: 10.1007/s00425-010-1160- 7. Almeida D.M., Almadanim M.C., Lou enço T., Ab eu I.A., Saibo N.J., Oli ei a M.M. (2016) Sc eening o abio ic s ess ole ance in ice: sal , cold and d ough , in: D. P (Ed.), En i onmen al Responses in Plan s, Me hods in Molecula Biology, Sp inge , New Yo k, NY, USA. DOI: 10.1007/978-1- 4939-3356-3_14. And és Z., Pe ez-Ho maeche J., Leidi E.O., Schlucking K., S einho s L., McLachlan D.H., Schumache K., He he ing on A.M., Kudla J., Cube o B., Pa do J.M. (2014) Con ol o acuola dynamics and egula ion o s oma al ape u e by onoplas po assium up ake. P oc Na l Acad Sci U S A 111:E1806-14. DOI:10.1073/pnas.1320421111. An hony R.G., Hen iques R., Hel e A., Mesza os T., Rios G., Tes e ink C., Munnik T., Deak M., Koncz C., Bog e L. (2004) A p o ein kinase a ge o a PDK1 signalling pa hway is in ol ed in oo hai g ow h in A abidopsis. EMBO J 23:572-81. DOI: 10.1038/sj.emboj.7600068. Apse M.P., So osan o J.B., Blumwald E., (2003) Vacuola ca ion/H+ exchange, ion homeos asis, and lea de elopmen a e al e ed in a T-DNA inse ional mu an o A NHX1, he A abidopsis acuola Na+/H+ an ipo e . The Plan Jou nal 36: 229-239. DOI: 10.1046/j.1365-313X.2003.01871.x. Ba agán V., Leidi E.O., And és Z., Rubio L., De Luca A., Fe nández J.A., Cube o B., Pa do J.M. (2012) Ion exchange s NHX1 and NHX2 media e ac i e po assium up ake in o acuoles o egula e cell u go and s oma al unc ion in A abidopsis. Plan Cell 24:1127-42. DOI: 10.1105/ pc.111.095273. Bassil E., Blumwald E. (2014) The ins and ou s o in acellula ion homeos asis: NHX- ype ca ion/H+ anspo e s. Cu Opin Plan Biol 22:1-6. DOI:10.1016/j.pbi.2014.08.002. Bassil E., Coku A., Blumwald E. (2012) Cellula ion homeos asis: eme ging oles o in acellula NHX Na+/H+ an ipo e s in plan g ow h and de elopmen . J Exp Bo 63:5727-40. DOI: 10.1093/jxb/e s250. Bassil E., Tajima H., Liang Y.C., Oh o M.A., Ushijima K., Nakano R., Esumi T., Coku A., Belmon e M., Blumwald E. (2011a) The A abidopsis Na+/H+ an ipo e s NHX1 and NHX2 con ol acuola pH and K+ homeos asis o egula e g ow h, lowe de elopmen , and ep oduc ion. Plan Cell 23:3482-97. DOI: 10.1105/ pc.111.089581. Bassil E., Oh o M.A., Esumi T., Tajima H., Zhu Z., Cagnac O., Belmon e M., Peleg Z., Yamaguchi T., Blumwald E. (2011b) The A abidopsis in acellula Na+/H+ an ipo e s NHX5 and NHX6 a e endosome associa ed and necessa y o plan g ow h and de elopmen . Plan Cell 23:224-39. DOI: 10.1105/ pc.110.079426. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 120 Cas aings L., Ma chi e C., Meye C., K app A. (2011) Ni ogen signalling in A abidopsis: how o ob ain insigh s in o a complex signalling ne wo k. J Exp Bo . 62:1391-7. DOI: 10.1093/jxb/e q375. Cas aings L., Cama go A., Pocholle D., Gaudon V., Texie Y., Bou e -Me cey S., Taconna L., Renou J.P., Daniel-Vedele F., Fe nández E., Meye C., K app A. (2009) The nodule incep ion-like p o ein 7 modula es ni a e sensing and me abolism in A abidopsis. Plan J 57:426-35. DOI: 10.1111/j.1365-313X.2008.03695.x. Cubas P., Lau e N., Doebley J., Coen E. (1999) The TCP domain: a mo i ound in p o eins egula ing plan g ow h and de elopmen . The Plan Jou nal 18:215-222. C i anich C., Pallisgaa d N., Nielsen K.A., Hansen A.C., La sen K., Pihakaski- Maunsbach K., Ma cke K.A., Jensen E.O. (2000) CPP1, a DNA-binding p o ein in ol ed in he exp ession o a soybean leghemoglobin c3 gene. P oc Na l Acad Sci U S A 97:8163-8. DOI: 10.1073/pnas.090468497. Degenkolbe T., Do P.T., Zu he E., Repsilbe D., Wal he D., Hincha D.K., Köhl K.I. (2009) Exp ession p o iling o ice cul i a s di e ing in hei ole ance o long- e m d ough s ess. Plan Mol Biol. 2:133-153. DOI: 10.1007/s11103-008-9412-7. Djanagui aman M., P asad P.V.V. (2012) E ec s o Salini y on Ion T anspo , Wa e Rela ions and Oxida i e Damage, in: SPRINGER-VERLAG NEW YORK INC. (Ed), Ecophysiology And Responses O Plan s Unde Sal S ess, Sp inge , New Yo k, NY, USA. Fe dose J., Kawasaki M., Taniguchi M., Miyake H. (2009) Di e en ial sensi i i y o ice cul i a s o salini y and i s ela ion o ion accumula ion and oo ip s uc u e. Plan P od. Sci. 4: 453-461. DOI: 10.1626/pps.12.453. Figuei edo D.D., Ba os P.M., Co dei o A.M., Se a T.S., Lou enço T., Chande S., Oli ei a M.M., Saibo N.J. (2012) Se en zinc- inge ansc ip ion ac o s a e no el egula o s o he s ess esponsi e gene OsDREB1B. J Exp Bo 63:3643-56. DOI: 10.1093/jxb/e s035. Fukuda A., Nakamu a A., Tanaka Y. (1999) Molecula cloning and exp ession o he Na+/H+ exchange gene in O yza sa i a. Biochim Biophys Ac a 1446:149-55. DOI: 10.1016/S0167-4781(99)00065-2. Fukuda A., Nakamu a A., Ha a N., Toki S., Tanaka Y. (2011) Molecula and unc ional analyses o ice NHX- ype Na+/H+ an ipo e genes. Plan a 233:175-88. DOI: 10.1007/s00425-010-1289-4. Gao J.-P., Chao D.-Y., Lin H.-X. (2007) Unde s anding abio ic s ess ole ance mechanisms: Recen s udies on s ess esponse in ice. Jou nal o In eg a i e Plan Biology 49:742–750. DOI: 10.1111/j.1744- 7909.2007.00495.x. Gaxiola R.A., Rao R., She man A., G isa i P., Alpe S.L., Fink G.R. (1999) The A abidopsis haliana p o on anspo e s, A Nhx1 and A p1, can unc ion in ca ion de oxi ica ion in yeas . P oc Na l Acad Sci U S A 96:1480-5. DOI: 10.1073/pnas.96.4.1480. Chap e III 121 Gaxiola R.A., Li J., Undu aga S., Dang L.M., Allen G.J., Alpe S.L., Fink G.R. (2001) D ough - and sal - ole an plan s esul om o e exp ession o he AVP1 H+-pump. P oc Na l Acad Sci U S A 98:11444-9. DOI: 10.1073/pnas.191389398. Gong Q., Li P., Ma S., Indu R.S., Bohne H.J. (2005) Salini y s ess adap a ion compe ence in he ex emophile Thellungiella halophila in compa ison wi h i s ela i e A abidopsis haliana. Plan J. 445: 826-39. DOI: 10.1111/j.1365-313X.2005.02587.x. G ego io G.B. (1997) Tagging salini y ole ance genes in ice using ampli ied agmen leng h polymo phism (AFLP), PhD. hesis, Uni e si y o he Philippines, Los Baños. pp. 118 G ego io G.B., Senadhi a D., Mendoza R.D. (1997) Sc eening ice o salini y ole ance. IRRI Discussion Pape Se ies Nº22. G ego io G.B., Senadhi a D. (1993) Gene ic analysis o salini y ole ance in ice (O yza sa i a L.). Theo Appl Gene 86:333-8. DOI: 10.1007/BF00222098. G ego io G.B., Senadhi a D., Mendoza R.D., Manigbas N.L., Roxas J.P., Gue a C.Q. (2002) P og ess in b eeding o salini y ole ance and associa ed abio ic s esses in ice. Field C ops Resea ch 76:91–101. DOI: 10.1016/S0378-4290(02)00031-X. Hamada A., Shono M., Xia T., Oh a M., Hayashi Y., Tanaka A., Hayakawa T. (2001). Isola ion and cha ac e iza ion o a Na+/H+ an ipo e gene om he halophy e A iplex gmelini. Plan Mol Biol. 46:35-42. DOI: 10.1023/A:1010603222673. Hause B., He J., SO P., Gasse C. (2000) TSO1 is a no el p o ein ha modula es cy okinesis and cell expansion in A abidopsis. De elopmen 127::2219- 26. Jiang X., Leidi E.O., Pa do J.M. (2010) How do acuola NHX exchange s unc ion in plan sal ole ance? Plan Signal Beha .:792–795. DOI: 10.4161/psb.5.7.11767. Jin J., Zhang H., Kong L., Gao G., Luo J. (2014) Plan TFDB 3.0: a po al o he unc ional and e olu iona y s udy o plan ansc ip ion ac o s. Nucleic Acids Res 42:D1182-7. DOI: 10.1093/na /gk 1016. Konishi M., Yanagisawa S. (2011) Roles o he ansc ip ional egula ion media ed by he ni a e- esponsi e cis-elemen in highe plan s. Biochem Biophys Res Commun 411:708-13. DOI: 10.1016/j.bb c.2011.07.008. Konishi M., Yanagisawa S. (2013) A abidopsis NIN-like ansc ip ion ac o s ha e a cen al ole in ni a e signalling. Na Commun. 4. DOI: 10.1038/ncomms2621. Kosugi S., Ohashi Y. (1997) PCF1 and PCF2 speci ically bind o cis elemen s in he ice p oli e a ing cell nuclea an igen gene. Plan Cell 9:1607-19. DOI: 10.1105/ pc.9.9.1607. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 122 Kosugi S., Ohashi Y. (2002) DNA binding and dime iza ion speci ici y and po en ial a ge s o he TCP p o ein amily. Plan J 30:337-48. DOI: 10.1046/j.1365-313X.2002.01294.x. Kosugi S., Hasebe M., Tomi a M., Yanagawa H. (2009) Sys ema ic iden i ica ion o cell cycle-dependen yeas nucleocy oplasmic shu ling p o eins by p edic ion o composi e mo i s. P oc Na l Acad Sci U S A 106:10171-6. DOI: 10.1073/pnas.0900604106. Kuma i S., Sabha wal V.P., Kushwaha H.R., Sopo y S.K., Singla-Pa eek S.L., Pa eek A. (2009) T ansc ip ome map o seedling s age speci ic salini y s ess esponse indica es a speci ic se o genes as candida e o saline ole ance in O yza sa i a L. Func In eg Genomics 9:109-23. DOI: 10.1007/s10142-008-0088-5. Leidi E.O., Ba agán V., Rubio L., El-Hamdaoui A., Ruiz M.T., Cube o B., Fe nández J.A., B essan R.A., Hasegawa P.M., Quin e o F.J., Pa do J.M. (2010) The A NHX1 exchange media es po assium compa men a ion in acuoles o ansgenic oma o. Plan J 61:495-506. DOI: 10.1111/j.1365-313X.2009.04073.x. Li C., Po uschak T., Colon-Ca mona A., Gu ie ez R.A., Doe ne P. (2005) A abidopsis TCP20 links egula ion o g ow h and cell di ision con ol pa hways. P oc Na l Acad Sci U S A 102:12978-83. DOI: 10.1073/pnas.0504039102. Liu C., Mao B., Ou S., Wang W., Liu L., Wu Y., Chu C., Wang X. (2014) OsbZIP71, a bZIP ansc ip ion ac o , con e s salini y and d ough ole ance in ice. Plan Mol Biol 84:19-36. DOI: 10.1007/s11103-013- 0115-3. Liu P., Yang G.-D., Li H., Zheng C.-C., Wu C.-A. (2010) O e exp ession o NHX1 in ansgenic A abidopsis enhances pho op o ec ion capaci y in high salini y and d ough condi ions. Ac a Physiologiae Plan a um 32:81-90. DOI: 10.1007/s11738-009-0383-3. Liu Z., Running M.P., Meye owi z E.M. (1997) TSO1 unc ions in cell di ision du ing A abidopsis lowe de elopmen . De elopmen 124:665-72. Manasse o N.G.U., Viola I.L., Welchen E., Gonzalez D.H. (2013) TCP ansc ip ion ac o s: a chi ec u e o plan s o m. Biomol Concep s. 4:111- 27. DOI: 10.1515/bmc-2012-0051. Ma chi e C., Roudie F., Cas aings L., B ehau V., Blonde E., Colo V., Meye C., K app A. (2013) Nuclea e en ion o he ansc ip ion ac o NLP7 o ches a es he ea ly esponse o ni a e in plan s. Na Commun 4:1713. DOI: 10.1038/ncomms2650. Ma ínez-A ienza J., Jiang X., Ga ciadeblas B., Mendoza I., Zhu J-K., Pa do J.M., Quin e o F.J. (2007) Conse a ion o he Sal O e ly Sensi i e Pa hway in Rice. Plan Physiol. 143:2. DOI: 10.1104/pp.106.092635. Michael G., And é L. (2002) Global impac o salini y and ag icul u al ecosys ems, in: A. Läuchli and U. Lü ge (Eds.), Salini y: En i onmen - Plan s - Molecules Kluwe Academic Publishe s. pp. 3-20 Chap e III 123 Mohammadi-Nejad G., A zani A., Reza A.M., Singh R.K., G ego io G.B. (2008) Assessmen o ice geno ypes o sal ole ance using mic osa elli e ma ke s associa ed wi h he sal ol QTL. A ican Jou nal o Bio echnology. 6: 730-736. Munns R., Tes e M. (2008) Mechanisms o salini y ole ance. Annu Re Plan Biol 59:651-81. DOI: 10.1146/annu e .a plan .59.032607.092911. Neg ão S., Almadanim M.C., Pi es I.S., Ab eu I.A., Ma oco J., Cou ois B., G ego io G.B., McNally K.L., Oli ei a M.M. (2013) New allelic a ian s ound in key ice sal - ole ance genes: an associa ion s udy. Plan Bio echnology Jou nal 11:87–100 DOI: 10.1111/pbi.12010. Oh a M., Hayashi Y., Nakashima A., Hamada A., Tanaka A., Nakamu a T., Hayakawa T. (2002) In oduc ion o a Na+/H+ an ipo e gene om A iplex gmelini con e s sal ole ance o ice. FEBS Le 532:279-82. DOI: 10.1016/S0014-5793(02)03679-7. Ouwe ke k P.B., Meije A.H. (2001) Yeas one-hyb id sc eening o DNA-p o ein in e ac ions. Cu P o oc Mol Biol Chap e 12:Uni 12 12. DOI: 10.1002/0471142727.mb1212s55. Ouyang S., Zhu W., Hamil on J., Lin H., Campbell M., Childs K., Thibaud-Nissen F., Malek R.L., Lee Y., Zheng L., O is J., Haas B., Wo man J., Buell C.R. (2007) The TIGR Rice Genome Anno a ion Resou ce: imp o emen s and new ea u es. Nucleic Acids Res 35:D883-7. DOI: 10.1093/na /gkl976. Pi es I.S., Neg ão S., Oli ei a M.M., Pu ugganan M.D. (2015) Comp ehensi e pheno ypic analysis o ice (O yza sa i a) esponse o salini y s ess. Physiol Plan . DOI: 10.1111/ppl.12356. Regue a M., Bassil E., Tajima H., Wimme M., Chanoca A., O egui M.S., Pa is N., Blumwald E. (2015) pH Regula ion by NHX-Type An ipo e s Is Requi ed o Recep o -Media ed P o ein T a icking o he Vacuole in A abidopsis. Plan Cell 27:1200-17. DOI: 10.1105/ pc.114.135699. Rod íguez-Rosales M.P., Gal ez F.J., Hue as R., A anda M.N., Baghou M., Cagnac O., Venema K. (2009) Plan NHX ca ion/p o on an ipo e s. Plan Signal Beha 4:265-76. Roy S.J., Neg ão S., Tes e M. (2014) Sal esis an c op plan s. Cu Opin Bio echnol 26:115-24. DOI: 10.1016/j.copbio.2013.12.004. San os A.P., Se a T., Figuei edo D.D., Ba os P., Lou enço T., Chande S., Oli ei a M.M., Saibo N.J. (2011) T ansc ip ion egula ion o abio ic s ess esponses in ice: a combined ac ion o ansc ip ion ac o s and epigene ic mechanisms. OMICS 15:839-57. DOI: 10.1089/omi.2011.0095. Schause L., Wieloch W., S ougaa d J. (2005) E olu ion o NIN-like p o eins in A abidopsis, ice, and Lo us japonicus. J Mol E ol 60:229-37. DOI: 10.1007/s00239-004-0144-2. Iden i ica ion and Cha ac e iza ion o Fi e No el T ansc ip ions Fac o s Regula ing OsNHX1 Exp ession in a Sal ole an Rice Geno ype 124 Schause L., Roussis A., S ille J., S ougaa d J. (1999) A plan egula o con olling de elopmen o symbio ic oo nodules. Na u e 402:191-5. DOI: 10.1038/46058. Schmi F., C eme S., Gauba z S. (2009) LIN54 is an essen ial co e subuni o he DREAM/LINC complex ha binds o he cdc2 p omo e in a sequence- speci ic manne . FEBS J. 219:5703-16. DOI: 10.1111/j.1742- 4658.2009.07261. So okin A.V., Kim E.R., O chinniko L.P. (2007) Nucleocy oplasmic anspo o p o eins. Biochemis y (Mosc) 72:1439-57. DOI: 10.1134/S0006297907130032. So osan o J.B., Gelli A., Blumwald E. (2004) DNA a ay analyses o A abidopsis haliana lacking a acuola Na+/H+ an ipo e : impac o A NHX1 on gene exp ession. The Plan Jou nal 40: 752-771. DOI: 10.1186/1471-2229-7- 18. Ta a es B., Domingos P., Dias P.N., Feijo J.A., Bicho A. (2011) The essen ial ole o anionic anspo in plan cells: he pollen ube as a case s udy. J Exp Bo 62:2273-98. DOI: 10.1093/jxb/e 036. Walia H., Wilson C., Zeng L., Ismail A.M., Condamine P., Close T.J. (2007) Genome-wide ansc ip ional analysis o salini y s essed japonica and indica ice geno ypes du ing panicle ini ia ion s age. Plan Mol Biol 63:609-23. DOI: 10.1007/s11103-006-9112-0. Walia H., Wilson C., Condamine P., Liu X., Ismail A.M., Zeng L., Wanamake S.I., Mandal J., Xu J., Cui X., Close T.J. (2005) Compa a i e ansc ip ional p o iling o wo con as ing ice geno ypes unde salini y s ess du ing he ege a i e g ow h s age. Plan Physiol 139:822-35. DOI: 10.1104/pp.105.065961. Xia T., Apse M.P., Aha on G.S., Blumwald E. (2002) Iden i ica ion and cha ac e iza ion o a NaCl-inducible acuola Na+/H+ an ipo e in Be a ulga is. Physiol Plan 116:206-212.DOI: 10.1034/j.1399- 3054.2002.1160210.x Xiao B.-Z., Chen X., Xiang C.-B., Tang N., Zhang Q.-F., Xionga L.-Z. (2008) E alua ion o Se en Func ion-Known Candida e Genes o hei E ec s on Imp o ing D ough Resis ance o T ansgenic Rice unde Field Condi ions. Mol Plan . 2:73–83. DOI: 10.1093/mp/ssn068. Xuea Z.-Y., Zhia D.-Y., Xueb G.-P., Zhangc H., Zhaoc Y.-X., Xiaa G.-M. (2004) Enhanced sal ole ance o ansgenic whea (T i i um aes i um L.) exp essing a acuola Na+/H+ an ipo e gene wi h imp o ed g ain yields in saline soils in he ield and a educed le el o lea Na+. Plan Science 167:849-859. Yang Z., Gu S., Wang X., Li W., Tang Z., Xu C. (2008) Molecula e olu ion o he CPP-like gene amily in plan s: insigh s om compa a i e genomics o A abidopsis and ice. J Mol E ol 67:266-77. DOI: 10.1007/s00239-008- 9143-z. Chap e III 125 Yao X., Ma H., Wang J., Zhang D. (2007) Genome-Wide Compa a i e Analysis and Exp ession Pa e n o TCP Gene Families in A abidopsis haliana and O yza sa i a. Jou nal o In eg a i e Plan Biology 49:885 - 897. DOI: 10.1111/j.1744-7909.2007.00509.x Yokoi S., Quin e o F.J., Cube o B., Ruiz M.T., B essan R.A., Hasegawa P.M., Pa do J.M. (2002) Di e en ial exp ession and unc ion o A abidopsis haliana NHX Na+/H+ an ipo e s in he sal s ess esponse. Plan J 30:529-39. DOI: 10.1046/j.1365-313X.2002.01309.x. Yoshidas S., Fo no D., Cock J., Gomez K. (1976) Labo a o y manual o physiological s udies o ice, In e na iona Rice Resea ch Ins i u e (IRRI), Manila (Philippines). Zhang G.H., Su Q., An L.J., Wu S. (2008) Cha ac e iza ion and exp ession o a acuola Na+/H+ an ipo e gene om he monoco halophy e Aelu opus li o alis. Plan Physiol Biochem. 462:117-26. DOI: 10.1016/j.plaphy.2007.10.022. Zhang H.-X., Blumwald E. (2001) T ansgenic sal - ole an oma o plan s accumula e sal in oliage bu no in ui . Na u e Bio echnology 19:765– 768. DOI: 10.1038/90824 Zhang T., Hu S., Zhang G., Pan L., Zhang X., Al-Mssallem I.S., Yu J. (2012) The o ganelle genomes o Hassawi ice (O yza sa i a L.) and i s hyb id in saudi a abia: genome a ia ion, ea angemen , and o igins. PLOS ONE 7:e42041. DOI: 10.1371/jou nal.pone.0042041.