Candidate Germline Genetic Variants for Familial Colorectal Cancer Type X

Te esa Pa ícia da Sil a Gil Dua e Licenciada em Bioquímica Candida e Ge mline Gene ic Va ian s o Familial Colo ec al Cance Type X Disse ação pa a ob enção do G au de Mes e em Gené ica Molecula e Biomedicina O ien ado : D a. Ma ia C is ina Man as Albuque que Vale oso, In es igado a, Unidade de In es igação em Pa obiologia Molecula (UIPM), Ins i u o Po uguês de Oncologia de Lisboa F ancisco Gen il, EPE (IPOLFG) Jú i: P esiden e: P o . Dou o a Paula Ma ia The iaga Mendes Be na des Gonçal es A guen e: P o . Dou o a Ma ia Alexand a Taquenho Maia e Sil a Se emb o 2017 Te esa Pa ícia da Sil a Gil Dua e Licenciada em Bioquímica Candida e Ge mline Gene ic Va ian s o Familial Colo ec al Cance Type X Disse ação pa a ob enção do G au de Mes e em Gené ica Molecula e Biomedicina O ien ado : D a. Ma ia C is ina Man as Albuque que Vale oso, In es igado a, Unidade de In es igação em Pa obiologia Molecula (UIPM), Ins i u o Po uguês de Oncologia de Lisboa F ancisco Gen il, EPE (IPOLFG) Jú i: P esiden e: P o . Dou o a Paula Ma ia The iaga Mendes Be na des Gonçal es A guen e: P o . Dou o a Ma ia Alexand a Taquenho Maia e Sil a Se emb o 2017 Candida e Ge mline Gene ic Va ian s o Familial Colo ec al Cance Type X Copy igh Te esa Pa ícia da Sil a Gil Dua e, FCT/UNL, UNL A Faculdade de Ciências e Tecnologia e a Uni e sidade No a de Lisboa êm o di ei o, pe pé uo e sem limi es geog á icos, de a qui a e publica es a disse ação a a és de exempla es imp essos ep oduzidos em papel ou de o ma digi al, ou po qualque ou o meio conhecido ou que enha a se in en ado, e de a di ulga a a és de eposi ó ios cien í icos e de admi i a sua cópia e dis ibuição com objec i os educacionais ou de in es igação, não come ciais, desde que seja dado c édi o ao au o e edi o . Aos meus pais i AGRADECIMENTOS Em p imei o luga , não podia deixa de ag adece a odas as pessoas que me ajuda am e con ibuí am pa a a ealização des e p oje o, es a jo nada não se ia a mesma sem ocês. À D a C is ina Albuque que po me e dado a opo unidade de desen ol e es e p oje o, pela disponibilidade com que escla eceu as minhas dú idas, po oda a simpa ia e po odo o conhecimen o que me ansmi iu ao longo des e ano. Ao D . B uno Filipe, um especial ag adecimen o po oda a incansá el ajuda p es ada, paciência, disponibilidade pa a escla ece odas as minhas dú idas e po nunca e pe dido a simpa ia apesa da cons an e insis ência em lhe “gas a ” o nome. À Mes e Inês F ancisco po oda a ajuda p es ada na e isão da ese, ansmissão de conhecimen os e apoio no abalho p á ico ealizado, e à Dou o anda Pa ícia Sil a po oda a ajuda e simpa ia com que me acolheu. À Dou o a B anca Ca aco, Coo denado a da unidade de In es igação em Pa obiologia Molecula , do Ins i u o Po uguês de Oncologia, Lisboa, F ancisco Gen il, E.P.E, po me e concedido a opo unidade de pa icipa nes e p oje o. Ao Se iço de Gas en e ologia, Clínica de Risco amilia e ao Se iço de Ana omia Pa ológica do Ins i u o Po uguês de Oncologia, Lisboa, F ancisco Gen il, E.P.E, pela disponibilização do ma e ial biológico e in o mação clínica dos doen es. À D a Pa ícia Machado, D a Sidónia San os e em especial à D a So ia F agoso po oda a boa disposição no labo a ó io e simpa ia. Aos es an es memb os da Unidade de In es igação em Pa obiologia Molecula , pela simpa ia com que me ecebe am. Às minhas colegas de labo a ó io Ma lene Dua e, Ana Magalhães, Ana Hipóli o e Ca olina Pe ei a que o na am odo es e pe cu so mais ácil, seja po um so iso, uma pala a amiga, uma ga galhada na ho a de almoço ou um simples “es ou aqui pa a e ajuda ”. Sem ocês o labo a ó io não se ia o mesmo. À Mes e Ma lene Dua e po odos os momen os de ca inho, amizade e descon ação e sob e udo po se es incansá el e semp e dispos a a ajuda . À minha Mes e Ana Magalhães po me e es acolhido como ua pupila e sob e udo como ua amiga. Po oda a ajuda, oda a o ça que me ansmi is e e po odos os so isos den o e o a do labo a ó io. Não podia e pedido melho mes e. À minha Ana Hipóli o, po me e es dado uma no a aleg ia a pa i do momen o em que en as e no labo a ó io e que do nada e o nas e o meu apoio. Po odas as noi adas no labo a ó io, odas as loucu as, so isos, is ezas, dias in ensi os e acima de udo, po e es es ado semp e aqui pa a mim. À minha colega de casa, Ma a Fe nandes po odo o apoio, paciência pa a ou i as minhas lamu ias, momen os de descon ação, ca inho e amizade. iii 2.2.6.1 Selec ion o a ian s iden i ied h ough WES in he L56 amily ................................. 28 2.2.6.2 Seg ega ion analysis o he selec ed a ian s wi h he disease in he L56 amily ..... 28 2.2.6.3 Iden i ica ion o no el FCCTX suscep ibili y genes by copy numbe a ia ion analysis based on WES da a ................................................................................................................... 29 Copy numbe a ia ion analysis in he L56 amily ............................................... 29 2.2.6.3.1.1 Selec ion o amplicons de i ed om CNV analysis .......................................... 30 2.2.7 Ge mline mu a ion analysis o candida e genes o FCCTX suscep ibili y .................... 30 2.2.7.1 P ime design o ampli ica ion o candida e genes o FCCTX suscep ibili y ........... 30 2.2.7.2 Mu a ion analysis o candida e genes o FCCTX suscep ibili y ............................... 31 2.2.7.3 Mu a ional analysis o he MTMR3 c.1933C>T a ian in heal hy indi iduals ........... 32 2.2.8 Po en ial pa hogenic ole o TPP2 gene ........................................................................ 32 2.2.8.1 TPP2 gene exp ession analysis by qPCR ................................................................. 32 2.2.8.2 Splicing analysis o TPP2 .......................................................................................... 33 2.2.8.3 S udy o he TPP2 al e na i e 13a exon using he p o ein unca ion es echnique 33 P o ein unca ion es .......................................................................................... 33 PCR ampli ica ion o TPP2 o PTT ..................................................................... 35 P epa a ion o ansc ip ion/ ansla ion eac ion .................................................. 35 SDS-PAGE gel elec opho esis ........................................................................... 35 T ea men and SDS-PAGE gel e ela ion ........................................................... 36 Analysis o esul s ................................................................................................ 36 3. Resul s ........................................................................................................................................... 37 3.1 Iden i ica ion o no el FCCTX suscep ibili y a ian s by WES .............................................. 37 3.1.1 Selec ion o a ian s iden i ied h ough WES in he L56 amily ..................................... 37 3.1.2 Seg ega ion s udy o he selec ed a ian s ................................................................... 37 3.1.3 Copy numbe a ia ion analysis in he L56 amily based on WES da a ........................ 41 3.2 Ge mline mu a ion analysis o candida e genes o FCCTX suscep ibili y ............................ 42 3.2.1 MTMR3 .......................................................................................................................... 42 3.2.2 TAS1R1 ......................................................................................................................... 44 3.2.3 DUSP12 and LGR6 ....................................................................................................... 45 3.3 TPP2 ole in FCCTX suscep ibili y ........................................................................................ 45 3.3.1 Gene exp ession analysis ............................................................................................. 45 3.3.2 Splicing analysis ............................................................................................................ 46 3.3.3 S udy o he al e na i e 13a exon by PTT ..................................................................... 51 4. Discussion ..................................................................................................................................... 53 4.1 Iden i ica ion o no el FCCTX suscep ibili y a ian s by WES .............................................. 53 4.1.1 Analysis o po en ial copy numbe a ia ion (disease associa ed) om he WES da a 55 4.2 Ge mline mu a ional analysis o candida e genes o FCCTX suscep ibili y ......................... 55 4.2.1 MTMR3 .......................................................................................................................... 55 4.2.2 TAS1R1 ......................................................................................................................... 58 4.3 TPP2 ole in FCCTX suscep ibili y ........................................................................................ 59 5. Conclusion ..................................................................................................................................... 63 6. Re e ences .................................................................................................................................... 65 7. Appendices .................................................................................................................................... 71 ix FIGURE INDEX Figu e 1.1 - The adenoma-ca cinoma sequence. Main his ological and molecula changes. ................ 2 Figu e 1.2 - Schema ic o e iew o he WNT signaling pa hway and i s ole in colo ec al cance . ........ 3 Figu e 1.3 – Schema ic iew o ch omosome 13. Localiza ion o he minimum LOH egion iden i ied h ough linkage analysis and he genomic loca ion o TPP2. ..................................................... 11 Figu e 1.4 – Pedig ee o he TSG- amily - L56. .................................................................................... 14 Figu e 1.5 - Exclusion c i e ia used o he selec ion o a ian s o seg ega ion s udies wi h he disease wi hin L56 amily. ......................................................................................................................... 16 Figu e 2.1 – G aphic ep esen a ion o a qPCR ampli ica ion plo . ....................................................... 26 Figu e 2.2 – Schema ic ep esen a ion o how he p ime s o cDNA ampli ica ion o he candida e genes we e designed.. ........................................................................................................................... 31 Figu e 2.3 - The p o ein unca ion es . ................................................................................................ 34 Figu e 3.1 – L56 amily pedig ee wi h he seg ega ion esul s o a ian p.Asp1203Asn, loca ed a he CACNA1S gene. ......................................................................................................................... 39 Figu e 3.2 - L56 amily pedig ee wi h he seg ega ion esul s o all he selec ed a ian s ha seg ega ed wi h he disease. .......................................................................................................................... 40 Figu e 3.3 - Pa ial elec ophe og ams ep esen ing he 3 iden i ied a ian s in he MTMR3 gene. ..... 42 Figu e 3.4 – Rep esen a i e scheme o he al e na i e spliced iso o ms ound in agmen s B and D o MTMR3. ....................................................................................................................................... 43 Figu e 3.5 – Gene exp ession analysis by qPCR o he w (13/14) and an al e na i e ansc ip (13a) o he TPP2 gene. ........................................................................................................................... 46 Figu e 3.6 – Schema ic ep esen a ion o he desc ibed iso o ms o TPP2 (ENST00000376065 and ENST00000376052) and a non-desc ibed iso o m.. ................................................................... 47 Figu e 3.7 – Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L950 and espec i e esul s. ....................................................................................................................... 48 Figu e 3.8 - Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L1590 and espec i e esul s.. ............................................................................................................... 49 Figu e 3.9 - Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L926 and espec i e esul s.. ...................................................................................................................... 50 Figu e 3.10 - Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L447 and espec i e esul s. ................................................................................................................ 50 Figu e 3.11 - Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o samples L905 (uppe panel) and L1544 (lowe panel), and espec i e esul s. ................................................. 51 Figu e 3.12 – Pa ial adiog aphy om he PTT, ep esen ing he no mal and he unca ed p o ein bands o 3 samples: L1574, L1544 and CAs2000. ............................................................................... 52 Figu e 4.1 – Mechanisms o exci a ion-con ac ion coupling and elaxa ion in skele al muscle cells. .. 54 Figu e 4.2 - Schema ic ep esen a ion o he MTMR3 ansc ip (Ensemble ID: ENST00000401950) and localiza ion o he main p o ein domains.. ................................................................................... 55 Figu e 4.3 – Family’s pedig ee o he indi idual we e he c.1933C>T (p.A g645T p) a ian was ound (L2127, ma ked wi h an a ow). .................................................................................................. 56 x Figu e 4.4 –Regula ion o au ophagy by in e ac ion o G-p o ein-coupled as e ecep o TAS1R1/TAS1R3 wi h mTORC1. ............................................................................................... 58 Figu e 4.5 – Main domains o he TAS1R1 p o ein and he localiza ion o 3 o he a ian s ound. ..... 59 Figu e 4.6 - Schema ic ep esen a ion o he desc ibed iso o ms o TPP2 and localiza ion o he main p o ein domains.. ......................................................................................................................... 60 Figu e 4.7 – Amino acid (aa) sequences o he no mal TPP2 p o ein (le panel), wi h a molecula weigh o 138 kDa and he unca ed p o ein gene a ed by he inse ion o he 13a exon ( igh panel), wi h an app oxima e (~) molecula weigh o 65 kDa. ........................................................................ 61 xi TABLE INDEX Table 1.1 - Ams e dam c i e ia I and II .................................................................................................... 7 Table 1.2 - The Be hesda guidelines ...................................................................................................... 8 Table 1.3 – Con as s be ween LS and FCCTX. ..................................................................................... 9 Table 1.4 - Desc ip ion o he s a egy used in he 5 bioin o ma ic analyzes using he esul s ob ained by WES o he selec ed pa ien s om L56, and espec i e numbe o a ian s. ....................... 15 Table 1.5 - Desc ip ion o he 4 ou pu s ob ained a e bioin o ma ic analysis and o al numbe o a ian s ob ained o each ou pu . ............................................................................................................ 15 Table 3.1 - Cha ac e iza ion o he selec ed a ian s a e applica ion o selec ion c i e ia, e iew o mu a ion equency and in silico analysis. ................................................................................... 37 Table 3.2 – Resul s o he seg ega ion s udy o he selec ed a ian s om analysis 1.. ...................... 38 Table 3.3 - Resul s o he seg ega ion s udy o he selec ed a ian s om analysis 3.. ....................... 39 Table 3.4 - Cha ac e iza ion o he selec ed a ian s ha e ealed a seg ega ion pa e n wi h he disease acco ding o each analysis. ......................................................................................................... 40 Table 3.5 – Resul s om he selec ion o amplicons de i ed om CNV analysis. ................................ 41 Table 3.6 - Cha ac e iza ion o he mos ele an a ian s ob ained in he mu a ional analysis o he MTMR3 gene, o he 34 index pa ien s o FCCTX and FCCTX-like amilies wi hou an iden i ied mu a ion in he MMR genes. ....................................................................................................... 43 Table 3.7 - Cha ac e iza ion o he mos ele an a ian s ob ained in he mu a ional analysis o he TAS1R1 gene, o he 26 index pa ien s o FCCTX and FCCTX-like amilies wi hou an iden i ied mu a ion in he MMR genes. ....................................................................................................... 44 xii xiii LIST OF ABBREVIATIONS AC Ams e dam c i e ia APC Adenoma ous polyposis coli BER Base excision epai BMPR1A Bone mo phogene ic p o ein ecep o ype 1A CACNA1S Calcium ol age-ga ed channel subuni alpha1 S cDNA Complemen a y DNA cGMP Cyclic guanosine monophospha e CIMP CpG island me hyla o pheno ype CIN Ch omosomal ins abili y CNV Copy numbe a ia ion CRC Colo ec al cance C Th eshold cycle DCC DCC ne in 1 ecep o ddH2O Double-dis illed wa e ddNTP Dideoxynucleoside iphospha e dNTP Deoxynucleo ide iphospha e DUSP12 Dual speci ici y phospha ase 12 EDTA E hylenediamine e aace ic acid EPCAM Epi helial cell adhesion molecule FCCTX Familial colo ec al cance ype X FFPE Fo malin- ixed pa a in- embedded GAPDH Glyce aldehyde-3- phospha e dehyd ogenase GIMAP1 GTPase, IMAP amily membe 1 GTP Guanosine iphospha e HNPCC He edi a y non-polyposis colo ec al cance JPS Ju enile polyposis synd ome KRAS KRAS p o o-oncogene LGR6 Leucine ich epea con aining G p o ein- coupled ecep o 6 LOH Loss o he e ozygosi y LS Lynch synd ome MAP MUTYH-associa ed polyposis MAPK1 (ERK2) Mi ogen-ac i a ed p o ein kinase 1 MAPK3 (ERK1) Mi ogen-ac i a ed p o ein kinase 3 MGMT O-6-me hylguanine-DNA me hyl ans e ase MHC Majo his ocompa ibili y complex MLH1 Mu L Homolog 1 MMR Misma ch epai MSH2 Mu S Homolog 2 MSH3 Mu S Homolog 3 MSH6 Mu S Homolog 6 MSI Mic osa elli e ins abili y MSI-H Mic osa elli e ins abili y -low MSI-L Mic osa elli e ins abili y - high MSS Mic osa elli e s able MTMR3 Myo ubula in ela ed p o ein 3 mTOR Mechanis ic a ge o apamycin mTORC1 Mechanis ic a ge o apamycin complex 1 MUTYH mu Y DNA glycosylase xi NGS Nex -gene a ion sequencing NPR2 Na iu e ic pep ide ecep o 2 PCR Polyme ase chain eac ion PJS Peu z-Jeghe s synd ome PMS1 PMS1 Homolog 1 PMS2 PMS1 Homolog 2 POLD1 DNA polyme ase del a 1 P dIns(3,5)P2 Phospha idylinosi ol 3,5- biphospha e P dIns3P Phospha idylinosi ol 3- phospha e PTT P o ein unca ion es qPCR Quan i a i e PCR RNF213 Ring inge p o ein 213 RPS20 Ribosomal p o ein S20 RT Re e se ansc ip ion RYR1 Ryanodine ecep o 1 SD S anda d de ia ion SDS Sodium dodecyl sul a e SDS-PAGE Sodium dodecyl sul a e- polyac ylamide gel elec opho esis SEMA4A Semapho in 4A SMAD2 SMAD amily membe 2 SMAD4 SMAD amily membe 4 SMG7 SMG7, nonsense media ed mRNA decay ac o SNP Single-nucleo ide polymo phism SP Se a ed polyposis STK11 Se ine h eonine kinase 11 TAS1R1 Tas e 1 ecep o membe 1 TBE T is-Bo a e-EDTA TCF T-cell ac o TGF-β T ans o ming g ow h ac o be a TP53 Tumo p o ein p53 TPP2 T ipep idyl pep idase 2 TSG Tumo supp esso gene TSG- Tumo supp esso gene nega i e TSG+ Tumo supp esso gene posi i e WES Whole exome sequencing W Wild ype ZNF717 Zinc inge p o ein 717 x LIST OF UNITS % (w/ ) Weigh pe olume pe cen age °C Deg ees Celsius bp Base pai Ci Cu ie kDa Kilodal on kb Kilobases Tm Mel ing empe a u e V Vol s mA Milliampe es U Uni s L; mL; μL Li e ; millili e (10-3L); mic oli e (10-6L) M; mM; μM; nM Mola (mol/L); milimola (10-3 M); mic omola (10-6 M); nanomola (10-9M) mol; pmol Mole; picomol (10-12 mol) x i 1 1. INTRODUCTION 1.1 Colo ec al cance Colo ec al cance (CRC) is he hi d mos common cance and he ou h mos common cause o cance - ela ed dea hs wo ldwide. (Fe lay e al. 2013) In Po ugal, CRC has he second highes incidence a e b eas cance in emale and p os a e cance in men, being he second cause o cance - ela ed dea hs (Mi anda e al. 2016). CRC has a low incidence a ages younge han 50 yea s, bu s ongly inc eases wi h age, ha ing a median age a diagnosis o 70 yea s in de eloped coun ies. (B enne e al. 2014) The pa hogenesis o CRC is e y complex and di e se and is also in luenced by mul iple ac o s, some o which a e ela ed o gene ic p edisposi ion, while o he s a e a ibu ed o unheal hy li es yle ac o s. Se e al epidemiological s udies ha e con i med he in ol emen o nume ous en i onmen al and die a y ac o s, such as ciga e e smoking, alcohol abuse, a die high in a and low in ibe , a seden a y li es yle and obesi y. (Colussi e al. 2013) Abou 75% o pa ien s wi h CRC ha e spo adic disease wi h no appa en e idence o ha ing inhe i ed he diso de . The emaining 25% o pa ien s ha e a amily his o y o CRC ha sugges s a he edi a y con ibu ion, common en i onmen al exposu es wi hin he amily, o a combina ion o bo h. Gene ic pa hogenic a ian s ha e been iden i ied as he cause o inhe i ed cance isk in some colon cance –p one amilies, bu hese pa hogenic a ian s a e es ima ed o accoun o only 5% o all CRC. (Daly e al. 2017) The emaining 20% o inhe i ed CRC cases do no ha e a clea ly de ined mechanism and likely esul om a combina ion o gene polymo phisms and mu a ions, al e a ions in mul iple suscep ibili y loci and en i onmen al in luences. (Popek and Tsiki is 2011) To de elop accu a e isk assessmen and mo e p ecise sc eening app oaches, a cla i ica ion o p edisposing genes and a be e unde s anding o he pa hways and molecula e en s ha d i e CRC ca cinogenesis is essen ial. (Daly e al. 2017) 1.2 Molecula e en s associa ed wi h colo ec al ca cinogenesis CRC esul s om he accumula ion o bo h acqui ed gene ic and epigene ic changes ha ans o m no mal glandula epi helium in o in asi e adenoca cinoma (Lao and G ady 2011). P esen ly, CRC can be sepa a ed in o h ee ca ego ies based on simila molecula gene ic ea u es, sugges ing di e gen pa hways o umo igenesis: ch omosomal ins abili y (CIN), mic osa elli e ins abili y (MSI), and CpG island me hyla o pheno ype (CIMP). (Daly e al. 2017) 1.2.1 Ch omosomal ins abili y pa hway The majo i y o CRCs de elop h ough he CIN pa hway which is cha ac e ized by widesp ead al e a ions in ch omosome numbe (aneuploidy) and equen de ec able losses a he molecula le el o po ions o ch omosomes (loss o he e ozygosi y - LOH), such as 5q, 18q, and 17p. The s eps in ol ed 8 To access umo mic osa elli e ins abili y (MSI), a s anda dized panel o mic osa elli es e e ed o as he Be hesda panel is used, his panel comp ises wo mononucleo ide (BAT25 and BAT26) and h ee dinucleo ide mic osa elli es ma ke s (D5S346, D2S123, and D17S250). Conside able MSI o MSI- high (MSI-H) is de ined as MSI a ≥2 (40%) o he i e speci ied ma ke s, MSI-low (MSI-L) as MSI only a one ma ke , and mic osa elli e s able (MSS) when no ins abili y is demons a ed a hese ma ke s. (Wo hley e al. 2010) Indi iduals wi h LS ca y a he e ozygous ge mline MMR mu a ion and, o malignancy o occu , a second copy o he a ec ed MMR gene mus be soma ically inac i a ed. Loss o unc ion o he MMR sys em may lead o DNA eplica ion e o s, especially in mic osa elli es, which can occu in umo supp esso genes o p o o-oncogenes leading o ca cinogenesis. DNA eplica ion e o s a e p opaga ed h ough daugh e cells, leading o e o s in mic osa elli es, making hem uns able (MSI-H). (Ca ballal e al. 2014) (Wells and Wise 2017) Table 1.2 - The Be hesda guidelines (adap ed om: Gia diello e al. 2014) Tumo s om indi iduals should be es ed o MSI in he ollowing si ua ions: 1. CRC diagnosed be o e he age o 50 yea s; 2. P esence o synch onous o me ach onous CRC o o he HNPCC-associa ed umo s (colo ec al, endome ium, s omach, o a y, panc eas, u e e , enal pel is, bilia y ac , b ain, small bowel, sebaceous glands, and ke o oacan homas), ega dless o age. 3. CRC wi h MSI-high pa hologic-associa ed ea u es (C ohn-like lymphocy ic eac ion, mucinous/signe cell di e en ia ion, o medulla y g ow h pa e n) diagnosed be o e he age o 60 yea s; 4. CRC diagnosed in one o mo e i s -deg ee ela i es wi h an HNPCC- ela ed umo , wi h one o he cance s being diagnosed be o e he age o 50 yea s. 5. CRC diagnosed in wo o mo e i s - o second-deg ee ela i es wi h HNPCC- ela ed umo s, ega dless o age. 1.3.2.2 Familial colo ec al cance ype X In 2005, Lindo and co-wo ke s epo ed a subse o amilies who ul ill AC bu ha e no e idence o a DNA MMR de ec , umo s did no p esen mic osa elli e ins abili y and did no sha e he same cance incidence as amilies wi h Lynch synd ome. Rela i es in such amilies had a lowe incidence o colo ec al cance han hose in amilies wi h Lynch synd ome, and he e was no e iden isk o ex acolonic umo s. These non-Lynch synd ome clus e s o CRC we e e med amilial colo ec al cance ype X (FCCTX). (Lindo e al. 2005) Table 1.3 compa es and con as s LS wi h FCCTX. Be hesda Guidelines 9 Table 1.3 – Con as s be ween LS and FCCTX. (adap ed om Lindo 2009b) LS FCCTX CRC Cance isk Ve y high Modes ly inc eased Age o onse 45 yea s (a e age) 50-60 yea s Usual loca ion P oximal colon Dis al colon Polyps Few Mo e O he cance s Endome ial isk Ve y high Low O he cance si es Many None known MMR genes Ge mline Mu a ions ound No mu a ions ound Tumo MSI MSS Tumo s aining Loss o MMR exp ession No mal exp ession As he “ ype X” label implies, he gene ic e iology o FCCTX is la gely unknown. Al hough he iden i ica ion o he gene ic basis o FCCTX has been a opic o in ensi e esea ch, he cause o he inc eased isk o cance in his g oup emains unknown and e idence sugges s ha i is a he e ogenous g ouping. (Ca ballal e al. 2014) (Ca e he s and S o el 2015) I likely includes some amilies ha ha e a andom agg ega ion o a common umo ; some amilies may be a ibu able o sha ed li es yle ac o s, polygenic p edisposi ion and some amilies likely ha e a ye o be de ined single gene diso de s. (Lindo 2009b) Se e al linkage s udies, nex gene a ion sequencing (NGS) and associa ion s udies, ha e been conduc ed o disco e p edisposing genes behind FCCTX. A ge mline mu a ion in RPS20 ( ibosomal p o ein S20) (c.147dupA), encoding an ibosomal RNA ma u a ion p o ein has been iden i ied in a FCCTX amily. (Nieminen e al. 2014) The p oduc o RPS20 is equi ed du ing he la e s eps o 18S ibosomal RNA o ma ion, and RPS20 has been associa ed o TP53 s abiliza ion. Con e sely, he cons an ac i a ion o TP53 consecu i e o ibosomal s ess induced by RPS20 mu a ion could a o , in he long un, he selec ion o cells ha escape egula ion by TP53. (Nieminen e al. 2014) Th ee di e en missense mu a ions (p.Val78Me , p.Gly484Ala and p.Se 326Phe) in he SEMA4A (semapho in 4A) gene we e also iden i ied in h ee FCCX amilies. (Schulz e al. 2014) The p.Val78Me a ian demons a ed signi ican ly inc eased MAPK/E k and PI3K/Ak signalling ac i a ion as well as cell cycle p og ession in HCT-116 CRC cells. (Schulz e al. 2014) Howe e , he impo ance o his gene seems o be con o e sial since ano he s udy ailed o ind e idences o suppo a ia ions in SEMA4A as a de e minan o FCCTX isk. (Kinne sley e al. 2016) Ano he gene ha has been e e ed in FCCTX is he BMPR1A gene ( ypically associa ed wi h ju enile polyposis), ha encodes a p o ein ecep o ha 10 belongs o a amily o se ine/ h eonine kinases, whe e ha e been epo ed 2 a ian s (p.Gludel88 and c.68-10_68+14del). (Nieminen e al. 2011) A a ian iden i ied in he POLD1 (DNA polyme ase del a 1) gene (p.P o300Leu) was also ound wi hin a FCCTX amily. (Dua e 2015) Despi e he e o s made owa ds a be e unde s anding and cha ac e iza ion o FCCTX, addi ional s udies a e s ill necessa y o iden i y he gene ic basis associa ed wi h his synd ome. Thus, p o iding a be e sc eening, su eillance and main enance o he amilies. 1.4 Molecula cha ac e iza ion and iden i ica ion o no el suscep ibili y genes/ a ian s o FCCTX 1.4.1 Molecula cha ac e iza ion o a g oup o FCCTX amilies In o de o achie e a be e unde s anding o he FCCTX synd ome, he Colon Pa hology G oup om IPOLFG, E.P.E pe o med a s udy ha aimed o cha ac e ize a g oup o FCCTX amilies a clinical and molecula le el by e alua ing he in ol emen o he CIN pa hway in umo s om hese amilies. (F ancisco e al. 2011) Fo his pu pose, 24 umo s om 15 FCCTX amilies we e analyzed o LOH in known umo supp esso gene (TSG) loci (APC, TP53, SMAD4 and DCC (DCC ne in 1 ecep o ), me hyla ion s a us o MMR genes and MGMT (O-6-me hylguanine-DNA me hyl ans e ase), and also APC and KRAS soma ic mu a ions. These analyzes e ealed wo dis inc molecula en i ies among he umo s o he FCCTX amilies: one, mo e p e alen , whe e umo s p esen ed loss o TSG loci (72%) - TSG+ ( umo supp esso gene posi i e), sugges ing he in ol emen o he CIN pa hway, and a lesse p edominan one, wi h no e idence o TSG loss (28%) - TSG- ( umo supp esso gene nega i e). Wi hin he TSG+ sub ype umo s also p esen ed equen APC and KRAS soma ic mu a ions, as well as equen gene p omo e me hyla ion, while almos no p omo e me hyla ion was ound in he TSG- sub ype. (F ancisco e al. 2011) 1.4.2 Iden i ica ion o no el FCCTX suscep ibili y loci h ough linkage analysis Rega ding his FCCTX comp ehensi e s udy, a p ojec was de eloped by he Colon Pa hology G oup o map new gene ic suscep ibili y loci o FCCTX. Thus, a genome-wide linkage s udy using 50,000 single-nucleo ide polymo phisms (SNPs) a ay and a subsequen LOH analysis using mic osa elli e ma ke s, was pe o med in he 2 mos in o ma i e FCCTX amilies, one wi h TGS+ umo s and one wi h TGS- umo s. This analysis allowed he iden i ica ion o 2 sugges i e ch omosomal egions (13q and 21q) wi hin he TSG+ amily ha may ac as po en ial egions o suscep ibili y. While o he TSG- amily he e was no signi ican esul s. (Pe ei a 2013) (Belo 2010) Using mo e mic osa elli e ma ke s o es ain he iden i ied egions, as well as addi ional samples o FCCTX umo s, i was possible o de e mine a minimum egion o LOH o 0.84Mb and o 1.3Mb, o egions 13q and 21q espec i ely (13q32-33 and 21q11). Conside ing he his ological ea u es o he analyzed FCCTX umo s, i was also ound ha LOH on ch omosome 13 we e mo e equen in adenomas, whe eas losses on ch omosome 21 we e mo e equen in ca cinomas, sugges ing ha 11 e en s in 13q occu a he le el o umo ini ia ion while e en s in 21q appea a he le el o umo p og ession. (Pe ei a 2013) Among he a ious genes con ained in hese egions o in e es , some candida e genes o ge mline mu a ion analysis we e selec ed acco ding o he ollowing c i e ia: genes exp essed in he colon; genes encoding p o eins in ol ed di ec ly o indi ec ly in cellula p ocesses associa ed wi h umo igenesis and gene ha we e no epo ed as he cause o o he pa hologies. (Sa amago 2014) (Pe ei a 2014) Using hese c i e ia a se o 13 candida e genes we e chosen o ge mline mu a ion analysis wi hin he 13q egion and 3 o he 21q egion. F om his la ge se o genes only ew emain as possible con ibu o s o FCCTX, since se e al s udies pe o med by he Colon Pa hology G oup ha e excluded o enhanced hei possible in ol emen . One o he emaining genes ha may be in ol ed in FCCTX suscep ibili y is he T ipep idyl pep idase 2 (TPP2) loca ed in 13q33.1 ( igu e 1.3), whose s udy will be con inued a he p esen wo k. 1.4.2.1 T ipep idyl pep idase 2 TPP2 is an aminopep idase ha emo es ipep ides om he ee N e minus o longe pep ides and is ega ded as a housekeeping enzyme o euka yo ic cells. I cons i u es he la ges cy osolic p o ease complex in euka yo es and i plays a ole in he ubiqui in-p o easome pa hway downs eam o he p o easome as well as in he p oduc ion and des uc ion o MHC (majo his ocompa ibili y complex) class I an igens and deg ada ion o neu opep ides. (P e a e al. 2010) TPP2 has been epo ed o play a ole in a ious biological p ocesses, including an igen p ocessing, cell g ow h, DNA damage epai and ca cinogenesis, a me abolism, eeding beha io , obesi y and mos ecen ly in he con ol o MAPK3 (mi ogen-ac i a ed p o ein kinase 3) and MAPK1 (mi ogen-ac i a ed p o ein kinase 1) phospho yla ion. (Wiemhoe e e al. 2015) (Pe e s e al. 2011) The TPP2 gene has wo p o ein coding ansc ip s desc ibed in he Ensembl da abase (Ensembl: h p://www.ensembl.o g/index.h ml, accessed in 2017). One wild ype (w ) o med by 29 exons and an al e na i e ansc ip , ha has a di e en s a codon and he p esence o an addi ional 39 bp exon be ween exons 23 and 24, named 23a. Molecula analysis o he TPP2 gene was pe o med in p e ious s udies o he p ojec desc ibed abo e, 1.4.1.1. A mu a ional analysis a he mRNA le el e ealed a new ansc ip , no desc ibed o Figu e 1.3 – Schema ic iew o ch omosome 13. Localiza ion o he minimum egion o LOH iden i ied h ough linkage analysis and he genomic loca ion o TPP2. (Adap ed om: Geneca ds (h p://www.geneca ds.o g/)) Ch omosome 13 Minimum LOH egion TPP2 12 da e, esul ing om an inse ion o a 72 bp be ween exons 13 and 14. (Pe ei a 2013) This al e na i e 72 bp exon will be desc ibed as 13a h oughou his p ojec . This no el ansc ip was e alua ed in a s udy conduc ed by he Colon Pa hology G oup, whe e i was obse ed an inc eased exp ession o he 13a ansc ip in blood samples in 71% o he FCCTX indi iduals, 69% in LS indi iduals and 35% in heal hy indi iduals. This inc eased exp ession was also ollowed by a conside able w ansc ip educ ion in 43%, 38% and 18% o he FCCTX, LS and heal hy indi iduals, espec i ely. Thus, ei he 13a o e exp ession and educ ion o w , o jus o e exp ession o 13a, was mo e equen in indi iduals wi h FCCTX and LS han in he g oup o heal hy indi iduals. (Pe ei a 2014) Howe e , i was unknow i he exp ession o his ansc ip would s ill be obse ed in he colon. Thus, samples om ca cinomas, adenomas and no mal mucosa we e included in he TPP2 gene exp ession analysis. This s udy showed ha he exp ession o he al e na i e ansc ip was signi ican ly educed when compa ed o he w in issue samples, showing a di e en ial exp ession be ween blood and colon samples. (Sa amago 2014) Howe e his s udy was pe o med in a small and limi ed numbe o samples, hus, he e is he need o include a la ge numbe o samples in o de o con i m hese indings. Gi en he ole o TPP2 wi hin he immune esponse, hese da a aken oge he sugges ha his al e na i e ansc ip could play a ole in FCCTX suscep ibili y, howe e u he s udies a e needed o disc imina e he ole o he al e na i e ansc ip when compa ed o he w ansc ip , bo h in blood and issue samples. 1.4.3 Iden i ica ion o no el FCCTX suscep ibili y a ian s by whole genome sequencing Recen ad ances in he de elopmen o sequencing echnologies, namely nex -gene a ion sequencing (NGS), ha e p o ided unp eceden ed possibili ies o gene ic analyses. The abili y cos - e ec i ely o gene a e genome-wide sequencing da a wi h deep co e age in a sho ime ame is eplacing app oaches ha ocus on speci ic egions o gene disco e y and clinical es ing. While whole genome sequencing emains expensi e o mos applica ions, whole exome sequencing (WES), a echnique ha ocuses only on he p o ein-coding po ion o he genome, places many ad an ages o he eme ging echnologies in o esea che ’s hands. Recen s udies using his echnology ha e unco e ed new a ian s (and genes) o a numbe o p e iously un esol ed Mendelian diso de s. (Pe e sen e al. 2017) (Majewski e al. 2011) NGS pla o ms sha e a common echnological ea u e: massi ely pa allel sequencing o clonally ampli ied o single DNA molecules ha a e spa ially sepa a ed in a low cell. This design is a pa adigm shi om ha o Sange sequencing and has allowed scaling-up by o de s o magni ude. In NGS, sequencing is pe o med by epea ed cycles o polyme ase-media ed nucleo ide ex ensions. As a massi ely pa allel p ocess, NGS gene a es hund eds o megabases o gigabases o nucleo ide sequence om a single ins umen un. (Majewski e al. 2011) Following he p ojec ha aimed he iden i ica ion o no el genes o suscep ibili y o FCCTX, desc ibed in 1.4.1 and 1.4.1.1, he TSG- amily (designa ed L56) was selec ed o a WES analysis, since 13 no signi ican esul s we e ob ained h ough he linkage analysis. Genomic DNA samples om 5 pa ien s o he amily we e selec ed o a WES analysis (using Agilen Su eSelec Exome e sion 4 cap u e ki (Agilen ) and Illumina T uSeq 3 p o ocol sample p ep in a Hiseq2500 pla o m (Illumina), pe o med by Cen e o Biomics a he E asmus Uni e si y Medical Cen e - Ro e dam, Ne he lands). This analysis aimed o iden i y he a ian s sha ed by he i e indi iduals and e alua e hei pa hogenici y and associa ion wi h he disease. Family pedig ee as well as he iden i ica ion o he pa ien s subjec ed o WES analysis a e ep esen ed in igu e 1.4. In o de o maximize he iden i ica ion o po en ial pa hogenic ge mline mu a ions and gi en he high pe cen age o spo adic CRC in he popula ion, he bioin o ma ic analysis was buil o comp ise all possibili ies and he e o e i was subdi ided in o i e analyzes, each wi h a unique combina ion o he pa ien s who sha ed a ian s ( able 1.4). Thus, analysis 1 con ained a ian s sha ed by all 5 pa ien s, while he emaining analyzes con ained a ian s sha ed only by ou o h ee pa ien s: analysis 2 excluded pa ien 4; analysis 3 excluded pa ien 2; analysis 4 excluded pa ien s 2 and 4 and analysis 5 excluded pa ien s 3 and 4. This exclusion o sha ed a ian s wi hin some amily membe s comes om he hypo hesis ha pa ien s 2 and 3 may be po en ial phenocopies and he e o e hei pheno ype may be a spo adic case and no a ibu ed o he sha e o an inhe i ed a ian in he con ex o an FCCTX amily. Pa ien 4 was also conside ed as a possible spo adic case because, when compa ing he age o adenoma de elopmen in o he ela i es, his pa ien only s a ed o de elop adenomas a age 40. The esul s o he i e bioin o ma ic analyzes we e p o ided by Bioin 2Bio Lda. using he GRCh38 e e ence genome and we e o ganized in o ou ou pu s ( o ma .xlsx), ha con ain desc ip i e in o ma ion abou he a ian s sha ed o each analysis, each ou pu desc ip ion can be ound in able 1.5. Selec ion o possibly pa hogenic a ian s ha could jus i y he FCCTX pheno ype in he L56 amily was done using he a ian s p o ided by ou pu s 3 and 4 ( able1.5). Al hough ou pu 4 desc ibes a ian s ha p esen high impac acco ding o he so wa e SIFT (Kuma e al. 2009) and Polyphen-2 (Ramensky e al. 2002) and he e o e desc ibing he a ian s wi h he g ea es pa hogenic po en ial, ou pu 3 analysis was also included in o de o a oid he elimina ion o a ian s ha may be equally impo an , excluded only by hei sco es in hese so wa e. (Magalhães 2016) 14 Figu e 1.4 – Pedig ee o he TSG- amily - L56. Pa ien s highligh ed in colo s we e he ones selec ed o WES analysis. Only indi iduals wi h a labo a o y iden i ica ion numbe (LXXX o LXXXX) ha e biological ma e ial a ailable. The age a diagnosis (AD, in yea s, y) and espec i e pheno ypic cha ac e iza ion a e desc ibed o he a ec ed indi iduals. CA: cu en age; y: yea s; ADC: adenoca cinoma; TALGD: ubula adenoma wi h low-g ade dysplasia; TAHGD: ubula adenoma wi h high-g ade dysplasia; HP: hype plas ic polyp; SSALGD: sessile se a ed adenoma wi h low-g ade dysplasia. 15 Table 1.4 - Desc ip ion o he s a egy used in he 5 bioin o ma ic analyzes using he esul s ob ained by WES o he selec ed pa ien s om L56, and espec i e numbe o a ian s. Table 1.5 - Desc ip ion o he 4 ou pu s ob ained a e bioin o ma ic analysis and o al numbe o a ian s ob ained o each ou pu . Ou pu Ou pu Desc ip ion To al numbe o a ian s (Analysis 1+2+3+4+5) 1. Anno a ion o all genomic a ian s ma ching p o ein coding ansc ip s wi h a: de ined geno ype; alignmen and geno ype quali y ≥ 20; numbe o eads ≥ 20. 26 301 2. In o ma ion om COSMIC da abases o all genomic a ian s ma ching p o ein coding ansc ip s wi h COSMIC ids. 26 301 Anno a ion o all genomic a ian s ma ching p o ein coding ansc ip s and wi h ele an p edic ed consequences (1 o a combina ions o he ollowing): 18 642 3. ameshi ; splice egion; missense; splice accep o a ian ; 5' UTR a ian ; 3' UTR a ian ; synonymous a ian ; s a los ; s op gained. 4. Anno a ion o all genomic a ian s de i ed om ou pu 3 selec ed o high impac : SIFT: dele e ious; PolyPhen: possibly/p obably damaging. 604 16 1.4.3.1 Selec ion o a ian s iden i ied h ough whole exome sequencing analysis In o de o selec po en ial pa hogenic a ian s sha ed by he a ec ed indi iduals o he L56 amily, o he subsequen seg ega ion s udy, exclusion c i e ia we e es ablished ( igu e 1.5), which we e applied o he a ian s desc ibed in ou pu s 3 and 4. The i s c i e ia consis ed in he exclusion o common a ian s ob ained by bioin o ma ic analysis om h ee amilies o amilial cance (colon, hy oid and p os a e) analyzed by WES ha we e included in he IPOFG, EPE p ojec - Exome sequencing p ojec /Familial and Indi idual cance isk- iden i ica ion o no el genes. The second c i e ia was used o elimina e a ian s ha p esen ed gene al popula ion equencies highe han 1%, since hese a e conside ed polymo phisms, ollowed by he exclusion o a ian s wi h a he mu a ed allele equency, in wo o mo e indi iduals, wi h alues lowe han 30%, which may ep esen possible a i ac s ha occu ed du ing he sequencing p ocess. The ollowing c i e ia ook in o accoun he geno ypes o he a ian s iden i ied in he indi iduals o he amily, ha is, i hey we e de ec ed in homozygosi y o he e ozygosi y. Thus, and gi en he dominan ansmission o CRC in he amily, a ian s iden i ied as homozygous o all o almos all indi iduals we e excluded. Finally, he las c i e ia se ed o ule ou unca ing a ian s whose new s op codon was loca ed a he end o he p o ein, since hey ga e ise o unca ed p o eins wi h simila size o he wild- ype, he e o e, wi h a low pa hogenic po en ial. A e applying hese c i e ia o he wo ou pu s (3 and 4), a o al o 300 a ian s we e ob ained. (Magalhães 2016) A e he use o hese exclusion c i e ia, in silico analysis was pe o med o all o he selec ed a ian s o es ic he numbe o a ian s and help p edic hei pa hogenici y. Gene al equencies in he popula ion we e con i med using 1000 Genomes (Au on e al. 2015), Exome Agg ega ion Conso ium (ExAC) (ExAC: h p://exac.b oadins i u e.o g/) (Lek e al. 2016) and Exome Va ian Se e (EVS) (Exome Va ian Se e , NHLBI Exome Sequencing P ojec : h p://e s.gs.washing on.edu/EVS/) Figu e 1.5 - Exclusion c i e ia used o he selec ion o a ian s o seg ega ion s udies wi h he disease wi hin L56 amily (Adap ed om: Magalhães 2016). C i e ia 1 Va ian s in common wi h a p os a e/ hy oid analysis Popula ion allele equencies highe han 1% C i e ia 2 C i e ia 3 C i e ia 4 C i e ia 5 Mu a ed allele equency lowe han 30% wi hin an indi idual T unca ed p o ein a he end o he p o ein o inse ion o an amino acid jus be o e he s op codon Geno ype 17 da abases. The SIFT/Polyphen-2 alues we e alida ed h ough he VEP so wa e (Jian e al. 2014) (VEP: h p://www.ensembl.o g/Tools/VEP). And an addi ional analysis was pe o med using he Mu a ion Tas e so wa e (Schwa z e al. 2014) (Mu a ion Tas e : h p://www.mu a ion as e .o g/), in o de o p edic possible splicing consequences. Finally, a su ey on p o ein unc ion using PubMed da abase (NCBI Resou ce Coo dina o s 2017) (PubMed: h ps://www.ncbi.nlm.nih.go /pubmed/) was pe o med, aiming o access i he p o eins, encoded by he genes con aining he selec ed a ian s, we e in ol ed di ec ly o indi ec ly in cellula p ocesses associa ed wi h umo igenesis. (Magalhães 2016) Thus, a e his analysis, 41 a ian s, in di e en genes, we e selec ed o seg ega ion s udies o he disease in he amily. The seg ega ion analysis highligh ed 6 a ian s in di e en genes (MTMR3 (Myo ubula in ela ed p o ein 3), DUSP12 (Dual speci ici y phospha ase 12), LGR6 (Leucine ich epea con aining G p o ein-coupled ecep o 6), NPR2 (Na iu e ic pep ide ecep o 2), TAS1R1 (Tas e 1 ecep o membe 1) and SMG7 (SMG7, nonsense media ed mRNA decay ac o ) ha may a ec cellula p ocesses ele an o colo ec al umo igenesis. (Magalhães 2016) Al hough a la ge numbe o a ian s we e analyzed and e ined along his selec ion sequence, his analysis was no inished, since analysis 1 o ou pu 3 (sec ion 1.4.1.2) was no comple ed and seg ega ion s udies, o wo o he selec ed a ian s in CACNA1S (calcium ol age-ga ed channel subuni alpha1 S) and GIMAP1 (GTPase, IMAP amily membe 1) genes, we e no pe o med. Thus, his s udy will be ca ied ou a he p esen wo k. 1.5 Objec i es The main goal o he p esen s udy was o iden i y and e alua e he po en ial ole o candida e ge mline gene ic a ian s and genes ha may be in ol ed in FCCTX suscep ibili y. Fo his pu pose, his p ojec aimed o s udy speci ic a ian s in candida e genes o FCCTX suscep ibili y, ob ained h ough WES and e alua e hei po en ial pa hogenici y, in o de o iden i y mu a ions ha may p edispose o his synd ome. In addi ion, i was also in ended o elucida e he possible con ibu ion o he co esponding genes o FCCTX, by sea ching o ge mline mu a ions in index pa ien s om FCCTX and FCCTX-like amilies, and o e alua e a possible in ol emen o copy numbe a ia ions ha could e en ually seg ega e wi h he disease. Also, i was engaged he in ol emen o he TPP2 gene, p e iously iden i ied as a possible candida e gene o FCCTX in ano he amily, in heal hy and a ec ed FCCTX pa ien s, by analysis o splicing iso o ms and ela i e quan i ica ion by quan i a i e PCR. 24 Enzyma ic pu i ica ion was pe o med by adding 1μL o The mosensi i e Alkaline Phospha ase - Fas AP (1 U/μL, The mo Scien i ic) and 0.5μL o Exonuclease I-ExoI (20 U/μL, The mo Scien i ic) di ec ly o he PCR p oduc . The samples we e hen subjec ed o a 15 minu e incuba ion a 37°C (op imal enzyme ac i i y empe a u e) ollowed by a 15 minu e enzyme inac i a ion a 85°C in a Ve i i® The mal Cycle (Applied Biosys ems). In cases whe e i was no possible o ob ain a speci ic band, o ins ance, when he PCR op imiza ion p ocess was ine icien o ob ain a speci ic agmen o , when using cDNA samples, he al e na i e splicing phenomenon p oduced mo e han one agmen (iso o m), he band o in e es was excised om he aga ose gel using a scalpel. The ampli ied p oduc was hen pu i ied using he Cu &Spin Gel Ex ac ion Columns (GRiSP) ki . B ie ly, he band excised om he aga ose gel, was placed in he column p o ided by he ki and cen i uged a 6000g a oom empe a u e o 10 minu es. To e alua e he pu i ica ion yield, he elua e was subjec ed o a gel elec opho esis in a 2% (w/ ) aga ose gel, as desc ibed in sec ion 2.2.2.4, wi h he addi ion o 8μL o O ange G 1x o 2μL o he pu i ied p oduc . 2.2.3.2 Sequencing eac ion Fo each ampli ied agmen o be sequenced, a eac ional mix u e was made wi h he ollowing elemen s: 2 μL o he o wa d o e e se p ime (1.6 pmol/μL); 2μL o bu e solu ion - Bu e Sequencing 5x, BigDye® Te mina o 1.1 (Applied Biosys ems) - o main ain a cons an pH; a a iable amoun o mix BigDye™ Te mina o 1.1 Cycle (Applied Biosys ems), depending on he size o he agmen o be sequenced; a a iable amoun o he pu i ied PCR p oduc , which depends on he yield o he PCR eac ion obse ed on aga ose gel and he size o he agmen o be analyzed; and ddH2O o make up a inal 20µl olume. Sequencing eac ion was pe o med on a Ve i i® The mal Cycle (Applied Biosys ems) using he condi ions desc ibed in he Appendix C (Table C.5). The p oduc s ob ained by he sequencing eac ion we e s o ed a 4°C o a maximum o 24 hou s un il DNA p ecipi a ion and pu i ica ion. 2.2.3.3 DNA p ecipi a ion and pu i ica ion a e sequencing eac ion The me hod used o DNA p ecipi a ion and pu i ica ion, a e sequencing eac ion, is based on a sal ing ou eac ion ecommended o he BigDye™ Te mina o ki 1.1 Cycle Sequencing Ki (Applied Biosys ems). This p o ocol aims o ob ain a pu i ied DNA pelle wi hou con aminan s ha could in e e e wi h capilla y elec opho esis and uses h ee eagen s: absolu e e hanol, sodium ace a e and EDTA (E hylenediamine e aace ic acid). Absolu e e hanol and sodium ace a e neu alize nucleic acids cha ges and educe hei solubili y, p omo ing DNA p ecipi a ion, while EDTA, a magnesium ions chela o , inhibi s he enzyme used in he sequencing eac ion. E hanol 70% ( / ) was used o wash he DNA pelle , which was d ied a 37oC. DNA pelle was s o ed a 4°C un il capilla y elec opho esis was pe o med. The de ailed p o ocol o his p ocedu e is desc ibed in Appendix E. 25 2.2.3.4 P epa a ion o sequencing eac ion p oduc s o capilla y elec opho esis D y DNA pelle s, ob ained a e p ecipi a ion and pu i ica ion o he sequencing eac ion, we e esuspended in 17μL o HI-DI o mamide (Applied Biosys ems), used as a capilla y injec ion sol en . Samples we e hen homogenized in a o ex and he o al olume was ans e ed o a 96-well pla e (Pla emax, Axygen) sui able o he au oma ic sequence . The pla e was sealed and placed in he mocycle a 95°C o 5 minu es o dena u e all samples and hen incuba ed on ice o 1-2 minu es. Finally, cen i uga ion was ca ied ou o 2 minu es a 1200 pm, o sample deposi ion and elimina ion o possible ai bubbles. The seal was hen emo ed and he sample pla e was placed on a ABI P ism™ 3130 Gene ic Analyze (Applied Biosys ems) sequencing ins umen , whe e he capilla y elec opho esis was un a 50°C and a 15 KV. 2.2.3.5 Analysis o esul s Capilla y elec opho esis esul s we e ob ained in he o m o an elec ophe og am gene a ed by he Sequencing Analysis so wa e 3.4.1 (Applied Biosys ems). The sequence ob ained was manually compa ed o he e e ence sequence o he a ge gene, wi hd awal om o he Ensembl da abase. 2.2.4 cDNA syn hesis by e e se ansc ip ion eac ion Re e se ansc ip ion (RT) is he syn hesis o complemen a y DNA (cDNA) om a single-s anded RNA empla e, in a p ocess ca alyzed by he e e se ansc ip ase enzyme. Fi s , andom p ime s a e used o bind o he mRNA s ands so ha he e e se ansc ip ase enzyme is able o con e he RNA in o cDNA and hen he cDNA is ampli ica ed by PCR. Each cDNA syn hesis comp ised wo eac ion mix u es. The i s , o a inal olume o 7.75μL, con ained: 0.5μL o hexame s (3 μg/μL, Roche), ha unc ion as andom p ime s; a a iable olume o RNA om each sample (equi alen o 1 μg o RNA); and ddH2O ea ed wi h die hylpy oca bona e (DEPC) (MERK), o make up he olume. This i s eac ion was incuba ed a 70°C o 10 minu es in a Ve i i® The mal Cycle (Applied Biosys ems) and hen placed on ice in o de o add he second eac ion mix u e, consis ing o : 4μL o 5x Fi s S and Bu e (In i ogen), o main ain a cons an pH; 4μL o dNTPs (100mM each, Illus aTM GE Heal hca e); 2μL o di hio h ei ol (DTT) (0.1M, In i ogen), as an enzyma ic s abilize ; 1μL o Supe sc ip ® II Re e se T ansc ip ase (200 U/μL, In i ogen); 0.75μL o RnaseOu ™ Recombinan Ribonuclease Inhibi o (40 U/μL, In i ogen), o he inac i a ion o possible RNases p esen in he eac ion; and 0.5μL o ddH2O ea ed wi h DEPC (MERK) o make up a inal olume o 12.25 μL. Toge he his 2 eac ional mix u es make a inal olume o 20μL. The ubes we e hen placed back in o he he mal cycle , con aining he second eac ion mix u e, o e mina e he eac ion acco ding o he condi ions desc ibed in he Appendix C (Table C.6). The syn hesized cDNA samples we e hen s o ed a -20°C. 2.2.5 Quan i a i e PCR In con en ional PCR, he ampli ied p oduc is de ec ed by an end-poin analysis, by unning DNA on an aga ose gel a e he eac ion has inished. In con as , quan i a i e PCR (qPCR) allows he accumula ion o ampli ied p oduc o be de ec ed and measu ed as he eac ion p og esses, allowing 26 he quan i ica ion o a s a ing empla e wi h accu acy and high sensi i i y o e a wide dynamic ange. This is made possible by including in he eac ion a luo escen molecule ha epo s an inc ease in he amoun o DNA wi h a p opo ional inc ease in luo escen signal, like DNA-binding dyes (e.g. SYBR® G een) and luo escen ly labeled sequence speci ic p ime s o p obes (e.g. TaqMan® p obe). Specialized he mal cycle s equipped wi h luo escence de ec ion modules a e used o moni o he luo escence as ampli ica ion occu s. The measu ed luo escence e lec s he amoun o ampli ied p oduc in each cycle. Because eac ions a e un and da a a e e alua ed in a closed- ube sys em, con amina ion is educed and he need o pos ampli ica ion manipula ion is p ac ically elimina ed. (Bio- Rad Labo a o ies 2006) The qPCR ampli ica ion plo ollows wo phases, an exponen ial phase, we e he amoun o PCR p oduc app oxima ely doubles in each cycle and a pla eau phase, when he eac ion componen s a e consumed, and ul ima ely one o mo e o he componen s becomes limi ing ( igu e 2.1). E en hough p oduc accumula es exponen ially, in an ini ial phase, he luo escence emains a backg ound le els, and canno be de ec ed. E en ually, enough ampli ied p oduc accumula es o yield a de ec able luo escen signal. The cycle numbe a which his occu s is called he h eshold cycle, o C ( igu e 2.1). Because C alues a e measu ed in he exponen ial phase, when eagen s a e no limi ed, eal- ime qPCR can be used o calcula e he ini ial amoun o empla e p esen in he eac ion. These alues depend on he equipmen used baseline and he amoun o empla e p esen a he s a o he eac ion. Wi h a highe amoun o ini ial empla e, ew ampli ica ion cycles will be equi ed o p oduce enough p oduc o gi e a luo escen signal, hus p o iding a lowe C alue. (Bio-Rad Labo a o ies 2006) The e o e, he nume ical alue o he C is in e sely ela ed o he amoun o amplicon in he eac ion. Quan i ica ion o gene exp ession by qPCR can be de e mined by wo me hods: absolu e and ela i e quan i ica ion. Absolu e quan i ica ion is used o quan i y unknown samples by in e pola ing hei quan i y om a s anda d cu e. Rela i e quan i ica ion is used o analyze changes in gene exp ession Figu e 2.1 – G aphic ep esen a ion o a qPCR ampli ica ion plo (F om: Real-Time PCR Applica ions Guide, Bio-Rad Labo a o ies). 27 o copy numbe a ia ion in a gi en sample ela i e o a e e ence sample. In his s udy, only he ela i e quan i ica ion me hod was used. (Bio-Rad Labo a o ies 2006) A widely-used me hod o displaying he ela i e exp ession o a gene is he compa a i e me hod o C , also e e ed o as he 2-ΔΔCT me hod. This me hod elies on 2 majo componen s, a calib a o sample and a e e ence gene. One o he samples is usually chosen as he calib a o , and he exp ession o he a ge gene in all o he samples is exp essed as an inc ease o dec ease ela i e o he calib a o and a e e ence gene is one whose exp ession le el is cons an ac oss all es samples and whose exp ession is no a ec ed by he expe imen al ea men unde s udy (e.g. GAPDH (glyce aldehyde-3- phospha e dehyd ogenase), β-ac in, e c.). (Bio-Rad Labo a o ies 2006) Fo his me hod, he C o he a ge gene needs o be no malized o ha o he e e ence gene ( e ), o bo h he es sample(s) and he calib a o sample(s) (mo e han 1 calib a o sample can be used), acco ding o equa ion 3: ΔC = (C a ge gene - C e ) (Equa ion 3) Then, he ΔC o he es sample(s) needs o be no malized o he ΔC o he calib a o (s), equa ion 4, and inally calcula e he exp ession a io, equa ion 5 (Schmi gen and Li ak 2008): ΔΔC = ΔC ( es ) - ΔC (calib a o ) (Equa ion 4) 2-ΔΔC = No malized exp ession a io (Equa ion 5) The esul ob ained is he old inc ease (o dec ease) o he a ge gene in he es sample ela i e o he calib a o sample and is no malized o he exp ession o a e e ence gene. No malizing he exp ession o he a ge gene o ha o he e e ence gene compensa es o any di e ence in he amoun o sample. (Bio-Rad Labo a o ies 2006) 2.2.5.1 Op imiza ion o qPCR condi ions and qPCR eac ion The 2-ΔΔC me hod assumes ha bo h a ge and e e ence genes a e ampli ied wi h e iciencies nea 100% and wi hin 5% o each o he so, be o e using his me hod (o o any qPCR assay), i is essen ial o de e mine he ampli ica ion e iciencies o he a ge and he e e ence genes. To calcula e he ampli ica ion e iciencies o each a ge / e e ence gene, se ial dilu ions o a e e ence cDNA sample (cell line HCT 116 (ATCC® CCL-247™)) we e pe o med, gi ing a inal concen a ion o 40, 20, 10, 5 and 2.5 ng/μL. Then, eac ions we e pe o med in duplica e on a 96 well pla e (ABI P ism™ Op ical 96 Well Reac ion Pla e), o a inal olume o 15μL, ha ing he ollowing composi ion: 0.75μL o each p ime ( owa d and e e se) ei he a 5 o 7.5 pmol/µL, o access op imal p ime concen a ion; 7.5μL o Powe SYBR® G een PCR Mas e Mix (Applied Biosys ems); 4μL o ddH2O; and 2μL o cDNA ( om he se ial dilu ions), excep in he nega i e con ol whe e he cDNA olume was eplaced by ddH2O. A e wa ds, a s anda d cu e was cons uc ed by plo ing he log o he s a ing quan i y o empla e (40, 20, 10, 5 o 2.5 ng/μL) agains he medium C alue ob ained du ing ampli ica ion o each 28 dilu ion. F om his cu e, an equa ion o he linea eg ession line was wi hd awal and he qPCR e iciency was calcula ed h ough equa ion 6, whe e m is he slope o he line. 𝐸𝑓𝑓𝑖𝑐𝑖𝑒𝑛𝑐𝑦 (𝐸)=10(− 1 𝑚) (Equa ion 6) A e qPCR op imiza ion, all he eac ions we e pe o med o a inal olume o 15μL, as desc ibed abo e, using each p ime pai and cDNA a he op imized concen a ion. The eac ions we e pe o med in iplica es on he ABI PRISM 7900HT Sequence De ec ion Sys em (Applied Biosys ems) and analysis o he esul s was pe o med by SDS 2.4 so wa e (Applied Biosys ems). A e he eac ion, he C alues acqui ed by he so wa e we e impo ed in o an Excel sp eadshee and he ela i e exp ession analysis was pe o med acco ding o he 2-ΔΔC me hod (desc ibed abo e). S a is ical analysis was pe o med using G aphPad P ism so wa e ( e sion 7.03), using he mean and s anda d de ia ion (SD) o he iplica es o each expe imen . 2.2.6 Iden i ica ion o no el FCCTX suscep ibili y a ian s by WES As p e iously de ailed in 1.4.1.2 sec ion, in a p e ious s udy, a WES analysis was ca ied ou on 5 a ec ed ela i es o he L56 amily, o iden i y candida e genes o FCCTX suscep ibili y and subsequen bioin o ma ic analysis o a ian iden i ica ion and s a i ica ion acco ding o hei possible pa hogenici y. Then, his analysis was e ined o selec and educe he numbe o candida e a ian s o seg ega ion s udies wi h he disease. Al hough a la ge numbe o a ian s we e analyzed and e ined, his analysis was no inished, since analysis 1 o ou pu 3 (sec ion 1.4.1.2) was no comple ed and seg ega ion s udies, o wo o he selec ed a ian s in CACNA1S and GIMAP1 genes, we e no pe o med. 2.2.6.1 Selec ion o a ian s iden i ied h ough WES in he L56 amily The selec ion o a ian s, using analysis 1 included in ou pu 3 as a s a ing poin , was made using he guidelines o a ian selec ion p e iously desc ibed in 1.4.1.2.1. A e he applica ion o exclusion c i e ia, he ini ial 12603 a ian s we e educed o 116. Which a e in silico analysis and su eys on p o ein unc ion, we e na ow down o only 2 a ian s o seg ega ion s udies wi h he disease in he amily. 2.2.6.2 Seg ega ion analysis o he selec ed a ian s wi h he disease in he L56 amily A e a ian selec ion, seg ega ion s udies o he selec ed a ian s wi h he disease in he L56 amily we e pe o med, adding he a ian s al eady ound in he CACNA1S and GIMAP1 genes. Th oughou his s udy, he colon pa hology g oup was able o gain access o a o malin- ixed pa a in-embedded (FFPE) no mal mucosa issue om he amily indi idual II.2 (now e e ed as 29 CAs1555), ha was no included in he p e ious analysis since no genomic DNA was a ailable om his pa ien . So, a seg ega ion analysis o he al eady epo ed a ian s was pe o med. Since he ea men o which he FFPE issue is subjec ed un il he inclusion in pa a in causes DNA agmen a ion, he p ime s used o he analysis o pa ien CAs1555 we e designed o ampli y a agmen wi h a size in e io o 200bp and, o he seg ega ion o he new a ian s he p ime s we e designed o ampli y a agmen wi h a size in e io o 600bp, all ollowing he guidelines de ined in 2.2.2.2 and a e desc ibed in Appendix A (Tables A.1 and A.2). Fo seg ega ion analysis wi h he disease o he a ian s ound in he CACNA1S and GIMAP1 genes, plus he 2 ound in analysis 1 o ou pu 3, PCR ampli ica ion was pe o med ollowed by Sange sequencing o each o he agmen s con aining he a ian s, o 12 genomic DNA samples om he L56 amily (9 a ec ed indi iduals and 3 una ec ed indi iduals), as desc ibed in sec ions 2.2.2 and 2.2.3. Since he FFPE issue was se e ely deg aded he seg ega ion analysis o pa ien CAs1555 could only be pe o med o MTMR3 and TAS1R1 genes. This analysis was pe o med as desc ibed abo e bu o 1 DNA sample ex ac ed om a FFPE no mal mucosa issue as desc ibed in 2.2.1.2. PCR condi ions used o ampli ica ion a e desc ibed in Appendix B (Tables B.1 and B.2) and C (Tables C.1 and C.2). 2.2.6.3 Iden i ica ion o no el FCCTX suscep ibili y genes by copy numbe a ia ion analysis based on WES da a Copy numbe a ia ions (CNVs) ep esen a class o a ia ion in which segmen s o he genome can be duplica ed (gains) o dele ed (losses). Resea ch o inhe i ed CNVs ha e been associa ed wi h many disease condi ions, including cance and inhe i ed diso de s. Thus, his echnique can be a p omising app oach in he iden i ica ion o no el FCCTX suscep ibili y genes. Copy numbe a ia ion analysis in he L56 amily Al hough a WES analysis had al eady been pe o med o he L56 amily in he sea ch o candida e genes o FCCTX suscep ibili y ano he app oach was used – a copy numbe a ia ion (CNV) analysis in he amily. Thus, om he BAM ile e ie ed om he WES analysis om he L56 amily and ano he amily wi h hy oid cance (included in he IPOFG, EPE p ojec - Exome sequencing p ojec /Familial and Indi idual cance isk- iden i ica ion o no el genes. (desc ibed in 1.4.1.2.1)), a bioin o ma ic analysis was pe o med by Bioin 2Bio Lda. B ie ly, his CNV bioin o ma ic analysis was done in o de o encompass ch omosomal egions o known genes, by compa ing he numbe o eads o a gi en amplicon in each sample o he L56 amily, o he a e age numbe o eads obse ed o he con ol g oup ( hy oid samples all oge he ). Then, amplicons we e classi ied as ha ing a ‘To al Dele ion’ scena io, when he numbe o eads o a gi en amplicon in each L56 amily sample we e ≤60% o he a e age numbe o eads obse ed o he con ol g oup. The esul ing numbe o amplicons wi h a ‘To al Dele ion’ scena io, compa ing wi h he con ol g oup, was 296. 30 2.2.6.3.1.1 Selec ion o amplicons de i ed om CNV analysis The amplicons iden i ied as a ‘To al Dele ion’ om he bioin o ma ic analysis, we e subjec ed o an addi ional analysis o u he e inemen o amplicons o in e es . So, o all he 296 amplicons wi h a ‘To al Dele ion’ scena io, he numbe o minimum eads in he con ol g oup was analyzed agains he numbe o eads o each o he 5 samples om L56 amily, o exclude amplicons we e he numbe o eads o each sample, did no p esen signi ican di e ences when compa ing o he minimum numbe o eads in he con ol g oup (i.e. in cases whe e he numbe o eads o 1 o mo e samples we e highly simila (al hough in e io ) o he numbe o minimum eads in he con ol g oup). A e his selec ion, 210 amplicons emained. And gi en he ch omosome coo dina es (GRCh38) o he amplicons, a su ey was conduc ed using he Ensembl da abase, whe e, o each o he 210 amplicons, was epo ed whe he hey include: only in onic sec ions o he gene; pa s o exonic and in onic sec ions o he gene, and how much o he exonic sec ion was included in he amplicon; a ull exon; a ull exon and pa s o he adjacen exon; o mo e han one ull exon. 2.2.7 Ge mline mu a ion analysis o candida e genes o FCCTX suscep ibili y A p e ious s udy, desc ibed in 1.4.1.2 and 1.4.1.2.1, iden i ied 6 gene ic a ian s in he MTMR3, DUSP12, LGR6, TAS1R1, NPR2 and SMG7 genes, as possible FCCTX con ibu o s. To access i hese genes, he e e e ed as candida e genes, could play an impo an ole in FCCTX, a ge mline mu a ion analysis was conduc ed in a se ies o index pa ien s om FCCTX and FCCTX-like amilies ha ul ill he CA o Be hesda guidelines 4 o 5 (c i e ia ha sugges s a amily his o y), who ail o p esen any ge mline mu a ion in he MMR genes. Since all candida e genes p esen an ex ensi e nucleo ide sequence, apa om TAS1R1 ( ha p esen s only 6 exons and mu a ion analysis was pe o med using DNA samples), he mu a ion analysis was pe o med a a cDNA le el ins ead o DNA, which allowed a educ ion o he numbe o p ime s used and agmen s o be ampli ied. 2.2.7.1 P ime design o ampli ica ion o candida e genes o FCCTX suscep ibili y Fo TAS1R1 mu a ion analysis, p ime s we e designed a a DNA le el, ollowing he guidelines desc ibed in 2.2.2.2, o ampli y each one o he 6 exons. Since he las exon (6) as a leng h o 1105bp, an addi ional o wa d p ime (wi h an app oxima e dis ance o 500bp o he ini ial o wa d p ime ) was designed o o e come he possibili y ha he agmen could no be accu a ely sequenced using only he o iginal o wa d and e e se p ime s o his agmen . Fo MTMR3, DUSP12, LGR6, NPR2 and SMG7, p ime s we e designed o cDNA ampli ica ion in o de o educe he numbe p ime o p ime s and agmen s o be ampli ied, since he majo i y o hese genes p esen s mo e han 10 exons (e.g. he MTMR3 iso o m wi h he highes exon numbe as 20 exons). P ime s we e gene a ed ollowing he guidelines desc ibed in 2.2.2.2, o ampli y he coding egions o all he known p o ein coding ansc ip s (ob ained om he Ensembl da abase) o each candida e gene, in o e lapping cDNA agmen s, like shown in igu e 2.2. Gi en igu e 2.2 as an example, mul iple se s o ‘ex e nal’ p ime s we e designed o ampli y agmen s o app oxima ely 1000bp 31 o co e all he p o ein coding egion o he gene. The i s se o p ime s o each gene was always designed o inco po a e he ansla ion ini ia ion codon: ATG. Howe e , o DUSP12 ( agmen A) and LGR6 ( ansc ip id ENST00000439764 – agmen E)) he i s se o p ime s had o be designed o DNA ampli ica ion, because he sequences (a cDNA) p io o he ATG sequence ailed o ensu e a good p ime design. Each o he agmen s, gene a ed wi h he ex e nal p ime s, we e designa ed a an alphabe ic o de : i s p ime pai : A; second p ime pai : B, e c., and o each agmen , an addi ional se o ‘in e nal’ p ime s we e designed, a o wa d and a e e se p ime in he middle o he esul ing agmen , o p e en cases whe e he agmen is oo long o be accu a ely sequenced using only he ‘ex e nal’ p ime s. All he p ime s used in he mu a ional analysis o he candida e genes a e desc ibed in he Appendix A (Tables A.3, A.4 and A.5). 2.2.7.2 Mu a ion analysis o candida e genes o FCCTX suscep ibili y Ge mline mu a ion analysis o he candida e genes comp ised h ee s eps. Fi s cDNA syn hesis om pa ien ’s RNA samples ( o agmen s ha we e designed o be ampli ied a a cDNA le el), was pe o med as desc ibed in 2.2.4, ollowed by i s PCR ampli ica ion (o he cDNA o DNA samples) and sequencing analysis acco ding o he me hods desc ibed in sec ions 2.2.2 and 2.2.3. Do o ime es ic ions, his mu a ion analysis could no be pe o med o all he selec ed genes, hus he analysis was ini ia ed wi h MTMR3, ha was one o he mos p omising genes o FCCTX suscep ibili y. (Magalhães 2016) Followed by TAS1R1, LGR6 and DUSP12. Fo MTMR3, 11 cDNA samples we e analyzed o all he agmen s, plus an addi ional 7 samples o agmen s B, D and E, and 15 samples o agmen E ( ha e ealed he mos p omising a ian s). All 6 exons o TAS1R1 we e Figu e 2.2 – Schema ic ep esen a ion o how he p ime s o cDNA ampli ica ion o he candida e genes we e designed. The numbe and leng h o he exons a e me ely ep esen a i e. F: Fo wa d, R: Re e se, ~: app oxima ely. 32 analyzed o 26 genomic DNA samples. Fo LGR6 12 DNA samples we e analyzed o agmen E and 11 DNA samples we e analyzed o agmen A o DUSP12. All he selec ed pa ien s o ge mline mu a ion analysis a e index indi iduals ha ul ill he AC o Be hesda guidelines 4 o 5 (c i e ia ha sugges s a amily his o y), ha do no p esen any ge mline mu a ion in he MMR genes wi hin he amily. The sequences ob ained we e manually compa ed o he e e ence ansc ip sequences om he Ensembl da abase (Buil GRCh38) in o de o iden i y al e a ions. All eac ions we e pe o med in a Ve i i® The mal Cycle (Applied Biosys ems) o UNO96 he mocycle (VWR), acco ding o he condi ions desc ibed in he Appendix B (Tables B.3 and B.4) and C (Tables C.1 and C.3). 2.2.7.3 Mu a ional analysis o he MTMR3 c.1933C>T a ian in heal hy indi iduals The a ian c.1933C>T, al eady iden i ied in he L56 amily (Magalhães 2016) was also obse ed in ano he sample, hus o ule ou he possibili y ha his a ian could ha e a highe equency in he popula ion in s udy han he one epo ed in he da abases, a pool o 50 DNA samples om po uguese indi iduals 50 po uguese indi iduals ( ha had al eady ep oduced allele equencies desc ibed in he da abases o o he mu a ions) we e analyzed o his a ian . PCR ampli ica ion and sequencing analysis we e pe o med acco ding o he me hods desc ibed in sec ions 2.2.2 and 2.2.3. All eac ions we e pe o med in a Ve i i® The mal Cycle (Applied Biosys ems), acco ding o he condi ions desc ibed in he Appendix B (Table B.5) and C (Table C.1), using he p ime s desc ibed in Appendix A (Table A.6). 2.2.8 Po en ial pa hogenic ole o TPP2 gene P e ious s udies ( epo ed in 1.4.1.1.1.1) e ealed e idence o an al e na i e non-desc ibed ansc ip (13a) in he TPP2 gene, ha could play a ole in FCCTX suscep ibili y. To e alua e he po en ial pa hogenic ole o his al e na i e 13a exon, a gene exp ession analysis by qPCR, a mu a ion analysis and a p o ein unca ion es we e pe o med. 2.2.8.1 TPP2 gene exp ession analysis by qPCR qPCR was used o quan i ied TPP2 gene exp ession o he al e na i e 13a ansc ip as well as he w ansc ip (13/14), using GAPDH as he e e ence gene. The p ime s we e designed ollowing he guidelines desc ibed in 2.2.2.2 wi h he addi ion o 3 ules: o each agmen o be ampli ied a leas one o he p ime s mus be a an exon/exon junc ion; he agmen mus ha e 60 o 150bp; and each p ime ’s Tm should be as close as possible o 60°C. All p ime s, excep one, we e designed p io o his s udy, and a e desc ibed in Appendix A (Table A.7). All RNA samples ex ac ed we e subjec ed o cDNA syn hesis by RT-PCR, as desc ibed in 1.2.4. In he analysis 18 cDNA samples ob ained om pe iphe al blood we e included: 6 om a FCCTX amily (L55 – ha was cha ac e ized wi h he TSG+ sub ype), 6 om a ec ed indi iduals (wi h ca cinoma, adenoma o mu a ions in he MMR genes) and 6 om heal hy indi iduals (2 o hem used as calib a o ). 33 qPCR e iciency was accessed and all he eac ions and da a analysis we e pe o med as desc ibed in 2.2.5.1. P ime s we e used a 5 pmol/ul and cDNA concen a ion was 5 ng/µl. qPCR condi ions a e desc ibed in Appendix B (Table B.6) and C (Table C.7). 2.2.8.2 Splicing analysis o TPP2 To access any al e na i e splicing al e a ions o he TPP2 ansc ip s, in he egions ha con ained he al e na i e 13a and 23a exons, an analysis o he TPP2 gene was pe o med using cDNA, syn he ized as desc ibed in 2.2.4, om RNA ex ac ed om FCCTX pa ien ’s pe iphe al blood, as desc ibed in 2.2.1.1. Subsequen ly, PCR ampli ica ion was done encompassing exon 2 o 29 using he Expand Long Templa e PCR Sys em (Roche), as desc ibed in 2.2.2.3. Since his PCR p oduced 2 dis inc bands, bo h bands we e excised om he gel and pu i ied as desc ibed in 2.2.3.1. Once hese bands we e pu i ied hey we e sequenced using he o wa d p ime in exon 13 and he o wa d p ime in exon 23, as desc ibed in 2.2.3.2 o 2.2.3.5. Howe e , his sequencing me hodology was no always e ec i e so ano he app oach was used: he elu ion p oduc ob ained om he pu i ied bands was dilu ed o 1:10 and subjec ed o a new PCR ampli ica ion, a nes ed PCR, using: 1) a pai o p ime s (13+14) ha ampli ied he 13a/14 and/o he 13/14 junc ions and 2) a pai o p ime s (23+27) ha ampli ied he 23/24 junc ion (whe e he inse ion o an exon, 23a, is desc ibed), and we e subsequen ly sequenced. PCR ampli ica ion and sequencing analysis we e pe o med acco ding o he me hods desc ibed in sec ions 2.2.2 and 2.2.3. All he p ime s used a e desc ibed in Appendix A (Table A.8) and he PCR condi ions in Appendix B (Table B.7) and C (Tables C.1 and C.4). The sequences ob ained we e compa ed o he TPP2 genomic and ansc ip sequences om he Ensembl da abase in o de o iden i y possible splicing al e a ions. 2.2.8.3 S udy o he TPP2 al e na i e 13a exon using he p o ein unca ion es echnique The al e na i e 13a exon ound in TPP2 gene has a s op codon wi hin is sequence. Thus, o see i his s op codon ga e ise o a unca ed p o ein, a p o ein unca ion es was pe o med. P o ein unca ion es The p o ein unca ion es (PTT) o in i o syn hesized p o ein assay, is a use ul app oach o de ec mu a ions ha gene a e sho ened p o eins, mainly p ema u e ansla ion e mina ion, using DNA o RNA as a s a ing poin . PTT is composed o ou s eps: i) isola ion o nucleic acid, ei he genomic DNA o RNA; ii) ampli ica ion o a speci ic egion o he gene o in e es ; iii) in i o ansc ip ion and ansla ion o he p oduc o he ampli ica ion eac ion; and i ) de ec ion o he ansla ion p oduc s. T ansla ion- e mina ing mu a ions gene a e ansla ion p oduc s ha a e sho e and can be easily dis inguished om he ull-leng h p o ein p oduc o he no mal allele ( igu e 2.3). (Beckle 2005) Ampli ied sequences o PTT can be gene a ed ac oss he en i e p o ein coding sequence o o ampli y speci ic exons. The key ea u e o he PTT is a speci ically designed PCR p ime ha allows 40 o he p e iously selec ed a ian s in DUSP12, MTMR3, NPR2, TAS1R1, SMG7 and LGR6 genes. (Magalhães 2016) The seg ega ion analysis o he MTMR3 and TAS1R1 a ian s in he CAs1555 pa ien , con i med he p esence o hese 2 a ian s. Figu e 3.2 exhibi s all he selec ed a ian s de ec ed by WES ound o seg ega e wi h he disease in L56 amily, acco ding o each analysis seg ega ion pa e n, wi h he addi ion o he a ian s ound o pa ien CAs1555 (II.2). Figu e 3.2 - L56 amily pedig ee wi h he seg ega ion esul s o all he selec ed a ian s ha seg ega ed wi h he disease. (con inues nex page) Table 3.4 - Cha ac e iza ion o he selec ed a ian s ha e ealed a seg ega ion pa e n wi h he disease acco ding o each analysis. Da abase/so wa e used a ailable a : NCBI: h ps://www.ncbi.nlm.nih.go ExAC da abase: h p://exac.b oadins i u e.o g Ensembl: h p://www.ensembl.o g SIFT/PolyPhen: h p://www.ensembl.o g/Homo_sapiens/Tools/VEP P o ean: h p://P o ean.jc i.o g Mu a ion Tas e : h p://www.mu a ion as e .o g Ensembl ExAC Ensembl ExAC SIFT/ PolyPhen Mu a ion as e P o ean MTMR3 22:30019592 c.1933C>T; p.A g645T p Missense s138823197 0.02 0.02 0.03 0.03 Dele e ious/ P obably damaging Disease Causing (AA Sco e:101) Dele e ious (Sco e: -4.34) TAS1R1 1:6577058 c.1582C>T; p.Leu528Phe Missense s560288110 - - - - Dele e ious/ P obably damaging Disease Causing (AA Sco e:22) Dele e ious (Sco e: -3.13) 3 3 CACNA1S 1:201058410 c.3607G>A; p.Asp1203Asn Missense s367956917 0.001 0.002 0.001 0 Tole a ed/ Benign Disease Causing (AA Sco e: 23) Neu al (Sco e: 0.16) 4NPR2 9:35807330 c.2644G>A; p.Val882Ile Missense s55700371 0.01 - 0.01 0.01 Dele e ious/ Possibly damaging Disease Causing (AA Sco e:29) Neu al (Sco e: -0.90) 3LGR6 1:202318327 c.2024G>A; p.A g675Gln Missense s767586087 0.001 - 0.002 - Tole a ed/ Benign Disease Causing (AA Sco e:43) Neu al (Sco e: -0.86) SMG7 1:183544963 1970C>T; p.P o657His Missense s34426362 0.2 0.4 0.7 0.6 Dele e ious low con idence/ P obably damaging Disease Causing (AA Sco e:77) Dele e ious (Sco e: -2,66) DUSP12 1:161749807 c.6_7insTTG; p.Leu2_Leu3ins In ame inse ion - - - - - - Regula o y ea u e Neu al (Sco e: -0.47) Va ian ype 4 5 4 4 Analysis Ou pu 1 De ined s (NCBI) Global allele equency (%) Eu opean allele equency (%) Gene Va ian 's ch omosomal posi ion (GRCh38) Iden i ied a ian In silico p edic ion 41 3.1.3 Copy numbe a ia ion analysis in he L56 amily based on WES da a The copy numbe a ia ion analysis in he L56 amily came as an addi ional app oach o exclude he possibili y o a gi en CNV being he cause o he disease in he FCCTX amily. The bioin o ma ic analysis de eloped o CNV analysis (pe o med by Bioin2Bio) o he 5 pa ien s ha had been p e iously analyzed by WES, e ealed 296 amplicons wi h possible dele ion when compa ed o a con ol g oup (a se o samples om a hy oid cance amily). This numbe was hen educed o 210 a e applica ion o selec i e c i e ia ha we e based on he numbe o eads o each sample agains he minimum numbe o eads o he con ol g oup (sec ion 2.2.6.3). And, a e an assessmen o he genomic egions included in he 210 selec ed amplicons, based on a compa ison o hese wo alues wi h he numbe o eads exhibi ed by he 5 h sample included in he exome sequencing, he inal numbe o amplicons was e ined o 22 ( able 3.5). This 5 h sample (pa ien 5) was sequenced in a di e en un om he o he 4 samples and, o a gi en egion, despi e a lowe numbe o eads o he o he 4 samples in compa ison wi h he minimum alue obse ed o hy oid samples, a highe numbe o eads o pa ien 5 excluded ha egion as a possible CNV. Table 3.5 – Resul s om he selec ion o amplicons de i ed om CNV analysis. Iden i ied amplicon (GRCh38) Amplicon leng h (bp) Gene Ch omosome Ch omosomal egion 1 10413107 o 10413331 224 PGD 1 11677344 o 11677689 345 MAD2L2 2 219307734 o 219307949 215 PTPRN 2 219333080 o 219333256 176 RESP18 2 219491758 o 219491955 197 SPEG 2 219611601 o 219612062 461 STK11IP 3 52706615 o 52706901 286 SPCS1 4 682678 o 682878 200 MFSD7 4 1238016 o 1238317 301 CTBP1 4 184850967 o 184851170 203 MIR3945HG 11 47486700 o 47486906 206 CELF1 11 72605126 o 72605296 170 PDE2A 12 56021464 o 56021661 197 IKZF4 13 32732035 o 32732226 191 PDS5B 13 97979806 o 97980021 215 IPO5 14 105382795 o 105383001 206 PACS2 15 82665416 o 82665536 120 AP3B2 16 89187437 o 89187616 179 CDH15 16 89510422 o 89510604 182 SPG7 17 29618796 o 29619239 443 CORO6 19 49624916 o 49625252 336 PRR12 20 38641723 o 38641911 188 ARHGAP40 ( igu e 3.2 – con inua ion) Pa ien s highligh ed in colo s we e selec ed o WES bioin o ma ic analysis acco ding o each analysis sub- ype. W i en in ed a e he a ian s de i ed om analysis 1, in blue om analysis 3, in o ange om analysis 4 and in g een om analysis 5. Only indi iduals wi h a labo a o y iden i ica ion numbe (LXXX, LXXXX o CAsXXXX) had biological ma e ial a ailable. The age a diagnosis (AD, in yea s, y) and espec i e pheno ypic cha ac e iza ion a e desc ibed o he a ec ed indi iduals. * - seg ega ion analysis only pe o med o MTMR3 and TAS1R1; AD: age a diagnosis (ca cinoma o adenoma); y: yea s; ADC: adenoca cinoma; TALGD: ubula adenoma wi h low- g ade dysplasia; TAHGD: ubula adenoma wi h high-g ade dysplasia; HP: hype plas ic polyp; SSALGD: sessile se a ed adenoma wi h low- g ade dysplasia. 42 3.2 Ge mline mu a ion analysis o candida e genes o FCCTX suscep ibili y The iden i ica ion o he a ian s ha seg ega ed wi h he disease in he L56 amily can gi e new insigh s on his amily suscep ibili y o FCCTX. In o de o cla i y he po en ial con ibu ion o he newly iden i ied candida e genes o his synd ome, a se o 34 FCCTX and FCCTX-like amilies was selec ed o a ge mline mu a ion analysis. 3.2.1 MTMR3 The mu a ional analysis o he MTMR3 gene in 34 index pa ien s om he selec ed FCCTX and FCCTX-like amilies e ealed 3 missense a ian s, in di e en pa ien s ha we e no p e iously epo ed o displayed a low allele equency ( igu e 3.3). These 3 a ian s we e all ound ei he a exon 16 o 17, which may indica e a mu a ion ho spo egion in his gene, since o es o he gene, samples did no show ele an mu a ions. Table 3.6 esumes he a ian s ound in MTMR3 and i s pa hogenic in silico p e ision. The a ian ound in sample L2127, c.1933C>T (p.A g645T p), is he same a ian ound in he L56 amily, ein o cing he possibili y ha his speci ic a ian could be associa ed wi h he FCCTX pheno ype, since all he p edic i e so wa e cha ac e izes his a ian as pa hogenic. The a ian s iden i ied in samples L2128 and L2219, ha e no been desc ibed o da e in he a ailable mu a ion da abases. The c.1811C>A (P o604His) a ian , ound in L2128, is classi ied as po en ially pa hogenic in 2/3 o he p edic i e mu a ion so wa e (SIFT/PolyPhen and Mu a ion Tas e ). In P o ean his mu a ion is e e ed as neu al, howe e he sco e gi en (-2.43) is eally close o he so wa e’s de aul h eshold o de ining a mu a ion as dele e ious (a mu a ion is de ined as dele e ious wi h a sco e ≤ -2.50). The c.2131G>A (p.Gly711Se ) a ian , ound in L2219, is a ed as non-pa hogenic by all he so wa e used. Since he a ian c.1933C>T (p.A g645T p) was ound no only in he L56 amily bu also in sample L2127, al hough i is desc ibed wi h a low equency in he Eu opean popula ion (19/65366, 0.03%), a con ol popula ion o 50 Po uguese indi iduals was analyzed o his a ian , o e alua e he possibili y ha his a ian could ha e a highe equency in he Po uguese popula ion han he epo ed in he da abases. In his analysis, no indi idual p esen ed he a ian . Figu e 3.3 - Pa ial elec ophe og ams ep esen ing he 3 a ian s iden i ied in he MTMR3 gene. In he uppe le co ne is indica ed he sample, he exon whe e he a ian was de ec ed and i s cha ac e iza ion. The DNA sequences ( o wa d di ec ion), in black, co espond o he no mal gene sequence while he ed bases indica e he al e a ions ound. All mu a ions we e de ec ed in he e ozygosi y. 43 Table 3.6 - Cha ac e iza ion o he mos ele an a ian s ob ained in he mu a ional analysis o he MTMR3 gene, o he 34 index pa ien s o FCCTX and FCCTX-like amilies wi hou an iden i ied mu a ion in he MMR genes. Sample Exon Iden i ied a ian Va ian ype De ined s (NCBI) Global allele equency (%) Eu opean allele equency (%) In silico p edic ion Ensembl ExAC Ensembl ExAC SIFT/ PolyPhen Mu a ion as e P o ean L2127 17 c.1933C>T; p.A g645T p Missense s138823197 0.02 0.02 0.03 0.03 Dele e ious /P obably damaging Disease Causing (AA Sco e:101) Dele e ious (Sco e: - 4.34) L2128 16 c.1811C>A; P o604His Missense - - - - - Dele e ious /Possibly damaging Disease Causing (AA Sco e:77) Neu al (Sco e: - 2.43) L2219 17 c.2131G>A; p.Gly711Se Missense - - - - - Tole a ed/ Benign Polymo phism (AA Sco e:56) Neu al (Sco e: - 0.13) Da abase/so wa e used a ailable a : NCBI: h ps://www.ncbi.nlm.nih.go ExAC da abase: h p://exac.b oadins i u e.o g Ensembl: h p://www.ensembl.o g SIFT/PolyPhen: h p://www.ensembl.o g/Homo_sapiens/Tools/VEP P o ean: h p://P o ean.jc i.o g Mu a ion Tas e : h p://www.mu a ion as e .o g Besides hese 3 a ian s, almos all he analyzed samples o agmen s B and D (see Appendix A: Table A.5) p esen ed al e na i e splicing, ep esen ed in igu e 3.4, be ween exons 9 o 11 and 12 o 15, non-desc ibed o da e in he a ailable da abases. These al e a ions we e always accompanied by he no mal ansc ip . Only samples L1667 and E436, in all he 19 analyzed samples o hese agmen s, did no p esen such al e a ions. Sample L1908 p esen ed he splicing al e a ions, al hough wi h much less peak in ensi y (in he Sange sequencing elec ophe og ams), when compa ing o he no mal ansc ip , sugges ing much lowe con ibu ion o he splicing iso o m. Samples L1368 and L2208 p esen ed he same p opo ion be ween he splicing al e a ions and he no mal ansc ip and sample L1310 had a supe io amoun o he spliced iso o ms. The emaining samples showed a sligh lowe con ibu ion o he splicing iso o ms in compa ison wi h he no mal ansc ip and all he samples wi h hese al e a ions p esen ed all he al e na i e spliced iso o ms. No mu a ions we e ound ha could explain hese splicing al e a ions. The esul s o he comple e mu a ional analysis o MTMR3 a e summa ized in Appendix G. Figu e 3.4 – Rep esen a i e scheme o he al e na i e spliced iso o ms ound in agmen s B and D o MTMR3. The g een a ows ep esen ex e nal p ime s o agmen B and he yellows o agmen D. The squa ed boxes ep esen exons and is espec i e numbe . Exons size a e no o scale. 44 3.2.2 TAS1R1 Fo TAS1R1 gene, he mu a ional analysis in a se o 26 indi iduals, e ealed 5 ele an a ian s in di e en pa ien s, all desc ibed in he Ensembl and ExAC da abases ( able 3.7). All a ian s we e iden i ied in he e ozygosi y excep o he c.1261-90C>T a ian , in in on 3 o sample L1291, ha was ound in homozygosi y. This a ian p esen s an allele equency o 1.7% which may indica e a polymo phism, howe e in is homozygo ic o m, he geno ype equency (T/T) is 0.04%. The Mu a ion Tas e so wa e does no p edic a pa hogenic consequence and he HSF so wa e (Human Splicing Finde , HSF: h p://www.umd.be/HSF3/index.h ml) does no an icipa e an impac on splicing, which makes his a ian likely non-pa hogenic. Table 3.7 - Cha ac e iza ion o he mos ele an a ian s ob ained in he mu a ional analysis o he TAS1R1 gene, o he 26 index pa ien s o FCCTX and FCCTX-like amilies wi hou an iden i ied mu a ion in he MMR genes. Sample Exon Iden i ied a ian Va ian ype De ined s (NCBI) Global allele equency (%) Eu opean allele equency (%) In silico p edic ion Ensembl ExAC Ensembl ExAC SIFT/ PolyPhen Mu a ion Tas e P o ean L108 3 c.1067C>G; p.Se 356Cys missense s41307749 0.2 0.2 0.2 0.2 Dele e ious/ P obably damaging Polymo phism (AA Sco e:112) Neu al (Sco e: - 1.24) L701 3 c.1043C>T; p.Ala348Val missense s147969126 0.1 0.07 0 0 Tole a ed/ Benign Polymo phism (AA Sco e:64) Neu al (Sco e: - 0.48) L1121 2 c.329C>T; p.Ala110Val missense s41278020 1.2 1.18 2 1.59 Tole a ed/ P obably damaging Polymo phism (AA Sco e:64) Neu al (Sco e: - 2.13) L1291 In on 3 c.1261- 90C>T * in onic s113004821 1.7 - 1.7 - - Polymo phism - L1473 3 c.953T>C; p.Ile318Th missense s754592015 0.001 - 0.001 - Dele e ious/ P obably damaging Polymo phism (AA Sco e:89) Dele e ious (Sco e: - 3.05) * Va ian ound in homozygosi y Da abase/so wa e used a ailable a : NCBI: h ps://www.ncbi.nlm.nih.go ExAC da abase: h p://exac.b oadins i u e.o g Ensembl: h p://www.ensembl.o g SIFT/PolyPhen: h p://www.ensembl.o g/Homo_sapiens/Tools/VEP P o ean: h p://P o ean.jc i.o g Mu a ion Tas e so wa e: h p://www.mu a ion as e .o g The c.1067C>G (p.Se 356Cys) a ian , in L108, p esen s a low equency and is classi ied as dele e ious/p obably damaging by he SIFT/PolyPhen so wa e, al hough he Mu a ion Tas e and P o ean so wa e do no classi y his a ian as pa hogenic, he Mu a ion Tas e AA sco e is 112. This sco e e alua es he deg ee o di e ence be ween he o iginal and he new amino acid, by aking in o accoun he physicochemical cha ac e is ics o he amino acids, anging om 0 o 215. So, a highe sco e like 112, can indica e a signi ican di e ence in he physicochemical cha ac e is ics o he new amino acid when compa ing o he no mal one ( om a se ine o a cys eine). As o po en ial splicing al e a ions, he Mu a ion Tas e so wa e does no p edic any splicing al e a ions, howe e he HSF so wa e p edic s he c ea ion o an exonic splicing silence si e, which can lead o splicing al e a ions. The a ian c.1043C>T (p.Ala348Val), in L701, is no classi ied as pa hogenic by he p edic i e so wa e, howe e bo h he Mu a ion Tas e and HSF so wa e p edic possible splicing al e a ions wi h a high sco e a ia ion be ween w and mu an (splicing dono inc eased, w :0.71/mu :0.91 – Mu a ion Tas e ) (ac i a ion o an exonic c yp ic dono si e, w :46.37/mu :73.2 - HSF). The highe he sco e a ia ion, mo e likely i is o he a ian o gene a e a splicing al e a ion. 45 Al hough he c.329C>T (p.Ala110Val) a ian , in L1121, is conside ed as p obably damaging by PolyPhen i s equency is highe han 1%, which may indica e a polymo phism. The c.953T>C (p.Ile318Th ) a ian , ound in L1473, exhibi s he highes pa hogenici y p edic ions, ha ing a dele e ious p edic ion by SIFT and P o ean so wa e, and p obably damaging by PolyPhen. The Mu a ion Tas e sugges s his a ian is a polymo phism, bu p esen s an ele a ed AA sco e (89) and a possible splicing dono inc eased (w :0.59/mu :0.81). The HSF does no p edic an impac on splicing o his a ian . The comple e mu a ional analysis o his gene is summa ized in Appendix H. 3.2.3 DUSP12 and LGR6 Fo DUSP12 and LGR6, due o he a ailable ime, he mu a ional analysis was only pe o med o one o he agmen s in 11 index pa ien s o FCCTX and FCCTX-like amilies. Fo DUSP12, only agmen A (see Appendix A: Table A.5) was analyzed and no al e a ion was ound. Fo LGR6, he only analyzed agmen was E (see Appendix A: Table A.5), which e ealed one ele an a ian in sample CAs1964: c.213-11224C>T, al eady epo ed wi h he s: s79821910 (NCBI). Howe e , his a ian displays a global allele equency o 2% and 3% in he Eu opean popula ion, hus being conside ed a polymo phism. Howe e , hese 2 genes should no be disca ded as possible FCCTX con ibu o s, since his analysis was only pe o med in a sho po ion o he genes and o a small numbe o samples, hus a mo e ex ensi e analysis is equi ed. The comple e mu a ional analysis o bo h agmen s o hese 2 genes is summa ized in Appendix I. 3.3 TPP2 ole in FCCTX suscep ibili y 3.3.1 Gene exp ession analysis P e ious s udies ha e epo ed di e ences in gene exp ession be ween an al e na i e TPP2 ansc ip (13a) and i s w ansc ip (he e e e ed as 13/14) in samples de i ed om pa ien s wi h di e en clinical spec a. (Pe ei a 2014) Thus, in he p esen s udy, his exp ession analysis was pe o med in 3 dis inc g oups o obse e possible co ela ions. The i s g oup was composed om 6 a ec ed pa ien s (L950, L905, L926, L447, L1544 and L295) o a FCCTX amily, cha ac e ized as TSG+ (L55); he second g oup included 6 a ec ed pa ien s (L1591, L1592, L1732, CAs2000, L1642 and L5), wi h he ollowing clinical and molecula ea u es: L1591 and L1592 a e a ec ed wi h adenomas, bu ha e no e idence o a mu a ion in he MMR genes (associa ed wi h LS); L1732 and L1642 ha e an iden i ied mu a ion in he MMR genes, bu so a ha e no p esen ed adenomas; and CAs2000 and L5 bo h p esen ca cinoma bu CAs2000 has a MMR gene mu a ion. The hi d g oup p esen ed 4 heal hy indi iduals (L1568, L1567, L1604 and L1829). The TPP2 gene exp ession analysis ( igu e 3.5) e ealed ha o amily L55 all indi iduals p esen a simila exp ession be ween he al e na i e and he w ansc ip excep o L447, ha p esen s an o e exp ession o he w ansc ip wi h almos a o al educ ion o he al e na i e, and L1544 ha p esen s an in e se ela ionship, ha ing he al e na i e ansc ip o e exp essed o e he w . 46 In he a ec ed g oup 4/6 pa ien s p esen ed a 13a o e exp ession and in 3/4 (L1591, L1592 and CAs2000) he e was an almos o al educ ion o he w ansc ip , while o he 2 emaining samples seems o be a sligh inc ease o w exp ession. All he pa ien s ha de eloped adenomas, wi h he excep ion o L447, seem o ha e simila exp ession o he w and 13a exp ession o e en an inc eased 13a exp ession, bu ne e a signi ica i e o e exp ession o he w ansc ip . In all heal hy con ol samples, he w exp ession was a leas 1- old highe han he 13a exp ession, ein o cing he possibili y ha he TPP2 gene, mo e speci ically he balance o imbalance be ween he 13a al e na i e ansc ip and he w could play a ole in colo ec al umo igenesis. 3.3.2 Splicing analysis The TPP2 gene has 2 di e en ansc ip s/iso o ms epo ed in he Ensembl da abase ha di e om he inse ion o an exon (he e e e ed as 23a) be ween exons 23 and 24. As al eady s a ed, he inclusion o an al e na i e exon (13a) lanked by he 13 and 14 exons, was epo ed in p e ious s udies by he colon pa hology g oup. Figu e 3.6 schema ically ep esen s he epo ed TPP2 ansc ip s, which will be e e ed as w , and he no el 13a ansc ip . Rela i e exp ession Figu e 3.5 – Rela i e gene exp ession analysis by qPCR o he w (13/14) and an al e na i e ansc ip (13a) o he TPP2 gene. E o ba s ep esen SD. Calib a o – mean ela i e exp ession o wo no mal samples used as calib a o . N=2; *p<0,05; **p<0,01; ***p<0,001. ** ** * *** ** * * ** ** ** ** ** *** 47 In o de o obse e he p esence o absence o hese iso o ms and i he e was any exclusi i y be ween he occu ence o he 13a iso o m and one o he al eady epo ed, blood samples om 6 FCCTX pa ien s we e subjec ed o a splicing examina ion on hese 2 egions ( he one ha con ains he 13a exon and he one ha in oduces he 23a exon). This analysis s a ed o wi h an almos ull open eading ame ampli ica ion (ampli ica ion o exons 2 o 29), ha o mos cases p esen ed he e idence o 2 bands. Then, o pe cei e he di e ences be ween hese 2 agmen s, nes ed PCRs we e conduc ed o he 2 egions o in e es . Nes ed PCRs we e pe o med due o insu icien olume o he elu ed p oduc a e band pu i ica ion o e ec i e sequencing o he egions o in e es . Sample L950 splicing analysis ( igu e 3.7) e ealed, o he 13 o 14 egion, an exp ession o bo h he w and he 13a iso o m. Fo he egion co e ing exons 23 o 27 he highes molecula weigh agmen ( om PCR 2-29), showed he p esence o he iso o m ha skips he 23a exon, while he lowes molecula weigh agmen p esen ed bo h. Besides hese 2 iso o ms, ano he al e na i e splicing e en seems o ake o m in his sample, which esul s om he skipping o exon 24 and/o 23a and 24. Howe e , hese inding do no explain he p esence o wo bands wi h di e en molecula weigh s, when almos all he open eading ame o he gene is ampli ied. Figu e 3.6 – Schema ic ep esen a ion o he desc ibed iso o ms o TPP2 (ENST00000376065 and ENST00000376052) and a non-desc ibed iso o m. The squa ed boxes ep esen exons and is espec i e numbe . Exons size a e no o scale. 48 The splicing e alua ion in sample L1590 ( igu e 3.8) disclose he p esence o only he w ansc ip o he 13 o 14 egion and he egion encompassing exons 23 o 27 showed he w ansc ip wi hou he p esence o he 23a exon and an al e na i e splicing de i ed om he skipping o exon 25 and hal o he exon 26. Al hough he lowes molecula weigh agmen , de i ed om ampli ica ion o exons 2 o 29, could no be sequenced o he 23 o 27 egion, i appea s ha he p esence o only he w ansc ip , dep i ed o he 23a exon, can be co ela ed o he absence o he al e na i e 13a exon, in his sample. Figu e 3.7 – Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L950 and espec i e esul s. The esul ing bands ( om an 1.2% aga ose gel) we e excised, pu i ied and subjec ed o nes ed PCRs a e a dilu ion o 1:10. Nes ed PCR 13+14 ep esen s he ampli ica ion o exons 13 o 14, and nes ed PCR 23+27 he exons 23 o 27 (ampli ica ion p oduc s o he nes ed PCRs we e an in a 2% aga ose gel). Sequencing esul s a e p esen ed as squa ed boxes ha indica e exons and i s espec i e numbe . Exons size a e no o scale. * - sequencing analysis could no be pe o med due o echnical issues. 49 Sample L926 exhibi ed only one band a e ampli ica ion o exons 2 o 29 ha p esen s all he w desc ibed ansc ip s and has no al e na i e splicing e en s ( igu e 3.9). L1590 PCR 2+29 TPP2 23+27 TPP2 13+14 Figu e 3.8 - Rep esen a i e scheme o he s eps in ol ed in TPP2 splicing analysis o sample L1590 and espec i e esul s. The esul ing bands ( om an 1.2% aga ose gel) we e excised, pu i ied and subjec ed o nes ed PCRs a e a dilu ion o 1:10. Nes ed PCR 13+14 ep esen s he ampli ica ion o exons 13 o 14, and nes ed PCR 23+27 he exons 23 o 27 (ampli ica ion p oduc s o he nes ed PCRs we e an in a 2% aga ose gel). Sequencing esul s a e p esen ed as squa ed boxes ha indica e exons and i s espec i e numbe . Exons size a e no o scale. * - sequencing analysis could no be pe o med due o echnical issues. 56 dele e ious h eshold. Al hough his a ian is no coexis ing wi h a p o ein domain, i is loca ed nea o a se ies o phospho yla ion esidues (PhosphoSi ePlus da abase: h ps://www.phosphosi e.o g), in which, he in oduc ion o a di e en amino acid may induce al e a ions in p o ein’s a angemen ha conceals one o mo e phospho yla ion esidues, which may a ec is unc ion, due o pos - ansla ional changes o p o ein-p o ein in e ac ions. Taken hese p edic ions oge he and since his a ian was ound in an index pa ien o a FCCTX-like amily, his a ian is a sui able candida e o u he seg ega ion s udies wi hin his pa ien ’s amily. The c.1933C>T (p.A g645T p) a ian , which was also he mu a ion ound o seg ega e wi h he disease in he L56 amily, has al eady been ex ensi ely cha ac e ized in a p e ious s udy (Magalhães 2016) and e ealed a highly pa hogenic p edic ion, being also loca ed wi hin a se ies o phospho yla ion esidues, sugges ing o be a s ong candida e o he L56 amily’s FCCTX pheno ype. Since his mu a ion was al eady ´ lagged´ as a s ong con ende o FCCTX suscep ibili y an e o was made in ying o access he indi idual’s amily pedig ee ( igu e 4.3). Looking a his amily’s pedig ee ( igu e 4.3) he e a e simila aspec s wi h he L56 amily, besides he au osomal dominan inhe i ance pa e n and an appa en pheno ypic an icipa ion, whe e younge gene a ions appea o de elop CRC a an ea lie age, which is common o he majo i y o CRC amilies, he lack o ex a colonic cance s and he good p ognosis o he a ec ed membe s s ikingly esemble he L56 amily. Acco dingly, he a ec ed pa ien s appea o ha e good p ognosis yea s a e hei diagnosis, indica ing ha he mu a ion and/o combina ion o mu a ions in hese amilies may con ibu e o cance ini ia ion and p og ession, bu no o i s agg essi eness. The only hing ha seems o di e be ween hese 2 amilies is he age a diagnosis, whe e he L2127’s amily appea s o de elop ca cinoma a an olde age (one o he desc ibed cha ac e is ics o FCCTX is he de elopmen o CRC a an olde age when compa ing o Lynch synd ome). These indings suppo ha his a ian can be in Figu e 4.3 – Family’s pedig ee o he indi idual we e he c.1933C>T (p.A g645T p) a ian was ound (L2127, ma ked wi h an a ow). CA: cu en age; AD: age a diagnosis (ca cinoma); y: yea s. 57 pa esponsible o his amily’s suscep ibili y o CRC. Thus, a seg ega ion s udy o his a ian wi h he disease in his amily is majo conce n o de ining his a ian ’s possible pa hogenici y and in ol emen in FCCTX suscep ibili y. The s udy o 50 Po uguese con ols, o he c.1933C>T (p.A g645T p) a ian , did no e eal he p esence o his mu a ion in any o he samples, which is agains he possibili y ha his a ian was ound in indi iduals om wo di e en amilies due o a high allele equency wi hin he Po uguese popula ion, ha is no epo ed in he da abases. The MTMR3 p o ein plays a ole in he au ophagy p ocess, a p ocess ha has been con inuously ela ed o p og ession and umo o ma ion in CRC (Zheng e al. 2012), and is also belie ed o be in ol ed in he mTOR signaling pa hway, a pa hway al eady associa ed o CRC ca cinogenesis. (Hao e al. 2016) In addi ion, a s udy has sugges ed ha al e a ions in he MTMR3 gene may play a ole in he de elopmen o gas ic and colo ec al cance due o a mis egula ion o i s phospha ase unc ions (Song e al. 2010), and ano he s udy demons a ed ha MTMR3 silencing led o dec eased cell p oli e a ion, impai ed colony o ma ion, a es ed cell cycle, and inc eased apop osis in CRC cells, hus ein o cing he in ol emen o MTMR3 in CRC p og ession. (Zheng e al. 2014) Taken oge he , hese s udies and ou indings ega ding he iden i ied MTMR3 ge mline mu a ions in FCCTX amilies seem o suppo he in ol emen o MTMR3 as a possible con ibu o o FCCTX’s suscep ibili y. Mo eo e , he mu a ional analysis o MTMR3 also e ealed he p esence o he no mal MTMR3 ansc ip , co-occu ing wi h al e na i e ansc ip s in 17/19 samples. The MTMR3 gene has 6 p o ein coding ansc ip s and ano he 6 non-coding ansc ip s desc ibed a he Ensembl da abase, howe e none o he splicing al e a ions ound wi hin his s udy ha e been epo ed o his gene, and no mu a ions we e ound, wi hin his analysis ha could explain hese indings. The splicing al e a ions we e ound be ween exons 9 and 15, whe e i was obse ed he exclusion o exons 10, 11, 13 and 14 wi hou any pa icula o de o exclusion o p e e en ial selec ion, he only pa e n ha was obse ed was he exclusion o exon 14 in all he al e na i e splicing o ms. All he desc ibed p o ein coding ansc ip s p esen all hese exons, since hey a e he majo componen s o he myo ubula in phospha ase domain, he domain ha con e s his p o ein is enzyma ic unc ion. (Taguchi-A a ashi e al. 2010) So i hese al e na i e splicing iso o ms can gi e ise o a p o ein coding ansc ip , he p o ein will be se e ely comp omised by he impai men o i s phospha ase unc ion, and he mis egula ion o MTMR3 phospha ase unc ion has al eady been p oposed in he de elopmen o CRC. (Song e al. 2010) Howe e , he obse ed splicing al e a ions we e always ollowed by he p esence o he no mal ansc ip , which in he end may be he only one who will gi e ise o a p o ein. In addi ion, hese al e a ions we e ound in 89% o he analyzed samples, which sugges s ha hese al e a ions migh no be pa hogenic. Ne e heless, he obse ed al e a ions may ha e a ole no as p o ein coding, bu as a pa o a RNA egula o y ne wo k has a non-coding ansc ip , since i is belie ed ha non-coding RNAs can con ibu e o egula ion o mRNA s abili y, ansla ional e iciency and cellula localiza ion. (Mockenhaup and Makeye 2015) (Ma ick and Makunin 2006) Thus, addi ional s udies may need o be pe o med in o de o cla i y he implica ion o hese splicing al e a ions. 58 4.2.2 TAS1R1 The TAS1R1 p o ein is a G p o ein-coupled ecep o ha is a componen o he he e odime ic amino acid as e ecep o TAS1R1/TAS1R3, o med as a dime o TAS1R1 and TAS1R3 p o eins and is esponsible o he umami as e pe cep ion. Con a y o wha was belie ed, as e ecep o s, in pa icula G-p o ein-coupled, a e no es ic ed o he ongue. They a e dis ibu ed h oughou he s omach, in es ine and panc eas, whe e hey aid he diges i e p ocess, egula ion o ene gy and glucose homeos asis. (T i edi 2012) (Depoo e e 2014) Like MTMR3, TAS1R1, mo e speci ically he TAS1R1/TAS1R3 G-p o ein-coupled ecep o , has been in ol ed in he au ophagy p ocess by in e ac ion wi h one o he mTOR complexes, mTORC1 (mechanis ic a ge o apamycin complex 1). (Wauson e al. 2012) TAS1R1-TAS1R3 can ac i a e mTORC1 h ough di ec sensing o amino acids, p omo ing he ac i a ion o phospholipase C (PLC), he inc ease o calcium in lux, and he ac i a ion o MAPK1-MAPK3, hus s imula ing mTORC1 and leading o an inhibi ion o au ophagy ( igu e 4.4). (Wauson e al. 2012) (Wauson e al. 2013) TAS1R1-TAS1R3 is also equi ed o he amino acid-induced mTOR localiza ion o he lysosome, a necessa y s ep in mTORC1 ac i a ion ( igu e 4.4). (Wauson e al. 2013) Dis up ions in TAS1R1/TAS1R3 ha e been shown o induce au ophagy by inhibi ing mTORC1 ac i i y (Wauson e al. 2012), and gene ic a ian s in TAS1R1 we e ecen ly associa ed wi h an inc eased isk o gas ic cance . (Choi e al. 2016) Gi en his in o ma ion and he ole o au ophagy in CRC, he disco e y o a ian s in TAS1R1 can gi e new insigh s on FCCTX suscep ibili y. The ge mline mu a ional analysis o TAS1R1 e ealed he p esence o 3 missense a ian s, c.1067C>G (p.Se 356Cys), c.1043C>T (p.Ala348Val) and c.953T>C (p.Ile318Th ) wi h p obable pa hogenic p edic ions by he so wa e used. These a ian s a e all p esen a he ligand binding egion domain ( igu e 4.5) and exhibi a low global and eu opean allele equency. Gi en he localiza ion o hese 3 a ian s in a key domain o he p o ein, and hei in silico p edic ions o possible pa hogenici y and splicing al e a ions, hese a ian s a e good candida es o Figu e 4.4 –Regula ion o au ophagy by in e ac ion o G-p o ein-coupled as e ecep o TAS1R1/TAS1R3 wi h mTORC1. (Adap ed om Wauson e al. 2013) mTORC1 59 seg ega ion s udies in he espec i e amilies o he indi iduals whe e he a ian s we e ound. And he disco e y o hese p obably pa hogenic a ian s gi es new insigh s as o he p obable in ol emen o he TAS1R1 gene in FCCTX suscep ibili y. Since bo h TAS1R1 and MTMR3 play a ole in au ophagy and egula e mTOR, and gi en he a ian s ound in pa ien s om FCCTX and FCCTX-like amilies, i would be an in e es ing app oach o co ela e he exp ession o bo h genes wi h he exp ession o mTOR and he pa icipan s in he au ophagy and mTOR egula ion cascade, o sea ch o po en ial al e a ions be ween no mal issue and samples de i ed om ca cinoma and/o adenoma. 4.3 TPP2 ole in FCCTX suscep ibili y The gene exp ession analysis o he undesc ibed 13a ansc ip e ealed ha almos all he analyzed pa ien s o L55 amily (all de elop adenoma) had a balanced ela ion be ween he w and he 13a ansc ip , wi h he excep ion o L447, ha p esen ed an o e exp ession o he w ansc ip , and L1544 ha p esen ed an o e exp ession o he al e na i e ansc ip . In he a ec ed g oup, 4/6 e ealed an o e exp ession o he 13a ansc ip whe e 3/4 had ha o e exp ession ollowed by an almos o al educ ion o he w ansc ip . The 2/6 emaining samples o his g oup had a sligh inc ease o he w exp ession, one o he indi iduals de elop ca cinoma and he o he does no p esen ca cinoma o adenoma bu has an iden i ied LS mu a ion in he MMR genes. As o he samples de i ed om heal hy indi iduals, all exhibi ed an o e exp ession o he w , ha was a leas 1- old highe han he al e na i e exp ession. Gi en hese esul s, i seems like he balance o imbalance be ween he 13a al e na i e ansc ip and he w , could play a ole in adenoma/ca cinoma suscep ibili y, since an o e exp ession o he al e na i e ansc ip was only de ec ed in samples ou side he heal hy g oup. As al eady s a ed (in sec ion 1.4.1.1), he p e ious SNP a ay was sugges i e ha he ch omosomal e en s in 13q occu ed a he le el o umo ini ia ion, which seems consis en wi h hese esul s conside ing ha all he analyzed pa ien s ha de eloped adenoma bu no ca cinoma (wi h he excep ion o L447) exhibi an equal ela ionship be ween he w and 13a exp ession o e en an inc eased 13a exp ession, bu ne e a signi ican o e exp ession o he w ansc ip , hus implying a possible ole o he al e na i e ansc ip o he TPP2 gene in colo ec al umo igenesis. Figu e 4.5 – Main domains o he TAS1R1 p o ein and he localiza ion o 3 o he a ian s ound. aa: amino acid. Adap ed om: cBioPo al o Cance Genomics (h p://www.cbiopo al.o g) 60 The p esence o he al e na i e ansc ip 13a was no only accessed by qPCR, he analysis o splicing iso o ms also e ealed he p esence o his ansc ip in almos all analyzed samples. In addi ion o his al e na i e ansc ip , ano he wo non-desc ibed iso o ms we e ound in wo di e en samples: he al e na i e splicing wi h he skipping o exon 24 and/o 23a (sample L950) and he al e na i e splicing de i ed om he skipping o exon 25 and he i s hal o exon 26 (sample L1590). Al hough hese no el iso o ms a e no p esen in any o he main domains o he TPP2 p o ein ( igu e 4.6), addi ional s udies a e needed o pe cei e i hese iso o ms can play a ole in CRC umo igenesis, since al e na i e splicing o cance -associa ed genes has been implied in umo p og ession and ini ia ion. (Ghigna e al. 2008) (S een e al. 2016) In he TPP2 splicing analysis, mos o he samples p esen ed wo bands when an almos ull open eading ame ampli ica ion was pe o med. The appea ance o wo dis inc molecula weigh bands seems o be co ela ed wi h he p esence o he al e na i e desc ibed and non-desc ibed ansc ip s. One hing ha was e iden in all he ampli ied samples was ha he de ec ion o he ansc ip ha exhibi ed he 23a exon was always dependen on he p esence o he no mal ansc ip wi hou he 23a exon, conside ing ha he no mal ansc ip was ound solely, while he 23a iso o m was always ound alongside wi h he no mal iso o m. And he same was ound in ela ion o he non-desc ibed 13a iso o m, which was dependen on he no mal iso o m. Samples L926 and L1590 we e he only ones ha did no p esen he 13a iso o m (apa om samples L905 and L1544, whe e he splicing analysis was no pe o med o egion 13 o 14, bu ha e al eady displayed an exp ession o he al e na i e ansc ip by qPCR), howe e in he gene exp ession analysis sample L926 p esen ed only a small o e exp ession o he w ansc ip in compa ison o he 13a. Thus, hese esul s do no seem o be in acco dance and he splicing analysis o L926 should be epea ed, since qPCR analysis is a highly sensi i e echnique and he esul s we e con i med by a leas wo independen expe imen s. The PTT con i med he ou lined p emise ha he inse ion o he al e na i e 13a exon could gi e ise o a p ema u e s op o he amino acid syn hesis, gi ing ise o a unca ed p o ein, due o an inclusion o a s op codon wi hin i s sequence (TAG). Figu e 4.7 shows he di e ences be ween he amino acid sequences ha occu s in a no mal ansla ion o he TPP2 gene and he hypo he ic ansla ion ha occu s when he e is he inse ion o he al e na i e 13a exon. Figu e 4.6 - Schema ic ep esen a ion o he desc ibed iso o ms o TPP2 and localiza ion o he main p o ein domains. The squa ed boxes ep esen exons and is espec i e numbe . Exons size a e no o scale. aa: amino acid. P o ein domains we e e ie ed om he Ensembl (h p://www.ensembl.o g) and UniP o (h p://www.unip o .o g) da abase. 61 This unca ed p o ein losses he second pep idase domain ( igu e 4.6), in addi ion o a majo loss by being educed o hal o i s o iginal sequence. Being he TPP2 p o ein he la ges known euka yo ic pep idase, i s s uc u al assembly is a majo conce n o i s no mal unc ion. (Rockel e al. 2012) TPP2 assembles in o a la ge homooligome unde physiological condi ions and, upon oligome iza ion, i s ac i i y s ongly inc eases, sugges ing ha ac i a ion is assembly induced. Also, TPP2’s C- e minal domain con ains a s uc u al mo i o en in ol ed in p o ein-p o ein in e ac ions. (Schönegge e al. 2012) This unca ed p o ein losses i s no mal C- e minal domain which may ha e a c i ical e ec on p o ein- p o ein in e ac ions and in he o e all assembly and oligome iza ion o TPP2’s homooligome , which will mos likely a ec he p o ein’s no mal unc ion and assembly. Al hough he PTT e ealed his unca ed p o ein, i canno be en i ely ex apola ed o an in i o con ex , since he e a e innume ous egula ing ac o s, ha an in i o syn hesis canno p edic , bu i p o ides a s a ing poin . Ul ima ely, he mul iple s udies pe o med on TPP2 sugges ha he al e na i e exp ession o non- desc ibed iso o ms, especially he 13a iso o m, could in luence he TPP2 p o ein unc ion and ul ima ely play a ole in CRC umo igenesis. This assump ion is ein o ced by he pa hways and biological p ocess whe e TPP2 has been in ol ed and he immune sys em ole in CRC and he in e ac ion o TPP2 wi h he MHC class I. I is well ecognized ha cy o oxic lymphocy es (also e e ed as CD8+ T) cons i u e one o he mos impo an e ec o mechanisms o an i- umo -immuni y (Deschoolmees e e al. 2011) and MHC class I p o eins a e esponsible o an igen p esen a ion o cy o oxic lymphocy es. (Nee jes e al. 2011) Howe e , since he TPP2 p o ein is one o he majo aminopep idases in ol ed in he p esen a ion o pep ides o he MHC class I, a dis up ion o i s unc ions may con ibu e o he immune escape o colon-ca cinoma cells. (P e a e al. 2008) Figu e 4.7 – Amino acid (aa) sequences o he no mal TPP2 p o ein (le panel), wi h a molecula weigh o 138 kDa and he unca ed p o ein gene a ed by he inse ion o he 13a exon ( igh panel), wi h an app oxima e (~) molecula weigh o 65 kDa. The unde lined aa ep esen he ampli ied egion ha was subjec ed o PTT analysis and ed le e s ep esen he addi ional aa p o ided by he 13a inse ion. 62 S ill, he e is he need o disc imina e i hese al e a ions occu in o he colo ec al cance en i ies o i hey a e s ic ly co ela ed o an inc eased FCCTX suscep ibili y, since al e a ions in he exp ession o he al e na i e 13a iso o m we e also ound in pa ien s a ec ed wi h LS. 63 5. CONCLUSION A conside able po ion o HNPCC amilies ail o p esen mu a ions in he MMR genes and ha e MSS umo s. These amilies a e classi ied as FCCTX and he gene ic e iology behind his synd ome emains unknown. The e o e, he iden i ica ion o gene ic a ian s/genes ha may con ibu e o his synd ome p edisposi ion is a majo s ep owa ds a be e sc eening, su eillance and main enance o he amilies. The WES analysis pe o med in a FCCTX amily, whose umo s p esen ed a molecula TSG- signa u e, had al eady e ealed he p esence o 6 dis inc a ian s ha seg ega ed wi h he disease acco ding o di e en seg ega ion models, aking in o accoun possible phenocopies in he amily. In he p esen s udy, ano he a ian (in he CACNA1S gene) was ound o seg ega e wi h he disease acco ding o one o he models. The iden i ica ion o he MTMR3 and TAS1R1 a ian s in a pa ien om an olde gene a ion a o s he in ol emen o hese a ian s in he amily’s pheno ype. Mo eo e , he p esence o p obably pa hogenic mu a ions in he MTMR3 and TAS1R1 genes in index pa ien s om FCCTX and FCCTX-like amilies and hei p o ein unc ions ha a e highly associa ed wi h known oncogenic pa hways, ein o ces he in ol emen o hese genes in FCCTX suscep ibili y. Also, he inding o he same MTMR3 mu a ion obse ed in he WES analysis, wi h highly in silico pa hogenic p edic ions, in an index pa ien o an FCCTX-like amily, whose amilies’ pheno ypic ea u es esemble hose o he WES amily, emphasizes he in ol emen o his speci ic a ian in FCCTX suscep ibili y. Al oge he , hese e idences sus ain he hypo hesis ha he FCCTX is likely no linked o a highly pene an single gene diso de , bu is a he a polygenic and he e ogeneous condi ion ha is o mula ed due o he accumula ion o mu a ions in di e en genes, especially genes in ol ed in me abolic and au ophagy p ocesses such as MTMR3, TAS1R1 and NPR2, ha ‘help each o he ’ in he umo igenesis p ocess. The inding o al e na i e splicing iso o ms in MTMR3 does no seem o be associa ed wi h a p edisposi ion o FCCTX, since almos all he analyzed pa ien s (89%) p esen ed such al e a ions. The analysis o po en ial CNV, om he exome sequencing da a, may e eal a ia ions in amplicons associa ed wi h he amily’s pheno ype, howe e u he s udies a e needed o un eil he in luence o he selec ed amplicons. The TPP2 s udy sugges s ha he al e na i e 13a ansc ip may be in ol ed in he ea lie s ages o colo ec al umo igenesis, in associa ion wi h o he colo ec al cance en i ies a he han being exclusi ely linked wi h a FCCTX p edisposi ion. Also, TPP2 may play a ole in colo ec al cance due o a dis up ion in he immune esponse. Thinking o wa d and gi en he WES analysis esul s, he colon pa hology g oup has an ongoing p ojec ha aims he cons uc ion o ec o s exp essing wild ype and mu an candida e genes o in i o exp ession in no mal and colo ec al cell models o access hei in ol emen in he colo ec al umo igenesis. Also, an exp ession analysis is cu en ly ongoing o access he exp ession o he candida e genes in umo /ma ched no mal issues om WES amily pa ien s as well as ano he 64 exp ession s udy aiming o co ela e he exp ession o MTMR3 and TAS1R1 wi h mTOR and he pa icipan s in he au ophagy egula ion cascade in umo /ma ched no mal issues. P elimina y esul s o his analysis ha e sugges ed an appa en ly educed exp ession o MTMR3 in one ca cinoma and one adenoma wi h high-g ade dysplasia om he WES amily, in compa ison wi h no mal mucosa. 65 6. REFERENCES Albuque que, C., B eukel, C., an de Luij , R., e al. 2002. The “jus - igh ” signaling model: APC soma ic mu a ions a e selec ed based on a speci ic le el o ac i a ion o he be a-ca enin signaling cascade., Human molecula gene ics, 11(13), pp. 1549–60. Au on, A., Abecasis, G. R., Al shule , D. M., e al. 2015. A global e e ence o human gene ic a ia ion, Na u e, 526(7571), pp. 68–74. Badou, A., Jha, M. K., Ma za, D., e al. 2013. Eme ging Roles o L-Type Vol age-Ga ed and O he Calcium Channels in T Lymphocy es, F on ie s in Immunology. F on ie s, 4, p. 243. Beckle , G. 2005. The p o ein unca ion es , in B idging he Gap Be ween Genomics and P o eomics: In Vi o Exp ession Tools o Func ional Genomics. P omega. Belo, H. 2010. Papel Do Gene APC e Iden i icação de Regiões C omossómicas En ol idas No Sind oma Familia de Canc o Do Cólon e Rec o Do Tipo X. Escola Supe io de Saúde Egas Moniz. Bio-Rad Labo a o ies 2006. Real-Time PCR, in Applica ions Guide. Boland, C. R. 2005. E olu ion o he Nomencla u e o he He edi a y Colo ec al Cance Synd omes, Familial Cance . Kluwe Academic Publishe s, 4(3), pp. 211–218. B enne , H., Kloo , M. and Pox, C. P. 2014. Colo ec al cance , The Lance . Else ie L d, 383(9927), pp. 1490–1502. Bu ada, F., Nicoli, E. R., Ciu ea, M. E., e al. 2015. Au ophagy in colo ec al cance : An impo an swi ch om physiology o pa hology., Wo ld jou nal o gas oin es inal oncology. Baishideng Publishing G oup Inc, 7(11), pp. 271–84. Bu , R. 2007. Inhe i ance o Colo ec al Cance ., D ug disco e y oday. Disease mechanisms. NIH Public Access, 4(4), pp. 293–300. Camici, M. 2008. Guanylin pep ides and colo ec al cance (CRC), Biomedicine & Pha maco he apy, 62(2), pp. 70–76. Ca ballal, S., Leoz, M. L., Mo ei a, L., e al. 2014. He edi a y colo ec al cance synd omes, Colo ec al Cance . Fu u e Medicine L d London, UK , 3(1), pp. 57–76. Ca e he s, J. M. and S o el, E. M. 2015. Lynch synd ome and Lynch synd ome mimics: The g owing complex landscape o he edi a y colon cance , Wo ld Jou nal o Gas oen e ology, 21(31), p. 9253. Choi, J.-H., Lee, J., Choi, I. J., e al. 2016. Va ia ions in TAS1R as e ecep o gene amily modi y ood in ake and gas ic cance isk in a Ko ean popula ion, Molecula Nu i ion & Food Resea ch, 60(11), pp. 2433–2445. Colussi, D., B andi, G., Bazzoli, F., e al. 2013. Molecula pa hways in ol ed in colo ec al cance : implica ions o disease beha io and p e en ion., In e na ional jou nal o molecula sciences, 14(8), pp. 16365– 16385. Daly, M., Do een Agnese, Ka hleen Calzone, e al. 2017. Gene ics o Colo ec al Cance (PDQ®): Heal h P o essional Ve sion, PDQ Cance In o ma ion Summa ies. Na ional Cance Ins i u e (US). A ailable a : h p://www.ncbi.nlm.nih.go /pubmed/26389505 (Accessed: 13 Ap il 2017). Depoo e e, I. 2014. Tas e ecep o s o he gu : eme ging oles in heal h and disease, Gu , 63(1), pp. 179– 190. Deschoolmees e , V., Baay, M., La don, F., e al. 2011. Immune Cells in Colo ec al Cance : P ognos ic Rele ance and Role o MSI., Cance mic oen i onmen  : o icial jou nal o he In e na ional Cance Mic oen i onmen Socie y. Sp inge , 4(3), pp. 377–92. Dua e, M. 2015. En ol imen o de a ian es gené icas especí icas na susce ibilidade pa a o isco aumen ado de canc o do cólon e e o e na ag essi idade umo al. Escola Supe io de Saúde Egas Moniz. 72 Table A.4 – P ime used o TAS1R1 sequencing ha di e s om he ones desc ibed abo e o exon ampli ica ion. Gene P ime a exon: P ime sequence (5' → 3') TAS1R1 6 F w CTCTTTGCCCTTGGTTTCAC Table A.5 – P ime sequence and expec ed agmen size o he ex e nal p ime s used o cDNA and DNA ampli ica ion o he MTMR3, DUSP12 and LGR6 candida e genes, and espec i e in e nal sequencing p ime s used (expec ed agmen size was ob ained om he p ime -BLAST so wa e (p ime -BLAST: h ps://www.ncbi.nlm.nih.go / ools/p ime -blas ). Gene F agmen Ampli ied exons T ansc ip (s) (Ensembl ID) Ex e nal P ime s Expec ed size (bp) In e nal sequencing p ime s o each agmen P ime sequence (5' → 3') P ime sequence (5' → 3') MTMR3 A 2 o 10 All excep : ENST00000406629 and ENST00000445401 F w ACTTCCTTGTGAAACCTCCT 908 - - Re TACTGACTGTACCAGATGCTCA - - B 2 o 10 ENST00000406629 F w TGGATGAAGAGACTCGGCACA 1072 o 1190 F w GAAAGTGTTGAATGCCGAG Re CCTCCGAATAGAATGAATGTTTG Re TCTTCTATTTTAGCAGGTGGTC C 2 o 6 ENST00000445401 F w GACTTCACCATAAGGGAAAGAA 462 - - Re TCTTCTATTTTAGCAGGTGGTC - - D 9 o 15 All excep : ENST00000406629 and ENST00000445401 F w AGTGTATCAAGTTTCAGGTCC 918 F w AGAGAGTTTAGCCATCCAA Re AAACAGGCAGGAATAGGTA Re CCTCCGAATAGAATGAATGTTTG E 14 o 17 All excep : ENST00000406629 and ENST00000445401 F w GTGGAAATGGAGTGGCTGGAT 1011 F w ATGTGCGTAACCTGATGCTGTG Re GACCTGGAGAGAACTGAGGAGAA Re ACAGGCTGTGGTCAGATTGTCG F 17 o 20 All excep : ENST00000406629 and ENST00000445401 F w GAACTGGGTGATGCTGCTCTGA 1463 o 1574 F w TGTAAAGAGGGGCTTGTGTGC Re GAGGAGGATGGAAAAGGTAGGGA Re TCAGTGAGTCCTTGCTCCTACCA DUSP12 A ( o DNA) 1 DNA ampli ica ion o exon 1 o all he ansc ip s F w CCCTCAGCGATAAGTCCAGATTC 339 - - Re TCCTCCGAGTCCACTGTTAGCA - - B * 1 o 6 All F w CAGCCAGGATTGTATTTCGGT 1080 o 1093 F w AAGGTTACAGAGAAGTATCCAG Re GCATAGTTTCCAGGTTACATCAAG Re GAGAACCTCATCTTTCAATCC LGR6 A * 1 o 15 ENST00000367278 F w CATCATGCTGTCTGCCGACT 1204 F w TCCATAACAACAACATCAAGGC Re CATCAAGCCCCCAAGTCCA Re CATAAAAGTGTATCGTCTGTAGC B * 1 o 15 ENST00000255432 F w GGGAAGACCAAGGTTGACACTT 1180 F w TCCATAACAACAACATCAAGGC Re CATCAAGCCCCCAAGTCCA Re CATAAAAGTGTATCGTCTGTAGC C * 2 o 13 ENST00000439764 F w GGACCTCAGCATGAACAACCTC 838 F w TCCATAACAACAACATCAAGGC Re CATCAAGCCCCCAAGTCCA Re CATAAAAGTGTATCGTCTGTAGC D * 2 o 9 ENST00000423542 F w GGACCTCAGCATGAACAACCTC 632 - - Re CCTCCAATTTCTGACACCTGTG - - E ( o DNA) 1 DNA ampli ica ion o exon 1 o ansc ip ENST00000439764 F w GCATACGAGAGAAGCGGCAGAAC 230 - - Re TGCGGAGGACCTGTGGAACTTT - - F * 14 o 18 ENST00000367278 and ENST00000255432 F w CAAGCTGGACCTGACAGACAACCA 1575 F w TACTTGGGTCGGAGGCATCGGT Re AAGCCTCCACCTGCTGGCGTAGAT Re AGGAGTTCATCATCACCAGGGC * Pc condi ions we e no op imized 73 Table A.6 – P ime s used o ampli ica ion o he MTMR3 a ian p.A g645T p. Gene Iden i ied a ian P ime sequence (5' → 3') Expec ed size (bp) MTMR3 c.1933C>T; p.A g645T p F w CCAAGATTTTCATTTCCCCC 406 Re TTCCTCCTGCTCTCCTTTTC All p ime s we e designed p io o his s udy Table A.7 - P ime s used o TPP2 gene exp ession o he no mal and he al e na i e 13a ansc ip . Gene P ime a exon: P ime sequence (5' → 3') Expec ed size (bp) TPP2 13/13a F w CGGAGAACACAGGTATAAGACAG 161 14 * Re CAAATGGCTGGGACACTGAAC 13/14 * F w CCGGAGAACACAGAAAACTCTG 93 14 * Re CAAATGGCTGGGACACTGAAC GAPDH 7 * F w TGCACCACCAACTGCTTAGC 87 7/8 * Re GGCATGGACTGTGGTCATGAG * P ime s we e designed p io o his s udy Table A.8 - P ime s used o TPP2 splicing analysis (expec ed agmen size was ob ained om he p ime -BLAST so wa e (p ime -BLAST: h ps://www.ncbi.nlm.nih.go / ools/p ime -blas ). Gene Ampli ied exons P ime sequence (5' → 3') Expec ed size (bp) TPP2 2 o 29 F w GAAGTGGCGATGTGAATAC 3541 Re GGGAGCCAGTTTTCAGTAA 13 o 14 F w ATAAAGCCTATGACTACCTCG 245 Re CAAATGGCTGGGACACTGAAC 23 o 27 F w CCAGCCATTCTTTGTTACT 565 Re TACGAGGGTGGATTTTTGT All p ime s we e designed p io o his s udy Table A.9 - P ime s used in PCR ampli ica ion o PTT analysis o TPP2 gene and cha ac e is ics o he ampli ied agmen . Gene Ampli ied exons Size (kb) Polypep ide molecula weigh (kilodal ons (kDa)) P ime a exon P ime sequence (5’ → 3’) TPP2 1 o 19 2.3 95* 1 [T7]-GCTGCGACTGAGGAGCCCTT 19 CGCAGTGTTTGGACCCAGTTCTTC *The polypep ide molecula weigh was calcula ed based on he o mula used in Calc Tool da abase (h p://www.calc ool.o g/CALC/p o /bio/p o ein_size); [T7] ep esen s he PTT-speci ic o wa d p ime sequence, con aining a T7 RNA polyme ase p omo e sequence, a space , and he Kozak sequence 74 Appendix B - PCR and qPCR condi ions used in his s udy Table B.1 - PCR condi ions used o he ampli ica ion o he a ian s selec ed h ough bioin o ma ic analysis, ob ained by WES analysis, o he seg ega ion s udy wi h he disease in he L56 amily. Ou pu Analysis Gene Iden i ied a ian Tempe a u e (°C) MgCl2 (µL) 3 1 ZNF717 c.2381G>A; p.Cys794Ty 66 1.5 RNF213 c.8084C>T; p.Ala2695Val 59 0.5 3 CACNA1S c.3607G>A; p.Asp1203Asn 63 1 4 1 GIMAP1 c.908T>G; p.Val303Gly 60 0.25 All eac ions we e pe o med using he Bio aqTM ki (Bioline) Table B.2 - PCR condi ions used o ampli ica ion o he MTMR3 and TAS1R1 a ian s iden i ied by WES in he FFPE issue sample o pa ien CAs1555. Gene Va ian Tempe a u e (°C) MgCl2 (µL) MTMR3 c.1933C>T; p.A g645T p 68 1 TAS1R1 c.1582C>T; p.Leu528Phe 60 2 All eac ions we e pe o med using he AmpliTaq Gold® (The mo ishe ) ki Table B.3 – PCR condi ions used o ampli ica ion o TAS1R1 exons. Gene Exon Tempe a u e (°C) MgCl2 (µL) TAS1R1 1 60.5 0.25 2 65 0.25 3 61.5 0.25 4 64.5 0.75 5 66 1 6 66.5 0.5 All eac ions we e pe o med using he Bio aqTM ki (Bioline) Table B.4 – PCR condi ions used o ampli ica ion o MTMR3, DUSP12 and LGR6 agmen s. Gene F agmen Tempe a u e (°C) MgCl2 (µL) MTMR3 A 62 1.5 B*¥ 51.5 0.35 C 62.5 0.5 D* 59.5 0.75 E 64.5 1.25 F 70 1 DUSP12 A 68 1 LGR6 E 69 1 All eac ions we e pe o med using he Bio aqTM ki (Bioline) excep o agmen s ma ked wi h *, whe e i was used he GC-RICH PCR Sys em ki (Roche); ¥ - addi ion o 0.75μL o GC-RICH esolu ion solu ion. 75 Table B.5 – PCR condi ions used o ampli ica ion o he MTMR3 a ian p.A g645T p. Gene Va ian Tempe a u e (°C) MgCl2 (µL) MTMR3 c.1933C>T; p.A g645T p 60.5 0.5 The eac ion was pe o med using he Bio aqTM ki (Bioline) Table B.6 – qPCR condi ions used o TPP2 gene exp ession analysis. Gene F agmen P ime concen a ion Sample concen a ion E iciency TPP2 W (13/14) 5 pmol/µL 5 ng/µL 2.08 13a 2.02 GAPDH GAPDH 2 Table B.7 – qPCR condi ions used o TPP2 splicing analysis. Gene Exons Tempe a u e (°C) MgCl2 (μL) TPP2 2 o 29 * 53 1.25** 13 o 14 60 1 23 o 27 52 1 All eac ions we e pe o med using he Bio aqTM ki (Bioline) excep o agmen s ma ked wi h *, whe e i was used he Expand Long Templa e PCR Sys em (Roche) ki ; ** MgCl2 added om bu e 3 o he pc ki . Table B.8 – PCR condi ions used o TPP2 gene ampli ica ion o PTT analysis. Gene Exons Tempe a u e (°C) MgCl2 (μL) TPP2 1 o 19 65 1.25* The eac ion was pe o med using he Expand Long Templa e PCR Sys em (Roche) ki ; * MgCl2 added om bu e 2 o he pc ki . 76 Appendix C - PCR ampli ica ion p og ams used in his s udy Table C.1 - PCR ampli ica ion p og am used wi h he eagen s om he Bio aqTM ki (Bioline). PCR ampli ica ion was pe o med in a UNO96 he mocycle (VWR). S ep Tempe a u e (°C) Time Cycles Ini ial dena u a ion 95 5 min 1 Dena u a ion 94 50 sec 35 Annealing Va iable 30 sec Elonga ion 72 70 sec Final elonga ion 72 7 min 1 Pause 15 ∞ ∞ Table C.2 - PCR ampli ica ion p og am used wi h he eagen s om he AmpliTaq Gold® (The mo ishe ) ki . PCR ampli ica ion was pe o med in a Ve i i® The mal Cycle (Applied Biosys ems). S ep Tempe a u e (°C) Time Cycles Ini ial dena u a ion 95 10 min 1 Dena u a ion 94 50 sec 40 Annealing Va iable 30 sec Elonga ion 70 1 min Final elonga ion 70 5 min 1 Pause 15 ∞ ∞ Table C.3 - PCR ampli ica ion p og am used wi h he eagen s om he GC-RICH PCR Sys em (Roche) ki . PCR ampli ica ion was pe o med in a Ve i i® The mal Cycle (Applied Biosys ems). S ep Tempe a u e (°C) Time Cycles Ini ial dena u a ion 95 3 min 1 Dena u a ion 95 30 sec 10 Annealing Va iable 30 sec Elonga ion 72 45 sec Dena u a ion 95 30 sec 25 Annealing Va iable 30 sec Elonga ion 72 45 sec + 5 sec cycle elonga ion o each successi e cycle Final elonga ion 72 7 min 1 Pause 15 ∞ ∞ Table C.4 - PCR ampli ica ion p og am used wi h he eagen s om he Expand Long Templa e PCR Sys em (Roche) ki . PCR ampli ica ion was pe o med in a Ve i i® The mal Cycle (Applied Biosys ems). S ep Tempe a u e (°C) Time Cycles Ini ial dena u a ion 94 2 min 1 Dena u a ion 94 10 sec 10 Annealing Va iable 30 sec Elonga ion 68 2 min Dena u a ion 94 30 sec 25 Annealing Va iable 30 sec Elonga ion 68 2 min + 20 sec cycle elonga ion o each successi e cycle Final elonga ion 72 7 min 1 Pause 15 ∞ ∞ 77 Table C.5 – P og am used o sequencing eac ion o he s udied genes. S ep Tempe a u e (°C) Time Cycles Ini ial dena u a ion 96 5 min 1 Dena u a ion 95 10 sec 25 Annealing 59 5 sec Elonga ion 60 4 min Pause 4 ∞ ∞ Table C.6 – Re e se ansc ip ion p og am used o cDNA syn hesis. S ep Tempe a u e (°C) Time Cycles Dena u a ion and binding o hexame s 70 5 min 1 Pause 10 ∞ cDNA syn hesis 42 60 min Elonga ion 70 15 min Pause 4 ∞ ∞ Table C.7 – qPCR p og am used o TPP2 gene exp ession analysis. S ep Tempe a u e (°C) Time Cycles Incuba ion 50 2 min 1 Polyme ase ac i a ion 95 10 min Dena u a ion 95 15 sec 40 Hyb idiza ion and elonga ion 60 1 min 78 Appendix D - P epa a ion o he eagen s used in aga ose gel elec opho esis 1. P epa a ion o he elec opho esis bu e (TBE 1x): To ob ain 1x TBE, a 10x TBE solu ion (0.89M T is Bo a e pH8.3 + 20mM Na2 EDTA, Na ional Diagnos ics) was dilu ed o a inal olume o 2L in ddH2O. 2. P epa a ion o 2% (w/ ) aga ose gel: I. Weigh 5g o aga ose (Seaken® LE Aga ose, Lonza) in a 500ml E lenmeye ; II. Add 250ml o TBE 1x bu e ; III. Dissol e he solu ion in he mic owa e; IV. Add 12.5μL o e hidium b omide (10mg/ml, MP biomedicals) and s i o homogeniza ion; V. Place he solu ion in a polyme iza ion base wi h 4 well molds and allow o cool un il he gel solidi ies. 3. P epa a ion o 0.8 and 1.2% (w/ ) aga ose gel: I. Weigh 1.2g o 0.8% o 1.8g o 1.2% o aga ose (Seaken® LE Aga ose, Lonza) in a 500ml E lenmeye ; II. Add 150ml o TBE 1x bu e ; III. Dissol e he solu ion in he mic owa e; IV. Add 7.5μL o e hidium b omide (10mg/ml, MP biomedicals) and s i o homogeniza ion; V. Place he solu ion in a polyme iza ion base wi h 1 well mold and allow o cool un il he gel solidi ies. 4. P epa a ion o O ange G 5x and 1x: O ange G 5x: P epa ed om 12ml Ficoll (Sigma), 125g o O ange G (Sigma) and 50ml o ddH2O, unde s i ing. S o e a -20 °C. O ange G 1x: Dilu ed om O ange G 5x o a inal olume o 1ml in ddH2O. S o e a 4ºC. 5. P epa a ion o he molecula weigh ma ke GeneRule 50bp DNA Ladde (The mo ishe Scien i ic): Add 50μL o GeneRule 50bp DNA Ladde (The mo ishe Scien i ic), 250μL o O ange G 5x and 700μL o ddH2O. 6. P epa a ion o he molecula weigh ma ke s Lambda/HindIII DNA Ladde (Fe men as): Add 20μL o Lambda/HindIII DNA Ladde (Fe men as), 100μL o O ange G 5x and 280μL o ddH2O. 7. P epa a ion o he molecula weigh ma ke s Lambda/HindIII DNA Ladde (Fe men as): Add 100μL o 1 kb DNA Ladde (P omega), 100μL o O ange G 5x and 200μL o ddH2O. 79 Appendix E - P ecipi a ion and pu i ica ion p o ocol o DNA E hanol / EDTA / Sodium ace a e - BigDye® Te mina o 1.1 Cycle Sequencing Ki (Applied Biosys ems) – a e sequencing eac ion 1. P o ocol: I. In a 2ml eppendo -like ube add 2μL o EDTA (125mM), 2μL sodium ace a e (3M) and 50μL absolu e e hanol, o each eac ion; II. Vo ex and spin-down; III. T ans e 54μL o he supe na an o new 1.5ml eppendo -like ube, add he o al olume o he sequencing eac ion and homogenize; IV. Incuba e o 15 minu es a oom empe a u e; V Cen i uge a 14000 pm o 30minu es a 4°C; VI. Remo e he supe na an comple ely wi h a mic opipe e; VII. Add 100μL o 70% ( / ) e hanol and sligh ly o ex; VIII. Cen i uge a 14000 pm o 15minu es a 4°C; IX. Remo e he supe na an comple ely wi h a mic opipe e; X. D y he pelle in a d y ba h a 37°C o abou 10 minu es; XI. S o e he pelle a 4ºC. 2. Solu ions: I. EDTA (125 mM, pH 8): Dissol e 4.65g o EDTA in ddH2O and make up he olume o 100 mL. II. Sodium ace a e (3M, pH 4.5): Dissol e 24.8g o sodium ace a e in ddH2O. Adjus he pH wi h ace ic acid and make up he olume o 100 mL. III. E hanol 70%: Add 30mL o ddH2O o 70mL o absolu e e hanol and homogenize. 80 Appendix F - P epa a ion o he eagen s used in SDS-PAGE 1. S op Solu ion: Fo 100mL: Add 8µL o glyce ol (SIGMA-ALDRICH®) o 2.4g o SDS (SIGMA- ALDRICH®) (a mask is equi ed du ing he weighing o his eagen ) o 0.004g o b omophenol blue (SIGMA-ALDRICH®) and make up he inal olume wi h ddH2O. Jus be o e adding he s op solu ion o he samples 25µL o β-me cap oe hanol (SIGMA- ALDRICH®) a e added pe 1000µL o he s op solu ion. 2. T is-glycine/SDS bu e : T is-glycine/SDS bu e 5x: Add 30g o izma-base (SIGMA-ALDRICH®), 144g o glycine (SIGMA-ALDRICH®) and 5g o SDS (SIGMA-ALDRICH®) (a mask is equi ed du ing he weighing o his eagen ) and make up o a inal olume o 1L wi h ddH2O (solu ion p epa ed unde agi a ion). T is-glycine/SDS bu e 1x: Dilu ed om T is-glycine/SDS bu e 5x o a inal olume o 1L in ddH2O. 3. Resol ing bu e (pH 8.9): Add 72.6g o izma-base (SIGMA-ALDRICH®) o 200mL o ddH2O and adjus pH wi h a HCl solu ion. 4. S acking bu e (pH 6.7): Add 11.4g o izma-base (SIGMA-ALDRICH®) o 200mL o ddH2O and adjus pH wi h a H3PO4 solu ion. 5. Sealing gel: I. P epa e a solu ion in he ollowing o de , wi h: 1.5mL o ac ylamide-bisac ylamide 30% (GRISP), 400µL o he esol ing bu e solu ion, 34.1µL o SDS 10% (AppliChem), 1.36mL o ddH2O, 50µL o an APS 10% solu ion and 5µL o TEMED (SIGMA-ALDRICH®); II. Gen ly mix he solu ion and add o he polyme iza ion base igh away; III. Wai a leas 30 minu es be o e adding he esol ing gel. 6. Resol ing gel: I. P epa e a solu ion in he ollowing o de , wi h: 9.1mL o ac ylamide-bisac ylamide 30% (GRISP), 2.5mL o he esol ing bu e solu ion, 204.6µL o SDS 10% (AppliChem), 8.15mL o ddH2O, 138.6µL o an APS 10% solu ion and 13.8µL o TEMED (SIGMA-ALDRICH®); II. Gen ly mix he solu ion and add o he polyme iza ion base igh away; III. Wai a leas 30 minu es be o e adding he s acking gel. 81 7. S acking gel: I. P epa e a solu ion in he ollowing o de , wi h: 1.12mL o ac ylamide-bisac ylamide 30% (GRISP), 0.9mL o he s acking bu e solu ion, 75µL o SDS 10% (AppliChem), 5.4mL o ddH2O, 118µL o an APS 10% solu ion and 7.9µL o TEMED (SIGMA-ALDRICH®); II. Gen ly mix he solu ion, add o he polyme iza ion base and add he mold o he wells igh away; III. Wai a leas 1 hou be o e aking he mold o he wells o . 8. Fixa i e solu ion: Add 30mL o ace ic acid (VWR), 60mL o me hanol (Me ck) and 210mL o ddH2O.