Effects of envirnonmental and genetic factors on transposable element activity

Ma a MARIALVA Disse a ion p esen ed o ob ain he Ph.D deg ee in E olu iona y Biology Ins i u o de Tecnologia Química e Biológica An ónio Xa ie | Uni e sidade No a de Lisboa Oei as, No embe , 2016 E ec s o en i onmen al and gene ic ac o s on ansposable elemen ac i i y Resea ch wo k coo dina ed by: ! Aos meus pais… ! 3! The esea ch s udy desc ibed in his hesis was inancially suppo ed by Fundação pa a a Ciência e a Tecnologia (FCT) ellowship SFRH/BD/51882/2012. This hesis was p in ed wi h suppo om Ins i u o Gulbenkian de Ciência. ! "! The s udy desc ibed in his Ph.D. hesis was pe o med a Ins i u o Gulbenkian de Ciência (IGC), Oei as, Po ugal and was inancially suppo ed by Fundação pa a a Ciência e a Tecnologia (FCT), Po ugal (SFRH/BD/51176/2010). The wo k on his hesis esul ed in he ollowing publica ion and some w i en con en o he hesis was in oduced in o he ollowing publica ion: Yilmaz, B., Po ugal, S., T an, T. M., Gozzelino, R., Ramos, S., Gomes, J., e al. (2014). Gu Mic obio a Elici s a P o ec i e Immune Response agains Mala ia T ansmission. Cell, 159(6), 1277–1289. doi:10.1016/j.cell.2014.10.053 ! 5! ROAD TO EXTINCTION “ca y he weigh o c ush unde i ” Un il we a e no mo e (B ea he) Moonspell ! 13! Summa y He i able pheno ypic a ia ion is he aw ma e ial o e olu ion o occu h ough na u al selec ion. I is a pe asi e p ope y o li ing o ganisms and, in o de o unde s and e olu iona y p ocesses, we mus s udy he ac o s ha media e he p oduc ion o he i able pheno ypic, and he e o e geno ypic a ia ion. T ansposable elemen s (TEs) a e mobile DNA sequences ha cons i u e a la ge p opo ion o mos euka yo ic genomes and ha can d i e he p oduc ion o adap i e gene ic a ia ion. The e a e many s udies on ansposon mobili y, bu hese gene ally include only ew en i onmen al condi ions, TEs and gene ic backg ounds. As a consequence, we s ill know e y li le abou he impac o gene ic and en i onmen al ac o s ha can a ec ansposon dynamics in na u al popula ions. He e, I p oposed o o e come hose limi a ions by analysing he impac o a mul i ude o ac o s on ansposon mobili y using D osophila melanogas e as a model o ganism. To iden i y loci ca ying na u al allelic a ian s a ec ing TE copy-numbe , we pe o med a genome-wide associa ion s udy, using a mapping panel o D. melanogas e wild-de i ed geno ypes (Chap e 2). We hen selec ed ou D. melanogas e s ocks in ec ed wi h Wolbachia – a ma e nally ansmi ed α- P o eobac e ia, which ende s he hos esis an o in ec ion by RNA i uses – o es he e ec o symbio ic bac e ia on he exp ession o ansposons ha esemble e o i uses. We u he asked whe he TE ac i i y in he p esence o he endosymbion was in luenced by empe a u e and hos gene ic backg ound, hus in es iga ing gene ic-by-en i onmen -by-en i onmen (GxExE) in e ac ions (Chap e 3). This analysis was ex ended o o he abio ic ac o s; no ably, exposu e o oxida i e s ess and hea y me als in he die , and hei in e ac ion wi h he p esence o Wolbachia (ExE in e ac ions) (Chap e 4). E en hough he piRNA pa hway cons i u es he hallma k o o ganismsʼ p o ec ion agains TE ac i i y in he ge mline, ac ing h ough he p oduc ion o small RNAs ha in e ac wi h PIWI amily p o eins (piRNAs), we we e only able o ind ew piRNA pa hway loci associa ed wi h ansposon copy-numbe (Chap e 2). Addi ionally, his pa hway was also ound o be obus o ! 14! en i onmen al pe u ba ions (Chap e 4). Based on he analysis o he associa ed loci and on he TE esponses o pe u ba ion, we p opose ha changes in ansc ip ion ac o ac i i y could be a he basis o geno ype- and en i onmen al-speci ic exp ession o ansposons (Chap e 2, 3 and 4). To u he assess he impac o Wolbachia in he con ex o TE in asion o na u al popula ions, and gi en he known co ela ion be ween a ecen eplacemen o Wolbachia s ains and he sp ead o he TE P-elemen , we cha ac e ized a panel o 86 na u al geno ypes acco ding o he p esence o Wolbachia and suscep ibili y o P-elemen in asion (Chap e 5). This analysis sugges ed ha he p esence o he endosymbion migh ha e con ibu ed o p omo e P-elemen sp ead in na u al popula ions h ough bene icial and geno ype-speci ic e ec s on ecundi y and/o pe cen age o eclosion. In summa y, his hesis p o ides no el insigh abou he complexi y o in e ac ions es ablished be ween TEs, en i onmen al condi ions and hos geno ypes. We also show ha inc eased TE exp ession in o a ies can po en ially lead o no el inse ions in he nex gene a ion and ha egula ion a addi ional s eps o he ansposon “li e cycle” can add an ex a laye o complexi y in he abili y o p oduce gene ic a ia ion. ! 15! Resumo Toda a a iação eno ípica que é he dada encon a-se codi icada no genoma e cons i ui uma p op iedade uni e sal de odos os sis emas biológicos. Essa a iação pode se il ada e/ou induzida po de e minadas condições ambien ais. Sendo c ucial pa a e olução, o seu es udo é de e minan e pa a comp eende os p ocessos e olu i os. T ansposões são sequências de DNA com p op iedades mó eis que compõem uma impo an e p opo ção dos genomas de euca io as, e que in e êm na p odução de a iação gené ica adap a i a. Embo a exis am es udos ele an es que desc e em a mobilidade des es elemen os, os ac o es gené icos e ambien ais que a i am ansposões são ainda amplamen e desconhecidos. Es a ese em como p incipal objec i o comp eende a dinâmica de ansposição em di e sos genó ipos de D osophila melanogas e , e como es a é a e ada pela exposição a ac o es bió icos e abió icos. Em p imei o luga , es ámos a associação en e o núme o de cópias de ansposões e a a iação alélica que seg ega em populações na u ais de D. melanogas e , que exis em num painel de linhas es abelecidas no labo a ó io (Capí ulo 2). Des as linhas, o am selecionadas pa a pos e io análise algumas que con inham in ecção com Wolbachia – uma α-P o eobac e ia ansmi ida ma e nalmen e e que con e e ao hospedei o esis ência a in ecções i ais – pe mi indo assim o es udo da in e ação en e o endossimbion e, a empe a u a e o genó ipo (AxAxG) do hospedei o na modulação da exp essão de ansposões que pa ilham semelhanças com e o í us (Capí ulo 3). Pa alelamen e, e de o ma a en iquece o es udo com ou os ac o es abió icos, oi ambém incluída na análise a in e ação en e a p esença de Wolbachia e a espos a a s esse oxida i o ou a die as icas em me ais pesados (AxA) (Capí ulo 4). Embo a o p ocesso de p odução de piRNAs (pequenos RNAs que econhecem sequências de ansposões e que in e agem com p o eínas PIWI) cons i ua o p incipal modo de ep essão de elemen os mó eis na linha ge minal de euca io as, obse ámos que poucos alelos em genes elacionados com es e mecanismo se encon am associados ao núme o de cópias de ansposões ! 16! (Capí ulo 2). A análise de possí eis e ei os ambien ais ambém e elou que es e mecanismo é obus o a pe u bações bió icas e abió icas (Capí ulo 4). Tendo em con a a al a de ligação en e o p incipal mecanismo de ep essão de ansposões e a espos a des es elemen os a ac o es gené icos e ambien ais, p opomos que al e ações na a i idade de ac o es de ansc ição possam es a na base da espos a dos ansposões obse ada, sendo es a especí ica pa a os ac o es es ados (Capí ulo 2, 3 e 4). Pa a es uda o impac o do endossimbion e Wolbachia du an e o p ocesso de in asão de ansposões em populações na u ais, i emos em con a a co elação es abelecida en e a subs i uição de genó ipos de Wolbachia e a in asão do ansposão P em populações de D. melanogas e (Capí ulo 5). A nossa análise de 86 genó ipos na u ais, a aliando a p esença de Wolbachia e a sua suscep ibilidade à in asão de elemen os P, suge e que a p esença do endossimbion e pode e p omo ido a in asão des e elemen o, ao con e i e ei os bené icos na ecundidade e pe cen agem de eclosão, e ei os que são especí icos pa a cada genó ipo. Em suma, es a ese e elou in e ações complexas, es abelecidas en e ansposões, condições ambien ais e genó ipos, onde cada elemen o mó el esponde de o ma especí ica a cada ac o es ado. Os nossos esul ados suge em ambém que um aumen o da exp essão de ansposões nas gónadas pode á conduzi a no as inse ções, que se ão ansmi idas à ge ação seguin e, e ealçam as al e ações ambien ais como um ac o impo an e na p odução de a iação gené ica he edi á ia mediada po ansposição. ! 17! Chap e I Gene al In oduc ion ! 19! En i onmen al condi ions shape e olu ion by ac ing bo h as an agen o na u al selec ion, in ol ed in he so ing o gene ic a ia ion, and as a ac o in luencing he p oduc ion o no el gene ic a ia ion, h ough e ec s on ecombina ion and mu a ion a es. Du ing he pas ew yea s, much a en ion has been de o ed owa ds he explo a ion o he gene ic basis o adap i e e olu ion1,2, and impo an insigh s ha e eme ged om expe imen al e olu ion s udies ha a emp o link h ee key componen s o e olu ion: geno ype, pheno ype and i ness3–7. Howe e , mos o hose s udies ypically use a he simple en i onmen s, wi h changes in ew a iables, ha all sho o p ope ly ep esen ing many o he ecological in e ac ions ha media e adap a ion in wild popula ions8. Also, ew s udies succeed a connec ing a ia ion in pheno ypic ai s wi h a ia ion in allele equencies as en i onmen al condi ions change in na u e1,9,10. New echnologies p o ide ools ha will allow be e explo a ion o he gene ics o adap a ion o changing en i onmen s by allowing he as gene ic mapping o pheno ypic ai s, and genome-wide analyses o popula ions e ol ing in he wild8,11–15. Those app oaches can help o p ope ly es ablish he link be ween geno ype, pheno ype and i ness, and o unde s and how and why allele equencies change in na u e. The e olu iona y success o a popula ion depends on a ailable gene ic a iabili y ha is ini ially p oduced h ough mu agenesis and ea anged by ecombina ion. In aspeci ic a ia ion in mu a ion and ecombina ion a es can also be subjec ed o na u al selec ion as popula ions adap o a new en i onmen 16,17. In addi ion, he e is pheno ypic plas ici y o hose ai s, as in e ed by he en i onmen al abili y o in luence he equency o mu a ion and/o ecombina ion in same geno ype18–26. En i onmen al ac o s such as empe a u e and nu i ional in ake a e impo an playe s in he es ablishmen o no el gene ic a ia ion18–20,24–26. ! 20! 1.1 Response o s ess ul en i onmen s En i onmen al he e ogenei y is a pe asi e p ope y o all ecological niches, and condi ions a e called s ess ul when hey esul in educed indi idual i ness27. Subop imal condi ions caused by ei he bio ic o abio ic ac o s can be g ouped in o ch onic, mild o acu e based on he se e i y and/o du a ion o he s ess28. Mos s udies abou he e ec s o dynamic en i onmen s ocus on acu e s esses ha equi e immedia e and p ecise cellula esponses.28–30. In o de o ci cum en s ess and e-es ablish homeos asis, o ganisms need o sense s ess and induce p ope signal ansduc ion pa hways ha ac i a e e ec o p ocesses28. Signalling pa hways end o be mo e conse ed han sensing and e ec o mechanisms, and gene ally espond o a a ie y o en i onmen al ac o s28,31. Fo example, mi ogen-ac i a ed p o ein kinase (MAPK) amily elemen s a e ac i a ed by se e al s imuli such as gamma ays, hea shock, in ec ion, ul a iole ligh , osmo ic and oxida i e s ess28,31–37. How speci ici y is ob ained when he same pa hway esponds o di e en s esses may ely on 1) he di e en ial ac i a ion, in space and ime, o he MAPK p o eins, and 2) he simul aneous induc ion o signal ansduc ion pa hways ha a e exclusi e o each en i onmen and may c ea e a s imulus-speci ic ne wo k o esponsi e elemen s28. 1.1.1 Mechanisms o esponse o empe a u e In he wild, popula ions a e exposed o empo al and spa ial luc ua ions in empe a u e ha may a ec o ganismal pe o mance and i ness38–41. Indi iduals e ol ed di e en mechanisms o sense he mal condi ions and igge e ec o esponses upon exposu e o sub-op imal empe a u es42–45. The ela i e con ibu ion o di e en sensing mechanisms depends on he species, p e ious exposu e and/o he ampli ude o he mal pe u ba ion42,46–48. Hea shock p o eins (Hsps) a e he hallma k o empe a u e-media ed cellula p ocesses and p omo e p ope p o ein olding in esponse ex eme insul s such as hea , oxida i e s ess, in ec ion and p esence o hea y me als49. In esponse ! 21! o he mal pe u ba ion, Hsps can unde go con o ma ional changes in a he mosenso domain ha a e necessa y o ac i a e hei chape one ac i i y42. In addi ion, Hsps can also indi ec ly de ec changes in empe a u e ia hei high binding a ini y o hea -induced dena u ed p o eins45. The ec ui men o Hsps o empe a u e-media ed p o ein agg ega es esul s in he ac i a ion o hea shock ac o s (HSFs) ha con e sely elici he ansc ip ion o Hsp genes (Figu e 1.1)50–52. Figu e 1.1. E ec o p ocesses media ing esponse o empe a u e s ess. In he absence o he mal pe u ba ions, hea shock ac o (HSF) is s abilized in he cy osol h ough he in e ac ion wi h hea shock p o eins (Hsps)49 (A). Upon empe a u e shock, se e al p o eins acqui e non-na i e con o ma ions ha ul ima ely esul in he o ma ion o agg ega es. As Hsps a e ec ui ed o media e p ope p o ein olding, HSF is eleased and ac i a ed by o ming homo ime s53–57. HSF ime s a el o he nucleus and induce ansc ip ion o empe a u e esponsi e genes, including Hsps, ha con ain hea shock cis- egula o y elemen s (HSE)58. A he same ime, he mi ogen-ac i a ed p o ein kinase (MAPK) pa hway is induced59 (B). This media es HSF phospho yla ion and alle ia es i s in luence in gene exp ession. Addi ionally, as cy osolic p o eins acqui e p ope con igu a ion, Hsps a e eleased and con ibu e o e- ep essing HSF (C). ! 28! Figu e 1.4. Mechanisms o TE jumping. DNA elemen s (A) mo e ia a cu -and-pas e mechanism mainly media ed by ansposase ac i i y. Each DNA elemen encodes own ansposase ha speci ically ecognizes e minal in e ed epea s a each TE end (yellow a ows), media ing DNA clea age and ansposon excision. T ansposase also ca alyzes TE in eg a ion in a new genomic a ea. LTR (B) and non-LTR (C) elemen s a e e o ansposons and mo e ia an RNA in e media e. LTR e o ansposons a e lanked by long e minal epea s (yellow a ows) and code o : p o ease, i al pa icle coa (Gag), e e se ansc ip ase and in eg ase p o eins. Hos ansc ip ional machine y is used o exp ess LTR elemen s and a i al-like pa icle is o med in he cy oplasm wi h Gag isola ing TE-exp essed p o eins and mRNA. Re e se ansc ip ion occu s inside hose pa icles. A e , cDNA is anspo ed o he nucleus whe e in eg ase ca alyzes ansposon inse ion (B). Non-LTR elemen s code o wo enzymes: endonuclease (ORF1 p o ein) and e e se ansc ip ase (ORF2 p o ein). cDNA p oduc ion occu s a he nucleus while e e se ansc ip ase uses mRNA as empla e and DNA o e hang (p oduced by endonuclease ac i i y) as p ime (C). Aside de ailed in o ma ion o he e e se ansc ip ion p ocess, li le is known abou o he s eps o non-LTR ansposi ion122,126. This igu e was adap ed om Le in and Mo an (2011)122. AB C ! 29! DNA ansposons a e ancien TEs ound in p oka yo es and almos all euka yo es ha anspose wi hou p oducing an RNA in e media e127. Those a e mos ly lanked by e minal in e ed epea s (TIRs) (Figu e 1.4A) ha can a y in leng h and sequence, and be used o classi y DNA elemen s128,129. In plan s, he i s bases o TIRs a e composed by highly conse ed CACTA mo i s ha a e eplaced by CCC sequences in animals and ungi130. In sho , DNA elemen s ha code o ansposase mobilize by a cu -and-pas e mechanism and can only inc ease in copy numbe when ansposing du ing DNA eplica ion o by sis e ch oma id ecombina ion131. Al e na i ely, hey can also exploi he gap epai machine y upon excision while he old inse ion is es o ed using lanking homologous egions as p ime s o DNA syn hesis and he sis e ch oma id con aining TE inse ion as empla e132. 1.2.2 TE ac i i y upon en i onmen al pe u ba ions Ou knowledge abou wha igge s TE ansposi ion is s ill a he incomple e. Ba ba a McClin ock p oposed ha , mobile elemen s would unc ion as genomic a chi ec s by becoming ac i e in esponse o en i onmen al s esses133. She belie ed ha jumping o ansposons could elici he exp ession o genes necessa y o ci cum en s ess. Only ecen ly ha e disco e ies unco e ing a link be ween en i onmen al ac o s and TE ac i i y134–139 con i med he iew. This includes da a demons a ing ansc ip ional induc ion o plan Tn 1 and T o1 LTR elemen s in esponse o se e al bio ic (inocula ion wi h i al, bac e ia and ungal pa hogens) and abio ic (me hyl jasmona e, CuCl2 and salicylic acid) condi ions140–143. Also, he p esence o cis-ac ing elemen s wi hin he 5ʼ sequence o LTRs was p o en o media e TE ac i a ion du ing en i onmen al change144. Con e sely, Tn 1 inse ions ound in se e al obacco plan s we e shown o p omo e chlo ide- esis an pheno ypes123,145. I is impo an o no e ha he li e cycle o e o ansposons includes o he s eps han ansc ip ion such as ansla ion, e e se ansc ip ion and in eg a ion, and ha en i onmen al ac o s can a ec any o hose le els o in luence ansposi ion. Fo example, change in he phospho yla ion s a e o Ty5 in eg ase ! 30! ha is media ed by nu ien dep i a ion a ec s TE inse ion p e e ence wi hou in luencing TE exp ession146,147. When in eg ase is phospho yla ed, Ty5 p e e en ially inse s in o he e och oma in minimizing he chances o damage coding sequences. A e exposu e o nu ien dep i a ion, in eg ase is dephospho yla ed and Ty5 is inse ed in o a eas o ac i e gene exp ession. A mechanism whe eby en i onmen al pe u ba ion can egula e TE ac i i y o in eg a ion could ha e been selec ed o i TE deploymen is some imes, bu no always, ad an ageous. The s udy o TE- esponse o en i onmen al luc ua ions in o he model o ganisms is needed o unde s and he conse a ion and/o gene ali y o such mechanisms. The e ha e been se e al a emp s o demons a e induc ion o mobile elemen s associa ed wi h s ess ul condi ions in D. melanogas e 148. These include ci cums an ial e idence o TE esponse o hea 149–151, e hanol, adia ion, and i al in ec ion152,153 hough esul s we e s ongly dependen on he ansposon and gene ic backg ound analyzed. While he e is e idence o he impo ance o en i onmen al ac o s in he egula ion o TE ac i i y, empi ical esea ch on o he hos o ganisms and ansposon ypes is needed o elucida e he occu ence and impo ance o such s a egies. 1.2.3 TEs as sou ce o gene ic a ia ion The amous colou pheno ypes o co n ke nels i s desc ibed by Ba ba a McClin ock esul om TE ins abili y and inse ion in essen ial pigmen a ion pa hway genes154. In ha s udy, ansposi ion occu ed du ing ke nel de elopmen and he e o e induced non-he i able mu a ions123,154. In ac , only TE ac i i y in he ge mline will con ibu e o he i able gene ic a ia ion, which is wha is ele an o e olu ion. The ansposon-media ed mu a ion a e can ange om 10-3 and 10-5 pe elemen pe gene a ion, depending on he elemen , whe eas he classical nucleo ide subs i u ion a e luc ua es a ound 10-8 and 10-9 pe nucleo ide pe gene a ion155. Upon ansposi ion, TEs can in luence exp ession o neighbou ing genes, bo h a he ansc ip ional and pos - ansc ip ional le els (Figu e 1.5). In e es ingly, se e al mobile elemen s adding ! 31! new egula o y egions a e sca e ed along he genome and can play an impo an unc ion in he es ablishmen o gene ic ne wo ks156,157. The p e e ence o DNA elemen s o Hsp p omo e s in D osophila158 and he conside able impac o LTR e o ansposons in he ansc ip ional ne wo k o human p53159 p o ide good examples o his. Figu e 1.5. T ansc ip ional and pos - ansc ip ional modi ica ions media ed by TE inse ions. Gene exp ession and/o unc ion can be a ec ed by no el TE inse ions. Those can be media ed by he induc ion o ansc ip ional (A-E) o pos - ansc ip ional modi ica ions (F-I). Gi en ha ansposons con ain hei own p omo e s and cis- egula o y egions, TE inse ions ups eam o a gene can in oduce an al e na i e ansc ip ion s a si e (A), dis up exp ession when inse ed wi hin gene egula o y elemen s (B) o add new egula o y elemen s (C)160–166. In addi ion, TE in eg a ion can also p omo e an i-sense ansc ip ion (D)167 o ec ui ch oma in- emodeling p o eins ha e en ually silence gene and TE ac i i y (E)168. Con e sely, TE in eg a ion may media e pos - ansc ip ional A B C D E F G H I ! 32! modi ica ions by in oducing al e na i e polyadenyla ion signals (F)169,170, no el miRNA a ge si es (G)171 o al e na i e splicing e en s (H)172,173. TE sequences can also be inco po a ed as an al e na i e exon (p ocess called exoniza ion) ha can esul in he ansla ion o a new p o ein iso o m, o media e mRNA deg ada ion by he nonsense- media ed decay (NMD) i new s op codons a e inse ed (as e isk) (I)163,174. This igu e was modi ied om Fescho e (2008)156. The con ibu ion o TE ac i i y o he p oduc ion o gene ic a ia ion is a gene al p ope y o li ing o ganisms. In ac , ac i e ansposons ha e been ound in he genome assemblies o ma ine plank on175 as well as in se e al plan 176–178 and ish179,180 species. Addi ionally, mo e de ailed s udies on he selec i e alue o TE inse ions seg ega ing in D. melanogas e na u al popula ions e ealed ha many a e adap i e wi h pu a i e unc ion in p ocesses such as pes icide esis ance181,182, oxida i e s ess183, amino acid me abolism, immune esponse o i al in ec ion and eye de elopmen 184. Mo eo e , expe imen al e olu ion in bac e ia has shown changes in TE ac i i y and selec ion o no el inse ions du ing adap a ion o gu en i onmen 6. In summa y, he onse o e idence o he impo ance o mobile elemen s in adap a ion dis inguishes hose sequences as enginee s o ansc ip ional ne wo ks and pu a i e media o s o di e si ica ion. 1.2.4 TEs and no el y The bulk o s udies in e olu iona y biology en ail esea ch abou adap a ion, specia ion and he o igin o no el ies – lineage speci ic ai s wi h adap i e alue185. This las esea ch p og am ad anced he eme gence o a new discipline (e olu iona y de elopmen al biology) ha ocuses on he gene ic basis o in a- and in e -speci ic mo phological a ia ion186. Du ing he pas yea s, i has become clea ha TEs a e a he ounda ion o se e al no el ai s and hence demand u he a en ion. Among hose, esea che s ga he ed e idence o he e olu ion o conspicuous male in colou pa e ns ha a e in ol ed in ma ing o cichlids187, he o igin o mammal placen a188 and he di e si ica ion o ui colou and shape189; all pheno ypes de i ing om ansposon inse ions ha esul ed in cis- egula o y changes o neighbou ing genes. Aside hese examples ! 33! o how pa icula TE inse ions a ec ed gene exp ession o media ed new genomic unc ions, he e is also documen a ion o a ious “domes ica ion e en s” ha p oduced new p o ein-coding genes om ansposases156. In pa icula , he V(D)J ecombina ion eac ion necessa y o adap i e immuni y elies on ansposase-de i ed RAG1 ha eme ged in jawed e eb a es190. O he examples also ound in me azoans deal wi h he e olu ion o highly conse ed PAX p o eins ha unc ion in eye de elopmen and cephaliza ion191 as well as cen ome e-associa ed p o ein B (CENP-B) ha is ela ed wi h cell-cycle192. Addi ionally, a s iking scena io o con e gence be ween dis an lineages desc ibes he pu a i e ecu en appea ance o ansposase-de i ed p o eins ha a e in ol ed in a - ed ligh signalling in yeas , insec s and angiospe ms156,193,194. All in all, i is clea ha TEs a e c i ical media o s o di e si ica ion and inno a ion. 1.3 Mechanisms o ep ess TE ac i i y Despi e he impo ance o mobile gene ic elemen s in c ea ing adap i e a ia ion and con ibu ing o mo phological di e si y, hey can h ea en genomic in eg i y and educe i ness when ac i e in he ge mline195. As a esul , me azoan species ha e e ol ed mechanisms o p omo e speci ic TE ecogni ion and guide silencing h ough he use o small RNAs196,197. Small RNAs can be g ouped in o h ee main classes ha di e in hei biogenesis p ocess and biological/biochemical unc ion. Small in e e ing RNAs (siRNAs) and mic o RNAs (miRNAs) a e ubiqui ously exp essed and de i e om double s anded RNAs p ocessed by he RNA-clea ing enzyme Dice , whe eas he gonadal speci ic PIWI-in e ac ing RNAs (piRNAs) a e p oduced h ough Dice - independen mechanisms and de i e om bo h single and double s anded RNAs198,199. Mos in o ma ion a ailable abou piRNA ac i i y comes om s udies in D. melanogas e ha is cu en ly used as e e ence o TE-silencing sys ems in o he species197. The main unc ion o piRNAs is o media e homology- dependen ansposon silencing while in e ac ing wi h p o eins ha belong o he PIWI amily – Piwi, Aube gine (Aub) and A gonau e 3 (AGO3)200–202. piRNAs ! 34! belong o a g oup o sequences ha a e pa icula ly di e se and ansc ibed om in e genic inac i e epe i i e elemen s ha collec i ely map o genomic clus e s. In D. melanogas e he e a e 569 desc ibed piRNA clus e s (h p://pi nabank.ibab.ac.in/), and only some a e exclusi ely exp essed in he ge mline o males and emales203–205. Con e sely, o he clus e s speci ically ep ess TE ac i i y in he soma ic issues o o a ies, whe eas some ep ess bo h ge mline and soma ic exp ession o mobile elemen s203. Figu e 1.6. P og essi e oocy e de elopmen in D. melanogas e o a ioles. Oogenesis ini ia es a he ge ma ium ha is localized a he an e io ip o o a ioles. The e, ge mline s em cells (GSC) di ide o p oduce oocy e and nu se cells; soma ic s em cells (SSC) gi e ise o ollicula cells. When he egg chambe exi s he ge ma ium, a laye o ollicula cells is p o ec ing he oocy e and nu se cells ha main ain a common cy oplasm. 1.3.1 piRNA pa hway in he o a y o D. melanogas e D osophila o a ies a e composed o mul iple o a ioles each made up o a se ies o egg chambe s wi h an e io -pos e io p og essi e de elopmen (Figu e 1.6). The soma ic suppo cells es ablish an in ica e ela ionship wi h he ge mline by eeding de elopmen al signals and nu ien s in o he oocy e and nu se cells syncy ium206. This close in e ac ion be ween soma ic ( ollicula cells) and ge mline (oocy e and nu se cells) issue exposes he oocy e genome o h ea s ha can de i e om bo h cell ypes. In ac , se e al ansposons a e able o exp ess in he ge mline whe e mo emen can di ec ly d i e he i able ansmission195,207–209, bu e o ansposons exp essed in ollicula cells can also o m e o i al pa icles ha e icien ly in ade he oocy e210–213. To minimize TE S age 10 S age 14S age 8 Ge ma ium S age 3 S age 5 Egg chambe Oocy e Nu se cells Follicula cells GSC SSC Egg An e io Pos e io ! 35! access o he emale game ocy e, he piRNA pa hway unc ions as a genome su eillance sys em o bo h cell ypes. In e es ingly, piRNA biogenesis di e s be ween soma ic and ge mline issue leading o dis inc silencing p ocesses used o ep ess TEs in di e en cell ypes203. In ollicula cells o e 90% o he piRNA pool is an isense o ansposons ha a e speci ically ac i e in soma ic gonadal cells and belong o he gypsy amily214. Mos a e p oduced om wo X-ch omosomal clus e s – he lamenco locus and clus e 20A – and de i e om long single-s anded ansc ip s ha a e p ocessed in o smalle sequences214,215. In e es ingly, he p oduc ion o hose genomic gua dians is independen o he exp ession o ac i e ansposons and hence cons i u es he p ima y piRNA biogenesis214. The biogenesis s ep akes place in he cy oplasm, whe e he Piwi p o ein (only elemen o he PIWI- amily exp essed in ollicula cells) is loaded wi h piRNAs216. Piwi-piRNA complexes hen mig a e o he nucleus o media e ansc ip ional ep ession o mobile elemen s217. The genomic place o TE inse ions is ecognized by complemen a i y wi h piRNA sequences, and Piwi di ec s he accumula ion o he e och oma ic ma ks a hose genomic places h ough di ec in e ac ion wi h he e och oma in p o ein 1a ha is a cen al playe in he e och oma ic gene silencing (Figu e 1.7)168. ! 36! Figu e 1.7. P ima y piRNA biogenesis in ollicula cells. piRNA p oduc ion in o a ian soma ic issue consis s o p ima y biogenesis esul an om p ocessing o wo main clus e s (clus e 20A and lamenco, ed box). Those a e unidi ec ionally ansc ibed and p ocessed in o smalle sequences (piRNAs). Piwi loaded wi h piRNAs mig a es o he nucleus o p omo e TE ep ession by ec ui ing ch oma in- emodeling p o eins. A pu a i e TE inse ion in he X-ch omosome is highligh ed in he blue box. In ge mline cells he a chi ec u e o piRNA biogenesis is complex and in ol es he p oduc ion o bo h sense and an isense small RNAs. Those o igina e om se e al piRNA clus e s ha a e sca e ed along he genome and comp ehend an ex ensi e collec ion o agmen ed TE sequences215. Clus e s ha a e exp essed in he soma ic and ge mline issue o o a ies (such as he p e iously desc ibed clus e 20A) a e unidi ec ionally ansc ibed; ge mline-speci ic clus e s (such as he well desc ibed clus e 42AB) a e bidi ec ionally ansc ibed and p oduce double-s anded ansc ip s ha a e ully clea ed un il piRNAs203,214. Those a e hen loaded in o all h ee PIWI amily p o eins: Piwi and Aub bind o an isense ! 37! and AGO3 o sense piRNAs. In addi ion o he p ima y biogenesis, piRNAs unde go a loop o ampli ica ion ha is mos ly d i en by Aub and AGO3. Those wo p o eins a e en iched a ound he nucleus whe e Aub-piRNA complexes a ge and di ec TE ansc ip s o clea age. As a consequence, sense piRNAs a e p oduced and inco po a ed by AGO3, ha has he po en ial o speci ically igge piRNA clus e p ocessing and inc ease he abundance o an isense piRNAs loaded in o Aub215. In pa allel, Piwi-piRNA complexes main ain unc ion o p omo e ch oma in- emodelling changes a he loci whe e ansponsons a e inse ed. In e es ingly, ma e nal ansmission o an isense small RNAs associa ed wi h bo h Piwi and Aub wo ks as a ca alys o p oduce piRNAs c ucial o ep ess TEs in he nex gene a ion207. The na u e o Aub and AGO3 engagemen o p oduce piRNAs in he ge mline named his ampli ica ion loop as ping-pong cycle215. This mechanism ep esen s he hallma k o he ge mline piRNA pa hway as i is conse ed in a spec um o species ha ange om sponges o mammals (Figu e 1.8)218–221. Figu e 1.8. P oduc ion o piRNAs in he ge mline. Se e al piRNA clus e s, including clus e 42AB, a e bidi ec ionally exp essed in he ge mline ( ed box). As a consequence, bo h sense and an isense piRNAs a e p oduced and loaded in o all PIWI- amily p o eins. ! 44! ch omosome o D osophila melanogas e . Gene ics 530–532 (1926). 21. Hende son, S. A. & Edwa ds, R. G. Chiasma equency and ma e nal age in mammals. Na u e 218, 22–28 (1968). 22. P ies , N. K., Roach, D. A. & Galloway, L. F. Ma ing-induced ecombina ion in ui lies. E olu ion (N. Y). 61, 160–167 (2007). 23. Hussin, J., Roy-Gagnon, M. H., Gend on, R., Andel inge , G. & Awadalla, P. Age-dependen ecombina ion a es in human pedig ees. PLoS Gene . 7, (2011). 24. Neel, J. V. A Rela ion be ween La al Nu i ion and he F equency o C ossing o e in he Thi d Ch omosome o D osophila Melanogas e . Gene ics 26, 506–516 (1941). 25. Bjedo , I. e al. S ess-induced mu agenesis in bac e ia. Sicence 42, 1404–1409 (2003). 26. Mulle , H. J. The Measu emen o Gene Mu a ion Ra e IN D osophila, I s High Va iabili y, and I s Dependence Upon Tempe a u e. Gene ics 279– 357 (1928). 27. A mb us e , P. & Reed, D. H. Inb eeding dep ession in benign and s ess ul en i onmen s. He edi y (Edinb). 95, 235–242 (2005). 28. de Nadal, E., Amme e , G. & Posas, F. Con olling gene exp ession in esponse o s ess. Na . Re . Gene . (2011). doi:10.1038/n g3055 29. Azad, P., Zhou, D., Russo, E. & Haddad, G. G. Dis inc mechanisms unde lying ole ance o in e mi en and cons an hypoxia in D osophila melanogas e . PLoS One 4, e5371 (2009). 30. De Angelis, M. & Gobbe i, M. En i onmen al s ess esponses in Lac obacillus: A e iew. P o eomics 4, 106–122 (2004). 31. Wagne , E. F. & Neb eda, A. R. Signal in eg a ion by JNK and p38 MAPK pa hways in cance de elopmen . Na Re Cance 9, 537–549 (2009). 32. Kamada, Y., Jung, U. S., Pio owski, R. & Le in, D. E. The P o ein- Kinase C-Ac i a ed Map Kinase Pa hway o Saccha omyces-Ce e isiae Media es a No el Aspec o he Hea -Shock Response. Genes De . 9, 1559–1571 (1995). 33. Lemai e, B. & Ho mann, J. The Hos De ense o D osophila melanogas e . Annu. Re . Immunol. 25, 697–743 (2007). 34. Mi le , R. Oxida i e s ess, an ioxidan s and s ess ole ance. 7, 405–410 (2002). 35. Inoue, H. e al. The C . elegans p38 MAPK pa hway egula es nuclea localiza ion o he ansc ip ion ac o SKN-1 in oxida i e s ess esponse. 2278–2283 (2005). doi:10.1101/gad.1324805.2278 ! 45! 36. Ko un, Y., Chiu, W. L., Tena, G. & Sheen, J. Func ional analysis o oxida i e s ess-ac i a ed mi ogen-ac i a ed p o ein kinase cascade in plan s. P oc. Na l. Acad. Sci. U. S. A. 97, 2940–2945 (2000). 37. de Nadal, E., Alepuz, P. M. & Posas, F. Dealing wi h osmos ess h ough MAP kinase ac i a ion. EMBO Rep. 3, 735–740 (2002). 38. Thomas, M. B. & Blan o d, S. The mal biology in insec -pa asi e in e ac ions. T ends Ecol. E ol. 18, 344–350 (2003). 39. Ragland, G. J. & Kingsol e , J. G. The e ec o luc ua ing empe a u es on ec o he m li e-his o y ai s: Compa isons among geog aphic popula ions o Wyeomyia smi hii. E ol. Ecol. Res. 10, 29–44 (2008). 40. Lazza o, B. P., Flo es, H. a., Lo igan, J. G. & You h, C. P. Geno ype-by- en i onmen in e ac ions and adap a ion o local empe a u e a ec immuni y and ecundi y in D osophila melanogas e . PLoS Pa hog. 4, 1–9 (2008). 41. Coline , H., Sinclai , B. J., Ve non, P. & Renaul , D. Insec s in Fluc ua ing The mal En i onmen s. Annu. Re . En omol. 60, 123–140 (2015). 42. F anzmann, T. M., Menho n, P., Wal e , S. & Buchne , J. Ac i a ion o he Chape one Hsp26 Is Con olled by he Rea angemen o I s The mosenso Domain. Mol. Cell 29, 207–216 (2008). 43. Hamada, F. N. e al. An in e nal he mal senso con olling empe a u e p e e ence in D osophila. Na u e 454, 217–220 (2008). 44. McClung, C. R. & Da is, S. J. Ambien he mome e s in plan s: F om physiological ou pu s owa ds mechanisms o he mal sensing. Cu . Biol. 20, 1086–1092 (2010). 45. Rich e , K., Haslbeck, M. & Buchne , J. The Hea Shock Response: Li e on he Ve ge o Dea h. Mol. Cell 40, 253–266 (2010). 46. Dhaka, A., Viswana h, V. & Pa apou ian, A. T p Ion Channels and Tempe a u e Sensa ion. Annu. Re . Neu osci. 29, 135–161 (2006). 47. Klinke , B. & Na be haus, F. Mic obial he mosenso s. Cell. Mol. Li e Sci. 66, 2661–2676 (2009). 48. Fede , M. E. & Ho mann, G. E. Hea -shock p o eins, molecula chape ones, and he s ess esponse: E olu iona y and Ecological Physiology. Annu. Re . Physiol 61, 243–282 (1999). 49. Ake el , M., Mo imo o, R. I. & Sis onen, L. Hea shock ac o s: in eg a o s o cell s ess, de elopmen and li espan. Na . Re . Mol. Cell Biol. 11, 545–555 (2010). 50. Gasch, a P. e al. Genomic exp ession p og ams in he esponse o yeas cells o en i onmen al changes. Mol. Biol. Cell 11, 4241–4257 ! 46! (2000). 51. Caus on, H. e al. Remodeling o yeas genome exp ession in esponse o en i onmen al changes. Mol Biol Cell 12, 323–337 (2001). 52. Shamo sky, I. & Nudle , E. New insigh s in o he mechanism o hea shock esponse ac i a ion. Cell. Mol. Li e Sci. 65, 855–861 (2008). 53. Shi, Y., Mosse , D. D. & Mo imo o, R. I. Molecula chape ones as HSF1- speci ic ansc ip ional ep esso s. Genes De . 12, 654–666 (1998). 54. Bale , R., Welch, W. J. & Voellmy, R. Hea shock gene egula ion by nascen polypep ides and dena u ed p o eins: hsp70 as a po en ial au o egula o y ac o . J. Cell Biol. 117, 1151–1159 (1992). 55. Ab a aya, K. & Biology, C. The human hea shock p o ein hsp70 in e ac s wi h HSF , he ansc ip ion ac o ha egula es hea shock gene exp ession iii ; ii ! i ! iiiii ii. 1153–1164 (1992). doi:10.1101/gad.6.7.1153 56. Goodson, M. L. & Sa ge, K. D. Hea -inducible DNA binding o pu i ied hea shock ansc ip ion ac o . J. Biol. Chem. 270, 2447–2450 (1995). 57. La son, J. S., Schue z, T. J. & Kings on, R. E. In i o ac i a ion o pu i ied human hea shock ac o by hea . Biochemis y 34, 1902–1911 (1995). 58. Pa ke , C. S. & Topol, J. A D osophila RNA polyme ase II ansc ip ion ac o con ains a p omo e - egion-speci ic DNA-binding ac i i y. Cell 36, 357–369 (1984). 59. Chu, B., Soncin, F., P ice, B. D., S e enson, M. A. & Calde wood, S. K. Sequen ial Phospho yla ion by Mi ogen-ac i a ed P o ein Kinase and Glycogen Syn hase Kinase 3Rep esses T ansc ip ional Ac i a ion by Hea Shock Fac o -1. J. Biol. Chem. 271, 30847–30857 (1996). 60. Raison, J. K. The in luence o empe a u e-induced phase changes on he kine ics o espi a o y and o he memb ane-associa ed enzyme sys ems. J. Bioene g. 4, 285–309 (1973). 61. Phillips, R. S. Tempe a u e modula ion o he s e eochemis y o enzyma ic ca alysis: P ospec s o exploi a ion. T ends Bio echnol. 14, 13–16 (1996). 62. B auchi, S., O io, P. & La o e, R. Clues o unde s anding cold sensa ion: he modynamics and elec ophysiological analysis o he cold ecep o TRPM8. P oc. Na l. Acad. Sci. U. S. A. 101, 15494–15499 (2004). 63. Voe s, T. e al. The p inciple o empe a u e-dependen ga ing in cold- and hea -sensi i e TRP channels. Na u e 430, 748–754 (2004). 64. Rosenzweig, M. e al. The D osophila o holog o e eb a e TRPA1 ! 47! egula es he mo axis. Genes De . 19, 419–424 (2005). 65. Finkel, T. & Holb ook, N. J. Oxidan s, oxida i e s ess and he biology o ageing. Na u e 408, 239–247 (2000). 66. Buchon, N., Sil e man, N. & Che y, S. Immuni y in D osophila melanogas e - om mic obial ecogni ion o whole-o ganism physiology. Na . Re . Immunol. 14, 796–810 (2014). 67. Be e idge, D. J. Wha Is Oxida i e S ess? Me abolism 49, 3–8 (2000). 68. Finkel, T. Oxidan signals and oxida i e s ess. Cu . Opin. Cell Biol. 15, 247–254 (2003). 69. Allen, R. G. & T esini, M. Oxida i e s ess and gene egula ion. F ee Radic. Biol. Med. 28, 463–499 (2000). 70. Zhong, M., O osz, a & Wu, C. Di ec sensing o hea and oxida ion by D osophila hea shock ansc ip ion ac o . Mol. Cell 2, 101–108 (1998). 71. Singh, V. & Aballay, A. Hea Shock and Gene ic Ac i a ion o HSF-1 Enhance Immuni y o Bac e ia. 5, 2443–2446 (2006). 72. Bu don, R. H. Supe oxid and hyd ogen pe oxide in ela ion o mammalian cell p oli e a ion. 18, 775–794 (1995). 73. Beckman, K. B. & Ames, B. N. The ee adical heo y o aging ma u es. Physiol. Re . 78, 547–581 (1998). 74. Sai oh, M. e al. Mammalian hio edoxin is a di ec inhibi o o apop osis signal- egula ing kinase (ASK) 1. EMBO J. 17, 2596–2606 (1998). 75. Adle , V. e al. Regula ion o JNK signaling by GSTp. EMBO J. 18, 1321– 34 (1999). 76. Lee, S. R., Kwon, K. S., Kim, S. R. & Rhee, S. G. Re e sible inac i a ion o p o ein y osine phospha ase 1B in A431 cells s imula ed wi h epide mal g ow h ac o . J. Biol. Chem. 273, 15366–15372 (1998). 77. Wang, X., McCullough, K. D., F anke, T. F. & Holb ook, N. J. Epide mal g ow h ac o ecep o -dependen Ak ac i a ion by oxida i e s ess enhances cell su i al. J. Biol. Chem. 275, 14624–14631 (2000). 78. Polyak, K., Xia, Y., Zweie , J. L., Kinzle , K. W. & Vogels ein, B. A model o p53-induced apop osis. Na u e 389, 300–305 (1997). 79. Johnson, T. M., Yu, Z. X., Fe ans, V. J., Lowens ein, R. a & Finkel, T. Reac i e oxygen species a e downs eam media o s o p53-dependen apop osis. P oc. Na l. Acad. Sci. U. S. A. 93, 11848–11852 (1996). 80. de Ba y, H. A. Die E scheinung de Symbiose. (1879). 81. Relman, D. A. ʻTil dea h do us pa ʼ: coming o e ms wi h symbio ic ela ionships. Na . Re . Mic obiol. 6, 721–724 (2008). ! 48! 82. We en, J. H., Baldo, L. & Cla k, M. E. Wolbachia: mas e manipula o s o in e eb a e biology. Na . Re . Mic obiol. 6, 741–751 (2008). 83. Baumann, P., Mo an, N. A. & Baumann, L. Gene ics o Aphid Endosymbion s. Bioscience 47, 12–20 (1997). 84. Taylo , M. J. & Hoe au , A. Wolbachia bac e ia o ila ial nema odes. Pa asi ol. Today 15, 437–442 (1999). 85. Fos e , J. e al. The Wolbachia genome o B ugia malayi: Endosymbion e olu ion wi hin a human pa hogenic nema ode. PLoS Biol. 3, 0599–0614 (2005). 86. C aig, S. C. & S ephen, J. G. T anso a ial inhe i ance o endosymnio ic Bac e ia in clams onhabi ing deep-sea hyd o he mal en s and colds- seeps. P oc Na l Acad Sci U S A 90, 5695–5699 (1993). 87. S ewa , F. J. & Ca anaugh, C. M. Bac e ial endosymbioses in Solemya (Mollusca: Bi al ia) - Model sys ems o s udies o symbion -hos adap a ion. An onie an Leeuwenhoek, In . J. Gen. Mol. Mic obiol. 90, 343–360 (2006). 88. Ushe , K. M., Kuo, J., F omon , J. & Su on, D. C. Ve ical ansmission o cyanobac e ial symbion s in he ma ine sponge Chond illa aus aliensis (Demospongiae). Hyd obiologia 461, 15–23 (2001). 89. Sha p, K. H., Eam, B., John Faulkne , D. & Haygood, M. G. Ve ical ansmission o di e se mic obes in he opical sponge Co icium sp. Appl. En i on. Mic obiol. 73, 622–629 (2007). 90. T am, U. & Sulli an, W. Role o Delayed Nuclea En elope B eakdown and Mi osis in Wolbachia-Induced Cy oplasmic Incompa ibili y. Science (80-. ). 296, 1124–1126 (2002). 91. S ou hame , R. & Kazme , D. J. Cy ogene ics o mic obe-associa ed pa henogenesis and i s consequences o gene low in T ichog amma wasps. He edi y (Edinb). 73, 317–327 (1994). 92. Kose, H. & Ka , T. L. O ganiza ion o Wolbachia pipien is in he D osophila e ilized egg and emb yo e ealed by an an i-Wolbachia monoclonal an ibody. Mech. De . 51, 275–288 (1995). 93. Fe ee, P. M. e al. Wolbachia u ilizes hos mic o ubules and Dynein o an e io localiza ion in he D osophila Oocy e. PLoS Pa hog. 1, 0111– 0124 (2005). 94. Se bus, L. R. & Sulli an, W. A cellula basis o Wolbachia ec ui men o he hos ge mline. PLoS Pa hog. 3, 1930–1937 (2007). 95. Sheehan, K. B., Ma in, M., Lesse , C. F., Isbe g, R. R. & New on, L. G. Iden i ica ion and Cha ac e iza ion o a Candida e Wolbachia pipien is Type IV E ec o Tha In e ac s wi h he Ac in Cy oskele on. MBio 7, 1–12 ! 49! (2016). 96. O e, M., Ueyama, M. & Yamamo o, D. Wolbachia P o ein TomO Ta ge s nanos mRNA and Res o es Ge m S em Cells in D osophila Sex-le hal A icle Wolbachia P o ein TomO Ta ge s nanos mRNA and Res o es Ge m S em Cells in D osophila Sex-le hal Mu an s. Cu . Biol. 26, 1–10 (2016). 97. Chin apalli, V. R., Wang, J. & Dow, J. a T. Using FlyA las o iden i y be e D osophila melanogas e models o human disease. Na . Gene . 39, 715–20 (2007). 98. Go a , M. e al. The D osophila immune esponse agains G am- nega i e bac e ia is media ed by a pep idoglycan ecogni ion p o ein. Na u e 416, 640–644 (2002). 99. Choe, K. M., We ne , T., S o en, S., Hul ma k, D. & Ande son, K. V. Requi emen o a pep idoglycan ecogni ion p o ein (PGRP) in Relish ac i a ion and an ibac e ial immune esponses in D osophila. Science (80-. ). 296, 359–362 (2002). 100. Räme , M., Man uelli, P., Pea son, A., Ma hey-P e o , B. & Ezekowi z, R. A. B. Func ional genomic analysis o phagocy osis and iden i ica ion o a D osophila ecep o o E. coli. Na u e 416, 644–648 (2002). 101. Kaneko, T. e al. Monome ic and polyme ic g am-nega i e pep idoglycan bu no pu i ied LPS s imula e he D osophila IMD pa hway. Immuni y 20, 637–649 (2004). 102. Takehana, A. e al. Pep idoglycan ecogni ion p o ein (PGRP)-LE and PGRP-LC ac syne gis ically in D osophila immuni y. Embo J 23, 4690– 4700 (2004). 103. Kaneko, T. e al. PGRP-LC and PGRP-LE ha e essen ial ye dis inc unc ions in he d osophila immune esponse o monome ic DAP- ype pep idoglycan. Na . Immunol. 7, 715–723 (2006). 104. B umell, J. H. & Scidmo e, M. a. Manipula ion o ab GTPase unc ion by in acellula bac e ial pa hogens. Mic obiol. Mol. Biol. Re . 71, 636–652 (2007). 105. Roy, C. R. Exploi a ion o he endoplasmic e iculum by bac e ial pa hogens. T ends Mic obiol. 10, 418–424 (2002). 106. Se bus, L. R., Caspe -Lindley, C., Landmann, F. & Sulli an, W. The gene ics and cell biology o Wolbachia-hos in e ac ions. Annu. Re . Gene . 42, 683–707 (2008). 107. Vo onin, D., Dudkina, N. V & Kisele a, E. V. A new o m o symbio ic bac e ia Wolbachia ound in he endoplasmic e iculum o ea ly emb yos o D osophila melanogas e . Dokl Biol Sci 396, 227–229 (2004). ! 50! 108. McClin ock, B. Induc ion o Ins abili y a Selec ed Loci in Maize. Gene ics 38, 579–599 (1953). 109. McClin ock, B. The o igin and beha iou o mu able loci in maize. Gene ics 36, 344–355 (1950). 110. O gel, L. E. & C ick, F. H. C. Sel ish DNA: he ul ima e pa asi e. Na u e 284, 604–607 (1980). 111. Dooli le, W. F. & Sapienza, C. Sel ish genes, he pheno ype pa adigm and genome e olu ion. Na u e 284, 601–603 (1980). 112. Kidwell, M. G. & Lisch, D. R. Pe spec i e: ansposable elemen s, pa asi ic dna, and genome e olu ion. E olu ion (N. Y). 55, 1–24 (2001). 113. González, J., Macphe son, J. M. & Pe o , D. a. A ecen adap i e ansposable elemen inse ion nea highly conse ed de elopmen al loci in D osophila melanogas e . Mol. Biol. E ol. 26, 1949–1961 (2009). 114. González, J. & Pe o , D. A. The adap i e ole o ansposable elemen s in he D osophila genome. Gene 448, 124–33 (2009). 115. Ko le , R., Be ancou , A. J. & Schlö e e , C. Sequencing o pooled DNA samples (Pool-Seq) unco e s complex dynamics o ansposable elemen inse ions in D osophila melanogas e . PLoS Gene . 8, (2012). 116. Fis on-La ie , A.-S., Ba ón, M. G., Pe o , D. A. & González, J. T-lex2: geno yping, equency es ima ion and e-anno a ion o ansposable elemen s using single o pooled nex -gene a ion sequencing da a. Nucleic Acids Res. 43, e22 (2014). 117. Kaminke , J. e al. The ansposable elemen s o he D osophila melanogas e euch oma in: a genomics pe spec i e. Genome Biol. 3, 1– 20 (2002). 118. In e na ional Rice Genome Sequencing P ojec . The map-based sequence o he ice genome. Na u e 436, 793–800 (2005). 119. Daboussi, M.-J. & Capy, P. T ansposable elemen s in ilamen ous ungi. Annu. Re . Mic obiol. 57, 275–299 (2003). 120. Human Genome Sequencing Conso ium. Ini ial sequencing and analysis o he human genome. Na u e 409, 860–921 (2001). 121. Wicke , T. e al. A uni ied classi ica ion sys em o euka yo ic ansposable elemen s. Na . Re . Gene . 8, 973–982 (2007). 122. Le in, H. L. & Mo an, J. V. Dynamic in e ac ions be ween ansposable elemen s and hei hos s. Na . Re . Gene . 12, 615–627 (2011). 123. Fescho e, C., Jiang, N. & Wessle , S. R. Plan T ansposable Elemen s: Whe e Gene ics Mee s Genomics. Na . Re . Gene . 3, 329–341 (2002). ! 51! 124. Ca , M., Bensasson, D. & Be gman, C. M. E olu iona y Genomics o T ansposable Elemen s in Saccha omyces ce e isiae. 7, (2012). 125. Kim, J. M. e al. T ansposable Elemen s and Genome O ganiza ion : A Comp ehensi e Su ey o Re o ansposons Re ealed by he Comple e Saccha omyces ce e isiae Genome ? Sequence T ansposable Elemen s and Genome O ganiza ion : A Comp ehensi e Su ey o Re o ansposons Re ea. 464–478 (1998). doi:10.1101/g .8.5.464 126. Kazazian J ., H. H. Mobile Elemen s: D i e s o Genome E olu ion. Science (80-. ). 303, 1626–1632 (2004). 127. Fescho e, C. & P i ham, E. J. DNA ansposons and he e olu ion o euka yo ic genomes. Annu. Re . Gene . 41, 331–68 (2007). 128. Kempken, F. & Windho e , F. The hAT amily: a e sa ile ansposon g oup common o plan s, ungi, animals, and man. Ch omosoma 110, 1– 9 (2001). 129. Fescho e, C. & P i ham, E. J. Non-mammalian c-in eg ases a e encoded by gian ansposable. BMC E ol. Biol. 4, 22–32 (2004). 130. DeMa co, R., Venancio, T. M. & Ve jo ski-Almeida, S. SmTRC1, a no el Schis osoma mansoni DNA ansposon, discloses new amilies o animal and ungi ansposons belonging o he CACTA supe amily. BMC E ol. Biol. 6, 89 (2006). 131. G eenbla , I. M. & B ink, A. Twin mu a ions in medium a iega ed pe ica p maize. Gene ics 47, 489–501 (1961). 132. Nassi , N., Penney, J., Pal, S., Engels, W. R. & Gloo , G. B. E icien copying o nonhomologous sequences om ec opic si es ia P-elemen - induced gap epai . Mol. Cell. Biol. 14, 1613–25 (1994). 133. Nobel Lec u es: Physiology o Medicine 1981-1990. (Wo ld Scien i ic Publishing Co. P e. L d., 1993). 134. Ikeda, K., Nakayashiki, H., Takagi, M., Tosa, Y. & Mayama, S. Hea shock, coppe sul a e and oxida i e s ess ac i a e he e o ansposon MAGGY esiden in he plan pa hogenic ungus Magnapo he g isea. Mol. Gene . Genomics 266, 318–325 (2001). 135. Kimu a, Y. e al. OARE-1, a Ty1-copia e o ansposon in oa ac i a ed by abio ic and bio ic s esses. Plan Cell Physiol. 42, 1345–1354 (2001). 136. Salaza , M., González, E., Casa e o, J. A., Casacube a, J. M. & Ruiz- La a, S. The p omo e o he TLC1.1 e o ansposon om Solanum chilense is ac i a ed by mul iple s ess- ela ed signaling molecules. Plan Cell Rep. 26, 1861–1868 (2007). 137. Se an , G., Penne ie , C. & Lesage, P. Remodeling yeas gene ansc ip ion by ac i a ing he Ty1 long e minal epea e o ansposon ! 52! unde se e e adenine de iciency. Mol. Cell. Biol. 28, 5543–5554 (2008). 138. Wood ow, P., Pon eco o, G., Cia miello, L. F., Fuggi, A. & Ca illo, P. T d1a p omo e is in ol ed in DNA-p o ein binding by sal and ligh s esses. Mol. Biol. Rep. 38, 3787–3794 (2011). 139. Casacube a, E. & González, J. The impac o ansposable elemen s in en i onmen al adap a ion. Mol. Ecol. 22, 1503–1517 (2013). 140. Pou eau, S., G andbas ien, M.-A. & Bocca a, M. Mic obial elici o s o plan de ence esponses ac i a e ansc ip ion o a e o ansposon. Plan J. 5, 535–542 (1994). 141. G andbas ien, M. A. Ac i a ion o plan e o ansposons unde s ess condi ions. T ends Plan Sci. 3, 181–187 (1998). 142. Takeda, S., Sugimo o, K., O suki, H. & Hi ochika, H. A 13-bp cis- egula o y elemen in he LTR p omo e o he obacco e o ansposon T o1 is in ol ed in esponsi eness o issue cul u e, wounding, me hyl jasmona e and ungal elici o s. Plan J. 18, 383–393 (1999). 143. Begui is ain, T., G andbas ien, M.-A., Puigdomènech, P. & Casacube a, J. M. Th ee Tn 1 Sub amilies Show Di e en S ess-Associa ed Pa e ns o Exp ession in Tobacco. Consequences o Re o ansposon Con ol and E olu ion in Plan s. Plan Physiol. 127, 212–221 (2001). 144. Kuma , A. & Benne zen, J. L. Plan e o ansposons. Annu. Re . Gene . 33, 479–532 (1999). 145. G andbas ien, M. a, Spielmann, A. & Caboche, M. Tn 1, a mobile e o i al-like ansposable elemen o obacco isola ed by plan cell gene ics. Na u e 337, 376–380 (1989). 146. Dai, J., Xie, W., B ady, T. L., Gao, J. & Voy as, D. F. Phospho yla ion Regula es In eg a ion o he Yeas Ty5 Re o ansposon in o He e och oma in. Mol. Cell 27, 289–299 (2007). 147. Ebina, H. & Le in, H. L. S ess Managemen : How Cells Take Con ol o Thei T ansposons. Mol. Cell 27, 180–181 (2007). 148. Ga cía Gue ei o, M. P. Wha makes ansposable elemen s mo e in he D osophila genome? He edi y (Edinb). 108, 461–468 (2012). 149. Junako ic, N., F anco, C. Di, Ba san i, P. & Palumbo, G. T ansposi ion o Copia-like Nomadic Elemen s Can Be Induced by Hea Shock. J. Mol. E ol. 24, 89–93 (1986). 150. Ra ne , V. A., Zabano , S. A., Kolesniko a, O. V & Vasilye a, L. A. Induc ion o he mobile gene ic elemen Dm-412 ansposi ions in he D osophila genome by hea shock ea men . P oc. Na l. Acad. Sci. U. S. A. 89, 5650–4 (1992). ! 53! 151. A naul , C., Loe enb uck, C. & Biémon , C. T ansposable elemen mobiliza ion is no induced by hea shocks in D osophila melanogas e . Na u wissenscha en 84, 410–4 (1997). 152. Jouan-Du ou nel, I., Cosse , F., Con amine, D., Ve die , G. & Biémon , C. T ansposable Elemen s Beha io Following Vi al Genomie S ess in D osophila melanogas e Inb ed Line. J. Mol. E ol. 43, 19–27 (1996). 153. Nabi ochkin, S. D. e al. Onco i al DNAs induce ansposi ion o endogenous mobile elemen s in he genome o D osophila melanogas e . Mu a . Res. 403, 127–36 (1998). 154. Wessle , S. R. Pheno ypic Di e si y Media ed by he Maize T ansposable Elemen s Ac and Spm. Science (80-. ). 242, 399–405 (1988). 155. Biémon , C. & Viei a, C. Gene ics: junk DNA as an e olu iona y o ce. Na u e 443, 521–524 (2006). 156. Fescho e, C. T ansposable elemen s and he e olu ion o egula o y ne wo ks. Na . Re . Gene . 9, 397–405 (2008). 157. Cowley, M. & Oakey, R. J. T ansposable Elemen s Re-Wi e and Fine- Tune he T ansc ip ome. PLoS Gene . 9, (2013). 158. Walse , J.-C., Chen, B. & Fede , M. E. Hea -shock p omo e s: a ge s o e olu ion by P ansposable elemen s in D osophila. PLoS Gene . 2, e165 (2006). 159. Wang e al. Species-speci ic endogenous e o i uses shape he ansc ip ional ne wo k o he human umo supp esso p o ein p53. P oc. Na l. Acad. Sci. U. S. A. 104, 18613–18618 (2007). 160. Ma iño-Ramí ez, L., Lewis, K. C., Landsman, D. & Jo dan, I. K. T ansposable elemen s dona e lineage-speci ic egula o y sequences o hos genomes. Cy ogene . Genome Res. 110, 333–341 (2005). 161. Van De Lagemaa , L. N., Land y, J. R., Mage , D. L. & Meds and, P. T ansposable elemen s in mammals p omo e egula o y a ia ion and di e si ica ion o genes wi h specialized unc ions. T ends Gene . 19, 530–536 (2003). 162. Mikkelsen, T. S. e al. Genome o he ma supial Monodelphis domes ica e eals inno a ion in non-coding sequences. Na u e 447, 167–77 (2007). 163. Beje ano, G. e al. A dis al enhance and an ul aconse ed exon a e de i ed om a no el e oposon. Na u e 441, 87–90 (2006). 164. San angelo, A. M. e al. Ancien exap a ion o a CORE-SINE e oposon in o a highly conse ed mammalian neu onal enhance o he p oopiomelanoco in gene. PLoS Gene . 3, 1813–1826 (2007). 165. B i en, R. J. Cases o ancien mobile elemen DNA inse ions ha now ! ! ! 61! 2.1 Abs ac T ansposable elemen s (TEs) a e mobile DNA sequences ha cons i u e a la ge ac ion o euka yo ic genomes, and media e he p oduc ion o gene ic and pheno ypic a ia ion1–5. Because ansposi ion h ea ens genomic in eg i y and ypically has dele e ious e ec s, o ganisms e ol ed a p o ec i e mechanism o speci ically es ain TE ac i i y in he ge mline6–12, he piRNA pa hway. Despi e much wo k on his pa hway, he gene ic basis o na u al a ia ion in TE ac i i y emain unknown5. To s udy he loci ha con ain a ia ion a ec ing TE ac i i y in na u al popula ions we pe o med a genome-wide associa ion s udy using as pheno ype he numbe o blood, gypsy5, mdg1, oo, I-elemen , jockey, H- elemen and pogo inse ions ha a e mo e likely o esul om ecen TE ac i i y13. We obse ed li le o e lap be ween alleles associa ed wi h he ac i i y o di e en ansposons and e y ew a ec ed piRNA pa hway genes. Ou analysis on blood ac i i y led us o p opose ha he ansc ip ion ac o Sin3A migh ha e played an impo an ole in a ec ing he exp ession o his TE. Con e sely, he bu s o gypsy5 ac i i y obse ed in a single geno ype was ela ed o alleles a ec ing se e al genes unc ioning in ollicle cell de elopmen and ha included he ansc ip ion ac o Poin ed. This s udy iden i ied an unan icipa ed se o egula o s and highligh ed he impo ance o genome-wide associa ion s udies o add ess ques ions ega ding he gene ic ac o s ha in luence TE ac i i y in he wild. 2.2 In oduc ion T ansposable elemen s (TEs) a e mobile DNA sequences ha we e i s disco e ed by Ba ba a McClin ockʼs e olu iona y wo k on he e ec o genomic ins abili y in he con ex o colo pigmen a ion in maize ke nels14. They a e abundan , di e se and ac i e componen s o mos euka yo ic genomes, and while ansposi ion e en s a e o en dele e ious, TEs can con ibu e o gene ic a ia ion ha can be adap i e and ele an o e olu ion1,3,4,15–18. Recen s udies ha e also implica ed TEs as media o s o pheno ypic di e si ica ion con ibu ing ! 62! o he e olu ion o no el ai s such as placen a19, ish spo s20 and colo pigmen a ion in B i ish peppe ed mo hs21. TEs a e di ided in o wo main ca ego ies ha g oup mobile elemen s acco ding o hei sequence p ope ies, which e lec how ansposi ion occu s. Re o ansposons esemble e o i uses and mo e ia an RNA in e media e ha adds new copies o he p o ile o al eady exis ing inse ions; DNA elemen s a e excised and in eg a ed in o new genomic places hus he numbe o copies is main ained a each cycle o mo emen 22,23. The copy-and-pas e and cu -and- pas e mechanisms o ansposi ion desc ibed abo e include a scope o dis inc s eps such as ansc ip ion, ansla ion and in eg a ion, upon which hos s can ac o con ol TE-speci ic ac i i y24–26. Mo eo e , he disco e y o a conse ed pa hway – he piRNA pa hway – ha p oduces small RNAs able o a ge and educe exp ession o mobile elemen s ( e o ansposons and DNA elemen s), con e ged e o s o he s udy o TE ansc ip ional egula ion6–9. The piRNA pa hway unc ions as a genome su eillance sys em ha speci ically minimizes TE access o emale and male game ocy es6,27. In D. melanogas e o a ies, he biogenesis o PIWI-in e ac ing RNAs (piRNAs) di e s be ween soma ic ( ollicula epi helium ha es ablish an in ica e ela ionship wi h ge mline) and ge mline (oocy e and nu se cell syncy ium) issue whe e he silencing p ocess is specialized o ep ess TEs exclusi e o each cell ype28. Al hough ansposons ha a e ac i e in he ge mline issue ha e di ec access o he oocy e, TEs exp essed in ollicula cells need o o m i al-like pa icles in o de o be able o in ade he emale game ocy e29,30. Despi e he ex ensi e in o ma ion ega ding ep essi e mechanisms, he gene ic ac o s ha modula e TE ac i i y in na u al popula ions emain elusi e5. He e, we aimed o iden i y loci in hos genomes ha ca y allelic a ia ion con ibu ing o changes in TE ac i i y and ha leads o di e ences in he numbe o ecen TE inse ions. We bene i ed om he D osophila melanogas e Gene ic Re e ence Panel (DGRP) ha includes a ious ully sequenced geno ypes con aining alleles ha seg ega ed in a na u al popula ion13. The in silico analysis o he sequence o 146 o hose isogenic lines p o ided in o ma ion on TE inse ions, ! 63! including he posi ion o inse ions, he elemen inse ed, and whe he o no each inse ion was sha ed wi h he D. melanogas e e e ence genome ( om ano he popula ion o lies). TE inse ions we e classi ied as no el when hey we e no sha ed wi h e e ence genome; hese we e also ypically no sha ed be ween di e en DGRP geno ypes and a e, hus, mo e likely o esul om ecen TE ac i i y. We pe o med a genome-wide associa ion s udy (GWAS) using he numbe o no el inse ions o di e en ansposons (blood, gypsy5, mdg1, oo, I-elemen , jockey, H-elemen and pogo) as pheno ype. To do he wo k, we i s alida ed in silico p edic ions o TE composi ion o na u ally- de i ed sequenced genomes and hen used hose p edic ions as a pheno ype in he GWAS s udy. Al hough we had hypo hesized o ind allelic a ian s o piRNA genes, we obse ed li le o e lap be ween loci con ibu ing o di e ences in he numbe o no el inse ions and hose encoding genes o he piRNA pa hway. Analysis o he GWAS esul s sugges ha ac i i y o he TE blood, a e o ansposon exp essed in ge mline and soma ic issue o o a ies, is egula ed by he ansc ip ion ac o Sin3A, and ha a bu s in he ac i i y o TE gypsy5, a e o ansposon speci ically exp essed in ollicula cells, may be ela ed o allelic a ia ion o genes impo an o he de elopmen o ollicula epi helia. 2.3 Ma e ials and Me hods TE iden i y o no el inse ions in DGRP geno ypes The DGRP is composed by nea ly 200 wild-de i ed geno ypes, 146 o which ha e a ailable in o ma ion abou TE inse ions ha we e cha ac e ized as sha ed o no el acco ding o whe he hey a e p esen o absen , espec i ely, in he e e ence genome13. Fo he no el inse ions, b eakpoin es ima es (posi ion o inse ion) and TE iden i y we e assessed based on sequence a ailable o le and igh sides o he inse ion, as desc ibed in e 13. Fo each ansposon iden i ied in a no el inse ion, he in silico anno a ion p o ided se e al TEs, each wi h an associa ed p obabili y. He e, o each no el inse ion, we used as TE iden i y ha wi h highes es ima ed p obabili y. ! 64! Con i ma ion o TE iden i y o no el inse ions To con i m in silico p edic ions o TE composi ion, we selec ed 129 p edic ed no el inse ions in 12 DGRP geno ypes including 13 o TE blood, 4 o copia, 7 o Doc, 7 o gypsy5, 7 o H-elemen , 5 o hoppe , 3 o F-elemen , 25 o I- elemen , 5 o Juan, 19 o mdg1, 2 o opus, 17 o pogo, 10 o oo and 5 o T anspac elemen s. Lis o TE inse ions and espec i e DGRP lines es ed he e can be ound in Supplemen a y Table 2.1. We ex ac ed gDNA om RAL-021, RAL-321, RAL-357, RAL-358, RAL-381, RAL-443, RAL-761, RAL-790, RAL-810, RAL-812, RAL-892 and RAL-908 lies, pool o en males pe sample. DNeasy Blood & Tissue Ki (Qiagen) was used o he ex ac ion, ollowing manu ac u e ʼs p o ocol. Sample concen a ion was measu ed in Nanod op ND- 1000 Spec opho ome e and samples we e s o ed a -20°C un il use. Based on he genome sequence a ailable o he DGRPs, we designed p ime s o he lanking egion o each no el inse ion and ob ained amplicons by longPCR (Roche) using 4ng o gDNA in 15µl o eac ion wi h 0.5µM p ime s, 2% DMSO, 1x bu e , 0.5mM dNTPs, 0.21µl o enzyme in 15µl o eac ion. We used s anda d ampli ica ion p og am o longPCR wi h 10 min o elonga ion ime; empe a u e o annealing and p ime sequences can be ound in Supplemen a y Table 2.1. Size o inse ion was ob ained by elec opho esis in 1% aga ose gel and classi ied as “la ge ”, “expec ed” o “smalle ” aking in o accoun he canonical TE sequences desc ibed o D osophila ansposons ( e sion 9.42). We assessed TE iden i y by sequencing he amplicons wi h BigDye Te mina o p o ocol (Te moFishe ) o SUPREME un™ (NZYTech) using he same o wa d p ime s used o ampli ica ion (Supplemen a y Table 2.1). To de ec p esence o alse nega i es in Mackay e al. p edic ions o TE inse ions we pe o med a PCR using as empla e gDNA om lines whe e inse ions we e p edic ed o be absen (Supplemen a y Table 2.2). As posi i e con ols, we pe o med same PCRs using ei he gDNA om a line wi h p edic ed inse ions (RAL-321; check o p ime s) o p ime s o gene Rpl32 (check o empla e). In nega i e con ol eac ions o each p ime pai gDNA was eplaced by wa e . The gDNA ex ac ion o RAL-109, RAL-161, RAL-237, RAL-350, RAL- ! 65! 362, RAL-555, RAL-776 and RAL-908 was pe o med as desc ibed abo e. Each PCR eac ion con ained 0.25U o GoTaq (P omega), 1x eac ion bu e , 1.5mM MgCl2, 0.4µM p ime s and 0.4ng o gDNA. The he mal cycling p o ocol was he same o all eac ions: 10 min a 95°C; 35 cycles o 95°C o 30 sec, 60°C o 1 min and 72°C o 30 sec; 5 min a 72ºC. P ime sequences a e desc ibed in Supplemen a y Table 2.3. Genome Wide Associa ion S udy (GWAS) We pe o med a GWAS analysis using he numbe o no el inse ions o blood, gypsy5, mdg1, oo, I-elemen , jockey, H-elemen , and pogo as pheno ypes. This in o ma ion is a ailable o 146 o he DGRP geno ypes. The analyses we e done on he DGRP2 websi e (h p://dg p2.gne s.ncsu.edu/)13,31. Fo he genes con aining alleles ound o associa e o a ia ion in numbe o no el inse ions (p<7e-05), we an gene on ology (GO) analyses using GO conso ium algo i hm, and Bon e oni co ec ion o mul iple es ing32. RNA ex ac ion and cDNA syn hesis To assess blood, gypsy5, and poin ed exp ession we chose nine ly s ocks wi h di e en numbe o no el inse ions: RAL-021, RAL-237, RAL-321, RAL-357, RAL-358, RAL-375, RAL-391, RAL-790 and RAL-908. To elimina e Wolbachia om he lines RAL-021, RAL-237, RAL-321 and RAL-790, lies we e ea ed wi h e acycline (0.05mg/ml) o wo gene a ions, and gu lo a con en homogenized as p e iously desc ibed33. We only used o his s udy indi iduals wi hou endosymbion in ec ion. Flies we e kep in s anda d co nmeal ood34 a 25°C, 60% humidi y and 12h day-nigh cycles. We collec ed o a ies om se en days old emales and pooled bo h o a ies om eigh emales pe sample. O a ies we e ob ained om wo independen expe imen s, one wi h eigh and ano he wi h ou eplica e samples pe geno ype. Dissec ions we e done in esh cold PBS 1x and o a ies we e di ec ly s o ed in 400μl o T izol (Ambicon) a 4ºC un il homogenized by pes els. Tissue collec ion and homogeniza ion was done in he same day; samples we e hen ! 66! s o ed a -80ºC un il RNA ex ac ion. Fo RNA ex ac ion, we used Di ec -zol RNA Minip ep ki (Zymo Resea ch) ollowing manu ac u e ʼs ins uc ions, and o al RNA was elu ed in 25μl o RNase- ee wa e (Sigma). RNA pu i y and concen a ion was measu ed wi h Nanod op ND-1000 Spec opho ome e ; A600/A800 abso bance was a ound wo o all samples and concen a ions anged om 200 o 800ng/µl. All RNA samples o he same geno ype we e p ocessed on he same day. Fo cDNA syn hesis we emo ed con amina ions o gDNA om 1µg o RNA using DNAse (P omega) ea men and ollowing manu ac u e ʼs ins uc ions. We hen ollowed Re e se T ansc ip ion Sys em (P omega) p o ocol using 0.02µM Oligo dT p ime s o p oduce cDNA. Reac ion was incuba ed a 42°C o 60min and hea ed a 95°C o 5min. cDNA was dilu ed 1:10 in RNAse- ee wa e and s o ed a -20°C un il quan i a i e eal- ime PCR (qPCR). qPCR We measu ed le els o gypsy5, poin ed, Rpl32 and Tbp exp ession by qPCR using a CFX384 he mal cycle (BioRad). Fo each eac ion, we used 5µl iQ™ SYBR® G een supe mix (BioRad), 1µl o 4µM p ime s and 4µl o dilu ed cDNA (1:10). P ime sequences a e desc ibed in Supplemen a y Table 2.3. We an wo echnical eplica es pe sample, bo h in he same qPCR pla e. The he mal cycling p o ocol was he same o all eac ions: 2 min a 50°C; 10 min a 95°C; 40 cycles o 95°C o 30 sec, 60°C o 1 min and 72°C o 30 sec. In each pla e, we an s anda d cu es (one s anda d cu e o each gene o TE es ed) wi h se ial dilu ions o known amplicon concen a ions ha we e ampli ied by PCR using 0.25U o GoTaq (P omega), 1x eac ion bu e , 1.5mM MgCl2, 0.4µM p ime s and 1µl o cDNA (1:10). PCR p oduc s we e cleaned using NucleoSpin® Gel and PCR Clean-up (Mache ey-Nagel), and elu ed in 15µl o bu e NE. We measu ed concen a ions in Nanod op ND-1000 Spec opho ome e . The minimum amoun o nucleic acids ha can be de ec ed by qPCR o each p ime pai was es ima ed by ex ending dilu ions o ou s anda ds un il he ela ionship be ween he known amplicon concen a ions and he quan i ica ion cycles (Cqs) ! 67! eached a pla eau. Samples ha had Cq alues ou side he linea de ec ion (Supplemen a y Figu e 2.1) and wi h s anda d de ia ion abo e 0.5 o he echnical eplica es we e elimina ed om he analysis. We used de aul h eshold se ings o ob ain he Cq o each eac ion, and ans o med Cq alues in o absolu e a ge concen a ions using he espec i e s anda d cu es. This me hodology allowed us o con ol o pla e e ec s and o di e ences in p ime e iciency. qPCR mel ing cu es we e analyzed o con i m speci ici y o ampli ied p oduc s and nega i e con ols ne e showed de ec able ampli ica ion. Fo he analysis o exp ession da a, we used No mFinde 35 and geNo m36 algo i hms o check exp ession s abili y o wo pu a i e e e ence genes, Rpl32 and Tbp, commonly used o no malize gene exp ession a di e en en i onmen al condi ions and geno ypes37,38. S abili y alues ob ained o Rpl32 (No mFinde , 0.58; geNo m, 1.32) we e o e all be e han hose ob ained o Tbp (No mFinde , 0.92; geNo m, 1.32). We he e o e no malized TE exp ession o Rpl32. S a is ical analyses All s a is ical analyses we e done in R ( e sion 3.0.3)39. Fo he analysis o gypsy5 and poin ed exp ession in di e en DGRP lines, we used linea models (lm) wi h logno mal dis ibu ion. Mul iple compa isons we e pe o med wi h leas -squa es means (lsmeans), and compac le e display (cld) was used o g oup geno ypes ha a e no s a is ically signi ican (p>0.05). Da a was ob ained om wo independen expe imen s (one wi h eigh and ano he wi h ou biological eplica es) ha we e plo ed and analyzed oge he . Analysis o TE exp ession om a ailable nex -gene a ion RNA sequencing da a To s udy he impo ance o Sin3A o egula ing blood exp ession we analyzed a ailable nex -gene a ion RNA sequencing lib a ies (GSE72172 and GSE68775) deposi ed on NCBI40. We ex ac ed aw da a o S2 (GSM1857008, GSM1857009 and GSM1857010), Sin3A-187HA (GSM1857011, GSM1857012 ! 68! and GSM1857013), GFP RNAi (GSM1681056, GSM1681057 and GSM1681058) and Sin3A KD (GSM1681059, GSM1681060 and GSM1681061) samples. Those samples we e ob ained om ou es ablished cell cul u e lines: wi hou any cons uc (S2), wi h GFP RNAi cons uc , o e exp essing Sin3A-187 (Sin3A-187HA), and ano he down- egula ing all iso o ms (Sin3A KD). Reads we e aligned o ansposon canonical sequences ( e sion 9.42) o D. melanogas e . We ex ac ed he numbe o eads o each TE and analyzed he da a using edgeR by i ing ead coun s o a nega i e binomial dis ibu ion. To e alua e he e ec o o e exp essing Sin3A-187 (Sin3A-187HA), we used S2 samples as nega i e con ols; o e alua e he e ec o knocking down Sin3A (Sin3A KD) iso o ms we used GFP RNAi samples as nega i e con ols. We plo ed old-change o TE exp ession wi h alse disco e y a e in e io o 0.1. 2.4 Resul s Con i ma ion o TE inse ions in DGRP lines We s udied a o al o 129 no el inse ions ha included ansposons wi h di e en sequence p ope ies: e o ansposons wi h and wi hou long e minal epea s (LTR and non-LTR elemen s), and DNA elemen s. Fo all 129 p edic ed inse ions (100%), we con i med p esence o ansposon sequences, and o 113 o hem (87.6%) we con i med he mos likely ansposon iden i y as pe he in silico p edic ions13 (co ec TE iden i y, Figu e 2.1). Fo eigh o he 16 cases whe e we did no con i m he mos likely p edic ed iden i y, ou sequence ma ched ha o elemen s wi h same sequence p ope ies and se en ma ched sequence iden i y o he second mos likely p edic ed TE (Supplemen a y Table 2.4). Fo he emaining nine cases, he inse ed TE was no wi hin he lis o p edic ed iden i ies o he speci ic posi ions. Fo he cha ac e iza ion o TE inse ions acco ding o leng h ( ela i e o he leng h o he TEs iden i ied by ou sequencing da a) we obse ed ha 58.9% showed p ope size o inse ion, 33.3% we e smalle and 7.8% la ge (Figu e 2.1). ! 69! We also assessed he occu ence o alse nega i es in Mackay e al. p edic ions by es ing p esence o TE inse ions in DGRP geno ypes ha we e p edic ed o lack hose elemen s (Supplemen a y Table 2.2). We de ec ed p esence o es ed TEs in he genome o all lines assessed (Supplemen a y Figu e 2.2). Figu e 2.1. Cha ac e iza ion o no el TE inse ions acco ding o sequence iden i y and size. Fo each no el inse ion we used as TE iden i y ha wi h highes es ima ed p obabili y o inse ion13. We hen cha ac e ized acco ding o sequence iden i y and size inse ions assigned o LTR (blood, copia, gypsy5, mdg1, opus, oo and T anspac), non- LTR (Doc, F-elemen , I-elemen and Juan) and DNA (H-elemen , hoppe and pogo) elemen s. No el TE inse ions we e g ouped acco ding o ou abili y o con i m TE iden i y es ima ed by Mackay e al. (expec ed and unexpec ed) and acco ding o size (smalle , expec ed and la ge ). Ba cha s show he numbe o blood, mdg1, opus, oo, T anspac, Doc, F-elemen , I-elemen , Juan, H-elemen , hoppe and pogo inse ions wi h expec ed and unexpec ed TE iden i y, and wi h smalle , expec ed and la ge sizes. When TE iden i y was de ined as unexpec ed we included he name o he ansposon ob ained ins ead. In hose cases, TE size was cha ac e ized in o smalle , expec ed o la ge acco ding o he canonical sequence o he TE we iden i ied he e. ! 76! Figu e 2.4. Model p oposed o he e ec o alleles associa ed wi h gyspy5 bu s in ac i i y. Scheme illus a ing genes impo an o ollicula cell de elopmen in D. melanogas e o a ies (A and B). A s age 6 and 8 o oocy e de elopmen , No ch is exp essed in he ollicula epi helia ha p o ec s he egg chambe . A s age 6, he in e ac ion o Sm e wi h Su(H) inhibi s No ch signaling and p omo es eplica ion o ollicula cells (a1)60. La e in de elopmen , Sm e is dissocia ed om Su(H) ha , consequen ly, ec ui s co-ac i a o s such as Mas e mind (b1)60. This e en esul s in he inhibi ion o mi o ic cycles and ollicula cells en e endo eplica ion o become polyploid62. The pola iza ion o ollicle cells is also essen ial o main ain epi helial unc ions h oughou oogenesis; cell adhesion (Sho gun and Fas3) and ac in-binding (Enabled and Rhea) p o eins a e impo an o he es ablishmen and main enance o cellula apical-basal pola i y (a2)47–49,59. The in e ac ion be ween oocy e and ollicula cells is c ucial o he es ablishmen o an e iopos e io and do so en al pola i y in he oocy e, and is mainly media ed by wa es o Gu ken-EGFR signaling (A and B)63. A s age 6, an ea ly signal o Gu ken de ines he an e iopos e io axis (A), whe eas a la e signal o Gu ken a s age 8 esul s in do so en al pola i y (B). When he EGFR signals o he ollicula cells i induces he exp ession o se e al genes including poin ed (a3)64. We p opose ha , some alleles associa ed wi h gypsy5 ac i i y may ha e enhanced EGFR signaling pa hway h ough e ec s in EGFR, Poin ed, H s and D k abundance and/o ac i i y (C). Also, alleles a ec ing No ch signaling ( h ough e ec s in Sm e , Mas e mind, H s, kib a and pigs) and cell pola i y ( h ough e ec s in Fas3, Sho gun, Rhea and Enabled) could ha e esul ed in inc eased cell numbe (d1) o genomic con en (d2). Those e ec s could ha e a di ec ( h ough ac i a ion o gypsy5 exp ession by he ansc ip ion ac o Poin ed, C) o an indi ec ( h ough inc ease in he numbe o cells exp essing gypsy5 o inc ease in he ! 77! numbe o gypsy5 copies in polyploid nuclei, D) impac in gypsy5 exp ession. In o de o inc ease in copy-numbe , gypsy5 needs o be exp essed and o o m i al-like pa icles ha a e able o mig a e om ollicle cells o he oocy e29,30. We u he sugges ha he dis up ion o epi helial in eg i y media ed by e ec s in cell cycle and cell-cell adhesion (D) could ha e bene i ed he mo emen o gypsy5 i al-like pa icles o he oocy e. Fo mo e in o ma ion abou he alleles a ec ing genes ela ed o ollicle cell de elopmen see Table 2.2. Figu e 2.5. Alleles a ec ing poin ed exp ession may explain bu s in gypsy5 ac i i y. Poin ed binding si es (GGAA) ound in 5ʼLTR sequences o gypsy5 and ZAM (A). Gypsy5 exp ession ela i e o Rpl32 (loga i hmic scale) ob ained o RAL-237, RAL- ! 78! 321, RAL-358, RAL-375 and RAL-790 (B). We could no de ec gypsy5 exp ession in RAL-021, RAL-357, RAL-391, and RAL-908. Exp ession o poin ed ela i e o Rpl32 (loga i hmic scale) in RAL-021, RAL-237, RAL-321, RAL-357, RAL-358, RAL-375, RAL- 391, RAL-790 and RAL-908 (C). We used linea model (lm) o e alua e he di e ence in gypsy5 and poin ed exp ession be ween DGRP lines. Mul iple compa isons we e pe o med using leas -squa es means (lsmeans). We used compac le e display (cld) o g oup geno ypes ha a e no s a is ically signi ican (p>0.05), in he g aphs ep esen ed by he same le e . Da a was collec ed in wo independen expe imen s; in he g aph we show esul s o bo h expe imen s. Each ci cle in he boxplo s ep esen s a pool o eigh pai s o o a ies; iangles co espond o he mean and black line o he median. 2.5 Discussion DGRP geno ypes: a lib a y o na u al TE inse ions TEs a e ac i e DNA sequences ha cons i u e a la ge p opo ion o mos genomes, making up o 4% o he D. melanogas e genome, o example65. The sequence di e si y and epe i i e na u e o ansposons makes hei analysis challenging, especially when using nex -gene a ion sequencing da a ha p o ides ai ly sho sequencing eads66,67. Fo his eason, he empi ical con i ma ion o in silico p edic ions o TE inse ions is essen ial. In his s udy, we con i med p esence o mobile elemen s a 129 posi ions p edic ed o ha e no el TE inse ions13. The obse a ion o 0% o alse posi i es and ou con i ma ion o 87.6% o he TE iden i ies wi h highes p obabili y13, s ongly sugges s ha he in o ma ion a ailable o TE inse ions in DGRP geno ypes is eliable, and his panel can he e o e be used as a lib a y o he na u al a ian s o ansposon inse ions. The inabili y o con i m 12.4% o he mo e p obable TE iden i ies could, howe e , esul om signi ican di e ences be ween ou and p e ious13 app oaches o de e mine ansposon iden i y. Al hough ou es ima ion o iden i y was based on he sco e o he alignmen wi h canonical TE sequences alone (gi ing g ea e weigh o a be e aligning TE), Mackay e al. p edic ions included he equency o ha elemen in he e e ence genome as well (gi ing g ea e weigh o mo e equen elemen s). In addi ion, ou iden i ies a e mos ly based in in o ma ion o one side o TE ! 79! inse ion ough Mackay e al. p o ide es ima es o bo h sides. Fo he cases whe e iden i ies wi h highes p obabili y a e only de ec ed in one side o he inse ion, and wi h second mos likely TE being de ec ed in bo h sides, i would be impo an o econside using in silico es ima es om bo h sides (le and igh ) o assign TE iden i ies o each posi ion o inse ion. As o he case o ou ou misiden i ied blood inse ions, his new app oach would p o ide be e p edic ions o TE iden i ies (es ima ed imp o emen o 3.1%). Fo he cha ac e iza ion o TE inse ions acco ding o size, we obse ed ha , al hough 58.9% had expec ed sequence leng h, 33.3% we e smalle and 7.8% la ge han he p edic ed sizes o he canonical sequences o he espec i e mobile elemen s. La ge inse ions could esul om he in eg a ion o mo e han one ansposon in he same genomic posi ion. In con as , smalle inse ions could de i e om 1) sequence loss a e TE mobiliza ion and/o 2) he ac i i y o incomple e and non-au onomous elemen s ha sha e sequence p ope ies wi h o he au onomous ansposons22. Rega ding ou esul s o he p esence o alse nega i es in TE p edic ions by Mackay e al., we sugges ha he lack o genomic in o ma ion o he ch omosome 4 and possibly Y ch omosome in he DGRP could explain ou de ec ion o speci ic TEs in geno ypes p edic ed o lack hem. A ailable da a o ansposon inse ions in he ou h and Y ch omosomes is o pa icula in e es gi en he high p e alence o epe i i e sequences in hose ch omosomes68,69. Impo an ly, and al hough Mackay e al. p edic ions had ne e been expe imen ally alida ed be o e, we only es ed a e y small p opo ion o inse ions (129 o app oxima ely 50 housand no el inse ions o all ansposons). Few SNPs a ec ing piRNA pa hway genes a e associa ed wi h TE copy numbe A g ea deal o wha is known abou TE ep ession in he ge mline is g ounded on s udies ha use D. melanogas e as a model o ganism6,11,12. Those desc ibe he exis ence o piRNAs ha cons i u e he hallma k o ansposon inhibi ion in ! 80! he gonads and collec i ely map o clus e s ha a e en iched o agmen s o TE inse ions. No ably, he piRNA biogenesis is media ed by specialized p ocesses ha di e be ween ge mline and soma ic issues o D osophila o a ies28. In ollicula cells, he p oduc ion o hose genomic gua dians is independen o he exp ession o ac i e ansposons and cons i u es he p ima y piRNA biogenesis70. The biogenesis s ep akes place in he cy oplasm, whe e he Piwi p o ein (only elemen o he PIWI- amily exp essed in ollicula cells) is loaded wi h piRNAs71. Piwi-piRNA complexes hen mig a e o he nucleus o media e ansc ip ional ep ession o mobile elemen s72. Only ecen ly, p ima y biogenesis o piRNAs has been linked o TUDOR domain-con aining p o eins (such as e eno) ha modula e Piwi unc ion h ough p o ein-p o ein in e ac ion73. In ge mline cells, he a chi ec u e o piRNA biogenesis is complex, as i in ol es he p ima y biogenesis and a loop o ampli ica ion ha is mos ly d i en by Aub and AGO3. Those wo PIWI- amily p o eins a e en iched a ound he nucleus whe e Aub-piRNA complexes a ge and di ec TE ansc ip s o clea age. As a consequence, sense piRNAs a e p oduced and inco po a ed by AGO3, ha has he po en ial o speci ically igge piRNA clus e p ocessing and inc ease he abundance o an isense piRNAs loaded in o Aub6. In e es ingly, ou GWAS o TE copy-numbe e ealed e y ew alleles a ec ing piRNA pa hway genes. In ac , we only ound one single nucleo ide polymo phism (SNP) in e eno coding sequence, and ano he SNP in an in on o AGO3, ha we e associa ed wi h he ac i i y o gypsy5 and pogo, espec i ely. Those esul s a e o pa icula in e es gi en he close ela ionship es ablished be ween he unc ion o hose p o eins and he place o gypsy5 and pogo exp ession. In o he wo ds, e eno p o ein unc ions in he p ima y piRNA biogenesis and in he cell ypes whe e gypsy5 is speci ically exp essed, whe eas AGO3 ampli ies he abundance o piRNAs in he ge mline whe e pogo is exclusi ely exp essed. Howe e , gi en ha pe u ba ions in he unc ion o hose wo p o eins is desc ibed o esul in o e all uncon olled TE ac i i y73,74, we would expec hose SNPs wi hin e eno and AGO3 sequences o be associa ed ! 81! wi h a ia ion in he ac i i y o se e al ansposons. The TE-speci ic associa ion o bo h loci o a ia ion in gypsy5 and pogo copy numbe was he e o e unexpec ed and we u he sugges ha pleio opic e ec s be ween hose and o he alleles could explain hose esul s. Alleles in CG17839, unc-13-4A and Sin3A may explain di e ences in blood ac i i y Da a a ailable om p e ious s udies40,41 allowed us o con i m ha CG17839, unc-13-4A and Sin3A a e able o egula e blood exp ession. Those esul s sugges ha alleles a ec ing such genes could po en ially in luence blood exp ession and lead o changes in blood copy numbe . Al hough he molecula unc ion o CG17839 and unc-13-4A is s ill unknown, Sin3A is ecognized o i s ansc ip ion ac o ac i i y. Sin3A lacks DNA-binding mo i s bu can ac as sca old o he assembly o nume ous ansc ip ion ac o s75. We hen p opose ha he non-synonymous mu a ion ound o be associa ed wi h a ia ion in blood copy numbe migh a ec Sin3A abili y o in e ac wi h some o hose ac o s, whe eas he SNP in in onic sequence may a ec i s exp ession. Bo h loci could he e o e impac blood exp ession h ough e ec s in he ac i i y and/o exp ession o his p o ein. Howe e , ou analysis o he o e exp ession o Sin3A e ealed e ec s in he exp ession o many ansposons including blood and oo. How alleles in Sin3A could media e speci ic e ec s in blood (as hose we e no ound o be associa ed wi h a ia ion in oo ac i i y) is s ill la gely unknown. We p opose ha he non-synonymous mu a ion may ha e a ec ed he in e ac ion be ween Sin3A and co- ac o s able o in luence blood bu no oo exp ession. This hypo hesis needs, howe e , o be es ed oge he wi h he unc ional alida ion o hose loci. Alleles associa ed wi h appa en bu s o gypsy5 ac i i y in RAL-790 The assessmen o TE popula ion dynamics in di e en species sugges s ha ansposons mo e h ough wa es o inc eased ac i i y76,77. Howe e , e y ew episodes o spon aneous bu s s in ansposi ion we e empi ically de ec ed. ! 82! Those include a couple o examples om D. melanogas e isogenic lines main ained in labo a o y condi ions78–80, and c osses be ween s ains wi h incompa ible TE composi ion81,82. He e, o he i s ime, we epo ed a bu s in TE ac i i y (gypsy5) in a geno ype (RAL-790) ha was collec ed om he wild and con ained alleles seg ega ing in na u al popula ions. Some o he loci associa ed wi h a ia ion in he numbe o gypsy5 inse ions we e ound o be wi hin o close o genes ela ed o ollicle cell de elopmen . Gi en ha gypsy5 is speci ically exp essed in hose cells, we p opose a model sugges ing ha alleles a ec ing hose genes could esul in he ac i a ion o gypsy5 exp ession and/o p omo e i s mobiliza ion o he oocy e (Figu e 2.4C and D). In his model, he SNPs associa ed wi h gypsy5 ac i i y may ha e caused he in ensi ica ion o EGFR signaling cascade ha can esul in mo e exp ession o he ansc ip ion ac o poin ed (Figu e 2.4C). Also, e ec s in he No ch signaling pa hway, oge he wi h p oblems in cell adhesion, could a ec he abundance o ollicula cells and he in eg i y o he epi helium, ei he by in ensi ying cellula di ision (Figu e 2.4d1) o endo eplica ion (Figu e 2.4d2). In summa y, we sugges ha highe exp ession o poin ed, inc ease in ollicula cell numbe o highe genome abundance could inc ease gypsy5 exp ession. Fu he mo e, we p opose ha he dis up ion o he soma ic epi helium could acili a e he mo emen o gypsy5 i al-like pa icles om he ollicula cells o he oocy e. Acco ding o ou model, RAL-790 should ha e highe exp ession o gypsy5 and poin ed when compa ed o ha o o he DGRP lines. Al hough ha expec a ion was con i med o TE exp ession, he le els o poin ed exp ession we e no enough o explain gypsy5 bu s in ac i i y. We sugges ha , alleles a ec ing he ac i i y o o he p o eins necessa y o he ac i a ion o Poin ed (such as hose ha media e pos - ansla ional modi ica ions and ac i a ion h ough phospho yla ion)83 could in luence he ac i i y o his ansc ip ion ac o wi hou a ec ing i s exp ession. Howe e , u he analyses a e needed o cla i y his hypo hesis. I is also impo an o no e ha , al hough ZAM also con ained cis- egula o y elemen s o Poin ed, we only obse ed highe copy-numbe o gypsy5 in RAL- ! 83! 790. We sugges ha he numbe o egula o y elemen s o Poin ed dic a es he sensi i i y o changes in ha ansc ip ion ac o : a ansposon con aining mo e binding si es would be mo e sensi i e o inc ease in Poin ed exp ession and/o ac i i y. In sum, ou GWAS analysis o he numbe o no el TE inse ions p o ed o be a powe ul ool no only o ind na u al a ian s associa ed wi h, bu also o ob ain unan icipa ed candida e egula o s o , ansposon ac i i y. Howe e , ou da a p o ide less insigh a he mechanis ic le el and u u e s udies o he allelic e ec s o gene exp ession and/o p o ein unc ion a e c i ical o ou comp ehension o he gene ic ac o s a ec ing TE ac i i y in na u al popula ions. Acknowledgemen s We would like o acknowledge Rena o Al es o helping wi h bioin o ma ic ools and Daniel Sob al o aligning nex gene a ion sequencing eads agains TE canonical sequences. Wen Huang and Michael Magwi e o answe ing all ou ques ions ega ding he D osophila Gene ic Re e ence Panel, and o Osca Ruiz and El i a La uen e o eading his chap e . We a e also hank ul o Casey Be gman o impo an eedback on his p ojec . Au ho con ibu ions The au ho o his hesis pe o med some expe imen s o con i m TE iden i y, did s a is ical and bioin o ma ic analysis, and oge he wi h Pa ícia Beldade designed all expe imen s. And é Al es checked p esence o alse nega i es, con i med iden i y and size o some no el inse ions, and epea ed he expe imen o con i m gypsy5 and poin ed exp ession. Ana Eugénio pe o med all o he expe imen s. ! 85! Supplemen a y In o ma ion Supplemen a y Figu e 2.1. Range o quan i ica ion cycles (Cqs) o blood and Rpl32 ha we e used in he analysis. Fo each sample wi h known amplicon concen a ion we ob ained he amoun o cycles ha we e necessa y o de ec exp ession by qPCR using de aul h eshold se ings. We an wo echnical eplica es and checked ha he ela ionship be ween he known amplicon concen a ions (log) and he quan i ica ion cycles (Cq) was linea . The ange o Cqs used o quan i y TE o gene exp ession is wi hin he linea ampli ica ion. Same me hodology was used o de ec exp ession o gypsy5, Tbp and poin ed. ! 92! Supplemen a y Table 2.1. Con . Posi ion o inse ion DGRP line Ta (ºC) Fo wa d p ime sequence Re e se p ime sequence mdg1 3L:10095528..100955 32 RAL-357 60 AGAGGCCTGTGAGATC CTTT AAGTGTTGCCCCATTCGAA 3L:20245853..202458 56 RAL-357 60 TGCCCGTACATTTATGC AGC CGTGTGTGTGGAGCGATC 3R:5798180..5798183 RAL-357 60 AGGGCACACAGTTTTG GTAC CTCGAATGGCAACCTGTAC T 3R:12117132..121171 36 RAL-357 62 CCAGAACGTCGACCAA CC GTGACCTAACGCAATACAC AA 3R:23192134..231921 45 RAL-357 62 CCTCAACAAGTCGGCG GG CCCCATTCCAACGCACAA X:16472629..1647264 3 RAL-357 60 TAAAGGCGAGAGGAAA GAGC TTTTGCCCCGTTCGAGTG 2L:19305699..193057 03 RAL-908 62 AACTCCACCGACTTGC TTTT TGGCTCTGACATGACCTAG A 2R:11793310..117936 99 RAL-908 60 AAAGGAGCAGGAGAAG GAGT GAGGCAAAACAACGAGCAT C 3L:676970..677090 RAL-908 60 ATATTCACGGTTTTGGC CAG GAGGGGCCGAGTCCTAAAT 3L:13514785..135147 89 RAL-908 60 CGCGCTTTGTTAACGT GG CATATTGGCTCGCGTTTTGT 3R:5737883..5737886 RAL-908 60 GAACACGCCGAGGATA GC CGAAAATCTACTCAGCCTG CT 3R:8620803..8620806 RAL-908 60 CTGACTGAGAAATGGG GCG TCACCAAAGTTGCAGTCGA A 3R:16918669..169186 73 RAL-908 62 ACCGGGTGCCAAGGAA TG CTTCCTCTTCGCTTCAGTG G 3R:18045826..180458 29 RAL-908 57 ACTCTACGGCAAATGA ATGGG GGCGTGACCCTTACTGAA X:5024909..5024914 RAL-908 60 ACAGAGAGCGACGAAA GC CGATGCGATGTCATGTCC opus 2L:7336324..7336327 RAL-908 60 GCATGACGATTACGTG GCTA ACAACCAAACGCTTTTCAC C 2R:17950637..179507 06 RAL-443 62 ATATGTCCTCGCCTGA CCTG GTTTCCACTGCACAGCCAT A oo 3R:17957511..179575 20 RAL-358 62 CCCACATAGTTGCATG CCA GTGTGTGGCAGTGGTAGT 3R:7884988..7884992 RAL-358 60 CAGTGCCCCATTGTTA CGA CGAACTCATTGCAACTCCC T 3R:17515331..175153 34 RAL-358 60 TCGTTCTCTCAGCAACC AAC AGAGAACCGAAACGCTACT G X:21270475..2127047 7 RAL-908 62 TTGGCGGGGAACAAAT ACAC TGCCCCTTACCGCTCCAT 2L:9204672..9204675 RAL-908 60 TCTTGTTTCCCCGCATC ATG TCTACCTCCGGAGCTCACA 2L:9361897..9361901 RAL-908 60 CAACTGATGGGGTAAG CAATG GCGAGCAAAGACAGCACTA 2L:9705174..9705181 RAL-908 60 CGGTGCTTGAGGTGTC CC CACTTCAAGCCTGGTTACC C 2L:12191481..121914 88 RAL-908 60 CACGACGTTAGAGCTG GAAC CACGCATCAAGTCAGGGTT 2L:12434248..124342 66 RAL-908 60 GAATTTCGGGCTGGTT TTCA CCATGATGTCCTGTGCTCC 2L:12902268..129022 74 RAL-908 60 GAATTTCGGGCTGGTT TTCA CCATGATGTCCTGTGCTCC ! 93! Supplemen a y Table 2.1. Con . Posi ion o inse ion DGRP line Ta (ºC) Fo wa d p ime sequence Re e se p ime sequence T anspac 2R:12108723..121087 29 RAL-810 60 ATAAACCGCAGCAAAA GTGG CCAATGGATTTTCGAGAGG A 3L:12856836..128568 42 RAL-908 60 CCCACTTCCTCTTCCAC TCA AGTCGACCAGGGACAATGA C X:345626..345630 RAL-357 RAL-892 58 TAACGATGGTGGCTGC TACA AAGGAAAGCGATTCAAGAC C X:15333499..1533350 4 RAL-443 60 CTGCAACTTTCCATGG CTTT ACAGCTTTCCCCTTCTGGA T Re o ansposons: non-LTR elemen s Doc 2L:11138677..111387 34 RAL-357 RAL-892 60 AAAATCCATTCGGCAAA CTG TCGATCAGCGCCTAGTATC A 3R:7873179..7873180 RAL-357 RAL-381 60 ATTGTCTGCGCAACTGT CTG ATGAATTCGTCTGCCTGTC C 2R:7936918..7936946 RAL-810 60 CGAAGACATCAGTCCT GCAA CCGCTGACTGTGATTGCTA A 3R:10301789..103018 22 RAL-908 60 GCACGAGACTCACACA GGAA TTATGGCCATTGTACGCTG A 2L:1399467..1399478 RAL-908 60 TGCATCTGTGTGCGTAT GTG GCACTTTTTGCCTCTGTTCC F-elemen 3R:6947766..6947992 RAL-810 60 TAGGCGCTGTTATTGAA ACC CAGTGAAAGTGGGTGCAAA 3L:7996067..7996071 RAL-908 60 GGGATTTGCTCTTGCT CTTG GCCATGGTCGAAACAAAAC T 3R:9994118..9994126 RAL-908 60 GCTTGTCAAAGGGTCC AAGA TGTTATGTGCGCGAACTTG T I-elemen 2R:10573276..105732 86 RAL-357 60 TCCGTCGGCTCTTATTT GTC CGTCTTACACTCGCAGCAA A 2R:13861586..138616 00 RAL-810 60 CCCAGATTCGCAATAC CAAA AACAAAAGCAACCACCAAG G 3L:5068011..5068084 RAL-908 56 TCGAATTGATACAACCC CAAT CTACTACGGCGGTGTTGGT T 3R:11405981..114059 87 RAL-357 60 GGCAGTGCAAACAAAA ACAA CTGAGGCCAAGGACTTATG C 3R:14271683..142716 93 RAL-810 56 ACCTCATAGGGGGTGC TTTT TTGGAAGTGAAGGCTTTGA A 2L:11388784..113887 93 RAL-790 60 CTTGAAGACCGGGTAC TTCT GCTGGCATATCTTCTCCGA C 2R:7961110..7961122 RAL-790 60 AACCCAGGGAGCTAAG TAGA ATTGAATGTCCGGGGATCT T 2R:12732718..127327 30 RAL-790 60 GCCGAACAGCATATAC CCT TCAAGCGTGTTTCCTCGAT 2R:14371197..143712 09 RAL-790 60 TACCCGCCACTCAATTA TCC AGTATGGCGTCGAGTGTG 3R:4277178..4277189 RAL-790 60 CTTTAAGCACCACGAG ACGA ACCCAAATGCAAAGCCGT 3R:14671496..146715 08 RAL-790 58 TAAATAAGTGCCTTCGC CCC TGTATCTCGGCTGTCTCCA 3R:21118597..211186 11 RAL-790 62 CCGGAGCCTGGTAGTT CTT TATCTTTCTCCCAGCCCGTC 3R:21756397..217564 00 RAL-790 60 CGCGCCTAGAACTATG CAA ACACACTAGCAAGCACTGG 2R:2648988..2649001 RAL-908 60 CCCCTCGTTTTCTACTG CTAC GTGGGTGTGGAACTCTGTG 2R:7224003..7224015 RAL-908 58 TAGCCTGCTTTTGTGTG GAG CTTGCAAGTTGGTTTTGGG G ! 94! Supplemen a y Table 2.1. Con . Posi ion o inse ion DGRP line Ta (ºC) Fo wa d p ime sequence Re e se p ime sequence I-elemen 3L:4501669..4501675 RAL-908 60 ACAGAAGTACAGTGAG CGT GGGGAGGTTCAATTGGTCA 3L:5068011..5068084 RAL-908 60 AGTCAATTCGCCTAGTA CCAC CAATTGGAGCTGCATCCTT T 3L:10088380..100883 81 RAL-908 60 AGGGCACTTTCCTCGA GA ATATGCTTTGATACGGCGC T 3L:22408430..224084 42 RAL-908 60 GTCTTGACGCCTTGCC TAG CACTGCATTTCAAACGCTC G 3R:8071617..8071628 RAL-908 58 GAACACGCCGAGGATA GC CGAAAATCTACTCAGCCTG CT 3R:11192794..111928 06 RAL-908 60 GCCTTCCACACGCATC TG GATGCCCGCACTGAGAGA 3R:22596610..225966 22 RAL-908 60 ACCCAAGTTCTTGTCG CC GCGGCGCATCAACTAATG 3R:22850421..228504 34 RAL-908 60 TCCGCTGGAGAAATTG CAT AATCTAAAAGGGGCTGCCA X:302449..302464 RAL-908 60 TAAGTCACAACCCTACA GCA TGACAGCAGTTGGGATCAA X:10027285..1002729 8 RAL-908 60 CGCTTACACTGTATTTG CCC GCCACCGTCTCTACTTGC Juan 2R:5572279..5572291 RAL-810 60 CTAACACGTTTCCGCC AAGT TTCGAGGGTGTGGGTGTAT T 3L:17698435..176984 91 RAL-357 RAL-761 60 TCAAGTCCCAGATGCA CTCA ATGTGGAACTTGGAGGATG C X:18924423..1892443 6 RAL-908 58 TCGAAGCCATTGCTATT TTTG TGACACCTATTCCTCAGACT CG 3L:16130441..161304 56 RAL-443 60 CAATCGCCTAGATCGC TTGT AGTAGCAGGTCGCCTTGAA A DNA elemen s: TIR elemen s hobo 3R:10703373..107033 79 RAL-357 60 CTCCCAAGGATTCTGT CCAA AATGTTTCCCAAAGCTGAC G 3R:22133514..221335 21 RAL-357 60 GGGTCTGAAAGCAGCT ATGG CATTGTTCTTGGCTGACGA A 2R:12871101..128711 13 RAL-810 60 TCAACGCTGAAAAGTAT GCAA GCAGATGATGTTGGCTTGA A 3L:19555349..195553 54 RAL-761 RAL-810 RAL-812 60 AGCTTTAGCCACAGCC ACAT GAGAGGCACGCAGGTAAGA C 3R:22134885..221348 92 RAL-908 60 CAAAGGCAGGGCTAAC AAAA CACAAGTGGGAGCATCAAC A hoppe 2L:2390528..2390533 RAL-357 60 ACCCATCAGACTTCCA CGAC GGAATCGCCTACAGAAGCT G 3R:13938897..139389 01 RAL-357 RAL-812 60 TCGATTTGGCTGGAAA CTCT ATGCTGAACACGATGTGGA A 3R:15010776..150107 80 RAL-908 60 GGGTACAATCAAATCG AGCTTC GCGAAAACTGCACTCAATC A X:4110151..4110442 RAL-810 60 CTTCGTTTCATTTGGCC ATT TGTGCCAAAAACACAGGCT A pogo 2R:11767856..117678 57 RAL-810 RAL-381 60 GGCTACGACATTTCCG TTGT AACCTATTCCTTGCGGACC T 3L:21388576..213885 78 RAL-810 RAL-812 60 TTCAATACGGATTTGCC ACA GCAAAAATAAGGGCCATCC T 3R:11292096..112920 97 RAL-357 60 GTTGAGCAAACAGACC CACA GGAGCCTCATAATCCGGTC T ! 95! Supplemen a y Table 2.1. Con . Posi ion o inse ion DGRP line Ta (ºC) Fo wa d p ime sequence Re e se p ime sequence pogo 3R:2926760..2926761 RAL-357 60 AACTCGAATCTGGCTC GAAA AGTGGCCTTATCGATTGGA A X:6015256..6015259 RAL-908 RAL-381 60 GATGTTTCGTGTGGCT GTTG GCAGTCGCTGCAGTTTGAT A 3L:1571691..1571694 RAL-358 60 TGCACATGACTGGATT CACA CACACGAACATTGCTCCGA 2L:12470302..124703 09 RAL-908 60 TTAGAAAGCAAGTACC GGCA TTCTGCCATCGTGTTGCC 2L:13770337..137703 38 RAL-908 60 GTGGGGCCTCATAGAT ACGT TATGCGCTGAGGTACACTT G 2L:13780514..137805 15 RAL-908 60 CCGGCCCATGTTAAGC TTTA GAGGCAGCGGATCAATTCA 2L:15151373..151513 77 RAL-908 58 TGTTCGGGTGGTAAAA GCG CAACGTTCCCAGGACACC 2L:18860089..188600 91 RAL-908 60 ACGCCTCGGATTTGAC ATC CCGTTGGCATTTTGTGGAT A 2R:1749442..1749443 RAL-908 60 ATAGCACATTCAGCCA CACG TGCTGAATTCGGAAAGAGC T 2R:5741587..5741594 RAL-908 60 GGTTTCGATTCGGTATT GGTTG ATTGCTTCGTGTTAGGACC C 2R:6426442..6426443 RAL-908 60 CTGAGTCGAGCTGGTA GGT CGACATTTTCTGCGGCCG Posi ion o inse ions is based on he assembly numbe i e o D. melanogas e genome. Ta s ands o annealing empe a u e Supplemen a y Table 2.2. DGRP lines wi h no inse ions de ec ed o blood, copia, gypsy5, opus, jockey, H-elemen and pogo elemen s. DGRP line blood copia gypsy5 opus jockey H-elemen pogo RAL-109 X X RAL-161 X RAL-237 X X X X X X X RAL-350 X RAL-362 X X RAL-555 X RAL-776 X RAL-808 X ! 96! Supplemen a y Table 2.3. P ime s used o de ec alse nega i es and o qPCR eac ions. Ta ge Fo wa d p ime sequence Re e se p ime sequence Re blood AACAATAGAAAGAAGCCACCGAAC AGTCATGGACTATTGAGGGTGTTG 73 copia TGCCAGAGAGCAAGTTCAGA GCAAACCCAATTTGTCTCGT gypsy5 GCCCAGAGACAACGACAGAA CTGTCTTTGCTGTCCCGGAT H- elemen CATTAAGTCGGAAGGCCAAA CTTGCTCTTCCGCTATCCAC jockey GCGGATTAACAAGGGGCTCT CCTGGGAGATAGATGCGCTG opus CGAGGAGTGGGGAGAGATTG TGCGAAAATCTGCCTGAACC 85 pogo CCAGCGATAACGAAGAAAGC GCTGCAAACCCATCCTTAAA poin ed GGGGCGTGCTGTTGTTGATG TCGCTGGGACTGGGCTACTTC 86 Rpl32 ATGCTAAGCTGTCGCACAAATG GTTCGATCCGTAACCGATGT Tbp GGCAAAGAGTGAGGACGACT GAGCCGACCATGTTTTGAAT 38 Re , e e ence ! 97! Supplemen a y Table 2.4. P obabili ies es ima ed by Mackay e al. o he iden i y o TE inse ions. Posi ion o inse ion DGRP line Mos likely TE P obabili ies o LEFT eads P obabili ies o RIGHT eads 3L: 22887401..22887413 RAL-321 blood R 1b, 0.33 C 1a, 0.28 blood, 0.93 R 1b, 0.07 3R:7387389..7387392 RAL-358 blood blood, 0.47 S alke 2, 0.42 S alke 2, 0.42 1360, 0.21 2L:14056691..14056894 RAL-321 blood blood, 0.6 S alke 2, 0.39 S alke 2, 0.52 INE-1, 0.25 X:10922194..10922200 RAL-790 blood blood, 0.6 S alke 2, 0.39 S alke 2, 0.35 1360, 0.23 2L:1788665..1788852 RAL-357 mdg1 mdg1, 0.58 HMS-Beagle, 0.19 Emp y 3R:23192134..23192145 RAL-357 mdg1 Emp y mdg1, 0.86 T anspac, 0.13 2R:19347971..19347974 RAL-357 mdg1 mdg1, 0.45 C 1a, 0.23 Emp y X:5024909..5024914 RAL-908 mdg1 mdg1, 0.83 T anspac, 0.12 Ide ix, 0.79 INE-1, 0.21 X:21270475..21270477 RAL-908 oo Emp y oo, 0.57 pogo, 0.43 2L:12191481..12191488 RAL-908 oo oo, 0.81 oo, 0.55 INE-1, 0.29 3R:17515331..17515334 RAL-358 oo INE-1, 0.81 oo, 0.17 oo, 0.99 3R:7873179..7873180 RAL-357 Doc Doc, 0.96 INE-1, 0.49 1360, 0.3 3R:7873179..7873180 RAL-381 Doc Doc, 0.97 INE-1, 0.69 1360, 0.16 3R:6947766..6947992 RAL-810 F-elemen INE-1, 0.8 F-elemen , 0.9 3L:4501669..4501675 RAL-908 I-elemen INE-1, 0.74 I-elemen , 0.12 I-elemen , 1 2R:6426442..6426443 RAL-908 pogo pogo, 0.58 oo, 0.19 pogo, 0.69 oo, 0.12 We only include in o ma ion o he inse ions analyzed in his s udy and ha con ained a di e en TE iden i y han he one p edic ed by Mackay e al. Posi ion o inse ions is based on he assembly numbe i e o D. melanogas e genome. ! 98! Supplemen a y Table 2.5. Numbe o no el inse ions pe TE pe geno ype. TEs ha had mo e han en no el inse ions a leas in one DGRP line (Maximum) a e highligh ed in iole . F om hose, we chose eigh TEs o he GWAS analyses (highligh ed in o ange). This able is p o ided in digi al o ma . Supplemen a y Table 2.6. Alleles associa ed wi h blood, gypsy5, mdg1, oo, I- elemen , jockey, H-elemen and pogo ac i i y. Table illus a es op alleles (single p- alue<7e-05) associa ed wi h numbe o no el inse ions o each TE. We ob ained allelic posi ion using he assembly numbe i e o D. melanogas e genome. This able is p o ided in digi al o ma . Supplemen a y Table 2.7. Gene on ology (GO) analysis o genes con aining alleles associa ed wi h gypsy5 ac i i y. GO analysis was pe o med o assess en ichmen o ce ain biological p ocesses in he g oup o genes con aining loci wi h allelic a ia ion a ec ing blood ac i i y. Signi ican GO e ms we e ob ained a e Bon e oni co ec ion o mul iple es ing. En ichmen o o a ian ollicle cell de elopmen (GO:0030707) genes is highligh ed in o ange. This able is p o ided in digi al o ma . ! 99! Re e ences 1. Ba ón, M. G., Fis on-La ie , A.-S., Pe o , D. A. & González, J. Popula ion Genomics o T ansposable Elemen s in D osophila. Annu. Re . Gene . 48, 561–581 (2014). 2. Vicien , C. M. T ansc ip ional ac i i y o ansposable elemen s in maize. BMC Genomics 11, 601 (2010). 3. González, J., Lenko , K., Lipa o , M., Macphe son, J. M. & Pe o , D. a. High a e o ecen ansposable elemen -induced adap a ion in D osophila melanogas e . PLoS Biol. 6, 2109–2129 (2008). 4. Lisch, D. How impo an a e ansposons o plan e olu ion? Na Re Gene 14, 49–61 (2012). 5. Ga cía Gue ei o, M. P. Wha makes ansposable elemen s mo e in he D osophila genome? He edi y (Edinb). 108, 461–468 (2012). 6. B ennecke, J. e al. Disc e e Small RNA-Gene a ing Loci as Mas e Regula o s o T ansposon Ac i i y in D osophila. Cell 128, 1089–1103 (2007). 7. A a in, A. A., Sachidanandam, R., Gi a d, A., Fejes-To h, K. & Hannon, G. J. De elopmen ally egula ed piRNA clus e s implica e MILI in ansposon con ol. Science (80-. ). 316, 744–747 (2007). 8. Kawaoka, S. e al. The Bombyx o a y-de i ed cell line endogenously exp esses PIWI/PIWI-in e ac ing RNA complexes. RNA 15, 1258–64 (2009). 9. Lau, N. C., Ohsumi, T., Bo owsky, M., Kings on, R. E. & Blowe , M. D. Sys ema ic and single cell analysis o Xenopus Piwi-in e ac ing RNAs and Xiwi. EMBO J. 28, 2945–2958 (2009). 10. Khu ana, J. S. e al. Adap a ion o P Elemen T ansposon In asion in D osophila melanogas e . Cell 147, 1551–1563 (2011). 11. A a in, A. e al. Double-s anded RNA-media ed silencing o genomic andem epea s and ansposable elemen s in he D. melanogas e ge mline. Cu . Biol. 11, 1017–1027 (2001). 12. Kalmyko a, A. I., Kleno , M. S. & G ozde , V. A. A gonau e p o ein PIWI con ols mobiliza ion o e o ansposons in he D osophila male ge mline. 33, 2052–2059 (2005). 13. Mackay, T. F. C. e al. The D osophila melanogas e Gene ic Re e ence Panel. Na u e 482, 173–178 (2012). 14. McClin ock, B. The o igin and beha iou o mu able loci in maize. Gene ics 36, 344–355 (1950). 15. Amine zach, Y. T., Macphe son, J. M. & Pe o , D. A. Pes icide ! 100! Resis ance ia T ansposi ion-Media ed Adap i e Gene T unca ion in D osophila. Science (80-. ). 309, 764–767 (2005). 16. Dabo n, P. J. e al. A Single P450 Allele Associa ed wi h Insec icide Resis ance in D osophila. Science (80-. ). 2253, 2253–2256 (2013). 17. Ba oso-Ba is a, J. e al. The Fi s S eps o Adap a ion o Esche ichia coli o he Gu A e Domina ed by So Sweeps. PLoS Gene . 10, (2014). 18. Guio, L., Ba ón, M. G. & González, J. The ansposable elemen Ba i- Jheh media es oxida i e s ess esponse in D osophila. Mol. Ecol. 23, 2020–2030 (2014). 19. Eme a, D. & Wagne , G. P. T ansposable elemen ec ui men s in he mammalian placen a: Impac s and mechanisms. B ie . Func . Genomics 11, 267–276 (2012). 20. San os, M. E. e al. The e olu ion o cichlid ish egg-spo s is linked wi h a cis- egula o y change. Na . Commun. 5, 5149 (2014). 21. Ho , A. E. anʼ e al. The indus ial melanism mu a ion in B i ish peppe ed mo hs is a ansposable elemen . Na u e 534, 102–105 (2016). 22. Wicke , T. e al. A uni ied classi ica ion sys em o euka yo ic ansposable elemen s. Na . Re . Gene . 8, 973–982 (2007). 23. Le in, H. L. & Mo an, J. V. Dynamic in e ac ions be ween ansposable elemen s and hei hos s. Na . Re . Gene . 12, 615–627 (2011). 24. Cu cio, M. J. & Ga inkel, D. J. New lines o hos de ense : inhibi ion o Ty1 e o ansposi ion by Fus3p. T ends Gene . 15, 43–45 (1999). 25. Dai, J., Xie, W., B ady, T. L., Gao, J. & Voy as, D. F. Phospho yla ion Regula es In eg a ion o he Yeas Ty5 Re o ansposon in o He e och oma in. Mol. Cell 27, 289–299 (2007). 26. Siebel, C. W. & Rio, D. C. Regula ed splicing o he D osophila P ansposable elemen hi d in on in i o: soma ic ep ession. Science (80-. ). 248, 1200–1208 (1990). 27. Kibano , M. V e al. A no el o ganelle, he piNG-body, in he nuage o D osophila male ge m cells is associa ed wi h piRNA-media ed gene silencing. Mol. Biol. Cell 22, 3410–3419 (2011). 28. Malone, C. D. e al. Specialized piRNA Pa hways Ac in Ge mline and Soma ic Tissues o he D osophila O a y. Cell 137, 522–535 (2009). 29. Meignin, C., Das ugue, B. & Vau y, C. In e cellula communica ion be ween ge m line and soma ic line is u ilized o con ol he ansc ip ion o ZAM, an endogenous e o i us om D osophila melanogas e . Nucleic Acids Res. 32, 3799–3806 (2004). 30. Tou e , F., Guiguen, F. & Te zian, C. Wolbachia In luences he Ma e nal ! 101! T ansmission o he gypsy Endogenous Re o i us in D osophila melanogas e . MBio 5, 1–10 (2014). 31. Huang, W. e al. Na u al a ia ion in genome a chi ec u e among 205 D osophila melanogas e Gene ic Re e ence Panel lines Na u al Va ia ion in Genome A chi ec u e Among 205 D osophila melanogas e Gene ic Re e ence Panel Lines. Genome Res. 24, 1193–1208 (2014). 32. The Gene On ology Conso ium. Gene On ology: ool o he uni ica ion o biology. Na . Gene . 25, 25–29 (2000). 33. Ch os ek, E. e al. Wolbachia Va ian s Induce Di e en ial P o ec ion o Vi uses in D osophila melanogas e : A Pheno ypic and Phylogenomic Analysis. PLoS Gene . 9, 1–22 (2013). 34. Mendes, C. C. & Mi h, C. K. S age-Speci ic Plas ici y in O a y Size Is Regula ed by Insulin/Insulin-Like G ow h Fac o and Ecdysone Signalling in D osophila. Gene ics (2015). doi:10.1534/gene ics.115.179960 35. Ande sen, C. L., Jensen, J. L. & Ø n o , T. F. No maliza ion o eal- ime quan i a i e e e se ansc ip ion-PCR da a: a model-based a iance es ima ion app oach o iden i y genes sui ed o no maliza ion, applied o bladde and colon cance da ase s. Cance Res. 64, 5245–5250 (2004). 36. Vandesompele, J. e al. Accu a e no maliza ion o eal- ime quan i a i e RT-PCR da a by geome ic a e aging o mul iple in e nal con ol genes. Genome Biol. 3, 1–12 (2002). 37. Pon on, F., Chapuis, M.-P., Pe nice, M., Swo d, G. A. & Simpson, S. J. E alua ion o po en ial e e ence genes o e e se ansc ip ion-qPCR s udies o physiological esponses in D osophila melanogas e . J. Insec Physiol. 57, 840–850 (2011). 38. Ma a, B. P., Bi ne -Ma hé, B. C. & Al es-Fe ei a, M. Ge ing eal wi h eal- ime qPCR: A case s udy o e e ence gene selec ion o mo phological a ia ion in D osophila melanogas e wings. De . Genes E ol. 221, 49–57 (2011). 39. R-Co e-Team. R - A language and en i onmen o s a is ical compu ing. h ps://www. -p ojec .o g/ (2012). 40. Saha, N., Liu, M., Gajan, A. & Pile, L. A. Genome-wide s udies e eal no el and dis inc biological pa hways egula ed by SIN3 iso o ms. BMC Genomics 17, 111 (2016). 41. Czech, B., P eall, J. B., McGinn, J. & Hannon, G. J. A ansc ip ome-wide RNAi sc een in he D osophila o a y e eals ac o s o he ge mline piRNA pa hway. Mol. Cell 50, 749–61 (2013). 42. Sha ma, V., Swamina han, A., Bao, R. & Pile, L. A. D osophila SIN3 is equi ed a mul iple s ages o de elopmen . De . Dyn. 237, 3040–3050 (2008). ! 109! 3.1 Abs ac T ansposable elemen s (TEs) a e impo an con ibu o s o pheno ypic di e si ica ion1–3 and ep esen an impo an sou ce o adap i e gene ic a ia ion4,5. Howe e , a la ge p opo ion o inse ions is elimina ed due o dele e ious e ec s6, and hos s bene i om mechanisms ha speci ically a ge TEs in he ge mline, and ha a e able o con ol he p oduc ion o he i able gene ic a ia ion7–11. Despi e ecen ad ances in he unde s anding o hose p ocesses, he en i onmen al and gene ic ac o s ha igge ansposi ion in D osophila melanogas e emain poo ly desc ibed12. In addi ion, s udies abou he impo ance o bio ic13–15 and abio ic16–18 pe u ba ions in TE ac i i y p o ided con lic ing esul s as each assess e ec s in di e en ansposons and in di e en gene ic backg ounds. In his wo k, we o e came hose p oblems by es ing GxExE in e ac ions in he ac i i y o di e en ansposons. In pa icula , we s udied he e ec o a bio ic (Wolbachia) and an abio ic ( empe a u e) ac o in he exp ession o e o ansposons (blood, mdg1 and oo) in he o a ies o ou di e en ully sequenced, wild-de i ed geno ypes (geno ypic ac o s)19. How changes in empe a u e du ing adul li e in luenced TE esponses o he p esence o Wolbachia (ExE in e ac ion) was also included in he analysis. In e es ingly, we obse ed geno ype- and TE-dependen e ec s o Wolbachia and empe a u e in blood, mdg1 and oo exp ession. Mo e speci ically, he p esence o endosymbion and he mal pe u ba ions we e able o educe, induce o con e no e ec in he exp ession o ansposons. We discuss he in luence o hos ansc ip ion ac o s as media o s o hose esponses. 3.2 In oduc ion T ansposable elemen s (TEs) a e conside ed impo an d i e s o genome e olu ion. They cons i u e a la ge p opo ion o hos DNA and ep esen a majo sou ce o gene ic a ia ion6,20. Al hough ecen s udies ecognized ha TEs a e impo an con ibu o s o pheno ypic di e si ica ion1–3, and ha se e al inse ions ha e adap i e alue4,5, a la ge p opo ion is s ill elimina ed due o pu a i e dele e ious e ec s6. ! 110! When o e -ac i e in he ge mline, TEs can damage genomic in eg i y and lead o s e ili y21. As a consequence, hos s ha e e ol ed s a egies o speci ically ecognize mobile elemen s and con ol ansposi ion in ge minal cells7–11. Al hough ecen ad ances ha e unco e ed many aspec s o such mechanisms, he en i onmen al and gene ic ac o s ha igge jumping emain la gely unknown12. Also, and hough ansposon inse ions in luence hos adap a ion o en i onmen al pe u ba ions22, he e is no consensus abou he impo ance o speci ic s esses, bio ic13–15 and abio ic16–18, in D. melanogas e ansposi ion a es. Inconsis encies ob ained o TE esponse o hea shock16–18 and sca ce s udies on ansposon ac i i y in lies in ec ed wi h na u al pa hogens14 highligh he demand o u he a en ion o his subjec . D. melanogas e genome con ains se e al inse ions o di e en mobile elemen s ha can be g ouped in o wo main classes6,23. Those classi y TEs acco ding o sequence p ope ies, and di e en ia e e o ansposons om DNA elemen s23. Re o ansposons mo e ia an RNA in e media e, and sha e s uc u al commonali ies wi h e o i uses; DNA elemen s mo e ia a non- eplica i e cu -and-pas e mechanism, and a e usually lanked by e minal in e ed epea s24. They bo h exp ess p o eins ha a e c ucial o comple e each cycle o ansposi ion, and o media e in eg a ion in hos genome25. DNA elemen s code o a ansposase p o ein, while e o ansposons and e o i uses usually exp ess a i al-pa icle coa , e e se ansc ip ase, ibonuclease H and in eg ase25. T adi ionally, e o ansposons a e di ided in o wo main g oups based on he p esence o absence o long e minal epea s (LTRs). In D. melanogas e , mos copies belong o he LTR g oup6 ha can con ain cis- egula o y elemen s wi hin 5ʼ LTR o TE open eading ames 22. Those egula o y elemen s a e necessa y o igge exp ession o ansposons, and a e ypically ecognized by hos ansc ip ion ac o s26–28. In e es ingly, expe imen s done in plan species p o ed impo ance o such elemen s in media ing TE esponse o speci ic en i onmen al s esses22,26–30. This idea was ne e empi ically es ed in me azoans. ! 111! He e, we p opose o s udy he e ec o he in e ac ion be ween wo en i onmen al ac o s (one bio ic and ano he abio ic) in he ac i i y o ansposons o D. melanogas e o a ies. Fo he bio ic ac o , we es ed he impo ance o Wolbachia – an obliga o y in acellula bac e ia ha in ec s se e al a h opod and nema ode species31–33. The s udy o he e ec o his ma e nally ansmi ed endosymbion in he ac i i y o ansposons is o pa icula in e es gi en 1) Wolbachiaʼs abili y o inc ease hos su i al o RNA i al in ec ion34,35 and 2) he s uc u al commonali ies be ween e o i uses and e o ansposons. In acco dance wi h hese wo obse a ions, we hypo hesize ha he p esence o Wolbachia in D. melanogas e o a ies could educe e o ansposon exp ession, simila o ha obse ed o i al load34. Also, and gi en ha some Wolbachia- media ed hos pheno ypes (such as male killing in D. bi ascia a36) a e sensi i e o empe a u e, we decided o u he es o which ex en he mal pe u ba ions du ing adul li e in luenced Wolbachia-induced TE esponses. The exp ession o h ee e o ansposons (blood, mdg1 and oo) was assessed in o a ies collec ed om ou ully sequenced, wild-de i ed geno ypes. We obse ed geno ype- and TE-dependen e ec s o Wolbachia and empe a u e in blood, mdg1 and oo exp ession. Mo e speci ically, he p esence o endosymbion and he mal pe u ba ions we e able o educe, induce o con e no e ec in he exp ession o ansposons. We u he sugges ha hos ansc ip ion ac o s may media e hose esponses. 3.3 Ma e ials and Me hods D osophila melanogas e s ocks and main enance O egon-R s ock was ob ained om Rui Ma inho labo a o y, and was na u ally clea ed o Wolbachia in ec ion. Flies om he D osophila Gene ic Re e ence Panel (DGRP)19 (RAL-021, RAL-237, RAL-321 and RAL-790) ha we e na u ally in ec ed wi h he same s ain o Wolbachia (wMel-like geno ype37), we e pu chased om Blooming on s ock cen e . To ob ain gene ically iden ical geno ypes in ec ed o no wi h Wolbachia, hose lies we e ea ed wi h e acycline (0.05mg/ml) o wo gene a ions, and gu lo a con en homogenized ! 112! as p e iously desc ibed38. Flies we e kep in s anda d co nmeal ood39 a 25°C, 60% humidi y and 12h day-da k cycles, unless o he wise men ioned. Tempe a u e ea men s To assess TE esponse o empe a u e change a di e en ime poin s, we collec ed 0-8h old O egon-R lies and kep i e emales wi h wo males o h ee days a 25ºC. Males we e hen emo ed and emales placed a 25ºC (con ol condi ion) o 29ºC (expe imen al condi ion). O a ies we e dissec ed a day one, wo, h ee and ou a e empe a u e change, o RNA ex ac ion. We pooled eigh pai s o o a ies pe sample, ou eplica es pe condi ion. To es he e ec o D. melanogas e gene ic backg ound in TE esponse o empe a u e and Wolbachia, we collec ed 0-8h old RAL-021, RAL-237, RAL-321 and RAL-790 lies in ec ed o no wi h endosymbion . Fo each geno ype and Wolbachia s a us, i e emales we e kep wi h wo males o h ee days, a 25ºC. Males we e hen emo ed and emales placed a di e en empe a u es, 25ºC o con ol, 21ºC and 29ºC o expe imen al condi ions. O a ies we e dissec ed a day ou a e he mal change o RNA ex ac ion. We pooled eigh pai s o o a ies pe sample, six o eigh eplica es pe condi ion. RNA ex ac ion and cDNA syn hesis O a ies we e dissec ed in esh cold PBS 1x, and di ec ly s o ed a 4ºC in 400μl o T izol (Ambicon) un il homogenized by pes els. Tissue collec ion and homogeniza ion was done in he same day; samples we e s o ed a -80ºC un il RNA ex ac ion. We polled eigh pai s o o a ies pe sample. Fo RNA ex ac ion we used Di ec -zol RNA Minip ep ki (Zymo Resea ch) and o al RNA was elu ed in 25μl o RNase- ee wa e (Sigma). RNA pu i y and concen a ion o each sample was measu ed wi h Nanod op ND-1000 Spec opho ome e ; A600/A800 abso bance was a ound wo o all samples, and concen a ions anged om 200 o 800ng/µl. All RNA samples o he same geno ype we e p ocessed on he same day. ! 113! Fo cDNA syn hesis we emo ed con amina ions o gDNA om 1µg o RNA using DNAse (P omega) ea men . Fo cDNA syn hesis, we ollowed Re e se T ansc ip ion Sys em (P omega) p o ocol, using 0.02µM Oligo dT p ime s. Reac ion was incuba ed a 42°C o 60 min and hea ed a 95°C o 5 min. cDNA was dilu ed in RNAse- ee wa e (1:10) and s o ed a -20°C un il quan i a i e eal- ime PCR (qPCR). qPCR We measu ed le els o mRNA exp ession by qPCR in CFX384 he mal cycle (BioRad). Fo each eac ion we used 5µl iQ™ SYBR® G een supe mix (BioRad), 1µl o 4µM p ime s and 4µl o dilu ed cDNA (1:10). P ime sequences a e desc ibed in Supplemen a y Table 3.1. We un wo echnical eplica es pe sample, pe pla e. The mal cycling p o ocol was he same o all eac ions: 2 min a 50°C; 10 min a 95°C; 40 cycles o 95°C o 30 sec, 60°C o 1 min and 72°C o 30 sec. We used de aul h eshold se ings o ob ain he quan i ica ion cycle (Cq) o each eac ion. qPCR mel ing cu es we e analyzed o con i m speci ici y o ampli ied p oduc s and nega i e con ols ne e showed de ec able ampli ica ion. To es he dynamic o TE exp ession in O egon-R o a ies upon exposu e o 25ºC and 29ºC, we used P a l me hod40 ha co ec s exp ession o he e iciency o each p ime pai . We used Rpl32 as e e ence gene, gi en ha he alues ob ained o exp ession s abili y using No mFinde 41 and geNo m42 algo i hms we e be e o ha gene (Rpl32: No mFinde =0.04, geNo m=0.60; Tbp: No mFinde =0.05, geNo m=0.61). Fold-change o exp ession was de e mined o each TE, using as no malize he a e age ela i e exp ession ob ained o samples collec ed in day one, and kep a 25ºC. To assess le els o TE and gene exp ession o DGRP samples, we an in each pla e s anda d cu es (one s anda d cu e o each gene o TE es ed) wi h se ial dilu ions o known amplicon concen a ions. To ob ain amplicons o s anda d cu es, we ampli ied a ge egions by PCR using 0.25U o GoTaq (P omega), 1x eac ion bu e , 1.5mM MgCl2, 0.4µM p ime s (Supplemen a y ! 114! Table 3.1) and 1µl o cDNA (1:10). PCR p oduc s we e cleaned using NucleoSpin® Gel and PCR Clean-up (Mache ey-Nagel), elu ed in 15µl o bu e NE, and concen a ions measu ed in Nanod op ND-1000 Spec opho ome e . The minimum amoun o nucleic acids ha can be de ec ed by qPCR o each p ime pai was es ima ed by ex ending dilu ions o ou s anda ds un il he ela ionship be ween he known amplicon concen a ions and he quan i ica ion cycles (Cqs) eached a pla eau. Samples ha had Cq alues ou side he linea de ec ion and wi h s anda d de ia ion abo e 0.5 o he echnical eplica es we e elimina ed om he analysis. To ob ain le els o exp ession we ans o med Cq alues in o absolu e a ge concen a ions using espec i e s anda d cu es. This me hodology allowed us o con ol o pla e e ec s, and o di e ences in p ime e iciency. Fo he analysis o exp ession da a, we used No mFinde 41 and geNo m42 algo i hms o check exp ession s abili y o wo e e ence genes commonly used o no malize gene exp ession a di e en en i onmen al condi ions and geno ypes, Rpl32 and Tbp43,44. S abili y alues ob ained o Rpl32 (RAL-021: No mFinde =0.26; geNo m=0.36; RAL-237: No mFinde =0.24; geNo m=0.22; RAL-321: No mFinde =0.07; geNo m=0.19; RAL-790: No mFinde =0.03; geNo m=0.13) and Tbp (RAL-021: No mFinde =0.33; geNo m=0.33; RAL-237: No mFinde =0.15; geNo m=0.20; RAL-321: No mFinde =0.09; geNo m=0.21; RAL-790: No mFinde =0.08; geNo m=0.13) we e simila in bo h algo i hms. We hen decided o use Tbp as con ol gene o RAL-021, and Rpl32 o RAL-237, RAL-321 and RAL-790 as hose seem o be mo e s able o he espec i e DGRP lines (Supplemen a y Figu e 3.1). gDNA ex ac ion gDNA om RAL-021, RAL-321 and RAL-790 male adul s was ex ac ed using DNeasy Blood & Tissue Ki (Qiagen). Tissues we e homogenized in 180µl o bu e ATL, using pes els. We used 200µl o bu e AE o elu e gDNA and ea ed all samples wi h 0.2mg/ml o RNAse (In i ogen) o 20 min a 55ºC. gDNA concen a ion was measu ed in Nanod op ND-1000 Spec opho ome e , and samples s o ed a -20°C un il nes ed PCR. ! 115! Nes ed PCR We designed p ime s o he lanking egion o blood o oo inse ions p edic ed wi hin CG31751, CG10073, CG31974, CG8920, CG4374, CG5440, CG11319, CG2022, CG5681, CG17883, CG33966, CG5210, CG9194, po , Sema-1a, Ac 42A, Dg, Ta 12, Fas2, Topo s, ws and dnc genes (Supplemen a y Figu e 3.2A). P ime sequences a e desc ibed in Supplemen a y Table 3.2. We ob ained amplicon by longPCR (Roche): 4ng o RAL-021, RAL-321 o RAL-790 gDNA, 0.5µM p ime s, 2% DMSO, 1x bu e , 0.5mM dNTPs, and 0.21µl o enzyme pe 15µl o eac ion. We used s anda d ampli ica ion p og am o longPCR wi h 10 min o elonga ion ime, and 60ºC as annealing empe a u e. Size o inse ion was ob ained by elec opho esis, and 1µl o he p oduc o longPCR (1:100) used as empla e o a second PCR eac ion: 0.25U o GoTaq (P omega), 1x eac ion bu e , 1.5mM MgCl2 and 0.4µM o p ime s o blood o oo (Supplemen a y Table 3.1). This me hodology allowed us o con i m whe he blood o oo inse ions ha we e p edic ed o ha e landed inside genes and ha we e pu a i ely exp essed oge he wi h p o ein-coding mRNAs con ained sequences de ec ed by qPCR. S a is ical analyses All s a is ical analyses we e done in R ( e sion 3.0.3). To assess he e ec o empe a u e and ime o exposu e (ca ego ical ixed a iables) in TE ac i i y, we used linea models (lm) wi h logno mal dis ibu ion (O egon-R da ase ). In e ac ion be ween empe a u e and ime was emo ed i no con ibu ing o explain di e ences in exp ession. We es ed he signi icance (p<0.05) o he e ec o empe a u e a each ime poin by using leas -squa es means (lsmeans). When ime o exposu e in luenced TE exp ession, ega dless o he e ec o empe a u e, we ob ained an es ima e and signi icance o ha e ec , using same models desc ibed abo e and including ime o exposu e as con inuous ixed a iable. To es o he e ec o Wolbachia and empe a u e (ca ego ical ixed a iables) on ela i e TE and gene exp ession (dependen a iables) in RAL-021, RAL-237, ! 116! RAL-321 and RAL-790 o a ies, we used lm wi h logno mal dis ibu ion. When he in e ac ion be ween hose wo ac o s (Wolbachia and empe a u e) was s a is ically signi ican we used lsmeans o es o he e ec o Wolbachia a each empe a u e. Each ansposable elemen , gene and geno ype was analyzed sepa a ely. Cha ac e ize place o TE inse ions We ex ac ed a ailable in o ma ion o blood, mdg1 and oo inse ions o RAL- 021, RAL-237, RAL-321 and RAL-790 ha we e deposi ed online (h p://www.hgsc.bcm. mc.edu/p ojec s/dg p/19) and used Va ian E ec P edic o ool45 (Ensembl) o u he cha ac e ize inse ions acco ding o hei genomic posi ion (e.g. coding s. non-coding). Fo hose ha landed inside o in he neighbo egions o gene sequences, we un a gene on ology (GO) analysis o assess en ichmen o inse ions a ec ing genes wi h pa icula molecula unc ions. We used GO conso ium algo i hm, and Bon e oni co ec ion o mul iple es ing46. P edic ion o ansc ip ion ac o binding si es We sea ched o ansc ip ion ac o binding si es in blood, mdg1 and oo canonical sequences using Consi e47 and TFBIND48 algo i hms. We only conside ed cis- egula o y elemen s ha we e p edic ed by bo h p og ams, as p e iously desc ibed49. As Consi e and TFBIND use da abases o mammalian binding si es, we only show ansc ip ion ac o s ha a e known o ecognize conse ed cis- egula o y elemen s. 3.4 Resul s Wolbachia s a us and empe a u e pe u ba ions in luence TE ac i i y in a geno ype-dependen way In o de o assess he dynamic o TE esponse o empe a u e, we exposed adul emales o 29ºC (and compa ed hem wi h con ol emales ha we e main ained a 25ºC) o di e en pe iods o ime. We obse ed ha TE ! 117! exp ession was a ec ed by empe a u e, and ha hose e ec s we e dependen on he ime o exposu e and on he TE analyzed ega dless o sequence p ope ies (Supplemen a y Figu e 3.3). Gi en ha mo e TEs esponded o empe a u e a e ou days o exposu e, we hen decided o use his ime poin o analyze he e ec o Wolbachia on TE ac i i y o ou geno ypes upon exposu e o di e en empe a u es (21ºC, 25ºC and 29ºC). In e es ingly, he dynamic o TE esponse o en i onmen al ac o s (bio ic and abio ic) was speci ic o each mobile elemen and geno ype analyzed (Supplemen a y Figu e 3.4 and Figu e 3.1). Al hough he exp ession o blood, mdg1 and oo in one geno ype (RAL-790) was obus o en i onmen al pe u ba ions, i esponded o one o bo h ac o s o he o he gene ic backg ounds analyzed (RAL-021, RAL-237 and RAL-321). Also, and when he e was an e ec , mobile elemen s o he same geno ype esponded in he same way o each en i onmen (Wolbachia o empe a u e) bu no be ween hem. In pa icula , we obse ed h ee ypes o esponses ha we e geno ype-, TE- and en i onmen -speci ic, and included dec ease, inc ease and no e ec in TE exp ession (Figu e 3.1). Only o one o he geno ypes analyzed (RAL-321) we ha e obse ed Wolbachia-media ed esponses in TE exp ession ha we e dependen on empe a u e (Supplemen a y Figu e 3.4). To unde s and o which ex en en i onmen al ac o s also a ec oocy e p og ession, we assessed he exp ession o CG15279 ha is mos ly exp essed in la e s ages o oocy e de elopmen 50 (Figu e 3.2A). We obse ed geno ype- dependen e ec s o Wolbachia s a us and empe a u e pe u ba ions in he exp ession o CG15279 (Figu e 3.2A and Supplemen a y Figu e 3.5). In pa icula , o mos geno ypes (RAL-237, RAL-321 and RAL-790) we de ec ed e ec s o bo h Wolbachia and empe a u e, and o only one geno ype (RAL- 021) we ha e obse ed an e ec o he in e ac ion be ween hese wo ac o s. ! 124! E ec o Wolbachia in TE exp ession and i al load may be ela ed Wolbachia is an endosymbion able o sp ead in na u al popula ions o D. melanogas e 61, and o con e p o ec ion agains i uses34,35. We hypo hesized ha he p esence o his endosymbion in D. melanogas e o a ies could also educe e o ansposon exp ession, simila o ha obse ed o i al load34. Al hough he mechanism unde lying he ipa i e in e ac ion be ween hos , Wolbachia and i us is s ill la gely unknown, ecen s udies ha e unco e ed a possible associa ion be ween Wolbachia-induced oxida i e s ess and i s abili y o p omo e hos su i al upon i al in ec ion62,63. I is he balance be ween he p oduc ion and des uc ion o eac i e oxygen species (ROS) ha e lec s he deg ee o oxida i e s ess64. As one possibili y, we hypo hesize ha Wolbachia may be able o educe hos abili y o es ablish an ioxidan de ences h ough nega i e e ec s in ansc ip ion ac o s ha p omo e cellula esponses o oxida i e s ess esul ing in inc eased le els o ROS. In e es ingly, blood and oo exp ession in RAL-021 o a ies ollowed ha o ou p edic ion and could be associa ed wi h p esence o cis- egula o y elemen s o a ansc ip ion ac o ha media es cellula esponses o oxida i e s ess (Cap-n- colla )65. This obse a ion sugges s ha TE and i al esponses o Wolbachia s a us may sha e impo an playe s possibly ela ed o he induc ion o oxida i e s ess. En i onmen al pe u ba ion as a d i e o he p oduc ion o gene ic a ia ion Inse ions o mobile elemen s in luence hos adap a ion and esponse o en i onmen al pe u ba ions22. Acco dingly, i has p e iously been sugges ed ha , when exposed o s ess ul condi ions, o ganisms could bene i om he p oduc ion o no el adap i e gene ic a ia ion h ough he ac i a ion o ansposons66. He e, we p oposed o explo e he e ec o bio ic and abio ic ac o s in D. melanogas e TE ac i i y, using exp ession in he ge mline as a p oxy o ansposi ion a es. Also, and gi en he eplica i e p ope ies o e o ansposons, we sugges ha inc eased TE ac i i y in he ge mline can ! 125! culmina e in highe mu a ion bu den ha is ansmi ed o he nex gene a ion. In e es ingly, we obse ed ha he abili y o p oduce he i able gene ic a ia ion is no only dependen on he en i onmen , bu also on he gene ic backg ound. Al hough some geno ypes we e obus o en i onmen al changes and had no po en ial o igge en i onmen ally media ed TE ac i i y (RAL-790) o educed TE exp ession in esponse o pe u ba ion (RAL-021 esponse o Wolbachia s a us), we obse ed ha one DGRP line (RAL-021) was able o p omo e blood, mdg1 and oo ac i i y in esponse o he mal challenges (inc ease in TE exp ession wi h dec ease in empe a u e). This s udy p o ides e idence ha some en i onmen al pe u ba ions, bu no all, may p omo e p oduc ion o he i able gene ic a ia ion ha can inc ease popula ionsʼ abili y o adap o new en i onmen s (e ol abili y). In summa y, he cu en s udy shows ha he egula ion o TE ac i i y can be e y complex, as geno ypic and en i onmen al ac o s g ea ly in luence he ac i i y o e o ansposons. Addi ionally, speci ic ime-dependen esponses o ex e nal s imuli we e also obse ed. We consequen ly p opose ha di e ences in he D. melanogas e gene ic backg ound, ime o exposu e o s ess, age o adul s and TE analyzed, could be a he basis o he p e ious inconsis encies ound in TE esponses o hea shock16–18. Acknowledgemen s DGRP lines we e ob ained om Blooming on ly s ock cen e , and O egon-R lies om Rui Ma inhoʼs lab. The au ho s hank o Alisson Gon ijo o p o iding p ime s agains CG15279, and membe s o Alisson Gon ijo, Chis en Mi h and Élio Sucena labo a o ies o sugges ions and impo an discussions. We would also like o acknowledge Osca Ruiz o eading his chap e . ! 126! Au ho con ibu ions The au ho o his disse a ion ob ained da a o O egon-R, did s a is ical and sequence analysis, and w o e his chap e . Ana Eugénio ob ained da a o DGRP lines; Ma a Ma ial a and Pa ícia Beldade designed all expe imen s. ! 127! Supplemen a y In o ma ion Supplemen a y Figu e 3.1. Exp ession o con ol genes (Rpl32 and Tbp). Rpl32 and Tbp exp ession (loga i hmic scale, log) in ou DGRP lines (RAL-021, RAL-237, RAL-321 and RAL-790) in ec ed (Wolb+) o no (Wolb-) wi h Wolbachia and exposed o di e en empe a u es (21ºC, 25ºC and 29ºC). Each do in box plo s ep esen s a biological eplica e (pool o eigh pai s o o a ies); iangles ep esen he mean. 89:!$;> 89:!;<" 89:!<;> 89:!"=$ !"#$ !%#& !%#$ !&#& !&#$ '()*! '()*+'()*!'()*+ '()*! '()*+ !"#$%,-./0-112(3,4)(56 89:!$;> 89:!;<" 89:!<;> 89:!"=$ !7#& !7#$ !"#& !"#$ !%#& &'",-./0-112(3,4)(56 25ºC 29ºC 21ºC '()*! '()*+'()*!'()*+ '()*! '()*+ '()*! '()*+ '()*!'()*+ '()*! '()*+ '()*! '()*+'()*!'()*+ '()*! '()*+ '()*! '()*+'()*!'()*+ '()*! '()*+ '()*! '()*+'()*!'()*+'()*! '()*+ '()*! '()*+'()*!'()*+'()*! '()*+ '()*!'()*+ '()*!'()*+ '()*! '()*+ ! 128! Supplemen a y Figu e 3.2. Con i ma ion o TE inse ions included in ma u e mRNAs. Scheme o nes ed PCR o ampli y TE inse ions ha a e wi hin gene sequences (A). P ime s used o he i s PCR eac ion (PCR.1) we e designed o ecognize gene sequences a ound he inse ion (Supplemen a y Table 3.2); p oduc o i s PCR was used as empla e o he second PCR eac ion (PCR.2) using p ime s designed o ecognize nucleo ide sequences inside he TE (Supplemen a y Table 3.1). Aga ose gel (1%) wi h amplicons ob ained om he i s (yellow) and second ( ed) PCR eac ions (B). Blood and oo nega i e con ols (C -) we e pe o med using a PCR eac ion wi hou gDNA bu wi h p ime s ampli ying espec i e TE sequences (Supplemen a y Table 3.1). We used GeneRule ™ 1kb DNA ladde (The mo Fishe Scien i ic). Ta ge gene PCR.1 PCR.2 T ansposable elemen blood C - oo C - CG31751 CG5440 CG31974 Sema-1a CG5681 CG11319 Ac 42A CG8920 CG10073 Dg CG17883 Topo s CG5210 CG9194 CG33966 CG4374 Ta 12 CG2022 ws po dnc Fas2 A B ! 129! Supplemen a y Figu e 3.3. E ec o empe a u e on TE exp ession a di e en ime poin s. Rela i e exp ession (P a l me hod) o blood, He -A, hobo, Juan, mdg1, opus, oo and Ti an elemen s, a day 1, 2, 3 and 4 a e empe a u e change. Blood, mdg1, opus, oo and Ti an a e e o ansposons wi h LTRs (LTR elemen s), HeT-A and Juan a e e o ansposons wi hou LTR sequences (non-LTR elemen s), hobo is a DNA elemen . We assessed he e ec o empe a u e and ime (ca ego ical ixed a iables) using linea models wi h dependen a iable ( ela i e TE exp ession) in loga i hmic scale. The e ec o empe a u e a each ime poin was es ed using leas -squa es means (p<0.05). S a is ical signi ican compa isons ob ained om his analysis a e highligh ed in he boxplo s. We also assessed he e ec o ime (con inuous ixed a iable) in TE exp ession (loga i hmic scale) by using linea models (TEs wi h exp ession ha is a ec ed by he age o emales: Juan, es ima e=-0.185, p- alue=0.002; Ti an , es ima e=- 0.430, p- alue=0.0003). Each ci cle in he boxplo s ep esen s a pool o eigh pai s o o a ies; iangles co espond o he mean, and black line o he median. B0..9 =(%!> A.B. ?<1/ @97# .*<, +.. %-+1/2 !" !# $ # !" !# $ # %&'()*+(,,-./'+(012-3('2.'4*05"'60.78 91:'# 91:'" 91:'5 91:'; 91:'# 91:'" 91:'5 91:'; 91:'# 91:'" 91:'5 91:'; 91:'# 91:'" 91:'5 91:'; 25ºC 29ºC p<0.05 p<0.05 p<0.05 p<0.05 LTR elemen LTR elemen LTR elemen LTR elemen LTR elemen non-LTR elemen non-LTR elemen DNA elemen ! 130! Supplemen a y Figu e 3.4. E ec o Wolbachia and empe a u e on TE exp ession o RAL-021, RAL-237, RAL-321 and RAL-790. Rela i e exp ession o blood, mdg1 and oo e o ansposons, in RAL-021, RAL-237, RAL-321 and RAL-790 o a ies. We es ed he e ec o Wolbachia, empe a u e and he in e ac ion be ween bo h (ca ego ical ixed a iables) in ela i e TE exp ession using linea models wi h logno mal dis ibu ion. Da a o each TE and gene ic backg ound was analyzed sepa a ely; s a is ically signi ican ac o s a e shown in boxplo s wi h espec i e p- alues. When he in e ac ion be ween Wolbachia and empe a u e was s a is ically signi ican ( o he case o blood and mdg1 exp ession in RAL-321) we used leas -squa es means (lsmeans) o es o he e ec o Wolbachia a each empe a u e. In ha case, colo ed lines ep esen s a is ically signi ican e ec s o Wolbachia. Each ci cle in he boxplo s ep esen s a pool o eigh o a y pai s; iangles co espond o he mean and black line o he median. Blood and mdg1 a e exp essed in he ge mline and soma ic issue o o a ies whe eas oo is only exp essed in he ge mline (see Supplemen a y Figu e 2.3 o mo e de ails). !"##$ %$&' (## )*+),-.(,//0#1)(,"2304,)3#)!"#$%)5"#&6 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 25ºC 29ºC 21ºC ABC8;@= ABC8@;' ABC8=D< 8: 8; < ; 8= 8> 8? 8: 8@ 8; 8= 8> 8? 8: 8@ 8; 7#"!8 7#"!9 7#"!8 7#"!9 7#"!8 7#"!9 ABC8<;' 8@ 8; 8' < ' ; 8; < ; : < ; : > )*+),-.(,//0#1)(,"2304,)3#)&'")5"#&6 Wolb p=8.8e-04 Temp p=5.9e-06 Wolb*Temp p=0.03 Wolb p=3.6e-05 Temp p=0.14 Wolb*Temp p=0.04 Wolb p=0.52 Temp p=2.9e-04 Wolb*Temp p=0.14 Wolb p=5.1e-04 Temp p=7.8e-06 Wolb*Temp p=0.21 Wolb p=0.38 Temp p=0.002 Wolb*Temp p=0.90 Wolb p=0.04 Temp p=7.97e-06 Wolb*Temp p=0.61 ! 131! Supplemen a y Figu e 3.5. E ec o Wolbachia and empe a u e on he exp ession o CG15279. Rela i e exp ession o CG15279 in RAL-021, RAL-237, RAL-321 and RAL- 790 o a ies. We es ed he e ec o Wolbachia, empe a u e and he in e ac ion be ween bo h ac o s (ca ego ical ixed a iables) in ela i e exp ession using linea models wi h logno mal dis ibu ion. Da a o each gene ic backg ound was analyzed sepa a ely; s a is ically signi ican ac o s a e shown in boxplo s wi h espec i e p- alues. Each ci cle in he boxplo s ep esen s a pool o eigh o a y pai s; iangles co espond o he mean and black line o he median. !" !# !$ !% !& !' >?@!'&" >?@!&'< >?@!"A= !"#$%&' ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, ()*+! ()*+, 25ºC 29ºC 21ºC -./01223)4501*6738157)5()*+%59*):; >?@!='< !& !' !< = < ' -./01223)4501*6738157)5,-)59*):; Wolb p=0.55 Temp p=0.08 Wolb*Temp p=0.01 Wolb p=0.04 Temp p=6.89e-05 Wolb*Temp p=0.30 Wolb p=0.04 Temp p=1.75e-04 Wolb*Temp p=0.15 Wolb p=5.51e-04 Temp p=0.01 Wolb*Temp p=0.11 ! 132! Supplemen a y Figu e 3.6. T ansc ip ion ac o exp ession. Exp ession o CREB, do sal, E2F1, o k head, Pebbled, cap-n-colla , PAX-6, slow bo de cells and se en up ansc ip ion ac o s in esponse o se e al en i onmen al pe u ba ions (cold, hea , cadmium, coppe , zinc, e hanol, ca eine, pa aqua , o e one and Sindbis i us) (A). Exp ession o ansc ip ion ac o s in o a ies collec ed om ma ed emales (B). Exp ession in esponse o en i onmen al s imuli was ob ained om modENCODE ea men exp ession da a67; exp ession in o a ies was acqui ed om modENCODE issue exp ession da a67. No exp ession, 0-3 eads; low exp ession, 4-10 eads; mode a e exp ession, 11-25 eads; mode a ely high exp ession, 26-50 eads; high exp ession, 51-100 eads. !"#$% &'()*+% #,-.% /'(0%12*&% 3244+2&% 5*67875'++*(% 39:7;% )+'<%4'(&2(% 52++)% )2=28%>6% !"#$%&'($)*+,-.!,/.)$01+,223"/)(-.- !'+& ?2*@ !*&AB>A !'662( CB85 #@1*8'+ !*//2B82 3*(*D>*@ "'@2@'82 EB8&4B)%=B(>) !"#$% &'()*+% #,-.% /'(0%12*&% 3244+2&% 5*67875'++*(% 39:7;% )+'<%4'(&2(% 52++)% )2=28%>6% !"#$%&'($)*3224,)$01+,223"/)(-.- F=*(GH%A*@2& I'&2(*@2%2J6(2))B'8 I'&2(*@2+G%1BK1%2J6(2))B'8 ?BK1%2J6(2))B'8 L'<%2J6(2))B'8 ! 133! Supplemen a y Table 3.1. P ime s used o qPCR Ta ge Fo wa d p ime sequence Re e se p ime sequence Re blood AACAATAGAAAGAAGCCACCGAAC AGTCATGGACTATTGAGGGTGTT G 68 He -A CGCGCGGAACCCATCTTCAGA CGCCGCAGTCGTTTGGTGAGT 69 hobo CATTAAGTCGGAAGGCCAAA CTTGCTCTTCCGCTATCCAC Juan GGGGCAAAATTCTCAATGAA GCGGAATATATGTGGGTTGC mdg1 GTCAGAAGGAGGCCATTCAGGAATTT GTTGCTGGCGGTTTCTGTTATTGT CAA 70 opus CGAGGAGTGGGGAGAGATTG TGCGAAAATCTGCCTGAACC 7 oo CGTCTGCAATGTACTGGCTCT CGGCACTCCACTAACTTCTCC 7 Ti an AAATGTTTGCCCCATCTCAG GGGTCAGTGTGGCGTTATTT CC15279 TCGTCTATCCAAATTGGTCTTACTC AATGGCCACGATCATCCA Rpl32 ATGCTAAGCTGTCGCACAAATG GTTCGATCCGTAACCGATGT Tbp GGCAAAGAGTGAGGACGACT GAGCCGACCATGTTTTGAAT 44 Re , e e ence Supplemen a y Table 3.2. P ime s used o con i m TE inse ions Ta ge Fo wa d p ime sequence Re e se p ime sequence Ac 42A ATATAACGCCGCTCGTTCTC ATCTCGCCTGAGCTCTACCA CG10073 TTACGTTTGGACGTGGTTGA CCATTCACACCACGTTTGTC CG11319 TGACAACGATGAGGAACCAA ATCGTCCCTGGTGTAGATCG CG17883 CCCTCCACACCAGTTTTCTT CAGTCACATGGTTCGATTGG CG2022 TGACACGTTTTTCAGGGATG GCGGGTAGAGATTATGCCTTA CG31751 CCGTTAGGCTTTTCCGTTTT TTTTGTTTGCGATCATCTCG CG31974 AACAAGGCGCTAATTCGATG AAGAACACGGGTGCAAAAAC CG33966 ATGTCGATGTGGACAAAGCA ATGAGACCAGCAGCTCGATT CG4374 CGCCTTGATGTCGATCTTCT TGCTTCACCAGTTCCAATGA CG5210 AGAGGACTCGTCGTGGCTAA GTGCTGCATGTTGGCTTAAA CG5440 ACGGCACGATAAAGAAAAGG ATGATCGTCGAGGTCCACTC CG5681 TGAACGGATGTCCAAGTCAA CCCCTGCACCATGATTAGTT CG8920 TATTGGGCCTTTCGAATCTG GGATTGGTTCTGCCATGTCT CG9194 CGACCTCCAAACATTTTCGT AGCAGATGGCAGCTACACAG Dg GTTTCTTCGGCACATCACCT CAACTGCGGAATGAGACTGA dnc AAATGCAACACTTGCCTTCC CACTTCCGATTTCGTTGGTT Fas2 AGACGGTCGGTGAAACTTTG GTTCATTCTTCCGCTTCTGC ! 141! Chap e IV TE esponse o s ess ul condi ions is dependen on he ype o s ess and Wolbachia s a us: a s udy o he e ec o empe a u e, cadmium and oxida i e s ess ! 143! 4.1 Abs ac En i onmen al pe u ba ions educing i ness – s ess ul condi ions1 – a e uni e sal o all na u al habi a s. Upon exposu e o h ea s, popula ions can bene i om esponses ha inc ease gene ic a ia ion2,3, including hose d i en by ansposi ion4,5. Despi e g owing e idence ha sugges ansposable elemen s (TEs) as impo an media o s o adap i e gene ic a ia ion6–8, he en i onmen al ac o s ha in luence mobiliza ion emain poo ly unde s ood9. He e, we aimed a s udying he impac o di e en en i onmen al cues, including bio ic and abio ic ac o s, on ansposi ion in he ge mline. We exposed D osophila melanogas e adul emales o s ess ul condi ions ha included se e al empe a u es, le els o oxida i e s ess and doses o hea y me al. We hen assessed exp ession o i e TEs (blood, Juan, pogo, oo and Ti an ) in o a ies. Gi en he abili y o Wolbachia o a ec many aspec s o hos biology, and o sp ead in na u al popula ions by ma e nal ansmission10–12, we u he assessed he impac o his endosymbion in a ec ing TE esponse o he a o emen ioned abio ic ac o s. We obse ed ha TE ansc ip ion le els depended on he en i onmen , Wolbachia s a us, and TE analysed. Al hough TE esponses o oxida i e s ess we e no obus and had signi ican di e ences be ween independen expe imen s, we obse ed obus esponses o blood and Ti an o changes in empe a u e, and o Juan and Ti an o cadmium. We p opose ha he main ep esso o TE ac i i y in he ge mline ( he piRNA pa hway) is no a ec ed by en i onmen al pe u ba ions and con ols he ac i i y o mos mobile elemen s, whe eas ew ansposons would speci ically espond o pe u ba ions (namely by e ec s in he ac i i y o ansc ip ion ac o s). This en i onmen -speci ic TE ac i i y in o a ies ha esul ed in new ansposon inse ions ansmi ed o he nex gene a ion may p oduce gene ic a ia ion ha is adap i e o he inducing en i onmen . 4.2 In oduc ion Wild popula ions a e o en exposed o en i onmen al pe u ba ions ha can shape e olu ion by ac ing as agen s o na u al selec ion, in ol ed in he so ing ! 144! o gene ic a ia ion ha esul s in ans-gene a ional changes in allelic equencies, and as ac o s in luencing he p oduc ion o no el gene ic a ia ion, h ough e ec s on ecombina ion13,14 o mu a ion a es2,3. Despi e g owing e idence ha ansposable elemen s (TEs) cons i u e an impo an sou ce o adap i e gene ic a ia ion6–8, li le is known abou he en i onmen al ac o s ha in luence TE mobiliza ion9. Mos o he in o ma ion ega ding he egula ion o mobile elemen s in me azoan species desc ibes a conse ed pa hway ha con ols TE ac i i y in he ge mline15. Those o ganisms speci ically ep ess TEs by p oducing small RNAs homologous o TE sequences and ha in e ac wi h PIWI amily p o eins (piRNAs)15. In e es ingly, ecen s udies e ealed commonali ies be ween he mechanisms ha con ol TE ac i i y and he pa hways igge ed in sub-op imal condi ions16. Those included he induc ion o hea shock esponses and he piRNA pa hway ha ails o con ain TE ac i i y in he absence o Hsp90 (a hea shock p o ein in ol ed in p o ein olding)17–19. As many en i onmen al changes esul in mis olded p o eins20, i is concei able ha , in s ess ul condi ions, he ec ui men o chape ones such as Hsp90 o mis- olding co ec ion, would esul in elaxed piRNA su eillance and in inc eased ansposon ac i i y. I his happens, we should see de egula ion o di e en TEs, including e o ansposons and DNA elemen s21. In his wo k, we aimed a s udying he impac o se e al en i onmen al cues, including bio ic and abio ic ac o s, on he ac i i y o e o ansposons and DNA elemen s in he ge mline o D osophila melanogas e . We also assessed whe he ou challenges could a ec he piRNA pa hway. D. melanogas e is able o colonize di e se habi a s22 and ha e adap ed o se e al bio ic and abio ic s esses known o igge hea shock esponses and o p oduce excessi e amoun o eac i e oxygen species (ROS)23–25. These en i onmen al condi ions include in ec ion10,26,27, empe a u e pe u ba ion 28–30 and exposu e o hea y me als31. We he e o e decided o e alua e TE exp ession a e exposu e o di e en ypes o en i onmen al pe u ba ion ha included empe a u e changes as well as exposu e o an oxidan agen and an ! 145! hea y me al. Also, gi en ha Wolbachia – a bac e ial symbion common in insec s – is able o in luence many aspec s o hos biology, and o sp ead in na u al popula ions by ma e nal ansmission10–12, we assessed he impac o he p esence o his endosymbion on TE esponse o he abio ic ac o s. Those e ec s we e es ed in ui ly o a ies, because ansposi ion occu ing in he ge mline can add o he i able gene ic a ia ion in a popula ion. We obse ed ha ansposon ac i i y is en i onmen -speci ic, and sugges ha empe a u e, and inges ion o cadmium, may in luence abili y o p oduce he i able gene ic a ia ion by changes in TE exp ession. In addi ion, and con a y o ou expec a ions, piRNA pa hway seems o be obus o en i onmen al change, and keep con olling he bulk o mobile elemen s, while only ew speci ic TEs espond o pe u ba ions. We discuss ha ansc ip ion ac o s ela ed wi h pa icula pa hways igge ed by en i onmen al change migh di ec ly a ec TE ac i i y, and ha Wolbachia may play an impo an ole in a ec ing ansposon sensi i i y o ac i a ion. 4.3 Ma e ials and Me hods D osophila melanogas e s ocks and main enance All expe imen s we e done in a gene ic backg ound esul an om a c oss be ween Ha wich emales (wi h and wi hou Wolbachia) and w[1118] males ( ee o Wolbachia). w[1118] and Ha wich s ocks we e p o ided by Luís Teixei a. Ha wich lies we e na u ally in ec ed wi h wMel Wolbachia s ain. To ob ain a Ha wich line ee o in ec ion, we ea ed lies wi h e acycline (0.05mg/ml added o hei ood), o wo gene a ions. Gu lo a con en was homogenized be ween e acycline ea ed and non- ea ed lies, as p e iously desc ibed32. We c ossed SpnE616/TM3 and SpnE100.37/TM3 lies (p o ided by Ví o Ba bosa) o ob ain a posi i e con ol (SpnE616/ SpnE100.37) and nega i e con ols (SpnE616/TM3 o SpnE100.37/TM3) o Bicaudal-D agg ega e o ma ion in o a ies. We kep lies in s anda d co nmeal ood33 a 25°C, 60% humidi y and 12h-12h day-nigh cycles, unless o he wise men ioned. ! 146! Tempe a u e, cadmium and oxida i e s ess ea men Fo empe a u e, cadmium and oxida i e s ess ea men s we collec ed eigh - hou -old lies (wi h o wi hou Wolbachia) and kep i e emales wi h wo males pe ial, a 25ºC. A e h ee days, males we e emo ed, emales ans e ed o new ubes, and placed in all di e en expe imen al condi ions. Females we e hen kep a each expe imen al condi ion o ou days (Supplemen a y Figu e 4.1). Fo empe a u e ea men s, emales we e placed ei he a 21ºC, 25ºC o 29ºC. Fo exposu e o hea y me als, lies we e ed wi h one o h ee di e en doses o cadmium (0mM, 0.05mM, o 0.1mM), and o exposu e o oxida i e s ess-inducing condi ions, emales we e ed wi h di e en doses o pa aqua (0mM, 1.25mM, o 2.5mM), a commonly used d ug o igge he p oduc ion o ROS34. Cadmium and pa aqua solu ions (Sigma) we e di ec ly mixed in he ly ood. To con i m ha emales ed, we included 2% o blue ege able colo ing in he ood and checked o he p esence o blue colo in he ly abdomen and gu s. We assessed ecundi y (numbe o eggs laid pe emale) a day ou a e en i onmen al pe u ba ion o es whe he changing empe a u e, exposing lies o hea y me al doses (cadmium) o o an oxidan agen (pa aqua ) a e s ess ul o D. melanogas e emales (wi h o wi hou Wolbachia) (Supplemen a y Figu e 4.1A). Also, a e ou days o exposu e o each expe imen al condi ion, o a ies we e dissec ed o RNA ex ac ion o assessmen o TE exp ession (see below and Supplemen a y Figu e 4.1B). To con i m e ec o empe a u e on TE copy numbe in he nex gene a ion, we collec ed emb yos laid on day ou a e empe a u e change, o genomic DNA (gDNA) ex ac ion (see below and Supplemen a y Figu e 4.1C). RNA ex ac ion and cDNA syn hesis O a ies we e dissec ed in esh cold PBS 1x, and di ec ly s o ed a 4ºC in 400µl T izol (Ambicon) un il homogeniza ion using pes els ha was done in he same day. Be o e homogeniza ion we polled 8-10 pai s o o a ies pe sample, and used 6-8 eplica es pe condi ion, pe expe imen . Homogenized samples we e s o ed a -80ºC un il RNA ex ac ion. Fo RNA ex ac ion we used Di ec -zol RNA ! 147! Minip ep ki (Zymo Resea ch), and o al RNA was elu ed in 25µl o RNase- ee wa e (Sigma). RNA pu i y and concen a ion o each sample, was measu ed wi h Nanod op ND-1000 Spec opho ome e ; A260/A280 abso bance was a ound wo o all samples, and concen a ions anged om 200 o 1000ng/µl. All RNA samples o each expe imen we e p ocessed on he same day. We cleaned 1µg o RNA om gDNA con amina ion, using DNAse (P omega) ea men , ollowing manu ac u e ʼs ins uc ion. Fo cDNA syn hesis, we ollowed Re e se T ansc ip ion Sys em (P omega) ins uc ions, using 0.02µM o Oligo dT p ime s. Reac ion was incuba ed a 42°C o 60min, and hea ed a 95°C o 5min. cDNA was hen dilu ed in RNAse- ee wa e (1:10) and s o ed a -20°C un il quan i a i e eal- ime PCR (qPCR). gDNA ex ac ion gDNA om emb yos was ex ac ed using DNeasy Blood & Tissue Ki (Qiagen). Fo each sample, we pooled all eggs laid by a g oup o 20 emales (Supplemen a y Figu e 4.1), six eplica es pe condi ion. Tissues we e homogenized in 180µl o bu e ATL, using pes els. We used 200µl o bu e AE o elu e gDNA and ea ed all samples wi h 0.2mg/ml o RNAse (In i ogen) o 20 min a 55ºC. gDNA concen a ion was measu ed in Nanod op ND-1000 Spec opho ome e , and samples s o ed a -20°C, un il qPCR. qPCR We measu ed le els o TE exp ession and TE copy numbe by qPCR: CFX384 (BioRad) o ABI Quan S udio-384 (Applied Biosys ems) he mal cycle s. Fo each eac ion we used 5µl o iQ™ SYBR® G een supe mix (BioRad), 0.4µM p ime s, 4µl o dilu ed cDNA (1:10) o gDNA (4ng/µl). We assessed he exp ession o i e TEs (blood, Juan, pogo, oo and Ti an ) and h ee con ol genes (Rpl32, Tbp and asa). P ime sequences a e desc ibed in Supplemen a y Table 4.1. We an wo echnical eplica es pe sample, pe pla e. The he mal cycling p o ocol was he same o all eac ions: 2 min a 50°C; 10 min a 95°C; 40 cycles o 95°C o 30s, 60°C o 1 min and 72°C o 30s. ! 148! In each pla e we an eac ions on se ial dilu ions o known a ge amplicon concen a ions o build s anda d cu es. To ob ain s anda ds, we ampli ied a ge egions o each p ime pai (Supplemen a y Table 4.1) by PCR using 0.25U o GoTaq (P omega), 1x eac ion bu e , 1.5mM MgCl2, 0.4µM p ime s and 1µl o cDNA (1:10). PCR p oduc s we e cleaned using NucleoSpin® Gel and PCR Clean-up (Mache ey-Nagel), and elu ed in 15µl o bu e NE. We measu ed concen a ions in Nanod op ND-1000 Spec opho ome e , and did 13 se ial dilu ions (1:5) om 0.125ng/µl un il 6.4e-10ng/µl. Fo each p ime pai , we es ima ed he minimum amoun o nucleic acids de ec able by qPCR by ex ending dilu ions o ou s anda ds un il he ela ionship be ween he known amplicon concen a ions and he quan i ica ion cycles (Cqs) eached a pla eau. We used de aul h eshold se ings o he qPCR machines o ob ain he Cq o each eac ion. Cq alues o all a ge s and expe imen al samples we e wi hin he linea ampli ica ion. We ans o med Cq alues in o absolu e a ge amplicon concen a ions using he espec i e s anda d cu es. This me hodology allowed us o con ol o pla e e ec s and p ime e iciency. qPCR mel ing cu es we e analyzed o con i m speci ici y o ampli ied p oduc s, and nega i e con ols ne e showed de ec able ampli ica ion. Fo he analysis o exp ession da a, we used No mFinde 35 and geNo m36 algo i hms o check exp ession s abili y o wo e e ence genes commonly used o calcula e ela i e gene exp ession a di e en en i onmen al condi ions, Rpl32 and Tbp37,38. We also es ed asa exp ession s abili y, which is a ge mline- speci ic gene39. Fo bo h algo i hms used, s abili y alues ob ained o asa (No mFinde , 0.39; geNo m, 0.84) we e be e han hose o Rpl32 (No mFinde , 0.57; geNo m, 0.95) and Tbp (No mFinde , 0.69; geNo m, 1.09). Howe e , asa exp ession in he second expe imen o Pa aqua ea men s is mo e a iable han ha obse ed o Rpl32 and Tbp (Supplemen a y Figu e 4.2). We he e o e decided o use Tbp (No mFinde , 0.46; geNo m, 0.40) as e e ence gene o ha da ase ins ead o asa (No mFinde , 0.81; geNo m, 0.62) o Rpl32 (No mFinde , 0.63; geNo m, 0.47). The median o ela i e exp ession in con ol samples (25ºC, 0mM o cadmium, o 0mM o pa aqua ), ! 149! ee o Wolbachia, was used o calib a e each ea men ( empe a u e, cadmium and pa aqua ) pe expe imen and ansposon (P a l me hod)40. To assess TE copy numbe in he genomic DNA o emb yos, we used Rpl32 (a known single copy gene) as e e ence. An ibody s aining o o a ies O a ies we e dissec ed in esh cold PBS 1x, and ixed in 200µl o 3.2% o maldehyde (Sigma), 0.5% NP40 (Sigma) dilu ed in PBS 1x, and 600µl o hep ane (Sigma) o 20 min wi h gen le (400 pm) shaking. To a oid unspeci ic an ibody (Ab) binding and pe meabilize issues, o a ies we e kep o 1 hou a 400 pm, in 1% BSA (Sigma), 0.01% T i onX (Sigma) dilu ed in PBS 1x. We hen added a cock ail o an i-Bicaudal-D 4C2 (1:10) and an i-Bicaudal-D 1B11 (1:10) (De elopmen al S udies Hyb idoma Bank) solu ions and incuba ed o e nigh a 4ºC. Alexa488 an i-mouse was used as seconda y Ab, and dilu ed (1:500) in PBS 1x, con aining 0.2% Tween (Sigma) (PBT). O a ies we e kep in ha solu ion o 2 hou s, in he da k a 400 pm. Nuclei we e hen s ained wi h To o-3 (1:500) o 7 min in he da k. We pe o med washes wi h PBT be ween all s eps men ioned abo e; las washes o he p o ocol we e done wi h PBS. All p o ocol was pe o med a oom empe a u e, unless s a ed o he wise. O a ies we e moun ed in glyce ol, and images acqui ed in Leica SP5 in e ed con ocal. S a is ical analyses All s a is ical analyses we e done in R ( e sion 3.2.1). To es he e ec o abio ic ac o s ( empe a u e, cadmium and pa aqua ) and Wolbachia s a us (ca ego ical ixed a iables) on ecundi y, we used gene al linea models wi h nega i e binomial dis ibu ion (glm.nb). The in e ac ion be ween ea men and p esence o Wolbachia was included in he analysis; each abio ic ac o was analyzed sepa a ely. Gi en ha Wolbachia s a us was ne e a ac o con ibu ing o explain he da a, we hen assessed di e ences be ween ea men s using non-pa ame ic Wilcoxon ank es . Fo empe a u e ea men s (21ºC, 25ºC and 29ºC) we pe o med all pai wise compa isons