Mechanisms of antifungal resistance in pathogenic yeasts: evaluation of the in vitro and in vivo expression

M ECHANISMS OF A NTIFUNGAL R ESISTANCE IN P ATHOGENIC Y EASTS : EVALUATION OF THE IN VITRO AND IN VIVO EXPRESSION Ana Sofia da Quinta e Costa Neves de Oliveira Morais Porto 2012 Dissertação de candidatura ao grau de Doutor em Biomedicina, apresentada à Faculdade de Medicina da Universidade do Porto Programa Doutoral em Biomedicina O presente estudo decorreu no Serviço e Laboratório de Microbiologia da Faculdade de Medicina da Universidade do Porto, Portugal. Orientação Professora Doutora Cidália Irene Azevedo Pina Vaz Co-orientação Professor Doutor Acácio Agostinho Gonçalves Rodrigues Júri da Prova de Doutoramento em Biomedicina Presidente Reitor da Universidade do Porto Vogais Doutora Emília Canton Lacasa, Investigadora do Centro de Investigação do “Hospital Universitari i Politècnic la Fe”, Valencia Doutora Teresa Maria Fonseca Oliveira Gonçalves, Professora Auxiliar da Faculdade de Medicina da Universidade de Coimbra Doutor José António Martinez Souto de Oliveira, Professor Catedrático da Faculdade de Ciências da Saúde da Universidade da Beira Interior Doutor Daniel Filipe de Lima Moura, Professor Catedrático da Faculdade de Medicina da Universidade do Porto Doutora Cidália Irene Azevedo Pina Vaz, Professora Associada da Faculdade de Medicina da Universidade do Porto Doutora Isabel Alexandra Marcos Miranda, Investigadora da Faculdade de Medicina da Universidade do Porto Artigo 48, Parágrafo 31: “A Faculdade não responde pelas doutrinas expendidas na Dissertação.” (Regulamento da Faculdade de Medicina da Universidade do Porto/ Decreto Lei nº 19337, de 29 de Janeiro de 1931) Apoio financeiro da Fundação para a Ciência e a Tecnologia (FCT) do Ministério da Ciência, Tecnologia e Ensino Superior (Bolsa de Doutoramento SFRH/ BD/ 27662/ 2006) . À MINHA FAMÍLIA "O valor das coisas não está no tempo que elas duram, mas na intensidade com que acontecem. Por isso existem momentos inesquecíveis, coisas inexplicáveis e pessoas incomparáveis." Fernando Pessoa VIII. Ricardo E, Costa-de-Oliveira S, Dias AS, Guerra J, Rodrigues AG, Pina-Vaz C. Ibuprofen reverts antifungal resistance on Candida albicans showing overexpression of CDR genes. FEMS Yeast Research 2009; 9:618-25. IX. Pinto e Silva AT, Costa-de-Oliveira S, Silva-Dias A, Pina-Vaz C, Rodrigues AG. "Dynamics of in vitro acquisition of resistance by Candida parapsilosis to different azoles. FEMS Yeast Research 2009; 9:626-33. X. Araujo R, Costa-de-Oliveira S, Coutinho I, Rodrigues AG, Pina-Vaz C. Evaluating the resistance to posaconazole by E-test and CLSI broth microdilution methodologies of Candida spp. and pathogenic moulds. European Journal of Clinical Microbiology and Infectious Diseases 2009; 28:1137-40. XI. Araujo R, Carneiro A, Costa de Oliveira S, Pina Vaz C, Rodrigues AG, Guimarães, JE. Fungal infections after haematology unit renovation: evidence of clinical, environmental and economical impact. European Journal of Haematology 2008; 80: 436-43. XII. Sofia Costa-de-Oliveira, Isabel Marcos Miranda, Ana Silva-Dias, Cidália Pina-Vaz, Helder Pinheiro, Daniel Moura, Dominique Sanglard, Acácio G. Rodrigues. Adrenaline stimulates efflux pumps activity, growth and mitochondrial respiration in Candida albicans. (submitted) XIII. Sofia Costa-de-Oliveira, Isabel Marcos Miranda, Elisabete Ricardo, Ana SilvaDias, Cidália Pina-Vaz, Acácio G. Rodrigues. In vivo synergistic effect between ibuprofen and fluconazole in Candida albicans. (submitted). XIV. Sofia Costa-de-Oliveira, Ana P. Silva, Isabel M. Miranda, Alexandre Salvador, Maria M Azevedo, Carol A. Munro, Acácio G. Rodrigues, Cidália Pina-Vaz. Determination of chitin content in fungal cell wall: an alternative flow cytometric method. (submitted) Abstracts I. Costa-de-Oliveira S, Miranda IM, Ricardo E, Silva-Dias A, Rodrigues AG, Pina-Vaz C. Effective reversion of fluconazole resistance by ibuprofen in an animal model. Clin Microb Infect 2012. (in press) II. Costa de Oliveira S, IM Miranda, A Silva-Dias, C. Pina Vaz, D. Moura, AG Rodrigues. Adrenaline enhances yeast cell growth and ATP production through a common target to mammalian cells. Mycoses 2011; 54:166. III. Costa-de-Oliveira S, AP Silva, IM Miranda, A Salvador, MM Azevedo, CA Munro, AG Rodrigues and C Pina-Vaz. Easy quantification of yeast chitin cell wall content by flow cytometry. Mycoses 2011; 54:166. IV. Silva A., Costa de Oliveira S., Miranda I, Pina Vaz C, Rodrigues AG. Fungaemia by Candida parapsilosis: in vivo induction of azole resistance due to prolonged therapeutic exposure. Clin Microbiol Infect. 2010; 16: S216. List of abbreviations ABC Adenosine triphosphate Binding Cassette ADR Adrenaline AIDS Acquired Immune Deficiency Syndrome AMB lipo Amphtericin B Lipid Complex AND Anidulafungin AOX Alternative Oxidase ARE Azole-Responsive enhancer ARP Alternative Respiratory Pathway CaR Candida albicans azole resistant induced strain CaS Candida albicans azole susceptible CDC Centre of Disease Control and Prevention CDR Candida Drug Resistance CFS Caspofungin CFU Colony Forming Unit CFW Calcofluor White Chr5 Chromosome 5 CLSI Clinical Laboratory Standards Institute CyA Clyclosporine A Cyp Cyclophilin DHR 123 Dihydrorhodamine 123 DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid dNTP Deoxyribonucleotide Triphosphate DST Diploid Sequence Type EC50 Half Maximal Effective Concentration ECV Epidemiological Cutoff Value ED50 Half Maximal effective Dose FC Flow Cytometry FIC Fractional Inhibitory Concentration FIX Fractional Inhibitory Index FK 506 Tacrolimus FLC Fluconazole GPCR G Protein-Coupled Receptor GPI Glycosylphosphatidylinositol GTP Guanosine Triphosphate HOG High Osmolarity Glycerol Response HS Hot Spot HSP Heat Shock Protein Ibu Ibuprofen ICU Intensive Care Unit ITC Itraconazole LOH Loss of Heterozygosity MAP Mitogen-Activated Protein MCA Micafungin MDR Multi Drug Resistance MF Major Facilitator MFS Major Facilitator Superfamily MIC Minimal inhibitory Concentration MLC Minimal Lethal Concentration MLP Microsatellite Length Polymorphism MLST Multilocus Sequence Typing MTL Mating-Type Locus NCCLS National Clinical Collaborative Laboratory Standards NS Non-Susceptible NSAID Non-Steroidal anti-inflammatory Drug PAS Periodic Acid-Schiff PBS Phosphate Buffer Saline PCR Polymerase Chain Reaction PDR Pleiotropic Drug Resistance P-gp Permeability Glycoprotein Phe Phenylalanine PKC Protein Kinase C Pro Proline PSC Posaconazole R Resistant RAPD Randomly Amplified Polymorphic Deoxyribonucleic acid REA Restriction Endonuclease analysis Rh-6G Rhodamine 6G RNA Ribonucleic Acid ROS Reactive Oxygen Species S Susceptible S-DD Susceptible Dose Dependent Ser Serine SHAM Salicylhydroxamic Acid SI Staining Index VRC Voriconazole YBC Yeast Biochemical Card YPD Yeast Peptone Dextrose List of Tables and Figures Chapter I Introduction Figure 1Principal mechanisms of azole resistance by minimizing the impact of the drug in the cell. Figure 2Mechanisms of echinocandin resistance and tolerance. Figure 3Risk factors that contribute to clinical resistance. Chapter III Results Part I. Genetic relatedness and antifungal susceptibility profile of Candida albicans isolates from fungaemia patients Table 1Candida albicans isolates from blood cultures and from other body sites obtained from 12 patients and respective multilocus genotyping results . Figure 1Schematic representation of patients clinical data and genetic relatedness of C. albicans strains. Part II. Determination of chitin content in fungal cell wall: an alternative flow cytometric method Table 1In vitro antifungal susceptibility and paradoxical effect of caspofungin (CFS) against Candida spp and Cryptococcus neoformans clinical isolates. Figure 1Cell wall chitin content of reference and chs3Δ/chs3Δ, pga62Δ/Δ and pga31Δ/Δ strains. Figure 2Cell wall chitin content of Candida spp and Cryptococcus neoformans clinical isolates in the absence and presence of caspofungin. Part III. FKS2 mutations associated with decreased echinocandin susceptibility of Candida glabrata following anidulafungin therapy Table 1Primers used for C. glabrata FKS1 and FKS2 HS1 amplification and sequencing. Table 2In vitro antifungal susceptibility of successive Candida isolates to amphotericin B (AmB), fluconazole (FLC), voriconazole (VRC), posaconazole (PSC), caspofungin (CAS), anidulafungin (AND) and micafungin (MCA), determined accordingly to the CLSI protocol. Table 3Mutations in HS1 of the FKS2 gene from C. glabrata clinical isolates. Figure 1Antifungal therapy administered to the patient. Figure 2Relative cell wall chitin content from susceptible (light grey) and nonsusceptible (dark grey) strains. Figure 3Random amplification of polymorphic DNA gel patterns of C. glabrata isolates 7-1, 9-2, 5-1 and 8-1 obtained with primers OPE-18 and OPA-18. Part IV. An alternative respiratory pathway on Candida krusei: implications on susceptibility and oxidative stress response Figure 1Effect of KCN and SHAM upon oxygen consumption by Candida krusei clinical strain (representative example). Figure 2Representative example of the presence of an AOX in Candida krusei. Figure 3Effect of fluconazole (FLC) and oxidative inductors (menadione – Men; plumbagin – Plumb; hydrogen peroxide – H 2 O 2 ) upon intracellular ROS accumulation by a clinical Candida krusei and a negative control strain Saccharomyces cerevisiae (S.c.), with or without the addition of SHAM. Figure 4Chronological life span of a C. krusei strain. Part V. Propofol lipidic infusion promotes resistance to antifungals by reducing drug input into the fungal cell Table 1Minimal fungicidal concentration (MFC) values of Candida strains to AMB (amphotericin B), FLC (fluconazole), ITC (itraconazole), VRC (voriconazole) and PSC (posaconazole), determined by CLSI protocols, in the absence and presence of propofol infusion. Figure 1Flow cytometric histograms representing the emitted fluorescence after 90 minutes. Figure 2Effect of propofol up on [ 3 H]-labelled itraconazole accumulation in antifungal susceptible strain C. albicans ATCC 90028. Part VI. Adrenaline stimulates efflux pumps activity, growth and mitochondrial respiration in Candida albicans Figure 1Effect of adrenaline (mixed α 1 , α 2 , β 1 and β 2 ), noradrenaline (mixed α 1 , α 2 and β 1 ) and isoprenaline (selective β 1 and β 2 ) upon FUN-1 staining. Figure 2Effect of adrenaline (adr) upon Rh-6G staining. Figure 3Effect of medetomidine (selective α 2 agonist) and phenylephrine (selective α 1 agonist) upon FUN-1clinical isolate staining. Figure 4Effect of adrenaline on wild-type and CDR1 and CDR2 mutants strains. Figure 5Effect of adrenaline upon cell receptor deleted strains. Figure 6Immunodetection of Cdr1p in C. albicans strain SC5314. Figure 7Effect of adrenaline (Adr) upon growth rate of C. albicans strain SC5314. Figure 8Effect of adrenaline upon oxygen consumption by C. albicans SC5314 strain. Part VII. In vivo synergistic effect between ibuprofen and fluconazole in Candida albicans Table 1Sequences of primers used in RT-PCR. Table 2Minimal inhibitory concentrations (MIC) and phenotypes of the Candida albicans parental susceptible (CaS) and resistant (CaR) strain after exposure to fluconazole (FLC) to FLC, voriconazole (VRC) and posaconazole (PSC) alone and in combination with subinhibitory concentrations of ibuprofen. Figure 1In vivo antifungal synergistic effect between fluconazole and ibuprofen against C. albicans systemic infection. Figure 2Effect of the combination of fluconazole plus ibuprofen on mice weight loss during C. albicans systemic infection. Figure 3Representative example of kidney histology slides of PAS-stained paraffin sections of kidneys recovered from mice infected with 5x10 5 cells/0.1 ml of C. albicans resistant (CaR) strain at day four post-infection. Figure 4C. albicans genes up-regulated and downregulated after fluconazole (FLC) exposure (C. albicans resistant - CaRFLC) in vitro comparatively to gene expression in unexposed cells (C. albicans susceptible parent strain-CaS) grouped according to their biological processes. Figure 5C. albicans genes up-regulated and down regulated after fluconazole (FLC) and ibuprofen exposure (CaRFLCIbu) comparatively to gene expression found in unexposed cells (C. albicans susceptible parent strain-CaS) grouped according to their biological processes. Figure 6Microarray analysis of the genes classically involved in antifungal resistance of the resistant strain (CaRFLC) and of the resistant strain following exposure to ibuprofen (CaRFLCIbu). Figure 7Quantitative real time PCR analysis of genes implicated in antifungal resistance whose expression was found to be altered in microarray assay. Content Chapter I Introduction Introduction ................................................................................................................................ 29 Epidemiology .............................................................................................................................. 31 Risk factors for candidaemia……………………….…………………………………………………………………………32 Antifungal agents: mechanisms of action ................................................................................... 35 Antifungal resistance mechanisms ............................................................................................. 37 Methods for assessing antifungal drug resistance……………………………………………………..…….…….43 Risk factors contributing to clinical resistance: patient versus yeast versus drugs………………….45 Strategies to defeat antifungal resistance……………………………………………………..……………….………48 Chapter II Aims Aims of the study ........................................................................................................................ 53 Chapter III Results Part I. Genetic relatedness and antifungal susceptibility profile of Candida albicans isolates from fungaemia patients ............................................................................................................ 57 Background ............................................................................................................................. 57 Material and methods…………………..…………………………………………………………………………………. 58 Results………………………………………………………………………..………..…………………………………………. 59 Discussion……………………………………………………………………………………………………………..…………..64 Part II. Determination of chitin content in fungal cell wall: an alternative flow cytometric method ....................................................................................................................................... 67 Background ............................................................................................................................. 67 Material and methods………………………………………………………………………………………………………. 68 Results and Discussion…………………………………………………………..…………………………………………. 69 Part III. FKS2 mutations associated with decreased echinocandin susceptibility of Candida glabrata following anidulafungin therapy .................................................................................. 75 Background ............................................................................................................................. 75 Case report………………………………………………………………………………………………………………………. 76 Material and methods………………………………………………………………………………………………………. 77 Results…………………………………………………………………………………..…………………………………………. 81 32 that they are more prevalent in elderly patients and with hematologic malignancies [52, 5961]. A prospective, observational study was conducted at a large Portuguese University hospital, aiming to evaluate the epidemiology of bloodstream fungal infection [7]. The incidence of fungaemia and nosocomial fungaemia during the year of 2004 were 2.7 and 2 per 1000 hospital admissions, respectively [7]. Thirty-five percent of yeast isolates were C. albicans followed by C. parapsilosis (25.6%). Mortality rate associated with fungemia was 39.3%; the highest values were found in patients yielding C. glabrata (78%), C. tropicalis (53%) and C. albicans (46%) infection [7]. Seventy-five per cent of the fungaemia episodes were nosocomial, with 48% mortality [7]. The main risk factors for an unfavourable fungaemia related outcome included concomitant therapy, the nosocomial origin of the infection and ICU stay [7]. In this study a high percentage (15%) of antifungal resistance was observed; 81% of fungaemia episodes due to resistant strains had been submitted to antifungal treatment (mostly with fluconazole) within the first episode of fungaemia (p=0.017) [7]. Attending to this picture, it was imperative to study the influence of the risk factors involved in patient clinical resistance (unfavourable outcome) in order to manage the high resistance found among us. This was the starting point of this thesis. Risk factors for candidaemia Colonization of the skin and mucous membranes and the alteration or disruption of natural host barriers, like wounds, surgery and the insertion of indwelling intravascular catheters are the main predisposing factors for Candida infections. Factors like broad-spectrum antibiotherapy, abdominal surgery, presence of central venous catheter, administration of parenteral nutrition and immunosuppressive therapy are the most important risk factors for candidaemia especially in ICU [7, 42, 45]. Among all admissions to the hospital, patients with underlying diseases such as hematologic malignancies or neutropenia, AIDS, extreme ages and those submitted to gastrointestinal surgery, are under an increased risk of 33 Introduction candidaemia [4, 7, 45, 47, 48]. In recent years a trend of increased candidaemia episodes in non-immunosuppressed patients admitted at ICU was registered [45, 62-64]. Among such patients, an important risk factor for the development of Candida bloodstream infection is the prolonged stay in the ICU; risk exponentially increases after a length of stay for 7 to 10 days [42, 63, 65]. The ICU setting provides Candida the idyllic opportunity for development of infection and subsequent transmission, attending to the fact that most patients are submitted to mechanical ventilation or placed central venous catheters and surgical drainage devices. Fungaemia by Candida spp in critical care patients is considered to have in most case an endogenous origin from the gastrointestinal tract [66]. Surveillance strategies have been implemented in order to identify ICU patients at high risk for candidaemia, who may benefit from antifungal prophylaxis or early empiric therapy [6769]. Ostrosky-Zeichner and co-workers have enrolled 2,890 patients who stayed for more than 4 days in the ICU in order to create a rule that identifies patients at high risk for invasive candidosis [69]. The clinical prediction rule for the early diagnosis of candidaemia in ICU patients used the combination of the following risk factors: any systemic antibiotic or presence of a central venous catheter and at least two of the following, total parenteral nutrition, any dialysis, any major surgery, pancreatitis, any use of steroids, or of other immunosuppressive agents [53]. In 2011 the prediction rule was improved and mechanical ventilation was considered important: mechanical ventilation and central venous catheter and broad spectrum antibiotics and one additional risk factor [70]. Hermsen et al recently applied this prediction rule to 352 patients and concluded that it is most useful for identifying patients who are not likely to develop invasive candidosis, potentially preventing unnecessary antifungal use, thus optimizing patient ICU care and facilitating the design of forthcoming antifungal clinical trials [71]. Understanding pathogen distribution and relatedness is essential for determining the epidemiology of nosocomial infections. Establishing clonality of pathogens can aid in the identification of the source (environmental or endogenous) of organisms and distinguish 34 relapse from reinfection. Many of the species that are hospital-acquired are also common endogenous commensal organisms, and therefore it is important to be able to determine whether the isolate recovered from a patient sample is a pathogenic strain a commensal or a contaminant strain unlikely to be the source of the infection. Molecular typing is a powerful tool in the armamentarium for combating the spread of infection in the hospital environment and to discover the routes of microbial transmission. Presently, Multilocus sequence typing (MLST) and microsatellite length polymorphism (MLP) are considered the most discriminatory typing methods for C. albicans. MLST typing is based on sequence analysis of DNA fragments from six housekeeping genes, ACC1, ADP1, GLN4, RPN2, SYA1, and VPS13 [72, 73]. MLST is the typing method more frequently used, mainly because it has a very high discriminatory ability, it has been optimized with a consensus scheme, and is the only typing method that has a public database (http://calbicans.mlst.- net/) where each diploid sequence type (DST) obtained can be deposited and compared with others already available in the database [74]. MLP typing is based on the PCR amplification of microsatellite sequences, defined as tandem repetitive stretches of two to six nucleotides. The PCR fragments obtained after amplification with primers flanking the microsatellite region differ in size according to the number of repetitions of the microsatellite stretch. This technique has been used in several studies addressing C. albicans genotyping [75-77]. Recently, the comparison between the ability of MLP and MLST in C. albicans typing and grouping indicated that the two methods show similar discriminatory abilities and a high correlation in the clustering of isolates [78]. Randomly amplified polymorphic DNA (RAPD) analysis is another robust typing tool, showing a high degree of discrimination in studies involving nosocomial transmission and microevolution, especially in C. glabrata infections [79]. Restriction endonuclease analysis (REA) of the mitochondrial DNA has been described as a valuable tool for Candida spp. characterization and has been recently used in order to discriminate between Candida clinical isolates [61, 80, 81]. 35 Introduction Antifungal agents: mechanisms of action The battery of clinical antifungal agents available is limited, in contrast to antibacterial drugs. Limits arise from the number of drug targets in fungi, which are heavily focused in the cell wall and plasma membrane. Nevertheless, pursuit for new cell targets, within the genomic era, has increased exponentially. Throw this section the main antifungal agents used for the treatment of candidaemia will be addressed. Polyenes The polyenes belong to a class of natural compounds with a heterocyclic amphipathic molecule (one hydrophilic charged side of the molecule and one hydrophobic, uncharged side). They target ergosterol in the fungal membrane by inserting into the lipid bilayers and creating pores that disrupt plasma membrane integrity, allowing small molecules to diffuse across the membrane resulting in cell death [82] . There are two main polyenes: amphotericin B and nystatin. Amphotericin B is still considered the gold standard in the treatment of most fungal infections, especially in severe invasive infections. However, amphotericin is toxic to mammalian cells, particularly causing nephrotoxicity. To overcome its toxicity a variety of reformulated versions have been introduced. Lipid formulations of amphotericin B are better tolerated than amphotericin B deoxycolate [83]. Although having a broad spectrum activity against most fungi, lipid formulations are very expensive, limiting the use to second-line or salvage therapy. Pyrimidine analogues 5-Fluorocytosine is the only representative of this class of antifungals. It acts through conversion to 5-fluorouracil by a cytosine deaminase, which is the incorporated into DNA and RNA, inhibiting cellular function and division [82]. Since most filamentous fungi lack cytosine deaminase, the spectrum of flucytosine is restricted to pathogenic yeasts. 5fluorocytosine is used in combination with other antifungal agents namely amphotericin B, rather than in monotherapy, because resistance develops at high frequency [82]. 36 Triazoles The triazoles are the largest class of antifungal drugs in clinical use and have been deployed for approximately two decades. They are heterocyclic synthetic compounds that inhibit the fungal cytochrome P450 14α-lanosterol demethylase, encoded by the ERG11 gene (also known as CYP51) which catalyzes the late step of ergosterol biosynthesis. The drugs binds through a nitrogen group in their five-membered azole ring to the heme group in the target protein and block demethylation of the C-14 of lanosterol, leading to the substitution of methylated sterols in the membrane. Inhibition of this enzyme results in decreased membrane ergosterol content and accumulation of toxic methylated intermediates, with resultant disruption of fungal cell membrane function, growth inhibition, and, in some cases, cell death [20, 84, 85]. Triazole antifungal activity is generally fungistatic against Candida spp., but fungicidal against Aspergillus. The triazoles include fluconazole, itraconazole, voriconazole and posaconazole. Given its excellent safety and low cost profile and the proven efficacy for the treatment of invasive candidosis, fluconazole remains one of the most commonly used antifungal agents [86]. Voriconazole is a second generation triazole that is active against all Candida species and has a broad spectrum of activity and, like itraconazole, is fungicidal against some isolates of filamentous species [87]. Posaconazole differs in structure from the compact triazoles (fluconazole and voriconazole) in part by its extended side chain (a feature held in common with itraconazole); however it displays a dioxolane ring altered to a tetrahydrofluran [84, 88]. The structural differences between the azoles might seem small, but they dictate its antifungal potency and spectrum, bioavailability, drug interaction and toxic potential. Posaconazole is currently only available as oral suspension, and it must be taken with food or a nutritional supplement, somewhat limiting its usefulness. The drug is well tolerated, with an overall safety profile comparable to that of fluconazole [88]. Echinocandins These compounds are fungicidal in vitro against yeasts. However they are not active against Cryptococcus spp. Three agents are presently available for clinical use: caspofungin, 37 Introduction micafungin and anidulafungin. They inhibit β-1, 3 glucan synthase, an enzyme complex that is located in the plasma membrane of fungal cells [25, 31, 82, 89]. This enzyme has a minimum of two subunits, Fks1, the catalytic subunit, and Rho, a GTP-binding protein that regulate the activity of the glucan synthase [31]. They are responsible for the production of β-1, 3 glucan which is essential for fungi as they represent one of the major components of the fungal cell wall [31]. The safety profile of echinocandins is excellent, with few reported adverse events and drug interactions. Despite considerably greater cost, echinocandins are replacing fluconazole as the antifungal of choice in ICU setting [86]. Recent studies have shown that echinocandins are efficacious and safe, explaining why these compounds are recommended as the first-line therapy for the treatment of candidemia [90]. Antifungal resistance mechanisms Patients under long term antifungal prophylaxis or antifungal treatment display favorable conditions for the emergence of antifungal resistance [91]. Three types of antifungal resistance have been described: primary or intrinsic, previous to antifungal exposure, secondary or acquired, and clinical resistance. Secondary or acquired resistance develops following exposure to an antifungal agent and can be either reversible, due to transient adaptation, or persistent as a result of one or several genetic alterations. Clinical resistance relates to patient unfavorable outcome despite antifungal therapy and it is most often to be due to primary or secondary yeast antifungal resistance mechanisms. Factors related to clinical resistance will be focused latter. Polyenes Resistance to amphotericin B is quite rare and most often results from mutations in the ERG3 gene (which encodes a C-5 sterol desaturase, an enzyme involved in ergosterol biosynthesis) and lower the concentration of ergosterol in the fungal membrane [92]. Consequently the accumulation of an alternate sterol in the membrane occurs [92]. 38 Resistance to amphotericin B may also be mediated by increased catalase activity, with decreasing susceptibility to oxidative damage [93]. C. krusei, C. glabrata and C. lusitaniae are less susceptible to amphotericin B [90]. Pyrimidine analogues The use of flucytosine is nowadays very restricted due to the high prevalence of resistance among clinical isolates and by the speed at which yeast isolates develop resistance under treatment. Resistance of Candida clinical isolates correlates with mutations in the enzyme uracil phosphoribosyltransferase (Fur1p) that turns unable the conversion of 5-fluorouracil to 5-fluorouridine monophosphate [20]. The high incidence of 5-fluocytosine resistance recommends its use only in combination with other antifungal drugs like amphotericin B, especially in cryptococcosis [94]. Triazoles The major mechanism responsible for high level of azole resistance is the overexpression of cell membrane efflux pumps [95, 96]. Two classes of pumps are responsible for lowering the accumulation of azoles inside the yeast cell by actively translocating compounds across cell membrane: ABC pumps and the major facilitator (MF) transporters (figure 1) [1, 9, 21, 24, 27, 34, 45, 46, 61, 66, 97, 98]. The ABC pumps, also called ATP-binding cassette, use the hydrolysis of ATP as energy source. They have low specificity since they accept as substrates azoles but also a wide range of compounds [22]. The most frequently encountered triazole resistance mechanism among clinical isolates is the upregulation or overexpression of mainly CDR1 and CDR2 genes [99-101]. Their expression is regulated by the zinc finger transcription factor Tac1, which binds to the drug response element (DRE) found in their promoter [102]. CDR expression is increased by gain-of-function mutations in Tac1p, with high level of fluconazole resistance occurring when this mutation is coupled with loss of heterozygosity [103]. Interestingly, TAC1 is located in the left arm of chromosome 5 (Chr5), the same chromosome where mating-type-locus (MTL) is located [104]. C. albicans exhibits two MTL alleles, MTLa and MTLα, and the loss of heterozigoty at MTL locus is frequently associated 39 Introduction with homozygosity at the TAC1 and ERG11 loci. This homozygosity is described by some authors to be related to antifungal resistance [23, 103, 105, 106]. However, others showed that homozygosity at MTL is infrequent among clinical isolates and it does not influence directly antifungal resistance [107-109]. Our findings suggest that homozygosity at MTL locus is not frequent among clinical isolates despite the azole resistance pattern, the site of infection or previous in vivo antifungal drug exposure (author unpublished data). As with C. albicans, azole resistance in C. glabrata clinical isolates is associated with increased expression of PDR ABC drug efflux pumps such as CgCdr1p and Cg Pdh1p, also called CgCdr2p [97, 110]. Contrary to C. albicans, C. glabrata usually shows high MIC values to azoles, especially fluconazole [111] and prophylaxis with azoles is the main factor responsible for such fact [110]. C. krusei shows intrinsic fluconazole resistance, however is susceptible to voriconazole and posaconazole [112, 113]. This innate resistance is due to reduced susceptibility of the drug target Erg11p to azole antifungals [114, 115], however C. krusei also possesses efflux pumps namely ABC1 and ABC2 [60, 116]. Voriconazole binds more effectively to the cytochrome P450 isoenzyme in C. krusei than fluconazole, thus resulting in higher rates of susceptibility [112, 113]. The second main class of multidrug transporters also involved in azole resistance is MF class. MDR1 gene is involved specifically in resistance to fluconazole rather than other azoles and uses the proton motive force of the membrane as an energy source [117, 118]. The multidrug resistant regulator, Mrr1, is the transcription factor that controls the expression and is upregulated with MDR1 in drug resistant clinical isolates [27, 118]. The gain-of-function in the transcription factor Mrr1p, followed by loss of heterozygosity, represents the main cause of MDR1 overexpression in fluconazole resistant C. albicans strains [26]. 40 Figure 1. Principal mechanisms of azole resistance by minimizing the impact of the drug in the cell. Upregulation of ABC transporter efflux pumps (ATP dependent) confers resistance to azoles while a major facilitator (MF) transporter (Proton motive force dependent) confers resistance only to fluconazole. Another mechanism that operates in order to overcome the effect of the drug in the yeast cell is the alteration of the target enzyme Erg11, where at least 12 mutations have been associated with azole resistance, avoiding the binding of the drug to the target [119, 120]. Reduced affinity of Erg11p to azoles seems to be responsible for the intrinsic resistance to fluconazole in C. krusei [114, 115]. Upregulation of ERG11 due to the amplification of the copy number of the gene is another way used by the cell in order to overcome antifungal action [121]. ERG11 overexpression can be achieved through mutations in the transcription factor Upc2 [122]. This transcription factor binds to the azole-responsive enhancer element (ARE) in the ERG11 promoter [123]. Upc2 also binds to two distinct regions on its own promoter to autoregulate expression during azole exposure [28]. 41 Introduction Echinocandins Echinocandin resistance in Candida spp. has been attributed to mutations in the FKS1 gene, the catalytic subunit of β-(1, 3)-glucan synthase, and in a lesser extent in FKS2, resulting in amino acid substitutions in conserved regions hot spot 1 (HS1) and hot spot 2 (HS2) (figure 2b) [11]. This mutations turn the mutant enzyme approximately 1,000-fold less sensitive to the drug [31] (figure 2). Acquired mutations in FKS1 and FKS2 genes have been predominantly found at position 645 (Serine), S645F (serine to phenylalanine), S645P (serine to proline) and S645Y (serine to tyrosine), and have now been identified in a wide range of Candida clinical isolates [31, 124]. Nevertheless the prevalence of Fks mutations in geographically different clinical isolates remains low [18]. Hot spot mutations are more likely to confer resistance to caspofungin than to anidulafungin or micafungin. Such fact suggests that caspofungin could be less potent than the other two drugs [18, 125]. However, these differences in echinocandin potency are abolished in the presence of human serum and therefore cross-resistance is likely to occur in vivo [14, 126]. Among Candida, MIC values are higher for C. parapsilosis and C. guilliermondii than for C. albicans isolates, although recent reports showed that MIC values are also higher for C. glabrata, C. krusei and C. tropicalis [17, 19, 127]. C. parapsilosis exhibits a point mutation at amino acid position 660 resulting in a proline to alanine substitution, which is thought to be responsible for the intrinsically less susceptible profile to caspofungin [30]. C. guilliermondii displays three amino acid polymorphisms in the first hot spot region in Fks1 and Fks2 [31]. Echinocandin treatment may trigger cell wall salvage mechanisms producing physiological alterations that decrease the susceptibility to these antifungal agents [128]. The inhibition of the β-(1, 3)-glucan synthesis leads to a compensatory increase in chitin synthesis (figure 2c) mediated by the PKC cell wall integrity MAP kinase, Ca 2+ - calcineurin and High Osmolarity Glycerol Response (HOG) signaling pathways [129]. This increase in chitin content is responsible for the paradoxical growth or “eagle effect” and occurs most frequently with caspofungin than with anidulafungin and micafungin [130-132]. There is now evidence that the compensatory elevated chitin content is likely to occur also in vivo [133]. 48 Concomitant medications administered to patients, such as antibiotics, can influence the pharmacodynamics of the antifungals. Fluoroquinolones antagonize fluconazole activity against C. albicans strains [170], whether rifampicin can induce the expression of MDR1 pumps [168]. Nevertheless, the effect of other medications, some of them life-saving in the case of critical care patients still remains to be elucidated. The choice of an antifungal agent for the empirical treatment of Candida bloodstream infections is a complicated task. Similarly to the findings with the extensive use of antibiotics and the development of multiresistant bacterial pathogens, the selective pressure due to the widespread use of fluconazole in prophylaxis, promoted a shift toward nonalbicans Candida species, like C. glabrata and C. krusei [171, 172]. Patient pharmacogenomics, which can influence drug absorption, distribution and metabolism, its immunological status and the underlying disease are additional important factors to be considered when managing individual patients [173]. Strategies to defeat antifungal resistance The knowledge of the mechanism of antifungal resistance brought by the genomic era supports the development of therapeutic strategies in order to bypass drug resistance. The principal cell mechanism of antifungal resistance is the active transport of drugs out of the cell by efflux pumps [24, 27, 98, 101], expressed not only by yeasts but also by humans cells [21, 173]. The main strategy to reduce efflux impact involves the maintenance of a high antifungal concentration inside the cell, at its site of action. The simplest approach would be the use of antifungals that are not substrate of efflux pumps, like amphotericin B or echinocandins, which given their hydrophobicity and size, do not interact with the efflux pump [25, 174]. The second approach would be the development of inhibitors or chemosensitizers of efflux, affecting the target, the activity, by blocking access to the binding site, or even the efflux pump transcription. 49 Introduction In humans, one of the factors that is responsible for the failure of cancer therapy are ATPdependent drug efflux pumps, such as P-glycoprotein (P-gp) [175]. P-gp substrates such as FK506 [176] or cyclosporine A (CsA) [177] are immunosuppressors that are able to inhibit efflux. They act similarly in C. albicans strains, inhibiting the calcineurin-mediated azole tolerance by binding to small, abundant, conserved binding proteins called immunophilins. CsA binds with cyclophilin A (Cyp1p) and FK506 with FKBP12, to form protein-drug complexes that inhibit calcineurin [24, 169, 178]. By inhibiting calcineurin these compounds act synergistically with azoles [169, 179, 180]. While FK506 and CsA chemosensitize C. albicans cells to azoles, rending the azoles fungicidal, they are also immunosuppressive drugs, which make it administration problematic in immunosuppressive candidosis patients. Nevertheless, the inhibition of calcineurin-mediated azole tolerance is still a potential therapeutic approach [181]. Non-immunosuppressive analogs could inhibit fungal calcineurin by exploiting structural differences between the human and the fungal targets [181]. Ibuprofen ([2-(4-isobutylphenyl)-propionic acid has been described to act synergistically with pyrazinamide [182], fluconazole [101, 145, 183] and amphotericin B [184] in fungi. In C. albicans expressing CDR efflux pumps, the presence of ibuprofen increased azole intracellular accumulation, changing the resistant phenotype to susceptible [101, 145]. This potent anti-inflammatory, non-steroidal drug might play important role in future therapeutic strategies. However, its in vivo effect still remains unveiled. Another helpful strategy would be the design of inhibitors that could act indirectly on efflux, de-energizing the ATP or H + dependent transporter, by lowering the cytoplasmic ATP concentration or depleting the electrochemical potential of the plasma membrane, respectively [22, 185]. However, by altering ATP and membrane potential, other cellular metabolic activities could be compromised. Alternatively, the promotion of antifungal uptake could also be a strategy to overcome antifungal resistance due to efflux. Dubikovskaya et al . showed that the inclusion of multiple arginine residues (octaarginine 50 [R8]) in human anticancer drugs enhances the delivery to its intracellular targets [186], an approach that has already been tried in yeasts [185]. The medical complexity of patients taken together with the intricate cellular mechanism involved in drug resistance makes the pursuit of effective solutions mandatory. CHAPTER I I Aims 53 Aims Aims of the Study This study has the following goals: 1. Characterization of yeasts isolates from fungaemia patients in order to assess: the source of infection and modes of transmission; the genetic relatedness and the antifungal susceptibility profile; 2. To evaluate the role of chitin in echinocandin resistance and to develop of a new methodology for evaluating chitin content in the fungal cell wall; 3. To characterize the in vivo mechanisms enrolled in the induction of resistance during echinocandin treatment; 4. To evaluate the role upon an alternative respiratory pathway in C. krusei as a possible contribution to resistance to cell stresses; 5. To unveil the effect of concomitant therapies used in critical care patients upon antifungal resistance or tolerance, like propofol or vasoactive amines, such as adrenaline and noradrenaline; 6. To assess the in vivo reversion of azole resistance by ibuprofen, in an animal model of systemic Candida infection. CHAPTER I II Results 57 Results Part I Genetic relatedness and antifungal susceptibility profile of Candida albicans isolates from fungaemia patients Background Candida infections have progressively emerged as major health care related invasive fungal infections since the late 80s, mainly arising from an endogenous source, either digestive or mucocutaneous. Commensalism, followed by colonization, usually precedes dissemination, most frequently in patients with transient or permanent immunocompromised status, such as transplant recipients, chemotherapy patients, underweight neonates and human immunodeficiency virus-infected individuals. Significant morbidity and mortality rates have been associated to bloodstream infections due to Candida spp [7, 187, 188]. Several polymorphic microsatellite loci have been identified in the genome of C. albicans near EF3 , CDC3 and HIS3 [75] or inside the coding regions of ERK1 , 2NF1 , CCN2 , CPH2 , and EFG1 [189]. However the discriminatory power for each locus is relatively low. In order to more rapidly obtain a higher discrimination, simultaneous amplification of sets of microsatellite markers can be performed. A multiplex system with a high discriminatory power was recently described and found to represent an efficient molecular tool for the swift and accurate differentiation of C. albicans [76, 190]. During a twelve month period (2004) a prospective study addressing fungaemia was conducted at Hospital de São João, a large university hospital located in the Northern region of Portugal [7]. The epidemiological data analyzed included the department of admission, underlying diseases and antimicrobial therapy, among others. Several yeast isolates from blood cultures were collected and analyzed as well as fungal strains isolated from surveillance cultures or from medical indwelling devices. These included isolates from distinct biological sources for the same patient, such as urine and lower respiratory 64 Discussion Nosocomial infections represent an important source of morbidity and mortality in hospital settings [194]. The understanding of pathogen distribution and relatedness is critical for both the epidemiological surveillance of health-care related infections and for the conception of rational pathogen control policies [195]. Pathogen typing allows for the determination of genetically and epidemiologically related isolates. The development and implementation of new DNA based technologies and molecular analyses over the last 3 decades have led to considerable advances in microbial typing approaches [77, 196, 197]. The identification of a pathogen origin, endogenous versus exogenous, and the characterization of consecutive infections by the same organism as relapse or re-infection are critical [197]. Our group has previously developed a microsatellite multiplex PCR strategy with high discriminatory power for typing Candida albicans [76]. This methodology was found to efficiently discriminate C. albicans strains, as well as C. glabrata , C. parapsilosis and C. tropicalis [77, 198, 199]. Maintenance and infection by the same strain may indicate that the therapeutic regimen was unsuccessful and that alternative therapies might be required. The results obtained here for successive blood isolates from the same patient suggest the failure of antifungal therapy in these cases. Moreover, fungal strains may invade the host from different body sites, and microevolution, due to strand slippage during DNA replication in the microsatellite region or loss of heterozygosity (LOH), may represent an adaptive fungal response to new environments [76, 196]. We detected microevolution events in 3 patients (9, 11 and 12). C. albicans colonization and/or infection of different body sites may represent a predisposing condition or an initial step towards the subsequent fungaemia development [188, 200]. All the fungaemia cases considered herein were of nosocomial origin, according to the accepted definition [191]. Our results clearly demonstrate that isolates displaying the same or highly similar genotypes were obtained from patients who shared the same hospital department of admission. This suggests hospital-acquired infections. These observations indicate that the safety measures between patients most probably failed and those 65 Results incidents of cross-infection were likely to have occurred. In our study, fungaemia relapses were frequent, appeared to be caused by the same strain, and were invariably associated to a poor therapeutic outcome. The extension of crossresistance to azoles detected among fungaemia patients may challenge the large empiric use of fluconazole and how it can lead to the development of dramatic resistance. We observed induction of azoles resistance in two groups of patients (patients 3, 4 and 5 and patients 6, 7 and 8) and the increase in MIC values, over time, in similar strains from different patients suggests that the strains were endemic to the hospital environment for at least several months. This exemplifies the risk of selecting for strains with increased antifungal resistance in the hospital environment. The molecular identity of fungal isolates represents a key feature for comprehensible therapeutic strategies in a near future; indeed, analysis of dominant genotypes in different geographical regions, distinct clinical samples and distinct underlying diseases is now a possibility. Molecular approaches are now available, allowing detailed comparisons between C. albicans clinical strains and providing a clear definition of their genetic relatedness. 67 Results Part II Determination of chitin content in fungal cell wall: an alternative flow cytometric method Background Chitin is a β-1,4-homopolymer of N -acetylglucosamine that is synthesized by chitin synthase enzymes [201]. This polysaccharide is present in most fungi and together with β-1,3-glucan, plays a fundamental role in maintaining fungal cell integrity and conferring structural rigidity during growth and morphogenesis [201-203]. Mutations in glucan synthase genes reduce glucan levels in the cell wall while stimulating salvage pathways leading to increased chitin synthesis. This pathway restores the strength of the cell wall matrix and prevents antifungal action [204]. Since chitin is not present in human cells, inhibition of chitin synthesis has been proposed as a potential, selective antifungal target. The assessment of cell wall chitin content based upon glucosamine release through acid hydrolysis has been used extensively; however this method is very laborious and time consuming [128, 129, 205]. Epifluorescence microscopy has also been widely used to quantify chitin levels in fungi stained by Calcofluor White (CFW), a specific chitin dye [128, 206-210]. However, with this approach, only a limited number of yeast cells can be analyzed and the quantification of the fluorescence emitted cannot be performed accurately [128, 211, 212]. Flow cytometry represents an efficient and fast approach for the analysis of cell architecture and functional phenotypes, with considerable advantages over conventional methods [103, 145, 147, 213]. Here we describe a fast and reliable protocol to measure cell wall chitin content in yeasts cells based upon flow cytometric analysis after CFW staining. 68 Material and methods Strains Twenty two Candida spp and 4 Cryptococcus neoformans clinical isolates with well characterized susceptibility profiles to caspofungin (antifungal chosen as representative of echinocandin class), were used in this study (detailed in Table 1). SC5314 [214] with wild type chitin levels, chs3 Δ/ chs3 Δ (Myco 3) [215], pga62 Δ/Δ [216] and pga31 Δ/Δ [216] were used as control strains. Measurement of cell wall chitin content Wild type and mutant yeast cells were grown in YPD broth medium at 35ºC, 150 rpm, until late logarithmic phase, and used to optimize flow cytometric protocol. A 10 6 yeast cells ml -1 suspension in sterilize distilled water was stained with 0 (autofluorescence), 2.5, 6.25, 12.5 and 25 µg CFW ml -1 (Fluka, St. Louis, USA), a specific chitin dye (excitation at 365 nm and emission at 430 nm), for 15 minutes at room temperature. In parallel, yeast cells were treated with MIC values of caspofungin during 2 hours, and stained with CFW. The yeast cells were washed twice and blue fluorescence (Pacific blue channel) emitted by 50000 cells was quantified, using a BD FACSCanto™ II (Becton Dickinson, San Jose, CA, USA) flow cytometer. BD FACSCanto™ II system consists of an excitation source with three lasers: blue (488-nm, air-cooled, 20-mW solid state), red (633-nm, 17-mW HeNe), and violet (405-nm, 30-mW solid state). The mean intensity of fluorescence (obtained from three independent experiments) emitted from stained (positive population) and non-stained (autofluorescence or negative population) yeast cells was analyzed and processed with FACSDiva software (version 6.1). In each experiment a staining index (SI) was calculated as follows: (mean intensity of fluorescence of positive population – mean intensity of fluorescence of negative population)/ 2 x standard deviation of the mean intensity of fluorescence of negative population [217]. The chitin content of the 26 clinical isolates was assessed according to the described protocol, after staining with 2.5 µg CFW ml -1 ; the SI was calculated. 69 Results Epifluorescence microscopy In order to confirm flow cytometry results, epifluorescence microscopy analysis was performed. Yeasts cells were grown and prepared as described for flow cytometric assays and stained with 25 µg CFW ml -1 for 15 minutes. Following staining, 30 µl of the cell suspension were placed on a glass slide and overlapped with vectashield fluorescence mounting medium (Vector Laboratories, Peterborough, UK) and observed under an epifluorescence microscope (400X) imager Z Apotome (Zeiss, Barcelona, Spain). Paradoxical effect of caspofungin The ability of the clinical isolates to grow in the presence of high caspofungin (Merck, Rahway, NJ, USA) levels, termed paradoxical growth was tested over a range of concentrations varying from 0.03 to 256 µg ml -1 and MICs were determined using prominent inhibition as an endpoint corresponding to 50% (MIC 50 ) [33, 218]. T he paradoxical effect was defined as a progressive increase in cell growth occurring at least two drug dilutions above the MIC, following 48 hours incubation [218]. Data Analysis The SI mean values displayed by the different isolates after CFW staining were compared using the Student’s t -test. Significant effects were accepted at p <0.05. The SPSS Statistics 17.0 Software for Windows was used to perform the statistical analysis. All experiments were performed in triplicate. Results and Discussion The cytometric protocol was optimized using four C. albicans strains with known differences in chitin contents: chs3 Δ /chs3 Δ, pga31 Δ/Δ, pga62 Δ/Δ and the reference strain SC5314. These strains are deleted in genes that are involved in chitin synthesis ( chs3 Δ /chs3 Δ) or encode GPI-proteins that are involved in cell wall biosynthesis or in cell wall salvage pathways ( pga31 Δ/Δ and pga62 Δ/Δ) [128, 216]. A range of CFW concentrations was tested and 2.5 µg CFW ml -1 revealed to be the concentration to achieve the best resolution to differentiate the chitin content of the four strains used as controls. The reference strain 70 SC5314 had significantly higher SI values (p<0.001) than strains chs3 Δ /chs3 Δ and pga31 Δ/Δ and had lower values when compared to the pga62 Δ/Δ strain (figure 1). Flow cytometry chitin measurements were concordant with the chitin levels determined by the quantification of glucosamine released by acid hydrolysis, previously obtained by others [128, 215, 216]. Caspofungin treatment of the reference strain SC5314 led to a significant increase in chitin content (p<0.001), contrasting with the mutant strains where caspofungin did not produce any effect (figure 1). The chitin levels obtained after caspofungin exposure of the reference and chs3 Δ/Δ strains are in agreement with those achieved by the classic method performed by other authors [128]. Furthermore, results obtained by flow cytometry were consistent with epifluorescence microscopy observations (data not shown). The flow cytometric protocol for chitin quantification is considerably less laborious and more accurate in comparison with the previously described methods since a large amount of cells (50000) are randomly evaluated, without operator interference. Given the variation in yeast morphology such as cell shape and size, different species may emit different levels of autofluorescence, which arises from endogenous fluorophores. This autofluorescence emission analyzed under epifluorescence microscopy or flow cytometry results in a background “noise” which may interfere with the quantification of fluorescence emitted by stained cells [217]. To avoid autofluorescence interference, especially when fluorescence emitted by cells from different species is compared, normalization of data is mandatory [217]. This was achieved through the calculation of a SI which provides sensitivity and reliability to the output data and enables comparison of the fluorescence emitted by cells with distinct morphologies. With this approach we can expect a possible normalization in intra and inter laboratory results. The relationship between the CFW staining index and the caspofungin susceptibility phenotype displayed by clinical strains is detailed in Table 1 and figure 2. Among the distinct species included in this study, C. parapsilosis , C. tropicalis and C. albicans clinical isolates showed a higher CFW staining index, and therefore a higher cell wall chitin content 71 Results 0 10 20 30 40 50 60 70 80 90 100 Wild Type chs3Δ/chs3Δ pga 31Δ/Δ pga 62Δ/Δ Mean Staining Index (SI) Control + Caspofungin comparing to C. glabrata and C. krusei (figure 2). C. neoformans showed intermediary levels (figure 2). Figure 1. Cell wall chitin content of reference and chs3 Δ /chs3 Δ, pga62 Δ/Δ and pga31 Δ/Δ strains. A suspension of 10 6 cells ml -1 was stained with 2.5 µg CFW ml -1 and the intensity of fluorescence was quantified by flow cytometry. The SI mean values displayed by the different strains were determined after three independent experiments. Reference and mutant strains had significantly differences (p<0.001) in SI mean values, revealing diverse chitin levels in the cell wall. After caspofungin exposure, only reference strains showed a significant increase in chitin levels (p<0.001). 72 Table 1. In vitro antifungal susceptibility and paradoxical effect of caspofungin (CFS) against Candida spp and Cryptococcus neoformans clinical isolates. Minimal inhibitory concentrations (MIC; µg ml -1 ) were determined using prominent inhibition as an end point, corresponding to 50% (MIC 50 ), according to CLSI protocol. Yeast Strain code Source CFS MIC 50 (µg ml - 1 ) / Phenotype Paradoxical growth (mean values) Start point/ end point (µg ml -1 ) C. glabrata Cg1 Blood >32/ NS NF Cg2 Blood 0.125/ S NF Cg3 Peritoneal fluid 32/ NS NF Cg4 Fecal 0.125/ S NF Cg5 Peritoneal fluid 0.5/ S NF Cg6 Blood 0.25/ S NF C. parapsilosis Cp1 Peritoneal fluid 4/ NS NF Cp2 Blood 2/ S NF Cp3 Blood 4/ NS NF Cp4 Blood 4/ NS 16/64 Cp5 Blood 0.5/ S NF C. tropicalis Ct1 Blood 0.5/ S 8/16 Ct2 Peritoneal fluid 0.5/ S NF Ct3 Pus 4/ NS 16 Ct4 Pus 4/ NS 16 C. krusei Ck1 Urine 1/ S NF Ck2 Blood 1/ S NF Ck3 Bronchial secretions 1/ S NF Ck4 Bronchial secretions 1/ S NF C. albicans Ca1 Blood 0.5/ S 16/32 Ca2 Blood 0.5/ S 16/32 Ca3 Blood 0.5/ S 16/32 C. neoformans Cn1 Blood 16/ NS NF Cn2 Blood 16/ NS NF Cn3 Blood 16/ NS NF Cn4 Blood 32/ NS NF NS non susceptible phenotype; S susceptible phenotype; NF not found 73 Results Figure 2. Cell wall chitin content of Candida spp and Cryptococcus neoformans clinical isolates in the absence and presence of caspofungin. Yeast cells were stained with 2.5 µg CFW ml -1 and fluorescence emitted was quantified by flow cytometry. Higher staining index (SI) values were observed in strains that showed a paradoxical growth (*) in the presence of caspofungin. # shows significantly different chitin levels after caspofungin treatment. Notably, several C. parapsilosis and C. tropicalis (Cp4, Ct1, Ct3 and Ct4) isolates showed a significant increase in chitin level (p<0.001) in comparison with other isolates from the same species (figure 2). Interestingly, these strains, along with all C. albicans isolates tested, exhibited a paradoxical growth in the presence of high caspofungin concentrations. The ability to grow at high caspofungin concentrations has been frequently described among C. albicans , C. parapsilosis and C. tropicalis [218] and has been suggested to relate to a compensatory increase in cell wall chitin [128, 130]. This salvage mechanism strengths cell wall damaged by exposure to echinocandins. Chitin quantification by flow cytometry revealed to be a highly sensitive method. It enabled the detection of different chitin levels, which allowed us to validate the association between a higher amount of cell wall chitin and paradoxical growth in the presence of caspofungin concentrations well above the MIC. Also, when yeast cells were treated with caspofungin for two hours, a significant increase in 80 minutes at 72ºC. The RAPD patterns were obtained through electrophoresis in 2% agarose gel. HS1 sequencing of FKS1 and FKS2 genes Specific primers (table 1) were used for PCR amplification of HS1 of FKS 1 and FKS 2 genes. PCRs were performed in a Realplex Mastercycler instrument (Eppendorf) according to the amplification conditions: an initial denaturation step of 2 minutes at 96ºC followed by 30 cycles of 30 seconds at 96ºC, 30 seconds at 69.6ºC, 30 seconds at 72ºC and a final extension step of 10 minutes at 72ºC. PCR products were treated with ExoSAP-IT (USB Corporation OH, USA) and used as template for the sequencing reactions, performed with the Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems). The DNA products were purified with Sephadex G-50 Fine (GE Healthcare, UK) and sequenced in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems). The results were analyzed with the Sequencing Analysis 5.2 software from Applied Biosystems. Table 1. Primers used for C. glabrata FKS1 and FKS2 HS1 amplification and sequencing. Primers Sequence (5’-3) Reference FKS1 1HS1F2 CTTATGTTTGATTTTTGCA This study FKS1 1HS1R CCTTCAATTTCAGATGGAACTTGATG [30] FKS2-HS1F GTGCTCAACATTTATCTCGTAGG [219] FKS2-HS1R CAGAATAGTGTGGAGTCAAGACG [219] 81 Results Data Analysis Fluorescence mean values displayed by the different strains after CFW staining were compared using Student’s t -test. Significance was accepted at p <0.05. The SPSS Statistics 17.0 Software for Windows was used to perform the statistical analysis. The coding sequences of the Candida glabrata FKS1 and FKS2 genes (GenBank accession: XM_446406 and XM_448401) were aligned with those obtained from the clinical isolates. Alignments were analyzed in BioEdit (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Results Antifungal susceptibility profile Twenty one isolates were recovered from the patient’s blood and other biological samples throughout anidulafungin treatment (table 2). The majority of such isolates corresponded to C. glabrata (table 2). All strains were susceptible to echinocandins, except two strains one recovered from the blood (7-1) and the other from the peritoneal fluid (9-2), the 7 th and 9 th isolates, respectively (table 2 and figure 1). Regarding azoles and amphotericin B no resistance could be observed (table 2). After subculturing the NS strains (7-1 and 9-2) in drug free RPMI medium during 30 days, the MIC values for both strains remained 4µg/ml (non-reverting strains 7-1NR and 9-2NR), confirming the stability of the non susceptible phenotype. 82 Table 2. In vitro antifungal susceptibility of successive Candida isolates to amphotericin B (AmB), fluconazole (FLC), voriconazole (VRC), posaconazole (PSC), caspofungin (CAS), anidulafungin (AND) and micafungin (MCA), determined accordingly to the CLSI protocol. Minimal inhibitory concentrations (MIC; µg/ml) were determined using prominent inhibition, corresponding to 50% (MIC 50 ) or 100% (MIC 100 ), as an end point. Strain number Days after admission Isolate Sample MIC 100 AmB MIC 50 FLC MIC 50 VRC MIC 50 PSC MIC 50 CAS MIC 50 AND MIC 50 MCA 1 - 1 6 C. glabrata urine 0.5 8 0.5 1 0.06 ≤0.06 ≤0.06 1 - 2 6 C. albicans bronchial secretion 1 32 1 1 0.125 ≤0.06 ≤0.06 2 - 1 7 C. glabrata blood 0.125 16 2 2 0.125 ≤0.06 ≤0.06 2 - 2 7 C. albicans blood 0.5 0.2 5 ≤0.015 0.06 0.06 ≤0.06 ≤0.06 3 - 1 8 C. albicans blood 0.5 0.25 ≤0.015 0.06 0.06 ≤0.06 ≤0.06 3 - 2 8 C. glabrata blood 0.25 16 2 0.5 0.125 ≤0.06 ≤0.06 3 - 3 8 C. albicans exudate ≤0.06 ≤0.125 ≤0.015 ≤0.03 ≤0.06 ≤0.06 ≤0.06 3 - 4 8 C. albicans exudate 0,25 0, 25 ≤0,015 ≤0,03 ≤0,06 ≤0,06 ≤0.06 3 - 5 8 C. glabrata exudate 0.5 8 0.5 2 ≤0.06 ≤0.06 ≤0.06 3 - 6 8 C. glabrata exudate 0.125 16 2 2 0.125 ≤0.06 ≤0.06 4 - 1 9 C. glabrata blood 0.25 4 2 1 0.125 ≤0.06 ≤0.06 4 - 2 9 C. glabrata urine 1 32 1 1 0,125 ≤0.06 ≤0.06 5 - 1 10 C. glabrata blood 0.25 1 2 1 0.125 ≤0.06 ≤0.06 5 - 2 10 C. glabrata urine 0.125 16 2 2 0.125 ≤0.06 ≤0.06 5 - 3 10 C. glabrata cvc 0.5 8 0.5 1 0.06 ≤0.06 ≤0.06 6 - 1 15 C. glabrata urine 0.25 8 0.5 1 0.06 ≤0.06 ≤0.06 7 - 1 18 C. glabrata blood 0.25 8 0.5 1 >32 4 4 7 - 2 18 C. glabrata urine 1 4 0.25 0.125 0,25 0,25 ≤0.06 8 - 1 19 C. glabrata peritoneal fluid 0.5 8 0.5 1 0.06 ≤0.06 ≤0.06 9 - 1 30 C. glabrata exudate 0.5 8 2 1 0.125 ≤0.06 ≤0.06 9 - 2 30 C. glabrata peritoneal fluid 0.5 8 2 1 32 4 8 83 Results Measurement of chitin content To evaluate whether anidulafungin (AND) resistance was related to an increase in chitin cell wall content, the two susceptible (5-1 and 8-1), two non susceptible strains (7-1 and 9-2) and the two non-reverting strains (7-1NR and 9-2NR) were compared regarding their chitin content. Flow cytometry was used to measure fungal chitin through assessment of fluorescence emitted by Calcofluor White (CFW). CFW is a fluorescent dye that binds specifically to fungal chitin and the resulting fluorescence intensity is considered proportional to chitin cell wall content [209]. When compared to the other strains, only the non susceptible strain 7-1 displayed a significant increase (p<0.0051) in the fluorescence mean value after CFW staining, indicative of a higher chitin content (figure 2). This result is concurrent with epifluorescence microscopy observations, showing strain 7-1 a higher staining intensity, with no abnormalities in the distribution of chitin (blue fluorescence), compared to strain 9-2 (figure 2a and b, respectively). Regarding the non-reverting strains (7-1NR and 9-2NR), after subculturing for 30 days in the absence of antifungal the chitin content decreased when compared to strains 7-1 and 9-2. Strain 7-1NR showed a significant lower chitin content than strain 7-1 ( p =0.0106) (figure 2). Genetic similarity between the different isolates recovered from the patient Random amplification of polymorphic DNA (RAPD) was carried out in isolates from different biological samples to determine their isogenicity. Using primer OPE-18 and OPA-18 [220] an identical band profile was displayed by all isolates with exception of strain 9-2 recovered from the peritoneal fluid (figure 3). 84 Figure 2. Relative cell wall chitin content from susceptible (light grey) and non susceptible (dark grey) strains. A suspension of 10 6 cells/ml was stained with 2.5 µg/ml Calcofluor White (CFW) and the intensity of fluorescence was quantified by flow cytometry. The mean CFW fluorescence was determined from three independent assays. Figure 3. Random amplification of polymorphic DNA gel patterns of C. glabrata isolates 7-1, 9-2, 5-1 and 8-1 obtained with primers OPE-18 and OPA-18. 85 Results FKS1 and FKS2 sequence analysis To determine if anidulafungin resistance was associated with mutations in the target genes, genomic DNA extraction of C. glabrata isolates was performed and the hot spot 1 (HS1) regions of FKS1 and FKS2 genes were amplified and sequenced. No sequence alterations were observed in HS1 of the FKS 1 gene, however, several point mutations were found in HS1 of the FKS 2 gene, most of them corresponding to synonymous substitutions that did not result in amino acid changes (table 3). Furthermore, isolate 9-2, which was recovered following a long period of antifungal treatment, displayed a C-T mutation at position 1987. This mutation leads to a substitution of serine 663 by proline in HS1 of FKS2 (table 3). In the same HS, a deletion of 3 nucleotides was found in the blood isolate 7-1, which results in the deletion of one of the two consecutive phenylalanines in positions 658 and 659 (table 3). These results are consistent with previous reports , describing increased resistance to echinocandins associated with the mutations S663P and Phe659 deletion in the FKS2 gene [125]. Table 3. Mutations in HS1 of the FKS2 gene from C. glabrata clinical isolates. All point mutations correspond to synonymous substitutions, except for the T to C substitution in position 1987 which led to a replacement of serine 663 by proline. The CTT deletion (19771979) results in the deletion of phenylalanine 659. SNP A1956G C1959T 1977-9 CTT deletion T1987C T2046C T2119C C2191T Codon AAA-AAG TAC-TAT TTCTTG-TT…G TCT-CCT TAT-TAC TTG-CTG CTA-TTA AA Lys Tyr ∆ Phe659 Ser663Pro Tyr Leu Leu C. glabrata isolates All All 7-1 9-2 All All All SNP – single nucleotide polymorphisms; AA - aminoacid 86 Discussion Echinocandins are considered to be advantageous over other existing antifungals, mainly azoles, due its clinical effectiveness and safety profile [25, 221]. While the three echinocandins, caspofungin, micafungin and anidulafungin share the same target, in vivo potency, mechanism of resistance, and spectrum, discrepancies in vitro have been observed [125]. In the absence of serum, caspofungin seems to be less potent than the two others drugs, however, such differences are minimized in the presence of 50% of serum and were confirmed in in vivo models [125, 126, 222]. We report for the first time the in vivo acquisition of echinocandin resistance following anidulafungin therapy in a patient with C. glabrata invasive candidosis. Our study describes anidulafungin resistance acquisition associated to an increase in caspofungin and micafungin MIC, suggesting the development of cross-resistance between these three echinocandins. Although MIC values are usually considered predictors of clinical responses to antimicrobial therapy in invasive fungal infections, no strong correlation has actually been found between in vitro susceptibility test results and clinical outcome [7, 223-226]. It is considered that high in vitro MIC values for echinocandin drugs are correlated to clinical failure, however some reports describing high MIC values have not been shown to be good predictors of treatment outcome [227, 228]. The authors justified it as the majority of the MIC values found were close to breakpoint (2µg/ml) while the sporadic clinical failures were related to only strains displaying high MIC values (>2µg/ml) [31]. Our clinical case however depicts a correlation between in vitro results and in vivo efficiency of the drug. MIC values were well above the breakpoint in the blood (7-1) and peritoneal fluid isolates (9-2) from a patient under anidulafungin therapy who developed clinical failure. After RAPD analysis, C. glabrata isolates were shown to be isogenic, including the non susceptible blood strain (7-1), except the last non susceptible C. glabrata isolate, obtained from the patient’s peritoneal fluid (9-2) prior to her death. Considering surgical procedures, the evidence of CVC infection and the long ICU stay (34 days), where 87 Results nosocomial infections are likely to occur, it is plausible that this strain had an exogenous source. The acquisition of resistance to echinocandins in several Candida species has been associated with amino acid substitutions in two highly conserved regions of Fks1p or Fks2p [31]. Deletion of both alleles of the FKS1 gene is lethal in Candida spp. and point mutations in FKS1 and FKS2 lead to reduced caspofungin susceptibility [11, 31, 125]. The highest frequency of resistance-associated mutations is found within hot spot 1 [229]. HS1 is a highly conserved region among the Fks family, hence amino acid changes in this region implicate a modification in the presumed echinocandin target and thus a reduced susceptibility phenotype. However, not all nonsynonymous mutations confer a similar resistance phenotype. A weaker resistance phenotype (caspofungin MIC≤2µg/ml) has been described for mutations occurring in the C-terminal of the HS1, whereas substitutions in the Ser645 lead to a stronger phenotype, even in a heterozygous form [11]. In our study, we identified this sort of mutation (C to T) leading to the Ser663Pro substitution in FKS 2 HS1 of the non susceptible strain isolated from the peritoneal fluid. Within the same region, a deletion of 3 nucleotides encoding Phe in position 659 was detected in the NS isolate 7-1 from blood. This deletion has previously been described as responsible for echinocandin resistance [125]. Furthermore, this isolate displayed an increase in cell wall chitin content compared to that of the other isogenic strains. The significant increase in chitin content following in vitro echinocandins exposure has been demonstrated by several investigators and suggested to be an escape or salvage pathway mechanism to echinocandins [128, 130, 150]. Up-regulation of the cell wall integrity pathway in C. albicans upon cell wall damage increases chitin content and has been correlated to paradoxical attenuation of caspofungin activity at clinically relevant supra-MIC concentrations [130]. Although this effect has not been observed in C. glabrata , some studies have reported the incomplete killing of some isolates due to the increase of SLT2 and CHS3 expression [14, 150, 218, 230]. Chitin and β1, 3-glucan represents key structural polysaccharides in fungal cell walls responsible for cell shape and structural rigidity [202]. Mutations in glucan synthase genes that reduce glucan levels in cell wall stimulate a salvage 88 pathway in which chitin synthesis is increased to restore the strength of the wall matrix [204]. Previous clinical case reports did not assess the cell wall chitin content of the isolates as a possible mechanism of resistance. In our study, a flow cytometry method was used to quantify the cell wall chitin. To unveil whether resistance of the blood isolate 7-1 was due to the Phe659 deletion or to the high chitin amount, daily subcultures in drug free medium were performed during 30 days. The NS phenotype remained, however the chitin content decreased. Attending to such results we can conclude that resistance of strain 7-1 was a consequence of the deletion found in FKS 2 gene. Nevertheless, the initial high chitin level in strain 7-1 might indicate a form of drug tolerance and an adaptive response to the presence of anidulafungin in vivo . Whilst the Ser663Pro substitution in FKS 2 HS1 seems to be exclusively responsible for the NS phenotype of the peritoneal fluid isolate. The chitin content found in this isolate was similar to that found on susceptible strains (9-2). Overall, our findings suggest that structural alterations in the HS1 of FKS 2 molecule due to the Ser663Pro substitution and a Phe659 deletion lead to a dramatic decrease in echinocandin efficiency. Although just a few cases of echinocandin resistance development have been so far reported, our case report emphasizes the crucial need of antifungal susceptibility surveillance in patients under extended echinocandin therapy. 89 Results Part IV An Alternative Respiratory Pathway on Candida krusei : Implications on Susceptibility Profile and oxidative stress response Background Over the past few decades authors have documented increases in the rate of candidaemia by nonalbicans species of Candida , such as C. krusei , especially in critically ill and immunocompromised patients with hematologic malignancies [52]. Fluconazole is often used in the prophylaxis and treatment of candidaemia and is the firstline therapy for this condition [10]. Among nonalbicans species, C. krusei is the only that is predictably fluconazole resistant [231]. Antifungal drug tolerance can also be modulated by metabolic adaptability mechanisms, including alterations in the respiratory mitochondrial pathway [161, 162] . This fact had been previously assessed in C. glabrata , C. albicans and C. parapsilosis regarding its influence on fluconazole and caspofungin [161-163]. In eukaryotic organisms the energy necessary for growth, development, reproduction and stress response is acquired through the ATP, synthesized during the mitochondrial respiration, where cytochrome c oxidase acts as a terminal oxidase in the reception of electrons and converting oxygen into water. Within the mitochondrial respiratory chain, another route mediated by the alternative oxidase (AOX) (a mitochondrial enzyme), can be found in plants, in certain protozoa and fungi [232-236]. This AOX is insensitive to cytochrome pathway inhibitors, such as antimicin A or cyanide, but is specifically inhibited by salicylhydroxamic acid (SHAM) and confers a cyanide-resistant respiration through an alternative respiratory pathway (ARP) to such organisms [233]. The AOX is located on the matrix side of the inner mitochondrial membrane and plays an important role in susceptibility to azole antifungals in C. albicans [163]. The alternative respiratory chain can 96 Figure 2. Representative example of the presence of an AOX in Candida krusei . Immunoblot analysis of AOX levels in 40 µg of mitochondrial extracts of Saccharomyces cerevisiae ( S.c. ), Candida albicans SC5314 ( C.a. ) and Candida krusei ( C.k. ). The presence of an alternative respiratory pathway in C. krusei relates to reduced ROS accumulation To assess the influence of the alternative respiratory pathway upon oxidative stress response we measured intracellular ROS accumulation with and without SHAM, using DHR123. This fluorochrome enters the yeast cell as a freely permeable dye, which is converted to rhodamine 123 and subsequently localized in the mitochondria. The conversion from the non-fluorescent to the fluorescent molecule is entirely dependent upon the presence of oxidation products. After treatment with the ROS-inducing agents, H 2 O 2 , plumbagin, menadione and with azoles, the percentage of stained cells (cells with ROS accumulation) was calculated and compared with values displayed by non treated cells, in the presence and absence of SHAM (3.2 mM). No significant differences regarding ROS accumulation were observed with the AOX negative strain, S. cerevisiae BY4742, in the presence or in the absence of SHAM (figure 3). In contrast, after treatment with ROS inducing agents, C. krusei cells treated with SHAM produced significantly ( p < 0.001) more endogenous ROS than the cells with the unblocked alternative respiratory pathway (without SHAM) (figure 3). Significant differences in ROS production ( p = 0.008) were also accomplish with fluconazole (figure 3). All C. krusei tested strains displayed similar results. 97 Results Chronological life span decreased in C. krusei strains incubated with menadione when compared to untreated cultures (figure 4). The viability of C. krusei strains reduced significantly after 3 days of incubating the cultures with menadione plus SHAM (figure 4). Figure 3. Effect of fluconazole (FLC) and oxidative inductors (menadione – Men; plumbagin – Plumb; hydrogen peroxide – H 2 O 2 ) upon intracellular ROS accumulation by a clinical Candida krusei (C.k.) strain (representative example) and a negative control strain Saccharomyces cerevisiae (S.c.), with or without the addition of SHAM. ROS accumulation was calculated and expressed as the percentage of DHR123 stained cells (* p <0.05). 98 Figure 4. Chronological life span of a C. krusei strain. Strains were incubated without (control) and with 3.2mM SHAM, 0.25mM and 0.5mM of menadione (Men) alone and in combination with 3.2mM of SHAM. Survival was assessed daily by counting colony-forming units (CFUs) from cultures aliquots in YPD agar plates beginning at day 0 (when viability was considered to be 100%) . Discussion Several authors have stressed the relevance of the mitochondrial respiration and its influence upon metabolic behavior, stress environment adaptability and antifungal drug tolerance [161-163, 244] . A mitochondrial alternative respiratory pathway (cyanineresistant) occurs in all higher plants, in many fungi and in some protozoa [245, 246]. Such a pathway uses electrons from the ubiquinol pool to reduce oxygen to water, bypassing the complex III and the cytochrome oxidase complex, two sites of energy conservation in the main respiratory chain. An alternative oxidase (AOX), sensitive to salicylhydroxamic acid (SHAM) and resistant to cyanide, is responsible for this alternative pathway [247]. The cyanide-resistant respiration has been previously described in C. albicans and C. parapsilosis [162, 163, 234]. In this study we described for the first time the presence of an alternative respiratory pathway mediated by an alternative oxidase in C. krusei . 99 Results The elucidation of the oxidative stress responses in yeast has considerable clinical interest, as it is involved in invasion and colonization of host tissues by yeast pathogens as well as during the defensive mechanisms triggered by phagocytes. All aerobic organisms inevitably generate a range of ROS, including superoxide anion, hydrogen peroxide and hydroxyl radical during oxygen metabolism. If not quickly and effectively eliminated from the cells, ROS will trigger a large number of oxidative reactions in cellular systems that possibly lead to cell death [248]. In the course of an in vivo infection, the formation of ROS and other oxidants radicals by phagocytes play a crucial role in the intracellular destruction of the pathogen [249]. ROS attack almost all essential cell components, including DNA, proteins and lipids [250]. In a recent study, C. krusei appears to be resistant to ROS and to possess a potent antioxidant system enabling deep systemic infections [251]. We decided to evaluate the difference regarding oxidative stress response before and after the blockade of the alternative respiratory pathway. It has been previously described that in C. albicans , fluconazole is able to induce the production and accumulation of ROS [252]. In our study, we showed that fluconazole induced a low percentage of ROS formation by C. krusei cells. These results may suggest that the fungistatic mechanism of this azole is not based upon ROS formation. However, when the AOX was inhibited by SHAM, an increase in the intracellular ROS levels was evident. Attending to these facts, we can conclude that AOX activity allows the yeast cells to reduce ROS accumulation when challenged by antifungals like fluconazole, leading to drug tolerance, like in C. albicans [163]. According to several authors, the AOX has a metabolic and antioxidant role and its presence may be considered a potential virulence attribute of pathogenic fungi [163, 253, 254]. The importance of AOX activity upon resistance to oxidative stress was evident when the oxidative stress inductors, H 2 O 2 , menadione and plumbagin were assayed. After treatment with such compounds, ROS accumulation was low. However, the scenario changed significantly when the AOX activity was blocked by SHAM. To confirm our hypothesis that the presence of an alternative respiratory pathway could protect C. krusei from oxidative stress, we assessed ROS accumulation in the presence of fluconazole and the other oxidative stress inductors by the negative control strain, S. cerevisiae (AOX-). The results obtained regarding ROS 100 accumulation, in the presence or absence of SHAM, were not significantly different. When testing C. albicans AOX mutant strains, Yan and co-workers also obtained no significant differences in the amount of ROS generation [163]. Regarding the chronological life span assays we could conclude that the decreased viability of C. krusei strains in the presence of menadione and with the AOX blocked is associated with an increased level of cell ROS. Our results showed clearly that the inhibition of the expression of the AOX was associated with intracellular ROS accumulation, unveiling its effect of the alternative respiratory pathway on oxidative damage. Although fluconazole resistance was unrelated to the presence of the ARP, we can consider that it confers antifungal tolerance, which may give yeast cells enough time to develop long-term genetically stable resistance mechanisms [22]. The alternative respiratory pathway is a potential target that should be taken into account considering the development of new therapeutic strategies in the case of C. krusei infections. Attending to its selective effect, SHAM should be used in combination with azoles, in order to reduce resistance due to oxidative stress and consequently the virulence of C. krusei . 101 Results Part V Propofol lipidic infusion promotes resistance to antifungals by reducing drug input into the fungal cell Background Discrepancies between in vivo and in vitro susceptibility to antifungals discourage microbiologists and clinicians regarding the routine use of susceptibility testing methods. Although in vitro resistance usually correlates with clinical resistance, high susceptibility in vitro is not always related to clinical success . Ultimately, the mortality rates are unacceptably high in patients treated with antifungals that showed high in vitro efficacy [255]. Propofol is an intravenous hypnotic agent very popular for induction and maintenance of general and intravenous anaesthesia. It is commonly administered in Intensive Care Units to critically ill patients, often under mechanical ventilation, which represent a high risk group for health care related infections. The use of propofol has been previously associated to an increased risk for infection, although some controversy still remains [256, 257]. It was proposed a low risk of contamination whenever providing standard hygienic precautions [256, 258]. Nevertheless, other observations described the lipid emulsion of propofol as a good culture medium to support the growth of Candida albicans and Escherichia coli [259, 260]. Additionally, other reports associated post-surgical infections with the extrinsically contamination of propofol infusion [258, 261]. Propofol has also been shown to inhibit a variety of functions of neutrophils in vitro , although such effect was not so evident in vivo [262]. 102 We have studied the effect of the infusion of propofol and its lipidic vehicle upon antifungal susceptibility of Candida . A promotion of resistance due to a decreased input of the antifungal drugs was found. Materials and Methods Strains Twenty clinical strains of Candida spp. (5 C. albicans , 5 C. tropicalis , 5 C. glabrata and 5 C. parapsilosis ) were studied. C. albicans 95-190, resistant to azoles by overexpression of efflux pumps genes (CDR1 and CDR2), was used during cytometric approach (strain kindly gift by Prof. Theodore White). Until testing, yeasts and moulds were kept frozen in BrainHeart broth (Difco Laboratories, Detroit, MI, USA) with 5% glycerol. For each experiment, the strains were subcultured twice on Sabouraud agar (Difco) at 35ºC, 48 hours for Candida . Drugs and Chemicals Propofol infusion Fresenius® (Kabi, France) at stock concentration of 1% was used. Propofol vehicle (soya bean oil, egg lecithin, glycerol, sodium hydroxide and sterile water) was also assayed. Fluconazole and voriconazole were obtained from Pfizer (Groton, CT, USA), amphotericin B from Bristol-Myers Squibb (New York, USA), itraconazole from Janssen-Cilag (Beerse, Belgium) and posaconazole from Shering-Plough (Kenilworth, NJ, USA). Antifungals drugs were maintained in stock solution at -70ºC until use. [ 3 H]-labelled itraconazole was supplied by Janssen-Cilag. Sodium azide was purchased from Sigma (Sigma-Aldrich, Germany). Growth assays After cultivation of Candida strains in Sabouraud agar medium (Difco, Detroit, MI, USA), a 5x10 6 .ml -1 blastoconidia suspension of Candida was prepared in phosphate buffer saline (PBS) (Sigma) and 100µl were added in two parallel serial dilutions of propofol infusion (stock solution at 1%) and its vehicle (both at 0, 1.25, 2.5 and 5 mg.ml -1 final concentrations) in RPMI 1640 culture medium (Sigma), PBS and plain propofol infusion in a final volume of 103 Results 500µl. RPMI is a hydrophilic medium, however, solubility problems were not found. For Candida strains, samples were collected after 3 hours incubation at 37ºC, the cells were observed under phase contrast microscopy (Leitz Larborlux K) and the percentage of budding and germ tube formation for C. albicans were determined [263]. Susceptibility testing For Candida spp. , the minimal inhibitory concentration (MIC) to fluconazole, voriconazole, posaconazole and amphotericin B (tested concentration range: 0.125-64 µg.ml -1 , 0.03-16 µg.ml -1 , 0.03-16 µg.ml -1 and 0.03-16 µg.ml -1 , respectively) were determined accordingly the CLSI protocols M27-A2 (formerly NCCLS) [33]. Strains were classified as susceptible (S), susceptible-dose dependent (S-DD) and resistant (R) to fluconazole according to breakpoints defined by CLSI [33]. For voriconazole MICs ≤1 µg.ml -1 were considered S, MIC =2 µg.ml -1 considered S-DD and MIC ≥4 µg.ml -1 considered R [264]. Although susceptibility breakpoints have not yet been established for amphotericin B and posaconazole, strains with MIC ≤1 µg.ml -1 were considered susceptible [193, 265]. Minimal fungicidal concentration (MFC) to all antifungals was also determined. The content of each well containing drug concentrations to and higher than the MIC, and also the positive growth control were transferred to Sabouraud dextrose agar plates and incubated at 35°C for 48h, as previously described [266]. The MFC was the lowest drug concentration that killed ≥99% of the final inoculum. The susceptibility tests to the antifungals mentioned above were repeated in the presence of the propofol infusion or its vehicle in three distinct concentrations (1.25, 2.5 and 5 mg.ml - 1 ). Since propofol infusion and its vehicle are opaque solutions, making impossible MIC determination, the content of each well containing antifungal + propofol drugs was cultured for MFC determination and values compared with the MFC to antifungals alone. Flow cytometry analysis Yeast cells were incubated at 150 rpm, overnight, until late exponential growth, in Sabouraud broth (Difco) at 37ºC. Yeasts cells were harvested after centrifugation and a 1x10 6 cells.ml -1 suspension was prepared in PBS supplemented with 2% glucose (GH 104 solution) and later divided into aliquots of 1 ml. The cells were then incubated with different concentrations of propofol infusion (0, 1.25, 2.5 and 5 mg.ml -1 ) at 37ºC for 90 minutes and afterwards washed thrice, ressuspended in sterile water supplemented with 2% glucose and stained with 0.5 µM FUN1 (Molecular Probes, Europe BV, Leiden, Holland) for 30 minutes at 37ºC. A Beckman Coulter XL-MCL flow cytometer (Beckman-Coulter Corp., Hialeah, FL, USA) equipped with a 15 nm argon laser was used. From each suspension 30000-50000 cells were analysed. The intensity of fluorescence emitted by cells treated with propofol infusion was determined at FL2 (575 nm) and compared with non-treated cells (control). In parallel experiments, yeast cells were treated with 0.1 mM sodium azide during 30 minutes, prior to incubation with propofol, as previously described [145],, in order to block efflux pumps; thereafter, the same flow cytometry analytical protocol was used. Intracellular accumulation of [ 3 H]-labelled itraconazole Candida cells were initially incubated under similar conditions as previously described for flow cytometry assays. The cells were harvested by centrifugation at 5000 rpm for 10 minutes at 4ºC, washed thrice, ressuspended in PBS at a final concentration of 2.5x10 8 cells.ml -1 and incubated with 0, 1.25 and 5 mg.ml -1 of propofol infusion at 37ºC, with continuous shaking at 300 rpm for 30 minutes [145]. Parallel experiments were prepared, but also involving a pre-incubation of the yeasts cells with sodium azide at 0.1 mM. The cells were washed thrice and [ 3 H]-labelled itraconazole was added to yeast suspensions at a final concentration of 3 µM, as previously described [145]; the cells were incubated in glass vials at 37ºC, with continuous shaking (300 rpm), during 1 hour and then harvested by centrifugation at 5000 rpm for 10 min at 4ºC, washed thrice with 3ml of ice-cold PBS containing 10 µM unlabelled itraconazole. The pellets were later ressuspended in 500 µl of PBS and the radioactivity was determined, following the addition of a scintillation cocktail (Optiphase “Hiphase3”, Perkin-Elmer), in a liquid scintillation counter (LKB Wallac, 1209 RackBeta). 105 Results Lipidic vehicle experiments All the described experiments were repeated in the presence of the propofol lipidic vehicle used in Fresenius® formulation (soya bean oil, egg lecithin, glycerol, sodium hydroxide and sterile water). Statistical analysis The effects of different concentrations of propofol upon germination of fungal cells and MFC values of the distinct antifungals were compared using one–way analysis of variance (ANOVA) and Student’s t -test. Significance was accepted at p <0.05. The SPSS 14.0 program for Windows was used to perform the statistical analysis. All susceptibility experiments were run in duplicate and growth and radioactivity assays in triplicate. Results In Candida strains, budding and germ tube formation were similar in presence of all tested concentrations of propofol infusion. In nonalbicans strains, the incubation with 5µg.ml -1 of propofol infusion resulted in a significant increase of cells with buds when comparing to control (71.5% ± 7.46 versus 26.6% ± 4.15, C. parapsilosis n =5 as a representative example) ( p <0.001). Conversely, a significant reduction of germ tube formation was observed in C. albicans strains comparing with non-treated yeasts (17.3% ± 6.29, versus 76.2% ± 8.69, n =5) ( p <0.001). The result of MIC determination revealed that all fungal strains were susceptible to the tested antifungals. Propofol infusion or its vehicle, at the tested concentrations, consistently promoted an increase of MFC mean values for Candida strains (Table 1), this effect being dose-dependent and statistically significant ( p <0.001); such effect was invariably observed with all strains of Candida and with all antifungals, in some cases the mean values increasing over 4 fold. MFC values in the presence of 5mg.ml -1 of propofol infusion or its vehicle increased at least 2 dilutions in all strains (above the error rate of the method) for fluconazole and voriconazole, more than 3 dilutions for amphotericin B and 4 to 5 dilutions 113 Results Part VI Adrenaline stimulates efflux pumps activity, growth and mitochondrial respiration in Candida albicans Background Candida spp. are the most common agents of bloodstream fungal infections [6]. High morbidity and mortality rates are often observed, mainly among intensive care units (ICU) patients [7, 275]. Despite the in vitro susceptibility to antifungals, particularly to azoles, a poor clinical outcome is often reported [6, 7, 48, 276], thus suggesting the development of in vivo resistance. Candida may develop resistance mechanisms during medical therapy that ultimately may lead to clinical failure [51]. However, discrepancies between in vitro susceptibility and the patient outcome show that drug resistance is not the single factor for the clinical results. The progression of Candida infections is often observed despite aggressive antifungal treatment, especially among ICU patients [6, 7, 48]. Such patients are invariably submitted to multiple lifesaving medications. In a recent study of patients admitted in ICU with bloodstream Candida infections we have shown that those receiving vasoactive amines showed a significantly higher risk of fungaemia-related poor outcome [7]. In humans, catecholamines target adrenoceptors which are a class of G protein-coupled receptors (GPCRs). GPCRs are transmembrane spanning proteins that transduce an extracellular signal (catecholamine binding) into an intracellular event (G-protein activation). Although firstly detected in mammals it is now clear that these receptors followed closely the evolutionary spectrum from archaebacteria to humans. GPCRs are abundantly expressed in yeasts, showing an identical GTP binding site to human GPCRs [277-281]. Considering these homologies between yeasts and human cells, we hypothesized that adrenaline and other vasoactive amine administered to ICU patients might also act on 114 Candida . We aimed to clarify whether adrenaline, acting on C. albicans might promote antifungal tolerance, resistance or both of clinical isolates to azoles, amphotericin B and caspofngin. The results obtained underscore the role of non-antifungal drugs like catecholamines, often prescribed in ICU patients, as promoters of antifungal tolerance or resistance. Material and Methods Strains The clinical isolates of Candida albicans (n=6) included in this study had been previously collected from blood cultures of patients with fungaemia admitted at different Intensive Care Units of Hospital São João, Porto, Portugal. All strains were susceptible to fluconazole, voriconazole, posaconazole, amphotericin B and caspofungin, according to the Clinical Laboratory Standards Institute (CLSI) M27-A3 protocol [282, 283]. C. albicans DSY 448 ( cdr1 Δ/Δ) [284], DSY 653 ( cdr2 Δ/Δ) [285], and DSY 654 ( cdr1 Δ/Δ cdr2 Δ/Δ) [285] with selective deletion of efflux genes were used (kindly gifted by Prof. D Sanglard). C. albicans strains gpr1 Δ / Δ (LDR8-5 strain) and gpa2 Δ / Δ (NM8 strain) [277] (kindly provided by Prof. Patrick Van Dijck), Δ ras1-2 / Δ ras1-3 (kindly provided by Prof. Gerald Fink) and ste2 Δ / Δ, ste3 Δ / Δ and ste4 Δ/Δ [145, 279] (kindly provided by Prof. David Soll) were used and the respective wild-type strains SC5314, P37005, P57072. Until testing, all strains were kept frozen in yeast extract peptone dextrose agar (YPD) (Difco Laboratories, Detroit, MI, USA) with 40% glycerol. For each experiment, the strains were subcultured twice on YPD medium at 35°C for 48 hours and afterwards cultured in YPD broth at 35°C, under constant agitation. Drugs and Chemicals Fluconazole and voriconazole were obtained from Pfizer (Groton, CT, USA), posaconazole from Shering-Plough (Kenilworth, NJ, USA), amphotericin B from Bristol-Myers Squibb (New York, USA) and caspofungin from Merck (Rahway, NJ, USA). Antifungal drugs were prepared following CLSI recommendations [282, 283] and maintained in stock solutions at -70°C until use. 115 Results The adrenoceptor agonists adrenaline (mixed α 1 , α 2 , β 1 and β 2 -adrenoceptor agonist) (Braun Medical, Barcarena, Portugal), noradrenaline (mixed α 1 , α 2 and β 1 -agonist) (Sigma-Aldrich, Germany), isoprenaline (selective β 1 and β 2 -agonist) (Sigma), medetomidine (selective α 2 - agonist) (Santa Cruz Biotechnology, Inc, Heidelberg, Germany) and phenylephrine (selective α 1 -agonist) (Sigma) were used. Drugs were dissolved in distilled water and kept at -20 ₀ C until use. Sodium azide was purchased from Sigma and dissolved in distilled water. The fluorescent probes FUN-1 was acquired from Molecular Probes (Molecular Probes, Europe BV, Leiden, Holand) and Rhodamine 6G (Rh-6G) from Sigma. Antifungal susceptibility testing of the clinical isolates Antifungal susceptibility testing of all clinical isolates was performed according to CLSI M27 A3 protocol [282, 283] in RPMI 1640 (Sigma). The minimal inhibitory concentration (MIC) of fluconazole, voriconazole, posaconazole, caspofungin and amphotericin B was determined [282, 283]. Strains were classified as susceptible (S), susceptible-dose dependent (S-DD) and resistant (R) to azoles according to the breakpoints defined by CLSI [282, 283]. Although definitive breakpoints have not yet been established for amphotericin B and posaconazole, strains with MIC ≤1 µg/ml were considered susceptible [286]. For caspofungin a MIC ≤2 μg/ml was considered S and >2 μg/ml non susceptible (NS) [282, 283]. MICs of adrenaline and noradrenaline were also determined using the above mentioned CLSI protocol [282, 283] (tested concentration ranging from 5 to 545 µM). The susceptibility tests with all the antifungals previously used were repeated in the presence of adrenaline (5, 27, 54, 108, 136, 273, 545 µM) and noradrenaline (11, 27, 136, 545 µM). Synergistic studies were performed according to the checkerboard procedure, as described in the Clinical Microbiology Procedures Handbook [239]. Fractional inhibitory concentration of drug A (FIC A ) was calculated as the ratio of the MIC of drug A in combination over the MIC of drug A alone. FIC B was the ratio of the MIC of drug B in combination over the MIC of drug B alone. The fractional inhibitory index (FIX) was calculated as follows: FIX= FIC A + FIC B . The interpretation of FIX was as recommended: ≤0.5 synergistic effect; >0.5 to <4.0 indifferent effect; ≥4.0 antagonistic effect [239]. 116 Efflux quantification by flow cytometry a) Yeast cell culture The yeast cells were incubated in YPD broth at 35⁰C until mid-exponential growth phase (optical density at 600nm [OD 600 ]= 0.4) and harvested by centrifugation. A suspension with 10 6 cells/ml was prepared in sterile distilled water supplemented with 2% glucose (Sigma). b) FUN-1 and Rh-6G staining Cells suspensions were incubated with 5, 27, 54, 108 µM of adrenaline for 90 minutes at 35ºC and stained with 0.5 µM of FUN-1 for 30 minutes, according to Pina-Vaz et al [145]. For Rh-6G staining, yeast suspensions were incubated with 5 µM Rh-6G for 30 minutes, washed twice and ressuspended in cold PBS (Sigma) supplemented with 10 mM of sodium azide. Yeast suspensions were kept in ice until cytometric analysis in a FACSCalibur flow cytometer (BD, Bioscience, Sydney). From each suspension 30,000 cells were analyzed and the intensity of fluorescence emitted by cells exposed to the different treatments was determined without staining (autofluorescence – af) and after FUN-1 and Rh-6G staining at FL2 (575 nm) and FL1 (525 nm), respectively. Results were compared with non-treated cells (control). Studies with adrenoceptor agonists Parameters like incubation time and agonist concentration were optimized using adrenaline. Adrenaline was tested at the concentrations of 5, 27, 54, 108, 136, 273 and 545 µM, for 30, 60 and 90 minutes. To further characterize the adrenoceptor that mediates the effect of amines upon clinical isolates, yeast suspensions were also incubated for 90 minutes, at 37 ⁰C with noradrenaline (5, 27, 54, 108, 136, 273, 545 µM), isoprenaline (5, 27, 54, 108, 136, 273, 545 µM), phenylephrine (5, 27, 54, 108, 136, 273, 545 µM, 1, 3 mM) and medetomidine (0.01, 0.1, 1, 10 µM) [287]. Effect of adrenaline upon Rh-6G staining of Candida CDR1 and/or CDR2 mutant strains Mutant strains DSY 448, DSY 653, DSY 654 and the wild-type strain were analyzed by flow cytometry following treatment increasing concentrations of adrenaline for 90 minutes and 117 Results staining with Rh-6G (according to the protocol described above). The amount of intracellular accumulation of Rh-6G was determined relatively to untreated cells (control) and compared between the different mutant strains. Effect of adrenaline upon membrane receptor deleted strains C. albicans selectively deleted in one of membrane receptors or proteins, gpr1 Δ/ Δ, gpa2 Δ/ Δ [277] , Δ ras1-2 / Δ ras1-3 [276, 278], ste2 Δ/ Δ, ste3 Δ/ Δ and ste4 Δ/ Δ [145, 279], and its respective wild-type strains, were incubated with 0, 5, 27, 54 and 108 µM of adrenaline for 90 min at 35ºC, stained with Rh-6G and analyzed according to the cytometric protocol described above. Effect of adrenaline upon Candida CDR1 and CDR2 gene expression C. albicans cell extracts for immunoblotting, previously exposed to 54 µM of adrenaline for 30, 60 and 90 minutes, were prepared by an alkaline extraction procedure as described previously [103]. Detection of Cdr1p and Cdr2p was performed as described previously [103]. Signals were revealed by exposure to Kodak BioMax MR films (GE Healthcare). Effect of adrenaline upon C. albicans SC5314 strain growth Following overnight culture in YPD broth medium a yeast suspension was diluted to an O.D. 600 0.07 in 50 ml of YEPD broth and incubated at 35ºC under agitation (150 rpm). Cells suspensions were exposed to the following conditions: no treatment (control), treatment with FLC 1 µg/ml (sub-MIC concentration), treatment with 54 and 108 µM of adrenaline, treatment with FLC 1 µg/ml plus 54 of adrenaline and treatment with FLC 1 µg/ml plus 108 µM of adrenaline. O.D. 600 was registered repeatedly during 18 hours. Effect of adrenaline upon oxygen consumption by C. albicans Late log phase cultures of SC5314 strain were centrifuged (18000g) for 4 minutes at 4 ºC and washed twice with cold sterile water. An amount of 1.5 g (wet weight) pellet was ressuspended in 100 ml of phosphate-buffered 50 mM, pH 6.0 with 0.1% cicloheximide (Sigma, St. Louis, MO, USA) and 6 ml of such suspension were incubated in a small reactor at 28ºC and 200 µl of glucose 1.55 M (Difco Laboratories, Detroit, MI, USA) were added. The O 2 consumption was continuously measured during 90 minutes with a Clark type electrode 118 YSI model 5775 (YSI Incorporated, Yellow Springs, Ohio, USA) in the presence of 16 µg/ml FLC, with 0 and 54 µM of adrenaline, and the oxygen uptake rate was determined. Data presentation All susceptibility assays were performed at least thrice. Mean values were compared using Student`s T-test whenever indicated. A p value <0.05 was considered statistically significant. The determination of FUN-1 and Rh-6G staining, oxygen consumption and strain growth were made in triplicate and the respective standard deviations values determined. Potency values were expressed as pEC 50 values, which are the negative logarithms of the molar concentration of the drug required to elicit half-maximal effect. Results Effect of adrenaline on antifungal susceptibility of C. albicans isolates – checkerboard results Checkerboard assays were performed in order to evaluate the interactions between adrenaline and antifungal drugs. Adrenaline, as well as noradrenaline, did not show antifungal activity upon all isolates even at high concentrations (MIC values ≥ 545µM). However, the median FIX for fluconazole combined with adrenaline or noradrenaline was 5 (range 2-17) (antagonistic effect). Although an antagonistic effect was obtained, the MIC values did not reach a breakpoint, except for one clinical isolate (that changed to susceptible –dose dependent, MIC=16 µg/ml). In contrast to fluconazole neither the antifungal activity of amphotericin B nor caspofungin were changed by adrenaline. Effect of adrenaline upon FUN-1 and Rh-6G staining In order to elucidate the antagonistic effect of adrenaline on the antifungal action of fluconazole, flow cytometric evaluations were performed using FUN-1. FUN-1 is a fluorescent probe that is converted by metabolically active yeasts in intra-cytoplasm vacuolar structures [269]. This probe has been previously used to study susceptibility of yeasts to azoles [147, 213]. In susceptible strains a high intensity of fluorescence is detected, while in resistant strains fluorescence decreases [147, 213]. This decrease in fluorescence intensity is due to the activity of energy-dependent efflux pumps which 119 Results actively export FUN-1 to the extracellular environment [145]. Furthermore, to confirm and quantify the effect of vasoactive amines upon efflux, another distinct efflux pump substrate was used (Rh-6G) [103]. Candida cells treated with adrenaline showed a dose-dependent decrease of FUN-1 fluorescence intensity in comparison with non-treated cells (figure 1), thus indicating an increase in the efflux activity with a pEC 50 = 5.81 ± 0.56. Although less pronounced, a similar effect was obtained with noradrenaline (pEC 50 = 4.58 ± 0.22) (figure 1). Since isoprenaline at concentration up to 545 µ M had no significant effect upon the efflux pumps activity it was possible to establish a rank order of potency: adrenaline>noradrenaline>>isoprenaline (figure 1). This rank order of potencies is achieved whenever an α-adrenoceptor-mediated effect is involved [288, 289]. Accordingly, cells treated with adrenaline showed a lower intensity of Rh-6G fluorescence than non-treated cells (figure 2). These results indicate the inhibitory effect of adrenaline on the accumulation of Rh-6G was concentration-dependent (figure 2). The same effect was observed with all the tested clinical isolates and with SC5314 strain. A concentration-dependent decrease of FUN-1 accumulation in all strains was observed with medetomidine (a selective α 2 -adrenoceptor-agonist) with a pEC 50 = 7.83 ± 0.28 while phenylephrine (a selective α 1 -adrenoceptor-agonist) in concentration up to 3 mM had no effect upon FUN-1 staining (figure 3). This result suggests that the effect of adrenaline upon C. albicans is mediated by a α 2 -adrenoceptor, as only with medetomidine cells were able to reduce stain accumulation. 120 Figure 1. Effect of adrenaline (mixed α 1 , α 2 , β 1 and β 2 ), noradrenaline (mixed α 1 , α 2 and β 1 ) and isoprenaline (selective β 1 and β 2 ) upon FUN-1 staining: a rank order of potencies was found (adrenaline>noradrenaline>>isoprenaline) showing a probable alpha mediated effect of adrenaline and noradrenaline on C. albicans clinical isolate (representative example). Data from three independent experiments is presented as mean ± standard deviation and shown as the percentage of FUN-1 accumulation relatively to untreated cells. Figure 2 . Effect of adrenaline (adr) upon Rh-6G staining: flow cytometric histogram representing the emitted fluorescence (Fl1) by a clinical isolate after 90 minutes of incubation with 0, 27 and 54 µM adr and stained with Rh-6G. A dose dependent reduction of Rh-6G accumulation is observed, shown by a decrease in the intensity of Fl1 fluorescence. 121 Results Figure 3 . Effect of medetomidine (selective α 2 agonist) and phenylephrine (selective α 1 agonist) upon FUN-1clinical isolate staining. A dose dependent decrease of FUN-1 staining was caused by medetomidine, while phenylephrine showed a minor effect. Data from three independent experiments is presented as mean ± standard deviation and shown as the percentage of FUN-1 accumulation relatively to untreated cells. Effect of adrenaline upon Rh-6G staining in CDR1 and/or CDR2 mutant strains The results described strongly suggest that adrenaline acts as a promoter of efflux pumps activity. However to demonstrate the role of this effect in antifungal resistance, we assessed the effect of adrenaline upon the efflux by strains with diminished capacity to extrude since the genes encoding for the two most important efflux pumps had been deleted. Thus, strains without CDR1 (DSY448), CDR2 (DSY653) genes, and also both CDR1 and CDR2 (DSY654) were used. As expected, in the DSY654 ( cdr2 Δ/Δ cdr1 Δ/Δ) strain the effect of adrenaline was null and Rh-6G accumulated inside the cell. Conversely, in the parental strain a major reduction of Rh-6G staining was found. Intermediate result were observed in the DSY653 ( cdr2 Δ/Δ) and DSY448 ( cdr1 Δ/Δ) (figure 4). These results indicate that adrenaline acts at the CDR1 and CDR2 efflux pumps, stimulating Rh-6G extrusion. 128 In an attempt to unveil the possible adrenaline receptor the effect of adrenaline upon Rh6G staining was studied in GPCR-deleted C. albicans strains and compared with the corresponding wild-type strains. We could conclude that adrenaline acts through a pheromone receptor Ste3 and a Gpa alpha protein, since in strains ste3 ∆/∆ and gpa2 Δ / Δ (NM8) adrenaline did not impair the Rh-6G staining. Aiming at uncovering the mechanisms underlying the increased efflux, immunoblotting assays were performed. The results revealed that adrenaline does not act as an inducer of the expression of CDR1 and CDR2 genes. However, adrenaline stimulates ATP production, and increases the activity of energy-dependent efflux pumps. In addition to increased efflux activity, other mechanisms can allow the cell to overcome antifungal drug induced stress [237, 295]. The mitochondrial electron transport chain has been implicated in drug tolerance or resistance and it is a very important cell apparatus for production of ATP [296299]. In brief we found that adrenaline enhances drug efflux activity mediated by CDR1 and CDR2 pumps. This increase in efflux pump activity requires energy whose production is also stimulated by adrenaline. Interestingly, despite the presence of fluconazole, adrenaline can improve the fitness of fungal cells by stimulating energy production and fungal growth, thus allowing them to overcome the stress caused by the antifungal drug. Overall, it is plausible to postulate that adrenaline can trigger ATP production through a GPCR by acting on the electron transport chain (via putatively a secondary messenger). In turn, these intracellular downstream events can increase the activity of efflux ATPdependent pumps ( CDR1 and CDR2 ) and yeast cell growth, promoting concomitantly the tolerance or resistance to antifungal drugs. Hospitals face at present an increasing emergence of resistant fungal pathogens. The knowledge on underlying mechanisms of induction of drug resistance by non-antifungal drugs like catecholamines will allow the development of new therapeutic strategies. 129 Results Part VII In vivo synergistic effect between ibuprofen and fluconazole in Candida albicans Background Candida infections range from superficial mucocutaneous infections to life-threatening invasive infections. Especially the last one represents an increasing challenge for clinicians, with an attributable mortality around 40% [6, 7, 300]. The emergence and spread of antifungal resistance is one of the main factors that are responsible for this trend. Among azoles, fluconazole represented a landmark in the treatment of Candida bloodstream infections. However, its extensive use both for prophylaxis and therapy resulted in the emergence of fluconazole resistance [301-303]. The major mechanism responsible for high level azole resistance in Candida albicans clinical isolates is the overexpression of plasma membrane efflux pumps, the ATP-Binding Cassette (ABC) transporters, namely CDR pumps, or the major facilitator superfamily (MFS) transporters, MDR pumps [24, 27, 98, 101]. The knowledge of the underlying resistance mechanisms is of crucial importance since it could support approaches to achieve its reversion, thus leading to the development of new therapeutic strategies. Our previous studies showed that antifungal resistance conferred by increased efflux activity in Candida clinical strains could be reverted by ibuprofen [101, 145]. Ibuprofen ([2-(4-isobutylphenyl)-propionic acid]) is a non-steroidal anti-inflammatory drug (NSAIDs) used for its antipyretic, analgesic, and anti-inflammatory effects. In humans, it inhibits the synthesis and release of prostaglandins as mediators of inflammation. Ibuprofen acts synergistically with pyrazinamide, an tuberculostatic drug [182], azoles [101, 145, 183] and amphotericin B [184]. Previously, we had showed that ibuprofen acts synergistically with fluconazole, voriconazole and itraconazole, by inhibiting efflux pumps 130 mechanisms, thus promoting intracellular accumulation of [H 3 ]- itraconazole in Candida cells overexpressing CDR1 and CDR2 genes [101, 145]. Generally, azole exposure triggers several cellular and molecular mechanisms in Candida albicans , including the overexpression of genes related with antifungal resistance, mainly efflux pumps [118, 302, 304, 305]. With the development of new molecular biology methods, mainly DNA microarray technology, it was possible to get insights about the molecular basis involved in the evolution of antifungal resistance [23, 302, 306]. Herein we aimed to study the in vivo synergistic effect between these two drugs using a C. albicans systemic model of infection and to unveil the transcriptional profile involved in the reversion of fluconazole resistance by ibuprofen. With this study we clarified the ability of ibuprofen to revert azole resistance, as well as elucidated about molecular changes associated with resistance reversion. Material and methods C. albicans strains and culture conditions A Candida albicans blood stream isolate (CaS) susceptible to fluconazole, voriconazole and posaconazole was used throughout this study. In order to induce a resistant phenotype, a yeast suspension containing 10 6 cells in 10 ml of RPMI 1640 medium (RPMI 1640; Sigma, St. Louis, MO USA) was repeatedly incubated with fluconazole (FLC; Pfizer, Groton, CT, USA) at a final concentration of 16 µg/ml (therapeutic serum levels achieved during antifungal therapy) in order to induce a resistant phenotype (CaR) [307, 308]. Yeast suspensions were grown overnight at 35 ° C under agitation (150 rpm). Cultures were daily transferred to fresh medium with and without the same antifungal concentration for a total of 60 days. Each day 1ml aliquot from each subculture was mixed with 0.5ml of 50% glycerol and frozen at - 70°C for later use. The Minimal inhibitory concentration (MIC) value of azoles was determined for the parent strain and the successive fluconazole exposed isolates. 131 Results Microdilution antifungal susceptibility testing Assessment of the antifungal susceptibility profile was performed according to the CLSI M27 A3 protocol in RPMI 1640 culture medium (Sigma)[33]. The minimal inhibitory concentration (MIC) of FLC, voriconazole (VRC; Pfizer) and posaconazole (PSC; ScheringPlough, NJ) was determined [33]. Strains were classified as susceptible (S), susceptible-dose dependent (S-DD) or resistant (R) to azoles according to the breakpoints defined by CLSI [33]. Although definitive breakpoints have not yet been established for posaconazole, a MIC ≤1 µg/ml was considered susceptible. Effect of ibuprofen upon azole resistance In order to study the effect of ibuprofen (Ibu; Sigma) on the resistant phenotype displayed by CaR strain, MIC value of FLC, VOR and PSC was re-determined as described above in the presence of 100 µg/ml of ibuprofen, a concentration previously described to impair azole extrusion [101, 145]. In vivo effect of ibuprofen upon fluconazole resistance All in vivo investigations were performed in the animal facility of the Cardiovascular Research & Development Unit Faculty of Medicine, University of Porto, in accordance with the European Directive 86/609, transposed to the Portuguese Law by DL 129/92 and by Portaria 1005/92. A murine model of disseminated candidosis was used to study the effect of ibuprofen upon fluconazole resistant phenotype. Female specific-pathogen-free BALB/c mice (age, 6 to 8 weeks; weight, 17 to 20 g; Charles River Laboratories, Barcelona, Spain) were housed in microisolator cages with five animals per group, having access to food and water ad libitum . To induce disseminated infection mice were injected with 5x10 5 cells of the CaS or the CaR strain in 0.1ml of sterile saline via the lateral tail vein. The fluconazole effective dose in reducing the pathological effects of i.v. C. albicans challenge relative to untreated mice (control) was defined as the 50% effective dose (ED 50 ) [309]. Therapy was initiated 3 hours after yeast challenge and was administered intraperitoneally once a day for a total of 4 days. Mice were treated with FLC (8 to 60 mg/kg of body weight/day), with Ibu (10 or 20 mg/kg/day) [182, 310] or FLC (8 to 60 mg/kg of body weight/day) + Ibu (10 or 132 20 mg/kg/day). Mice weight was daily registered and at day 4 post-infection mice were euthanized and the kidneys were aseptically removed. The right kidney from all mice was homogenized in 5 ml of phosphate buffer saline (PBS; Sigma) and weighted. Serial dilutions of the homogenate were plated onto YPD agar in triplicate and incubated at 30°C for 48 hours. The fungal burden was calculated as the number of colony forming units (CFU) per gram of tissue. The kidney fungal isolates were frozen in YPD broth with 50% glicerol at - 70°C for later MIC azole determination according CLSI M27 A3 protocol [33]. For histological studies the left kidneys were fixed in 10% phosphate-buffered formalin, embedded in paraffin, sectioned, and stained with periodic acid-Schiff (PAS) stain. Slides were observed under a Zeizz Axioskop 40 microscope and acquired with an Axiocam MRc5 Zeizz. RNA extraction Strains CaS and CaR were grown in 50-ml YPD broth at 180 rpm and 30°C until an optical density at 600nm of approximately 0.8 was reached. CaR strain was grown in the presence of 16 µg/ml of FLC (CaRFLC) and of 16 µg/ml of FLC plus 100 µg/ml of ibuprofen (CaRFLCIbu). Total RNA was extracted using the hot acid phenol method, as described by Köhrer & Domdey [311]. RNA concentration was assessed by Nanodrop ND-1000 and the RNA quality and integrity levels were controlled by capillary electrophoresis in the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA), according to the manufacturer’s instruction. Only samples yielding a 28S rRNA/18S rRNA ratio ranging from 1.6 to 2.2, with a “RNA Integrity Number” (RIN) higher than 7.0 and showing the absence of degradation were used. RNA samples were stored at -70°C for later use. Probe preparation and microarray hybridization All the experiments were carried out using C. albicans microarrays manufactured by Agilent Technologies. A RNA/primer mix containing 50 µg RNA, 1.25 µ g Oligo dT 12-18 , (Invitrogen, Carlsbad, CA) was incubated at 70°C for 10 minutes (min) and chilled on ice for 5 min. Then, a labeling mixture containing dGAC – mix 0.1mM, dTTP 0.03mM, aa-dUTP 0.08 mM, first strand buffer 1x, DTT 0.01M, Superscript II Reverse Transcriptase 400U (Invitrogen) was added and the reaction was incubated at 42°C for 60min. Residual RNA template was 133 Results degraded by hydrolysis. Briefly, the reaction mixture was incubated at 95°C for 2 min and placed on ice immediately; 10 µ l NaOH 1M (Sigma) and 10 µ l EDTA 0.5M (Sigma) were added to the reaction and incubated at 65°C for 15min. Afterwards, 25 µ l HEPES buffer 1M (pH 7.5, Sigma)were added. Samples were purified using the Microcon - 30 (Amicon Microcon YM-30, Millipore) columns, according to the manufacturer’s instructions and were coupled to Cy3 and Cy5 fluorophores. Before hybridization, free dyes were removed using Chromaspin-30 (Clontech) columns, the efficiency of cDNA synthesis and dye incorporation was measured spectrophotometrically in the Nanodrop ND-1000. For full slides, 200 ng of Cy3/5 labeled sample were used. Hybridization was performed according to the labeling kit Quick Amp Labeling for Two-Color Microarray-Based Gene Expression Analysis protocol (from Agilent Technologies). A common reference design with dye-swap replicates was used. Total RNA obtained from CaS strain was used as hybridized against samples studied. Control of experimental background was performed through self-self hybridization; a total of four experiments were made. Image acquisition and data processing The microarrays were scanned with an Agilent G2565BA microarray scanner and the fluorescence intensities were obtained with Agilent Feature Extraction Software Protocol GE2. Pre-processing of the data was performed using the Biometric Research Branch (BRB)- ArrayTools v3.4.0 software. Statistical analysis and functional annotation of the data For data analysis the statistical software R and the package Limma from Bioconductor (www.bioconductor.org) were used. Microarray normalization was performed using the method loess and within arrays quantile [312]. After normalization, median gene expression was determined for each ORF. Relative gene expression and statistically significant differences found between the different samples were determined with the software Limma package. Significant differences were encountered using the Empirical Bayes 134 statistical test [313]. Hierarchical clustering of the normalized and dye swap averaged samples was performed using the method complete linkage . Only probes with a fold change (FC) greater than 2 and adjusted p <0.05 were used in analyses. Gene ontology identification was performed for significant differentially expressed genes using the Web tool GoTermFinder available on the website of the Candida Genome Database (http://www.candidagenome.org/cgi bin/GO/goTermFinder). Quantitative RT-PCR In order to confirm microarray data, cDNA was synthesized from 100ng in 20µl of total RNA from CaS, CaRFLC and CaRFLCIbu strains using a Superscript III reverse transcriptase kit (Invitrogen) according to manufacturer`s instructions. Quantitative realtime PCR was performed using PerfeCTa SYBR green Fast Mix (Quanta Biosciences) on a Realplex Mastercycler instrument (Eppendorf, Madrid, Spain) and according to the following program: 1 minute hot start at 95°C, a 35-cycle program composed of 15-seconds (s) denaturation step at 95°C, a 30-s annealing step at 60°C, and a 30-s extension step at 60°C, ending by a 5-min final extension step at 60°C. The primers used were designed using OligoExplorer program (listed in Table 1). ACT1 was used as the normalization gene. 135 Results Table 1. Sequences of primers used in RT-PCR Primer name Primer sequence CDR11 - F 5´-GGTCACGAATCTACTTTGGAA-3´ CDR11 - R 5´-CGGGTCTCATAATGGCAT-3´ NAG3 - F 5´-CAAGGGGGTGGAAAAGAT-3´ NAG3 - R 5´-TCGTTGTAGTCAGTGTGTGG-3´ MDR1 - F 5´-CCCGAAAACCCTCAAAAT-3´ MDR1R 5´-CGACTCTTCCAATACCAAAATC-3´ ERG1 - F 5´-GACGAGACCATTACTATCCCTT-3´ ERG1 - R 5´-TTACACCATCAACGGCAT-3´ ACT1 - F 5´-ATGGACGGTGAAGAAGTTG-3´ ACT1 - R 5´-CAAGAGATGGGAAAACAGC-3´ Results In vitro induction of resistance The repeated exposure of the susceptible strain (CaS) to therapeutic serum concentrations of FLC the acquisition of an azole cross-resistant phenotype to FLC, VRC and PSC (table 2). Table 2 resumes MIC values assessed following 60 days of incubation with FLC. Effect of ibuprofen in azole susceptibility The azole susceptibility pattern of the parental (CaS) and the azole resistant induced strain in the absence and presence of ibuprofen is detailed in table 2. The MIC values decreased in the presence of Ibu for all strains, the phenotype changing from R to S regarding all the tested azoles (table 2); meanwhile, the MIC values remained unchanged regarding the susceptible strain (table 2). 136 Table 2. Minimal inhibitory concentrations (MIC) and phenotypes of the Candida albicans parental susceptible (CaS) and resistant (CaR) strain after exposure to fluconazole (FLC) to FLC, voriconazole (VRC) and posaconazole (PSC) alone and in combination with subinhibitory concentrations of ibuprofen (Ibu; 100 µg/ml). MICs were determined according the CLSI M27-A3 protocol. Susceptible, susceptible dose dependent and resistant phenotypes are represented as S, S-DD and R, respectively. MIC (µg/ml)/ phenotype Strains FLC FLC+Ibu VRC VRC+Ibu PSC PSC+Ibu CaS 1/S 1/S 0.06/S 0.06/S 0.03/S 0.06/S CaR >64/R 4/S >8/R 0.06/S >8/R 0.125/S In vivo synergistic effect between FLC and Ibu In order to investigate the potential clinical application resulting from the synergistic effect between FLC and ibuprofen experiments were conducted in a murine candidosis model. The fungal burden of CaS and CaR strains in mice kidneys were determined after treatment for 4 days with 8 to 60 mg/kg of body weight/day of FLC alone or combined with 10 or 20 mg/kg of body weight/day of ibuprofen. On mice infected with the CaS strain and treated with 30 mg/kg of body weight/day (ED 50 ) of FLC a significant reduction ( p <0.001) of CFU/g of kidney was found when compared with untreated mice (figure 1). On mice infected with the CaR strain no significant reduction on fungal burden was achieved even when treated with 60 mg/kg of FLC. The group of mice infected with CaR strain treated or untreated with FLC showed the highest weight loss during at the first and at the fourth day of infection (figure 2). However, when FLC was associated to the two concentrations of ibuprofen, a significantly reduction of CaR fungal burden ( p <0.001) was observed, especially in mice treated with 30 mg/kg of FLC plus 20 mg/kg of ibuprofen (figure 1). These mice also showed weight increase at the first and at the fourth day of infection (figure 2). 137 Results Interestingly, the yeast isolates recovered from mice kidneys retained the susceptible and the resistant phenotype as displayed previously to infection with CaS and CaR strains, respectively. Azoles MIC values remained unchanged. Figure 1. In vivo antifungal synergistic effect between fluconazole and ibuprofen against C. albicans systemic infection. Mice infected with the parent susceptible strain (CaS) and the induced resistant strain (CaR) were treated with 30mg/kg/day of fluconazole (ED 50 ) (FLC), and 10 or 20 mg/kg/day of ibuprofen (Ibu) intraperitoneally during 4 days. The right kidneys (from 5 mice per group) were removed, homogenized, weighed, serially diluted and plated onto YPD agar plates. Colony forming units (CFU) per gram of kidney were determined and plotted as mean value and respective standards error. 144 Discussion A high mortality rate is often observed in immunocompromised patients with systemic fungal infections, despite being often prescribed long courses of antifungal therapy. In addition, antifungal therapeutic options are limited, being the azoles the most commonly used drugs [314]. The widespread use of fluconazole, especially for prophylaxis, has selected Candida species with easily inducible resistance, such as C. glabrata [315] and C. tropicalis [306]. The development of resistance by C. albicans after in vitro fluconazole exposure has been widely demonstrated [302, 304, 305]. Aiming to reproduce in vivo findings occurring during antifungal treatment, we daily exposed a susceptible C. albicans strain to serum concentration levels of fluconazole. As expected fluconazole exposure resulted in the development of cross resistant profiles to azoles. The major mechanism described as responsible for azole resistance in clinical Candida albicans isolates is overexpression of plasma membrane efflux pumps [22, 96, 117]. The use of DNA microarray technology push forward the knowledge of the protagonists involved in cellular processes [23, 96, 152, 153, 302, 304, 306, 315]. The transcriptional responses of C. albicans after fluconazole exposure showed an increased expression of genes encoding CDR efflux pumps as well as of genes involved in the ergosterol biosynthesis, as expected [96, 117, 302, 304, 305]. Similarly to C. albicans , species like C. glabrata , C. tropicalis and C. parapsilosis also use efflux pumps as the main tool for the development of azole resistance [153, 306, 315]. During the recent years several approaches have been used in order to overcome the development of antifungal resistance. The inhibition of antifungal extrusion by blocking specifically ABC efflux pumps is a possible way to impair multiple drug resistance. The use of antifungals which are not substrates of efflux pumps, of pump blockers that inhibit the antifungal extrusion (inhibiting H + ATPase reducing the energy required for efflux activity) or the increase of antifungal uptake rate in order to maintain a high intracellular concentration of the drug are all strategies to achieve a high concentration of the antifungal compound at its site of action [22]. The pursuit of knowledge of efflux pumps mechanism in Candida 145 Results arises from the homology between yeasts and human cells. In eukaryotic neoplasic cells, ATP-dependent drug efflux pumps, such as P-glycoprotein (P-gp) which is encoded by MDR1 gene, are important mediators of resistance, contributing to failure of cancer therapy. Over the years different strategies were undertaken in order to overcome drug resistance by efflux, including the development of agents able to modulate P-gp activity, such as pump substrates like FK506 [176] or cyclosporine A [177], calcium channel blockers like verapamil [316] or anti-malaric analogs [317]. Azza et al demonstrated that ibuprofen could inhibit methotrexate efflux transporters in the human kidney [318]. A similar effect was described regarding FK506 (tacrolimus), a potent immunossuppressor agent used for the prevention of allograft rejection and as a calcineurin inhibitor, shows a synergistic effect when combined with antineoplastic agents on tumor cells, decreasing or even suppressing multidrug resistance by competing with cytotoxic drugs for the P-glycoprotein [319-321]. Thus, a similar approach could be applied to Candida albicans cells, using nonantifungal drugs exhibiting a synergistic effect with antifungals that could induce a reversion of resistance. In Candida , FK506 has shown to be a potent inhibitor of the calcineurin pathway, rendering the normally fungistatic azole effect to fungicidal [169, 179]. The calcineurin pathway has been shown to be critical for survival and stress responses in several fungi, including the in vitro antifungal activity against Saccharomyces cerevisiae , C. albicans and Cryptococcus neoformans [169, 322]. In the present study, a decreased of the MIC levels for the three azoles tested in the presence of ibuprofen was registered in strain CaR, changing the phenotype from azole resistant to a susceptible one. The synergism between posaconazole and ibuprofen was hereby demonstrated for the first time. The in vivo assays clearly demonstrated that ibuprofen acts synergistically with fluconazole in mice infected with the CaR strain. A significantly reduction of CFU kidney counts were obtained in mice treated with both drugs, as well as a recovery of mice weight. These results were attested by the histological assays. A dramatic increase in fungal cell numbers was observed in the kidneys of mice infected with CaR strain untreated or treated with 146 fluconazole. However, fluconazole in combination with ibuprofen promoted fluconazole activity, histologically showing scarce fungal cells. C. albicans cells recovered from mice treated with fluconazole plus ibuprofen still displayed a resistant phenotype to fluconazole. Consequently, we can conclude that the presence of ibuprofen is mandatory for the reversion of the azole resistance. Trying to scrutinize the molecular base involved in the ability of ibuprofen to revert antifungal resistance we used microarray analysis of CaRFLC comparing the transcriptional profile to CaRFLCIbu strain. The CaRFLC strain revealed an overexpression of ERG and CDR genes, as expected [302, 304, 305]. The presence of ibuprofen significantly increased the expression of CDR and MDR efflux pumps ( CDR4 , MDR1 , NAG3 and NAG4 ). Interestingly, these findings may be seen as cellular salvage attempt mechanisms to overcome the inhibitory capacity of ibuprofen. Yeasts cells have the capacity to trigger cellular salvage pathways when facing stress conditions like in the presence of antifungals or other drugs [22, 160, 237]. Similarly, regarding echinocandins, the ability to grow at high caspofungin concentrations and has been suggested to relate to a compensatory increase in cell wall chitin [128, 130]. This salvage mechanism strengths cell wall damaged by exposure to echinocandins. MRR1 and TAC1 are all transcription factors of MDR1 and CDR genes [96, 118, 152, 305, 323-325]. Despite the significative increase of MDR1 gene expression displayed by CaRFLCIbu strain, MRR1 expression remained downregulated and no difference was seen between exposed and non-exposed isolates to ibuprofen. On the other hand, the presence of ibuprofen promoted the downregulation of CDR11 , ERG251 and and the transcription factor UPC2 . In fact, these results strongly suggest that ibuprofen could act at the transcriptional level. However, and due to the contradictory gene expression profiles found and their respective transcription factors, this assumption still needs further investigation. Overall, our results stress the fact that ibuprofen can inhibit efflux pumps, either by blocking access to the binding site or by blocking the expression of the pumps. Besides, since it is not immunosuppressive, this anti-inflammatory drug has advantages over FK506. 147 Results Further studies are being addressed in order to uncover the main mechanism of ibuprofen inside the yeast cell as well as to assess its influence in the dynamics of the induction of antifungal resistance. By allying anti-inflammatory and analgesic properties, ibuprofen in combination with fluconazole could play a relevant role in a therapeutic strategy for severe fungal infections. CHAPTER I V Conclusions and Future Perspectives 151 Conclusions and Future Perspectives Conclusions Over the last 30 years medical advances led to a significant increase of life-threatening fungal infections. The incidence and mortality rates associated with invasive candidosis have remained unchanged for more than a decade despite the advances in the field of antifungal therapy. Such infections could be treated more effectively if faster and more specific diagnostic and therapeutic approaches were available. Preventive safe strategies targeting patients with a high-risk profile, the development of new diagnostic tools for early identification of fungal species, including innate resistant species or those that are more prone to develop multidrug resistance, especially in patients submitted to long term therapy are of utmost importance. In conjunction, preventive attitudes should be imperatively implemented in order to reduce the number of health care related infections. The comprehension of the routes of transition is essential to overcome this objective. Given the association between antifungal exposure and the development of resistance, prophylaxis must be selectively restricted to high-risk patients. Apparently there is no class of antifungal agents that is immune to the development of acquired resistance. It is essential that laboratories start performing routinely in vitro susceptibility testing especially in isolates from invasive infections, isolated from patients receiving antifungal prophylaxis and in strains isolated from patients who do not respond to therapy. Intricate signaling networks govern the development, morphogenetic transitions but also the evolution of antifungal drug resistance in Candida . Cell stress may be caused by other concomitant factors apart the presence of the antifungal drug. Medication often administered to critical care patients may trigger a medley of escapes responses in order to ensure survival which may also be responsible for the discrepancy between in vitro and in vivo susceptibility profile. The knowledge of the mechanisms involved in antifungal resistance will help to design effective measures to reverse it. Ibuprofen may represent a hopeful compound in the reversion of azole resistance by efflux activity. 152 Regarding echinocandins, point mutations in FKS genes are responsible for the decreased susceptibility; such findings stress the need for the development of novel molecules with higher affinity to the target. In brief, the research presented has led to the following findings: Following the assessment of the genetic relatedness between simultaneous and/or successive Candida albicans isolates from fungaemia patients and of the antifungal susceptibility profile (detailed in Part I) the following conclusions were obtained: • C. albicans colonization and/or infection of different body sites may represent a predisposing condition or an initial step towards the subsequent fungaemia development; • The resistance of blood infection by successive isolates with similar genotypes suggests the failure of antifungal therapy; • Isolates displaying the same or similar genotypes were obtained from patients who shared the same hospital department, suggesting the nosocomial origin of the infection in such cases; • The induction of azole resistance was observed in similar strains from different patients admitted in distinct periods of time, suggesting that the strains were endemic to the hospital environment; • Hospital acquired bloodstream infections are linked with a higher risk of antifungal resistance, thus needing close monitoring. The novel flow cytometric protocol developed to measure yeast cell wall chitin (detailed in Part II) helped to understand the effect of echinocandins on fungal cell wall: • Flow cytometry protocol showed to be a simple and reliable assay to accurately quantify cell wall chitin in yeast cells; 153 Conclusions and Future Perspectives • No relationship between chitin content and the caspofungin susceptibility profile was found; • The accuracy of this novel simple and reliable methodology can predict the occurrence of the paradoxical effect, representing a valuable tool for the detection of antifungal compensatory mechanisms in the presence of high echinocandin concentrations. In Part III the first case report describing acquisition of echinocandin resistance by C. glabrata following anidulafungin treatment was addressed. The main conclusions were: • The acquisition of resistance to anidulafungin was associated with an increase in caspofungin and micafungin MIC value, suggesting the development of cross-resistance between these three echinocandins drugs; • No relation between chitin amount and antifungal resistance was established; • Structural alterations in the HS1 of FKS 2 molecule due to the Ser663Pro substitution and a Phe659 deletion lead to a dramatic decrease of anidulafungin efficacy in vivo . Studies related to the contribution of mitochondrial respiration in the intrinsic fluconazole resistance displayed by C. krusei (Part IV) revealed that: • An alternative respiratory pathway, cyanide-resistant, was described for the first time as a characteristic of C. krusei species; • Such alternative pathway due to an alternative oxidase is unrelated to fluconazole resistance; nevertheless it protects C. krusei from oxidative stresses; • The alternative respiratory pathway is a potential target that should be taken into account considering the development of new therapeutic strategies in the case of C. krusei infections. Environmental surveillance The conventional volumetric air sampling method using the Andersen one-stage sieve impactor was used for air surveillance. This standard method is recommended to collect and quantify airborne fungal species. Eighteen impactor air samples with six different impact volumes of air (14, 28, 56, 84, 140 and 280 L) were collected in each room, at a flow of 28 L ⁄min, as recommended (18). Larger air volumes were not collected due to dehydration of agar culture medium for prolonged air exposure. Impactor air samples were cultured using the DG18 medium (19, 20) and incubated at 25C and 37C, during 10 d. Results were expressed as number of colony-forming units per cubic meter (CFU ⁄m 3 ) of analyzed air. Regression through the origin was applied to the data and the concentration of CFU in the analyzed air determined from the slope of the regression line. For each room, the total number of colonies was plotted against the volume of analyzed air. Identification of fungal colonies was based upon macro and microscopic morphological aspects, accordingly the standard mycological methods (21). Sample collection was conducted in phases of four consecutive weeks each (sampling phases performed every 3 months), before and after the renovation works. Statistical analysis SPSS 13.0 (SPSS Inc., Chicago, IL, USA) application was used for data elaboration and analysis. Student’s ttest for paired and two independent samples was used during statistical analysis. The comparison of infection incidence in the periods before and after renovation works was performed determining z-values, the population considered at normal distribution. Alpha was set to 0.05 and all reported P-values were two tailed. Results Haematological malignancies and fungal infections A total of 403 admissions (198 before and 205 after the renovation works), corresponding to 221 patients (119 women and 102 men), were made to the Haemato-Oncology Unit during the 28 months surveillance period. Patients’ age ranged between 15 and 86 years old (average of 54 years old). The haematological patients admitted at the unit corresponded to 75 patients with acute myeloid leukaemia (33.9%), 25 with acute lymphoblastic leukaemia (11.3%), 4 with blast crisis of chronic myeloid leukaemia (1.8%), 4 with chronic lymphoblastic leukaemia (1.8%), 5 with myelodysplastic syndrome (2.3%), 1 with plasma cell leukaemia (0.5%), 11 with Hodgkin lymphoma (5.0%), 51 with non-Hodgkin lymphoma (23.1%), 35 with multiple myeloma (15.8%) and 10 with aplastic anaemia (4.5%). The admissions of both periods are more detailed in Table 1. The incidence of fungal infections in haematological patients admitted at unit was 6.6% and 4.9% (P= 0.001), respectively, in the periods before and after the renovation works, corresponding to 0.33 patients per 100 d before works and 0.26 patients per 100 d after installation of protective measures (Table 1). These fungal infections also corresponded to 0.64 infections per 100 d of neutropenia before renovation and 0.49 infections per 100 d of neutropenia in the latter period. Mould infections, proven and probable, were significantly reduced after the renovation works (incidence of 1.5% and 0%, respectively, before and after renovation; P< 0.001), as well as proven yeast infections (incidence of 1.5% and 0%, respectively, before and after renovation; P< 0.001). The details of the patients diagnosed with proven and probable fungal infections are described in Table 2. Patients 1 and 6 stayed at haematology unit during the construction period, while the other four patients were admitted and left the unit before this period. Pre-construction period showed more fungal infections compared to construction period (incidences of 9.5% vs. 3.7%) probably due to the decrease of admitted patients for treatments causing longer expected neutropenia. After the unit renovation, there were no proven or probable fungal infections, being diagnosed 10 cases of possible fungal infection (in the previous period of 14 months, seven cases were diagnosed, Table 1). Of the previous 17 cases, three were PCR positive for Aspergillus fumigatus. However, this test is not still accepted as microbiological criteria. Nevertheless, it was especially relevant to the fact that there were no deaths in patients with the diagnosis of possible fungal infection in the latter period against three patients with poor outcome in the first 14 months (Table 1). More severely ill patients Table 1 Admissions, duration of neutropenia, unfavourable outcome and fungal infections in haematological patients, before and after unit renovation Before renovation After renovation Admissions 198 205 Non-neutropenia 51 43 Short neutropenia 68 74 Long neutropenia 79 88 Deaths 16 8 Fungal infections (FI) 13 10 Yeasts 1 30 Moulds 1 30 Possible FI 7 10 1 Proven and probable infections. Fungal infection after haematology renovation Araujo et al. 438 ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard were admitted during the latter period in the new protected wards compared to the wards without HEPA filters. The 10 cases of possible fungal infection detected after the renovation works corresponded to 7 patients admitted in the new rooms with HEPA filters and 3 patients admitted in the other rooms without air filtration. Haematological patients with expected prolonged neutropenia (more than 10 d) or submitted to autotransplant were preferentially admitted in the new rooms. All patients diagnosed with fungal infection stayed at least 3 wk into the haematology unit and were frequently neutropenic for longer periods (the average was 23 d in both studied phases), being simultaneously under administration of large spectrum antibiotics due to the systematic isolation of other microbial agents from clinical samples and ⁄or central venous catheters. Patients with acute myeloid leukaemia submitted to the induction treatment were more susceptible to acquisition of fungal infections, both yeast and mould infections, compared with patients with other haematological malignancies and ⁄or submitted to other treatments. A single case of probable mould infection was detected in a patient diagnosed with non-Hodgkin lymphoma (patient 6 shown in Table 2), being also found during the entire study a single case of possible fungal infection in each group of haematological patients admitted with acute lymphoblastic leukaemia, myelodysplastic syndrome, aplastic anaemia and non-Hodgkin lymphoma. Thirtyeight autotransplants were successfully performed after the renovation works; these patients were never diagnosed with a fungal infection. A. fumigatus was the most frequent and detected mould during the 28 months surveillance period, being registered a single case of possible infection by Mucorales in a patient admitted before the unit renovation. The three described yeast infections were all caused by different organisms. Two cases were classified as nosocomial yeast infections (patients 2 and 3; Table 2). Economical impact Considering the group of patients diagnosed with all fungal infections, the average of hospitalization days was reduced 3.4 d in the latter period. Patients with a proven or probable fungal infection stayed from 21 to 75 d in haematology unit (average of 41 hospitalization days). Although there was also a reduction in the number of patients diagnosed with a fungal infection, the administration of some antifungal agents did not follow this tendency. The consumption of voriconazole and caspofungin in the Haemato-Oncology Unit was reduced 66% and 59%, respectively, in the period after the renovation works, while increased the use of deoxycholate amphotericin B, liposomal amphotericin B and fluconazole (Table 3). The final cost with antifungal therapy was reduced by 17.4% (around €71 000) during the second arm of the study. The usual choice for empiric antifungal therapy of moulds was an amphotericin B formulation, Table 2 Data from haematological patients diagnosed with proven and probable fungal infections (all patients presented fever for more than 4 d, submitted to broad-spectrum antibiotics) Neutropenia (days) Haematological disease Diagnosis of fungal infection Fungi detected Level 1 Outcome Patient 1 20 Acute myeloid leukaemia CT scan suggesting fungal infection, negative antigen test, positive biopsy to A. fumigatus Aspergillus fumigatus Proven, deep tissue Alive Patient 2 27 Acute myeloid leukaemia Positive cultures from blood and bronchial secretions to C. glabrata Candida glabrata Proven, fungemia Died Patient 3 22 Acute myeloid leukaemia Positive blood culture Saccharomyces cerevisiae Proven, fungemia Alive Patient 4 20 Acute myeloid leukaemia Positive cultures from catheter and blood Candida parapsilosis Proven, fungemia Alive Patient 5 27 Acute myeloid leukaemia Two CT scans suggesting fungal infection, three positive cultures to A. fumigatus, two positive antigen tests, one positive PCR test Aspergillus fumigatus Probable Died Patient 6 6 Non-Hodgkin lymphoma Symptoms of lower respiratory tract infection and pleural infusion, two positive cultures from bronchial secretions to A. fumigatus Aspergillus fumigatus Probable Alive CT, Computerized tomography. 1 According to Ascioglu et al. (15). Araujo et al. Fungal infection after haematology renovation ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard 439 being the second line therapy mainly an association of drugs using voriconazole and ⁄or caspofungin. For yeast infections, the first choice was regularly fluconazole and the alternative caspofungin or liposomal amphotericin B. Liposomal amphotericin B was administered at 3 mg kg day )1 . The daily defined dose of the other antifungals administered to patients was similar in both periods and established according to standard therapeutic protocols. Environmental surveillance Higher values of A. fumigatus,Aspergillus flavus and Aspergillus niger were detected in the cultures incubated at 37C, while the other fungal species were mostly detected at 25C. The air surveillance of the clinical unit disclosed values of total fungi ranging from 22 to 278 CFU ⁄m 3 (average of 131 CFU ⁄m 3 ) in the rooms without air filtration system along the 28 months surveillance period. In the same wards, A. fumigatus ranged between 0.7 and 19.3 CFU ⁄m 3 (average of 8.5 CFU ⁄m 3 ). The haematology main hall was not monitored during the entire study, including the construction period. Airborne quality was assessed exclusively in patients’ wards throughout the study, being all rooms considered. Staff and patients were continuously alerted to keep wards maximally isolated from outdoor air. No significant differences were found during the renovation works considering airborne fungal levels into such wards (P> 0.05). However, the levels of A. fumigatus increased from 8.5 to 12 CFU ⁄m 3 , during the construction period. The new rooms with HEPA filters showed a gradual improvement of the air quality since the first week (Fig. 1). The total airborne fungi decreased from 70 CFU ⁄m 3 (reduction of 50%) in the first week to less than 7 CFU ⁄m 3 (reduction of 95%) in the following weeks. Aspergillus fumigatus yielded 1.4 CFU ⁄m 3 in the first week but it was not detected thereafter. Similar corresponding airborne values were detected in the entrance hall (also with HEPA filters) that conducted to the patient protected rooms (data not shown). Discussion Construction and renovation works are a well-known risk factor for mould infections (6, 22, 23). Aspergillus infections resulting from failure in air filtration systems have been reported (24, 25). Other studies have reported a reduction of Aspergillus infections after the installation of HEPA filters and ⁄or by the existence of physical barriers that limit the access of airborne conidia to the clinical units (6–9). The installation of HEPA filters in the individual rooms did not completely prevent fungal infections in the haematological patients admitted in our clinical unit, although its incidence was reduced by 25%. HEPA filters had shown in other studies a reduction of airborne fungi to less than 10 CFU ⁄m 3 (26) and a reduction of mould infections in haematological patients (7). After unit renovation, the new rooms with HEPA filters showed a large improvement of air quality compared with the non-treated rooms, as well as a clinical positive impact – no proven or probable fungal infections were registered in the latter period and no deaths associated to possible fungal infections were reported, even considering the 38 autotransplants performed in the unit during this period. During the construction period, a small increase of airborne A. fumigatus was found Table 3 Consumption of antifungal agents before and after renovation of haematology unit (number of packs) Antifungal and formulation Before After Difference (%) Deoxycholate amphotericin B (50 mg) 580 921 +59 Liposomal amphotericin B (50 mg) 759 990 +30 Fluconazole (200 mg), capsules 691 3342 +484 Fluconazole (2 mg mL )1 ), intravenous formulation (200 mL) 124 180 +45 Voriconazole (200 mg), capsules 454 330 )28 Voriconazole (200 mg), intravenous formulation 138 7 )95 Caspofungin, intravenous formulation 382 158 )59 CFU/m3 0 5 10 60 80 100 A. fumigatus A. flavus A. niger Other Aspergillu s Yeasts Other fungi No air treated wards Wards with HEPA filters (1st wk) Wards with HEPA filters (2nd wk and wks after) Figure 1 Colony-forming units per cubic meter (CFU ⁄m 3 ) of fungi detected during air quality surveillance in haematology unit after renovation works. Other fungi included mostly Penicillium sp. and rare isolates of Mucor sp., Alternaria sp. and Scedosporium sp. Values of Aspergillus fumigatus,Aspergillus flavus and Aspergillus niger were detected in the cultures incubated at 37C, while the other fungal species were mostly detected at 25C. Fungal infection after haematology renovation Araujo et al. 440 ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard but there was no significant clinical impact compared with the previous months, conversely to what had been shown in other locations (6, 22, 23). Even after the installation of HEPA filters, it was possible to find moulds into protected wards, particularly Penicillium sp., but these species are not commonly pathogenic, with the exception of Penicillium marneffei.Aspergillus species were rarely found, particularly A. fumigatus. Sherertz et al. had reported no A. fumigatus infections in clinical environments with less than 0.1 CFU ⁄m 3 (27). However, reference airborne fungal values are still not defined, as well as it is not yet established the sampling air frequency that should be performed in clinical units. Confirming previous reports (4), a higher number of fungal infections were reported among patients with acute myeloid leukaemia. These patients were commonly associated to prolonged neutropenia and longer hospital stay. Incidence of invasive aspergillosis had been previously associated with an increasing number of hospital admissions per year (5, 28). Possible confounders may be detected in this study, namely regarding patients’ age, patient’s genetic predisposition for infection, severity of haematological malignancy and mortality rate of a unit external group. All patients staying more than 24 h in Haemato-Oncology Unit were included in this study (criteria for admission were similar in both periods) and previous mentioned factors occasionally may not be equally distributed in both compared groups (before vs. after unit renovation). However, the presented main results and values were similar to previous reports and focus different aspects, all indicative of clinical and environmental improvements after installation of protective measures. The incidence of yeast infections was lower after renovation works, both classified as nosocomial and community-acquired infections. It is relevant that the new eight rooms were individual rooms therefore reducing inter-patient, medical staff–patient and visitor–patient contacts. Yeasts are usually present in the human internal milieu, being some nosocomial infections a clear consequence of host neutropenia and further invasion by the endogenous fungal agent. The economical benefits of the haematology unit renovation were shown by the reduction of the hospitalization days in a particular group of patients – hospitalization costs are commonly described the most important healthcare costs (5, 29–32) – and the reduction of the expenses with antifungal agents into the unit. The larger consumption of both amphotericin B formulations and fluconazole in the latter period was most probably related to the antifungal prophylaxis administered to patients with acute myeloid or lymphoblastic leukaemia under longer neutropenia (more admissions in this period, as shown in Table 1). The administration of antifungal prophylaxis was a clinician decision and it was mostly employed in acute leukaemic patients under longer neutropenia periods, being sometimes also related to clinical history of invasive aspergillosis. Unit policy regarding prophylaxis or treatment of fungal infections was not modified during the studied period, fluconazole for yeast and amphotericin B for mould infections. In accordance with previous studies (4, 27, 33), patients staying in hospital under prolonged neutropenia (more than 10 d) and with longer stay than 3–4 wk are more susceptible to develop fungal infections, usually associated to the isolation of other microbial agents and administration of a large spectrum of antibiotics. Patients submitted to autotransplant may be under higher risk of infection in haematological units, nevertheless, the installation of high-protective measures may efficiently prevent fungal infections in these patients, as we had shown in this study. It is urgent to understand the presence and transmission of fungal agents in protected clinical environments in order to improve health and well-being of patients submitted to immunosuppressive treatments and staying longer at hospitals. Acknowledgements The authors would like to thank Joa ˜o Paulo Cabral for providing the Andersen one siege impactor throughout the study, as well as all staff of the Department of Clinical Haematology and Pharmacy, Hospital S. Joao who kindly collaborated in this study. The authors also thank both reviewers for their valuable suggestions that certainly improved the manuscript. Conflict of interest The authors declare no conflict of interest. References 1. Groll AH, Shah PM, Mentzel C, Schneider M, JustNuebling G, Huebner K. Trends in the postmortem epidemiology of invasive fungal infections at a university hospital. J Infect 1996;33:23–32. 2. Marr KA, Carter RA, Crippa F, Wald A, Corey L. Epidemiology and outcome of mould infections in hematopoietic stem cell transplant recipients. Clin Infect Dis 2002;34:909–17. 3. Pagano L, Caira M, Candoni A, et al. The epidemiology of fungal infections in patients with hematologic malignancies: the SEIFEM-2004 study. Haematologica 2006;91:1068–75. 4. Vandewoude KH, Blot SI, Benoit D, Colardyn F, Vogelaers D. Invasive aspergillosis in critically ill patients: attributable mortality and excesses in length of ICU stay and ventilator dependence. J Hosp Infect 2004;56:269–76. Araujo et al. Fungal infection after haematology renovation ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard 441 5. Dasbach EJ, Davies GM, Teutsch SM. Burden of aspergillosis-related hospitalizations in the United States. Clin Infect Dis 2000;31:1524–8. 6. Oren I, Haddad N, Finkelstein R, Rowe JM. Invasive pulmonary aspergillosis in neutropenic patients during hospital construction: before and after chemoprophylaxis and institution of HEPA filters. Am J Hematol 2001;66:257–62. 7. Alberti C, Bouakline A, Ribaud P, Lacroix C, Rousselot P, Leblanc T, Derouin F; Aspergillus Study Group. Relationship between environmental fungal contamination and the incidence of invasive aspergillosis in haematology patients. J Hosp Infect 2001;48:198–206. 8. Hovi L, Saxen H, Saarinen-Pihkala UM, Vettenranta K, Meri T, Richardson M. Prevention and monitoring of invasive fungal infections in pediatric patients with cancer and hematologic disorders. Pediatr Blood Cancer 2007;48:28–34. 9. Berthelot P, Loulergue P, Raberin H, Turco M, Mounier C, Tran Manh Sung R, Lucht F, Pozzetto B, Guyotat D. Efficacy of environmental measures to decrease the risk of hospital-acquired aspergillosis in patients hospitalised in haematology wards. Clin Microbiol Infect 2006;12:738–44. 10. Hospenthal DR, Kwon-Chung KJ, Bennett JE. Concentrations of airborne Aspergillus compared to the incidence of invasive aspergillosis: lack of correlation. Med Mycol 1998;36:165–8. 11. Mahieu LM, De Dooy JJ, Van Laer FA, Jansens H, Ieven MM. A prospective study on factors influencing Aspergillus spore load in the air during renovation works in a neonatal intensive care unit. J Hosp Infect 2000;45:191–7. 12. Cooper EE, O’Reilly MA, Guest DI, Dharmage SC. Influence of building construction work on Aspergillus infection in a hospital setting. Infect Control Hosp Epidemiol 2003;24:472–6. 13. Eckmanns T, Ruden H, Gastmeier P. The influence of high-efficiency particulate air filtration on mortality and fungal infection among highly immunosuppressed patients: a systematic review. J Infect Dis 2006;193:1408–18. 14. Raad I, Hanna H, Osting C, Hachem R, Umphrey J, Tarrand J, Kantarjian H, Bodey GP. Masking of neutropenic patients on transport from hospital rooms is associated with a decrease in nosocomial aspergillosis during construction. Infect Control Hosp Epidemiol 2002;23:41–3. 15. Ascioglu S, Rex JH, de Pauw B, et al. Mycoses Study Group of the National Institute of Allergy and Infectious Diseases. Defining opportunistic invasive fungal infections in immunocompromised patients with cancer and hematopoietic stem cell transplants: an international consensus. Clin Infect Dis 2002; 34: 7–14. 16. Garner JS, Jarvis WR, Emori TG, Horan TC, Hughes JM. CDC definitions for nosocomial infections. In: Olmsted RN, ed. APIC Infection Control and Applied Epidemiology: Principles and Practice. St. Louis: Mosby, 1996:1. 17. Jeyaratnam D, Edgeworth JD, French GL. Enhanced surveillance of meticillin-resistant Staphylococcus aureus bacteraemia in a London teaching hospital. J Hosp Infect 2006;63:365–73. 18. Andersen AA. New sampler for the collection, sizing and enumeration of viable airborne particles. J Bacteriol 1958;76:471–84. 19. Hocking AD, Pitt JI. Dichloran–glycerol medium for enumeration of xerophilic fungi from low-moisture foods. Appl Environ Microbiol 1980;39:488–92. 20. Wu PC, Su HJJ, Ho HM. A comparison of sampling media for environmental viable fungi collected in a hospital environment. Environ Res 2000;82:253–7. 21. Larone DH. Medically important fungi: a guide to identification, 3rd edn. Washington DC: American Society for Microbiology, 2005. 22. De La Rosa GR, Champlin RE, Kontoyiannis DP. Risk factors for the development of invasive fungal infections in allogeneic blood and marrow transplant recipients. Transpl Infect Dis 2002;4:3–9. 23. Vonberg RP, Gastmeier P. Nosocomial aspergillosis in outbreak settings. J Hosp Infect 2006;63:246–54. 24. Lutz BD, Jin J, Rinaldi MG, Wickes BL, Huycke MM. Outbreak of invasive Aspergillus infection in surgical patients, associated with a contaminated air-handling system. Clin Infect Dis 2003;37:786–93. 25. Munoz P, Guinea J, Pelaez T, Duran C, Blanco JL, Bouza E. Nosocomial invasive aspergillosis in a heart transplant patient acquired during a break in the HEPA air filtration system. Transpl Infect Dis 2004;6: 50–4. 26. Araujo R, Cabral JP, Rodrigues AG. Air filtration systems and restrictive access conditions improve indoor air quality in clinical units. Penicillium as a general indicator of hospital indoor fungal levels. Am J Infect Control (in press). DOI: 10.1016/j.ajic.2007.02.001. 27. Sherertz RJ, Belani A, Kramer BS, Elfenbein GJ, Weiner RS, Sullivan ML, Thomas RG, Samsa GP. Impact of air filtration on nosocomial Aspergillus infections. Unique risk of bone marrow transplant recipients. Am J Med 1987;83:709–18. 28. Allam MF, Del Castillo AS, Diaz-Molina C, Navajas RF. Invasive pulmonary aspergillosis: identification of risk factors. Scand J Infect Dis 2002;34:819–22. 29. McGarry SA, Engemann JJ, Schmader K, Sexton DJ, Kaye KS. Surgical-site infection due to Staphylococcus aureus among elderly patients: mortality, duration of hospitalization, and cost. Infect Control Hosp Epidemiol 2004;25:461–7. 30. Olaechea PM, Palomar M, Leo ´n-Gil C, Alvarez-Lerma F, Jorda ´R, Nolla-Salas J, Leo ´n-Regidor MA; EPCAN Study Group. Economic impact of Candida colonization and Candida infection in the critically ill patient. Eur J Clin Microbiol Infect Dis 2004;23:323–30. 31. Falagas ME, Apostolou KE, Pappas VD. Attributable mortality of candidemia: a systematic review of matched Fungal infection after haematology renovation Araujo et al. 442 ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard cohort and case–control studies. Eur J Clin Microbiol Infect Dis 2006;25:419–25. 32. Riedel A, Choe L, Inciardi J, Yuen C, Martin T, Guglielmo BJ. Antifungal prophylaxis in chemotherapyassociated neutropenia: a retrospective, observational study. BMC Infect Dis 2007;7:70. 33. Marr KA, Carter RA, Boeckh M, Martin P, Corey L. Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in epidemiology and risk factors. Blood 2002;100:4358–66. Araujo et al. Fungal infection after haematology renovation ª2008 The Authors Journal compilation 80 (436–443) ª2008 Blackwell Munksgaard 443