Stromal MED12 exon 2 mutations in complex fibroadenomas of the breast

1 da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062 S omal MED12 exon 2 mu a ions in complex ib oadenomas o heb eas Edaise M da Sil a ,1 F ancisco Beca ,2 Ana Paula Ma ins Sebas iao,1,3 Melissa P Mu ay,1 Ca a ina Sil ei a,1,4 A naud Da C uz Paula,5 F esia Pa eja ,1 Hannah Y Wen,1 Timo hy M D’Al onso ,1 Ma cia Edelweiss,1 B i a Weigel ,1 Edi B ogi,1 Jo ge S Reis- Filho,1 Hong Zhang1 Sho epo To ci e: da Sil aEM, BecaF, Sebas iaoAPM, e al. J Clin Pa hol Epub ahead o p in : [please include Day Mon h Yea ]. doi:10.1136/ jclinpa h-2020-207062 ►Supplemen al ma e ial is published online only. To iew please isi he jou nal online (h p:// dx. doi. o g/ 10. 1136/ jclinpa h- 2020- 207062). 1Depa men o Pa hology, Memo ial Sloan Ke e ing Cance Cen e , New Yo k, NY, USA 2Pa hology, S an o d Uni e si y School o Medicine, S an o d, Cali o nia, USA 3Depa men o Medical Pa hology, Uni e sidade Fede al do Pa ana Se o de Ciencias da Saude, Cu i iba, B azil 4GenoMed SA, Ins i u e o Molecula Medicine, Uni e si y o Lisbon, Lisboa, Po ugal 5Su ge y, Memo ial Sloan Ke e ing Cance Cen e , New Yo k, NY, USA Co espondence o D Hong Zhang, Depa men o Pa hology, Memo ial Sloan Ke e ing Cance Cen e , New Yo k 10065, New Yo k, USA; zhangh3@ mskcc. o g Recei ed 26 Augus 2020 Re ised 23 No embe 2020 Accep ed 7 Decembe 2020 © Au ho (s) (o hei employe (s)) 2020. Re- use pe mi ed unde CC BY- NC. No comme cial e- use. See igh s and pe missions. Published by BMJ. ABSTRACT Aims He e we explo e he p esence o media o complex subuni 12 (MED12) exon 2 and elome ase e e se ansc ip ase (TERT) p omo e ho spo mu a ions in complex ib oadenomas (CFAs) o he b eas . Me hods The s omal componen s om 18 CFAs we e subjec ed o Sange sequencing o MED12 exon 2 and he TERT p omo e ho spo loci. The epi helial and s omal componen s o wo MED12 mu a ed CFAs we e subjec ed o lase cap u e mic odissec ion, and Sange sequencing o MED12 exon 2, TERT p omo e and PIK3CA exons 9 and 20, sepa a ely. Resul s MED12 exon 2 mu a ions we e iden i ied in he s oma o 17% o CFAs. The analyses o epi helial and s omal componen s, mic odissec ed sepa a ely, e ealed ha MED12 mu a ions we e es ic ed o he s oma. No TERT p omo e o PIK3CA mu a ions in exons 9 and 20 we e de ec ed in analysed CFAs. Conclusions Like con en ional ib oadenomas, MED12 exon 2 mu a ions appea o be es ic ed o he s omal componen o CFAs, suppo ing he no ion ha CFAs a e s omal neoplasms. INTRODUCTION Fib oadenomas (FAs) o he b eas a e a g oup o benign biphasic neoplasms consis ing o a p oli - e a ion o bo h epi helial and s omal compo- nen s.1 A e he seminal publica ion by Lim e al,2 desc ibing media o complex subuni 12 (MED12) exon 2 mu a ions in app oxima ely 60% o FAs, ou g oup and o he s ha e no only con i med he p esence o hese mu a ions in FAs, bu also demons a ed ha hey a e es ic ed o he s omal componen o hese lesions.2–5 MED12 exon 2 mu a ions ha e also been de ec ed in o he ib oep- i helial neoplasms, including phyllodes umou s (PTs), whe e hese mu a ions a e p esen in 88% o benign, in 78% o bo de line and in 8% o malignan PTs.5–8 In addi ion, ou g oup ini ially desc ibed he p esence o elome ase e e se an- sc ip ase (TERT) p omo e ho spo mu a ions in PTs,7 which ha e been con i med o inc ease in equency om benign o malignan PTs and o be anishingly a e in con en ional FAs.9–11 FAs comp ise his ologic a ian s, including ju e- nile ib oadenoma, cellula FAs and complex ib o- adenomas (CFAs), which display di e en his ologic ea u es and a ia ions in hei clinicopa hologic cha ac e is ics. A subse o FAs, cha ac e ised by abundan myxoid ma ix and hypocellula s omal componen , was p e iously ca ego ised as myxoid ib oadenomas (MFAs) as pe ou h edi ion WHO classi ica ion.12 These lesions we e epo ed o lack MED12 exon 2 mu a ions in he s omal compo- nen , and o ha bou ecu en mu a ions in TP53, PIK3R1, ERCC5 and PIK3CA in he epi helial a he han he s omal componen .13 Impo an ly, in one case o MFA included in Lozada e al,13 a mu a- ion a ec ing PRKAR1A was de ec ed in he s omal componen , and he case was subsequen ly eclassi ied as a myxoma. Pe i h edi ion WHO classi ica ion o b eas neoplasms,1 CFA is a a ian o ib oadenoma ha con ains one o mo e o he ollowing his ological indings: cys s >3 mm, scle osing adenosis, epi helial calci ica ions and papilla y apoc ine me aplasia. As compa ed wi h con en ional FAs, CFAs ha e mo e abundan epi helial componen s sha ing his ological ea u es o p oli e a i e ib ocys ic disease o b eas and less cha ac e is ic neoplas ic s oma. An inc eased ela i e isk (RR) o subsequen in asi e b eas ca ci- noma was epo ed o pa ien s wi h CFAs (RR 3.10; 95 % CI 1.9 o 5.1) in compa ison o pa ien s wi h con en ional FAs (RR 2.17; 95 % CI 1.5 o 3.2).14 O he s udies, howe e , ha e indica ed ha CFAs may no esul in inc eased b eas cance isk beyond he p esence o o he es ablished isk ac o s such as p oli e a i e disease o a ypical epi helial hype plasia o b eas . The clinical beha iou o CFAs, howe e , emains con en ious, and he cu en ecommenda- ion is o manage pa ien s wi h CFA wi h a conse - a i e app oach, simila ly o he app oach employed o he managemen o women wi h con en ional FAs.15 16 The gene ic unde pinning o CFAs, whe he he abundan epi helial componen con ibu es o he umo igenesis o whe he hey a e gene ically ela ed o con en ional FAs o PTs is unclea . He e we conduc ed an explo a o y analysis o de e mine whe he MED12 exon 2 and TERT p omo e ho spo mu a ions would be p esen in CFAs. Fu he mo e, gi en ou p e ious indings ha PIK3CA ho spo mu a ions we e p esen in PTs wi hou FA- like a eas and in a subse o FAs, classi ied as MFAs in he p io ( ou h edi ion) WHO classi ica ion,8 12 13 in addi ion o he MED12 exon 2 and TERT p omo e ho spo mu a ions, we also assessed he p esence o mu a ions in exons 9 and 20 o PIK3CA in sepa a e epi helial and s omal componen s o wo CFAs subjec ed o lase cap u e mic odissec ion (LCM). on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om 2da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062 Sho epo MATERIALS AND METHODS Subjec s and samples Following ins i u ional e iew boa d app o al, slides and o malin- ixed pa a in- embedded (FFPE) issue blocks o 24 CFAs om 23 adul pa ien s we e e ie ed om he a chi es o he Depa men o Pa hology o Memo ial Sloan Ke e ing Cance Cen e (New Yo k, USA). All cases we e e iewed by nine b eas pa hologis s (APMS, FP, ME, TMD, MPM, HYW, EB, JSR- F and HZ) and we e eclassi ied acco ding o he WHO c i e ia i h edi ion (2019).1 A diagnosis o CFA was ende ed when a leas one o mo e complex ea u es we e p esen (ie, cys s >3 mm, scle osing adenosis, epi helial calci ica ions and papilla y apoc ine me aplasia). Eigh een CFAs ( om 17 anony- mised pa ien s) we e included in his s udy on a consensus diag- nosis being ende ed. All cases a e unique o his s udy, and none has been p e iously epo ed. Tumou mic odissec ion and sequencing Eigh mic ome e hick FFPE ep esen a i e his ological sec ions o 18 CFAs we e mic odissec ed unde a s e eomic oscope (Olympus SZ61) o ensu e a s omal cell con en >80%. DNA was ex ac ed using he DNeasy Blood and Tissue Ki (Qiagen) acco ding o he manu ac u e ’s ins uc ions. Sange sequencing was used o he assessmen o mu a ions a ec ing MED12 exon 2 and TERT p omo e ho spo s in he s omal componen s o 18 CFAs. Sange sequencing and PCR ampli ica ion me hods we e pe o med as p e iously desc ibed17 and a e de ailed in online supplemen al me hods and able S1. To de ine whe he he mu a ions a ec ing he exon 2 o MED12 would be es ic ed o he s oma o would also be p esen in he epi helial componen in he MED12 mu a ed cases, ep esen a i e samples om hese umou s we e subjec ed o LCM o ob ain he epi helial and s omal componen s sepa- a ely (online supplemen al me hods). Due o he limi ed ma e- ial a ailable in one o he cases (CFA7), LCM was pe o med in wo (CFA18 and CFA22) CFAs ha bou ing MED12 exon 2 mu a ions. DNA samples om he epi helial and s omal compo- nen s we e subjec ed o Sange sequencing o MED12 exon 2, TERT p omo e ho spo s and PIK3CA exons 9 and 20. Sequence elec ophe og ams o he o wa d and e e se s ands we e anal- ysed using Mu a ion Su eyo (So Gene ics) and he mu a ions iden i ied we e manually cu a ed. All analyses we e pe o med in duplica e. RESULTS Ou s udy included 18 CFAs om pa ien s wi h a median age o 48 yea s a diagnosis ( ange 33–82 yea s, (online supplemen al able S2). All CFAs ha bou ed a leas one complex ea u e, such as scle osing adenosis o ib ocys ic changes ( igu e 1A and online supplemen al able S2). Fib ocys ic changes including usual duc al hype plasia wi hou a ypia, apoc ine me aplasia, columna cell changes, cys o ma ion and s omal ib osis we e iden i ied in all CFAs, and scle osing adenosis we e p esen in he adjacen b eas issue in 13 (72%) cases. Based on he da a e ie ed om he pa hology epo s, concu en duc al ca ci- noma in si u (67%, 12/18), in asi e duc al ca cinoma (22%, 4/18), in asi e lobula ca cinomas (6%, 1/18), lobula ca cinoma in si u (11%, 2/18) o a ypical duc al hype plasia (6%, 1/18) we e iden i ied in he b eas issue away om CFAs included in his s udy. MED12 exon 2 mu a ions we e iden i ied in he s omal componen o 17% (3/18) o CFAs ( igu e 1B and online supple- men al able S2). Two CFAs ha bou ed he ho spo p.G44S (c.130G>A) and one case ha bou ed he pa hogenic p.L36R (c.107T>G) MED12 mu a ions ( igu e 2A–C and online supple- men al able S3. No di e ences in he his ologic and clinical ea u es o he CFAs, acco ding o he p esence o absence o MED12 mu a ions we e ound online supplemen al igu e S1 and able S2. No TERT p omo e ho spo mu a ions we e de ec ed in he CFAs analysed ( igu e 1B, online supplemen al able S2). In CFA18 and CFA22, whe e he epi helial and s omal componen s we e success ully sepa a ed, Sange sequencing analysis e ealed ha he MED12 mu a ions (p.G44S) we e exclusi ely es ic ed o hei espec i e s omal componen s. No MED12 mu a ions we e ound in he epi helial componen o he CFAs ( igu e 2D and online supplemen al able S4). No TERT p omo e ho spo mu a ions o PIK3CA mu a ions in exons 9 o 20 we e ound in ei he he epi helial o s omal componen o he CFAs subjec ed o LCM. DISCUSSION CFAs a e a a ian o FAs12 and comp ise 22.7% o 40.4% o diagnosed FAs.14 18 O en clinically o e looked, CFAs end o occu in pa ien s olde han hose wi h con en ional FAs15 18 wi h an a e age size o hal o o he FAs.15 His ologically, he p esence o epi helial al e a ions o e lapping wi h ib o- cys ic changes inside he lesion is cha ac e is ic o his FA sub ype. Tubula adenoma o b eas , which is a a e epi helial p oli e a ion a ising om he e minal duc lobula uni , is occasionally in he di e en ial diagnosis due o he p esence o p ominen scle osing adenosis inside he CFA.19 Al hough some s udies sugges ha CFAs ca y a sligh ly inc eased isk o subsequen de elopmen o b eas cance s compa ing o gene al popula ion,14 o he s did no con i m his isk.15 16 The explo a o y, hypo hesis gene a ing analysis pe o med he e e ealed ha , akin o con en ional FAs, a subse o CFAs ha bou pa hogenic mu a ions in MED12 exon 2, al hough a a lowe equency (17% CFAs s up o 65% con en ional FAs).5 17 These indings suppo he no ion ha while CFAs and con en ional FAs a e mo phologically and, o a ce ain ex en , clinically sepa a e en i ies, hey sha e simila gene ic al e a ions in MED12 in a subse o cases, in ag eemen wi h wha was epo ed by Lien e al.20 Due o he ich na u e o epi helial componen and i s in eg al g ow h mixed wi h s omal componen s, i is echnically challenging o ob ain adequa e amoun o DNA om he sepa a e componen s in CFAs by LCM. We success ully assessed mu a ions in MED12 exon 2 and TERT p omo e loci in he sepa a ely lase mic odissec ed epi helial and s omal componen s o Figu e 1 His ologic ea u es and equency o MED12 exon 2 and TERT p omo e mu a ions in complex FAs o he b eas . (A) Rep esen a i e H&E mic og aph o a complex FA displaying apoc ine me aplasia (bo om igh ) and scle osing adenosis ( op igh ), scale ba , 2 mm. (B) F equency o MED12 exon 2 and TERT p omo e ho spo mu a ions in he s omal componen o 18 CFAs included in his s udy. CFAs, complex ib oadenomas; FAs, ib oadenomas; MED12, media o complex subuni 12; TERT, elome ase e e se ansc ip ase. on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om 3 da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062 Sho epo wo CFAs. These cases we e also subjec ed o Sange analysis o PIK3CA exons 9 and 20. Gi en ha MED12 mu a ions a e es ic ed o he s omal componen , CFAs, akin o con en- ional FAs, likely cons i u e s omal a he han ib oepi he- lial neoplasms. No PIK3CA mu a ions in exon 9 and 20 we e iden i ied in hese cases, consis en wi h p e ious obse a- ions de i ed om he analysis o ib oepi helial lesions ha bou ing MED12 mu a ions.10 Ou s udy has limi a ions. Due o limi ed a chi ed FFPE issue a ailabili y, we es ic ed ou analysis o speci ic gene ic al e a ions. Ou analysis was es ic ed o he mu a ions a ec ing MED12 exon 2, TERT p omo e ho spo mu a ions, and in wo MED12 exon 2 mu a ed cases, also PIK3CA exons 9 and 20. Al hough ou indings suppo he no ion ha MED12 exon 2 mu a ions do no cons i u e he main d i e o CFAs, we canno ule ou ha he e a e o he genes which may play a ole in he biology o CFAs. Mo eo e , due o he size o ou coho and a i y o ecu en e en s, ou s udy may ha e a limi ed powe o assess he signi icance o he p esence o MED12 exon 2 mu a ions in he s omal compo- nen o CFAs. All CFAs included in his s udy we e e ie ed om he pa hology a chi es o a cance cen e, which migh ha e con ibu ed o he high equency o co- occu en in a- si e and/o in si u ca cinomas a he ime o he diagnosis o CFA. Gi en he scope o his s udy, we could no de e mine he p ognos ic signi icance o MED12 exon 2 mu a ions and i s associa ion wi h he p esence o co- occu en in asi e and/ o in si u ca cinomas iden i ied in ou coho . Fu he s udies o assess he impac o MED12 exon 2 mu a ions in CFAs in he isk o de elopmen o b eas cance a e wa an ed. Despi e hese limi a ions, he e we demons a ed ha CFAs ha bou MED12 exon 2 mu a ions in he s omal componen , akin o o he his ologic a ian s o FAs. A a iance wi h con en ional FAs, howe e , he equency o MED12 exon 2 mu a ions in CFAs appea s o be lowe han ha o con en- ional FAs. Fu he s udies a e wa an ed o de ine he gene ic unde pinning o MED12 wild- ype CFAs. Handling edi o Cheok Soon Lee. Con ibu o s FP, EB, JSR- F and HZ concei ed he s udy. EMdS and HZ coo dina ed he e ie al o samples. APMS, MPM, FP, HYW, TMD, ME, EB, JSR- F and HZ pe o med he pa hology e iew. EMdS, APMS, CS and ADCP pe o med expe imen s and analysis. EMdS, FB, BW, JSR- F and HZ analysed and in e p e ed he da a. EMdS, FB, JSR- F and HZ w o e he i s manusc ip , which was e iewed by all coau ho s. Funding This s udy was unded by he B eas Cance Resea ch Founda ion. BW is unded by a Cycle o Su i al g an , CS by a Fundação pa a a Ciência e Tecnologia g an (SFRH/BDE/110544/2015). FP is pa ially unded by a K12 CA184746 g an . The esea ch epo ed in his pape was suppo ed in pa by a Cance Cen e Suppo G an o he Na ional Ins i u es o Heal h/Na ional Cance Ins i u e (g an No P30CA008748). Compe ing in e es s JSR- F epo s ecei ing pe sonal/consul ancy ees om Goldman Sachs and REPARE The apeu ics, membe ship o he scien i ic ad iso y boa ds o Voli ionRx, REPARE The apeu ics and Paige. AI, membe ship o he Boa d o Di ec o s o G upo Oncoclinicas, and ad hoc membe ship o he scien i ic ad iso y boa ds o Roche Tissue Diagnos ics, Ven ana Medical Sys ems, No a is, Genen ech and InVic o, ou side he scope o his s udy. HZ epo s consul ancy ee om Roche/ Genen ech, ou side he scope o he submi ed wo k. FB is cu en ly an employee and equi y holde o Sea le Gene ics, Inc bu he p esen wo k is ou side he scope o his ole. Pa ien consen o publica ion No equi ed. P o enance and pee e iew No commissioned; ex e nally pee e iewed. Supplemen al ma e ial This con en has been supplied by he au ho (s). I has no been e ed by BMJ Publishing G oup Limi ed (BMJ) and may no ha e been pee - e iewed. Any opinions o ecommenda ions discussed a e solely hose o he au ho (s) and a e no endo sed by BMJ. BMJ disclaims all liabili y and esponsibili y a ising om any eliance placed on he con en . Whe e he con en includes any ansla ed ma e ial, BMJ does no wa an he accu acy and eliabili y o he ansla ions (including bu no limi ed o local egula ions, clinical guidelines, e minology, d ug names and d ug dosages), and is no esponsible o any e o and/o omissions a ising om ansla ion and adap a ion o o he wise. Open access This is an open access a icle dis ibu ed in acco dance wi h he C ea i e Commons A ibu ion Non Comme cial (CC BY- NC 4.0) license, which pe mi s o he s o dis ibu e, emix, adap , build upon his wo k non- comme cially, and license hei de i a i e wo ks on di e en e ms, p o ided he o iginal wo k is p ope ly ci ed, app op ia e c edi is gi en, any changes made indica ed, and he use is non- comme cial. See:h p:// c ea i ecommons. o g/ licenses/ by- nc/ 4. 0/. ORCID iDs Edaise Mda Sil a h p:// o cid. o g/ 0000- 0003- 3281- 7333 F anciscoBeca h p:// o cid. o g/ 0000- 0002- 4409- 012X F esiaPa eja h p:// o cid. o g/ 0000- 0003- 3748- 8049 Timo hy MD’Al onso h p:// o cid. o g/ 0000- 0003- 0464- 0868 REFERENCES 1 Thike AA, B ogi E, Ha ada O, e al. B eas umou s. In: WHO classi ica ion o umo s. 5 h edn. Lyon: IARC, 2019: 168–71. 2 Lim WK, Ong CK, Tan J, e al. Exome sequencing iden i ies highly ecu en MED12 soma ic mu a ions in b eas ib oadenoma. Na Gene 2014;46:877–80. 3 Mishima C, Kaga a N, Tanei T, e al. Mu a ional analysis o MED12 in ib oadenomas and phyllodes umo s o he b eas by means o a ge ed nex - gene a ion sequencing. B eas Cance Res T ea 2015;152:305–12. 4 Yoshida M, Sekine S, Ogawa R, e al. F equen MED12 mu a ions in phyllodes umou s o he b eas . B J Cance 2015;112:1703–8. 5 Piscuoglio S, Mu ay M, Fusco N, e al. MED12 soma ic mu a ions in ib oadenomas and phyllodes umou s o he b eas . His opa hology 2015;67:719–29. 6 Tan J, Ong CK, Lim WK, e al. Genomic landscapes o b eas ib oepi helial umo s. Na Gene 2015;47:1341–5. 7 Piscuoglio S, Ng CK, Mu ay M, e al. Massi ely pa allel sequencing o phyllodes umou s o he b eas e eals ac ionable mu a ions, and TERT p omo e ho spo mu a ions and TERT gene ampli ica ion as likely d i e s o p og ession. J Pa hol 2016;238:508–18. 8 Pa eja F, Geye FC, Kuma R, e al. Phyllodes umo s wi h and wi hou ib oadenoma- like a eas display dis inc genomic ea u es and may e ol e h ough dis inc pa hways. NPJ B eas Cance 2017;3:40. Figu e 2 Complex FAs ha e MED12 exon 2 mu a ions es ic ed o he s omal componen . Rep esen a i e H&E mic og aphs o CFAs and Sange sequencing elec ophe og ams o (A) MED12 exon 2 L36R mu a ion (CFA7), (B–C) MED12 exon 2 G44S mu a ions (CFA18 and CFA22, espec i ely) iden i ied, scale ba , 2 mm, (D) CFA18 subjec ed o LCM and independen sequencing o he epi helial and s omal componen s (le , blue a ow—s oma, ed a ow—epi helium); ep esen a i e sequence elec ophe og ams o exon 2 o MED12 in he s oma ( igh op) and he epi helial componen ( igh bo om). ** MED12 mu a ed CFAs subjec ed o lase cap u e mic odissec ion. CFA, complex ib oadenomas; FAs, ib oadenomas; LCM, lase cap u e mic odissec ion; MED12, media o complex subuni 12; TERT, elome ase e e se ansc ip ase. on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om 4da Sil aEM, e al. J Clin Pa hol 2020;0:1–4. doi:10.1136/jclinpa h-2020-207062 Sho epo 9 Yoshida M, Ogawa R, Yoshida H, e al. TERT p omo e mu a ions a e equen and show associa ion wi h MED12 mu a ions in phyllodes umo s o he b eas . B J Cance 2015;113:1244–8. 10 Md Nasi ND, Ng CCY, Rajasega an V, e al. Genomic cha ac e isa ion o b eas ib oepi helial lesions in an in e na ional coho . J Pa hol 2019;249:447–60. 11 Ga cia- Dios DA, Le i D, Shah V, e al. MED12, TERT p omo e and RBM15 mu a ions in p ima y and ecu en phyllodes umou s. B J Cance 2018;118:277–84. 12 Lakhani IE SR, Schni SJ, Tan PH, e al. WHO classi ica ion o b eas umo s. 4 h edn. Lyon, 2012. 13 Lozada JR, Bu ke KA, Magui e A, e al. Myxoid ib oadenomas di e om con en ional ib oadenomas: a hypo hesis- gene a ing s udy. His opa hology 2017;71:626–34. 14 Dupon WD, Page DL, Pa l FF, e al. Long- e m isk o b eas cance in women wi h ib oadenoma. N Engl J Med 1994;331:10–15. 15 Sklai - Le y M, Sella T, Alweiss T, e al. Incidence and managemen o complex ib oadenomas. AJR Am J Roen genol 2008;190:214–8. 16 Nassa A, Vissche DW, Degnim AC, e al. Complex ib oadenoma and b eas cance isk: a Mayo clinic benign b eas disease coho s udy. B eas Cance Res T ea 2015;153:397–405. 17 Pa eja F, Da C uz Paula A, Mu ay MP, e al. Recu en MED12 exon 2 mu a ions in benign b eas ib oepi helial lesions in adolescen s and young adul s. J Clin Pa hol 2019;72:258–62. 18 Kuijpe A, Momme s EC, an de Wall E, e al. His opa hology o ib oadenoma o he b eas . Am J Clin Pa hol 2001;115:736–42. 19 Volckma A- L, Leichsen ing J, Flech enmache C, e al. Tubula , lac a ing, and duc al adenomas a e de oid o MED12 Exon2 mu a ions, and duc al adenomas show ecu en mu a ions in GNAS and he PI3K- AKT pa hway. Genes Ch omosomes Cance 2017;56:11–17. 20 Lien H- C, Huang C- S, Yang Y- W, e al. Mu a ional analysis o MED12 exon 2 in a spec um o ib oepi helial umou s o he b eas : implica ions o pa hogenesis and his ogenesis. His opa hology 2016;68:433–41. on Ap il 23, 2021 by gues . P o ec ed by copy igh .h p://jcp.bmj.com/J Clin Pa hol: i s published as 10.1136/jclinpa h-2020-207062 on 29 Decembe 2020. Downloaded om 1 SUPPLEMENTARY MATERIALS S omal MED12 Exon 2 Mu a ions in Complex Fib oadenomas o he B eas da Sil a e al. Supplemen a y Figu e S1 Supplemen a y Me hods Supplemen a y Tables S1-S4 Supplemen a y Figu e 1. His ologic ea u es o complex ib oadenomas o he b eas . Rep esen a i e hema oxylin and eosin mic og aphs o complex ib oadenomas lacking MED12 exon 2 mu a ions included in he s udy. Scale ba , 2mm. Co esponding sample IDs a e indica ed on each image ( op le ) and inse (bo om igh ) depic ing his ological ea u es iden i ied in he complex ib oadenomas. Supplemen a y Me hods Supplemen a y Table S1: P ime s used o Sange sequencing. Supplemen a y Table S2. Clinicopa hological cha ac e is ics, MED12 exon 2 and TERT p omo e s a us o he complex ib oadenomas o he b eas included in his s udy. Supplemen a y Table S3. MED12 exon 2 mu a ions iden i ied in he complex ib oadenomas o he b eas and hei p edic ed pa hogenici y. Supplemen a y Table S4. MED12 exon 2, TERT p omo e and PIK3CA exon 9 and exon 20 s a us in he complex ib oadenomas o he b eas subjec ed o lase cap u e mic odissec ion o he epi helial and s omal componen s. BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM 2 Supplemen a y Me hods Lase cap u e mic odissec ion Eigh -μm- hick FFPE sec ions o cases CFA18 and CFA22 we e cu using a mic o ome c yos a (Leica) and moun ed on o A c u us PEN Memb ane glass slides (Li e Technologies). Slides we e dehyd a ed and s ained wi h hema oxylin. Lase cap u e mic odissec ion was pe o med using an LMD 6500 ins umen (Leica Mic osys em). The s omal and epi helial componen s o a gi en case we e ou lined using he associa ed so wa e and hen cap u ed sepa a ely using an in a ed cap u e lase . DNA om he mic odissec ed componen s was ex ac ed using he DNeasy Blood and Tissue Ki (Qiagen) acco ding o manu ac u e ’ ins uc ions and subjec ed o mu a ion sc eening desc ibed below. PCR ampli ica ion and Sange sequencing Pu a i e soma ic mu a ions in selec ed genes o in e es we e in es iga ed by Sange sequencing. PCR ampli ica ion o 10ng o genomic DNA was pe o med using he AmpliTaq 360 Mas e Mix Ki (Li e Technologies) as p e iously desc ibed.1,2 PCR p oduc s we e pu i ied (ExoSAP-IT, The mo Fishe Scien i ic) and subjec ed o Sange sequencing encompassing MED12 exon 2, TERT p omo e ho spo locus and PIK3CA exons 9 and 20 (Supplemen a y Table S1). All analyses we e pe o med in duplica e. Supplemen a y Re e ences 1. Pa eja F, Da C uz Paula A, Mu ay MP e al. Recu en MED12 exon 2 mu a ions in benign b eas ib oepi helial lesions in adolescen s and young adul s. Jou nal o Clinical Pa hology 2019; 72; 258-262. 2. Piscuoglio S, Ng CK, Mu ay M e al. Massi ely pa allel sequencing o phyllodes umou s o he b eas e eals ac ionable mu a ions, and TERT p omo e ho spo mu a ions and TERT gene ampli ica ion as likely d i e s o p og ession. The Jou nal o Pa hology 2016; 238; 508-518. BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM 3 Supplemen a y Table S1: P ime s used o Sange sequencing. Gene Fo wa d Re e se MED12 exon 2 TGTTCTACACGGAACCCTCCTC CTGGGCAAATGCCAATGAGAT TERT p omo e CCAGGGCTTCCCACGTGC ACTGGGGACCCGGGCACC PIK3CA exon 9 CTGTGAATCCAGAGGGGAAA GCACTTACCTGTGACTCCATAGAA PIK3CA exon 20 CTCAATGATGCTTGGCTCTG TGGAATCCAGAGTGAGCTTTC BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM 4 Supplemen a y Table S2. Clinicopa hological cha ac e is ics, MED12 exon 2 mu a ions and TERT p omo e s a us o he complex ib oadenomas o he b eas included in his s udy. Sample ID Age (yea s) Menopausal s a us Scle osing adenosis Fib ocys ic changes Size (cm) MED12 mu a ion TERT s a us CFA 1 54 Pos Y Y NA WT CFA 2 67 Pos Y NA WT CFA 4 62 Pos Y 1 WT CFA 5 39 P e Y Y NA WT CFA 6 41 P e Y 1.5 WT CFA 7 36 P e Y NA c.107T>G WT CFA 8 63 Pos Y Y 2.1 WT CFA 9 47 P e Y Y NA WT CFA 10 52 P e Y Y NA WT CFA 11 63 Pos Y Y NA WT CFA 13 33 P e Y Y NA WT CFA 16 33 P e Y Y NA WT CFA 17 82 Pos Y Y NA WT CFA 18 41 P e Y Y NA c.130G>A WT CFA 19 45 P e Y 0.9 WT CFA 21 37 P e Y Y 1.8 WT CFA 22 52 Pe i Y Y 1.6 c.130G>A WT CFA 24 48 P e Y Y NA WT NA, no a ailable; WT, wild ype BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM 5 Supplemen a y Table S3. MED12 exon 2 non-synonymous soma ic mu a ions iden i ied in he complex ib oadenomas o he b eas and hei p edic ed pa hogenici y. Sample ID MED12 mu a ion MED12 Amino Acid Change S a Posi ion Mu a ion Tas e P o ean Polyphen- 2 CADD ClinVa In e p e a ion COSMIC Mu a ion ID CFA 1 CFA 2 CFA 4 CFA 5 CFA 6 CFA 7 c.107T>G p.L36R 70339230 disease causing dele e ious p obably damaging dele e ious No p o ided COSM131590 CFA 8 CFA 9 CFA 10 CFA 11 CFA 13 CFA 16 CFA 17 CFA 18 c.130G>A p.G44S 70339253 disease causing dele e ious p obably damaging dele e ious o he COSM131594 CFA 19 CFA 21 CFA 22 c.130G>A p.G44S 70339253 disease causing dele e ious p obably damaging dele e ious o he COSM131594 CFA 24 BMJ Publishing G oup Limi ed (BMJ) disclaims all liabili y and esponsibili y a ising om any eliance Supplemen al ma e ial placed on his supplemen al ma e ial which has been supplied by he au ho (s) J Clin Pa hol doi: 10.1136/jclinpa h-2020-207062–4.:10 2020;J Clin Pa hol, e al. da Sil a EM