Expression profile of microRNAs regulating proliferation and differentiation in mouse adult cardiac stem cells

Exp ession P o ile o mic oRNAs Regula ing P oli e a ion and Di e en ia ion in Mouse Adul Ca diac S em Cells Luis B a ´s-Rosa ´ io 1,2 *, Alex Ma suda 1.¤ , Ana Isabel Pinhei o 3. , Rui Ga dne 1 , Telma Lopes 1 , And eia Ama al 3 , Ma ga ida Gama-Ca alho 3 1Ins i u o Gulbenkian de Cie ˆncia, Oei as, Po ugal, 2Cen o de Ca diologia da Uni e sidade de Lisboa, Faculdade de Medicina de Lisboa, Lisboa, Po ugal, 3Cen e o Biodi e si y, Func ional and In eg a i e Genomics, Facul y o Sciences, Uni e si y o Lisbon, Lisbon, Po ugal Abs ac The iden i ica ion o ca diac cells wi h s em cell p ope ies changed he pa adigm o he hea as a pos mi o ic o gan. These cells p oli e a e and di e en ia e in o ca diomyocy es, endo helial and ascula smoo h muscle cells, p o iding o ca diac cell homeos asis and egene a ion. mic oRNAs a e mas e swi ches con olling p oli e a ion and di e en ia ion, in pa icula egula ing s em cell biology and ca diac de elopmen . Modula ion o mic oRNAs - egula ed gene exp ession ne wo ks holds he po en ial o con ol cell a e and p oli e a ion, wi h p edic able bio echnologic and he apeu ic applica ions. To ob ain insigh s in o he egula o y ne wo ks ac i e in ca diac s em cells, we cha ac e ized he exp ession p o ile o 95 mic oRNAs wi h epo ed unc ions in s em cell and issue di e en ia ion in mouse ca diac s em cells, and compa ed i o ha o mouse emb yonic hea and mesenchymal s em cells. The mos highly exp essed mic oRNAs iden i ied in ca diac s em cells a e known o a ge key genes in ol ed in he con ol o cell p oli e a ion and adhesion, ascula unc ion and ca diomyocy e di e en ia ion. We epo a subse o di e en ially exp essed mic oRNAs ha a e p oposed o ac as egula o s o di e en ia ion and p oli e a ion o adul ca diac s em cells, p o iding no el insigh s in o ac i e gene exp ession ne wo ks egula ing hei biological p ope ies. Ci a ion: B a ´s-Rosa ´ io L, Ma suda A, Pinhei o AI, Ga dne R, Lopes T, e al. (2013) Exp ession P o ile o mic oRNAs Regula ing P oli e a ion and Di e en ia ion in Mouse Adul Ca diac S em Cells. PLoS ONE 8(5): e63041. doi:10.1371/jou nal.pone.0063041 Edi o : Pie o An e sa, B igham and Women’s Hospi al, Uni ed S a es o Ame ica Recei ed Feb ua y 19, 2013; Accep ed Ma ch 27, 2013; Published May 17, 2013 Copy igh : ß2013 B a ´s-Rosa ´ io e al. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed. Funding: These au ho s ha e no suppo o unding o epo . Compe ing In e es s: The au ho s decla e ha no compe ing in e es s exis . * E-mail: [email p o ec ed] ¤ Cu en add ess: Cen e o Regene a i e Medicine, Ha a d Medical School, Bos on, Massachuse s, Uni ed S a es o Ame ica .These au ho s con ibu ed equally o his wo k. In oduc ion The obse a ion o ca diomyocy e di ision i s ques ioned he pa adigm ha he mammalian hea is a pos -mi o ic o gan. The isola ion o adul hea cells exp essing ma ke s o s emness (c-ki , Sca-1 o MDR1) displaying he undamen al p ope ies o s em cells: sel - enewal, clonogenici y, and mul ipo ency [1] u he challenged his pa adigm. I is es ima ed ha app oxima ely 3610 6 cells a e gene a ed in he human hea e e y day, a ising om he mul iplica ion o ca diac s em cells (CSCs) [2]. In e ms o pheno ype, CSCs a e undi e en ia ed, keep quiescen un il induced o p oli e a e and may di e en ia e in o one o he h ee ca diac cell lineages: ca diomyocy es, endo helial cells and ascula smoo h muscle cells. The o igin o he CSC popula ion emains unclea . They a e ei he belie ed o be he p ogeny o mesenchymal cells om he bone ma ow, which homed o he hea h ough sys emic ci cula ion, o o co espond o cellula emnan s o he emb yonic hea [3]. Du ing emb yogenesis, a igh ly o ches a ed gene exp ession p og am in ol ing ca diac speci ic genes and an- sc ip ion ac o s ha a e ac i a ed in succession is ini ia ed, coo dina ing hea de elopmen , along wi h he di e en ia ion o he main ca diac cell lineages [4]. In e es ingly, genes ha con ol ca diac o ma ion du ing de elopmen a e ac i e in CSCs. Fu he mo e, du ing he di e en ia ion p ocess om CSCs o ca diomyocy es, CSCs seem o eplica e he emb yonic p og am [5–7]. Howe e , unlike emb yological cells de eloping in o ca diomyocy es, o which once he p ocess begins i inexo ably leads o he inal pheno ype, he adul CSC manages o become s uck in an in e media e s age; bo h he mechanisms ha s op and es a CSCs a e unknown. In he las decade mic oRNAs (miRs) ha e been ound o play impo an oles in he egula ion o mul iple biologic unc ions, including he con ol o s em cell and issue di e en ia ion [5,8– 11], esponse o s ess and in pa icula , hea de elopmen and disease [12–16]. The e a e app oxima ely a housand miRs in he human genome, each one a ge ing mul iple RNAs and exe ing an in luence on hei u no e and ansla ion o di e en deg ees, depending on he speci ic cha ac e is ics o he miR-mRNA in e ac ion [17]. As a consequence o hese mul iple in e ac ions, miRs c ea e complex gene egula o y ne wo ks ha can se e mul iple pu poses, om lending obus ness o cellula esponses, o ac ing as de elopmen al swi ches o b oad en o ce s o issue and cellula iden i y [18–20]. The e o e, he miR exp ession p o ile o a gi en cell ype eme ges as a bona ide ma ke o he ac i e egula o y ne wo ks ha de ine he cell’s biological cha ac e is ics. The iden i ica ion o he CSC miR exp ession p o ile and o hei ole in CSC biology has ne e been sys ema ically add essed. PLOS ONE | www.plosone.o g 1 May 2013 | Volume 8 | Issue 5 | e63041 We epo he i s pa ial miR exp ession p o ile o CSCs isola ed om adul mouse hea s, ocusing on a subse o miRs known o be in ol ed in he egula ion o s em cell and issue di e en ia ion p ocesses. Compa a i e analysis wi h emb yonic hea cells om day E9 and imma u e c-ki posi i e bone ma ow p ogeni o cells (BMCs) has allowed us o iden i y a di e en ial exp ession p o ile ha co ela es s ongly wi h he biological p ope ies o his adul s em cell popula ion, p o iding no el insigh s in o cell iden i y and pheno ype. Me hods CSC Isola ion a) Ca diac cell suspension. Balb/c mice we e sac i iced by eu hanasia wi h CO2 asphyxia ion and he hea s we e emo ed and washed by injec ing 1 ml o Hank’s Balanced Sal Solu ion (HBSS) wi hou Ca2+eMg+(Sigma-Ald ich). The hea s we e sliced in o small clumps (,1 mm3) in a mic o ube wi h 500 ul o F12- Kaighn’s Media (F12-K) (GIBCO #21127) supplemen ed wi h 10% Fe al Bo ine Se um (FBS - GIBCO), 3% Penicillin/ S ep omycin (GIBCO #15140-122) e 1% T ans e in Sodium Seleni e (ITSS) (Sigma-Ald ich #1884) (F12-K+) and incuba ed a 37uC o 20 minu es wi h agi a ion (140 pm). The issue suspension was il e ed h ough a 40 mm nylon mesh a leas h ee imes in o de o exclude he la ge ca diomyocy es om he hea issue. The cell suspension was cen i uged a 12000 pm o 10 minu es a 4uC and hen he pelle was esuspended in 1 ml o FACS bu e (HBSS and 5% FBS). b) Fluo escen ac i a ed cell so ing. Ca diac cells we e hen labeled wi h monoclonal an ibody, an i-Sca1 (dMouse LY- 6A/E, clone E13–161.7 Ra IgG2a – BD Pha mingen TM #553355) conjuga ed wi h Fluo escein iso hiocya- na e (FITC). S aining was done a 4uC in he da k o 30 minu es and washed wi h FACS bu e . Cells esul ing om his p ocedu e we e so ed by FACS in a FACS A ia high-speed cell so e (Bec on Dickinson, San Jose´, CA, USA) wi h a 70 mm nozzle a .5 MPa (70 psi). A 488 nm (15 mW ou pu ) cohe en Sapphi e solid s a e lase was used o exci e FITC. Fluo escein emission was de ec ed wi h a 530/30 band-pass il e . Sca-1-FITC posi i e cells we e collec ed di ec ly in o an RNA la e solu ion (RNAla e H solu ion #AM7020-Ambion) and s o ed a 220uC. Bo h sample and collec ion ubes we e kep a 4uC h oughou so ing. Bone Ma ow S em Cell Isola ion a) Bone ma ow suspension. Isola ion o bone ma ow lineage nega i e cells was pe o med as ollows: Balb/c mice we e sac i iced by eu hanasia wi h CO2 asphyxia ion. The emu and ibia we e emo ed and he bone ma ow was collec ed by lushing wi h FACS bu e (HBSS and 5% FBS). The cell suspension was il e ed h ough a 40 mm nylon mesh and cen i uged a 12000 pm o 3 minu es a 4uC. Cells we e washed once wi h FACS bu e and he cell pelle was esuspended wi h 1 ml FACS bu e . b) Fluo escen ac i a ed cell so ing. Fo Fluo escen Ac i a ed Cell So ing, samples we e ea ed wi h FcBlock (d Mouse CD16/32, clone 2.4G2 Ra IgG2b - IGC) o 15 minu es, a 4uC and washed once, s ained wi h an an ibody cock ail : B220- Bio (dMouse CD45R, clone RA3 6B2 Ra IgG2b - IGC), Mac1- Bio (dMouse CD11b, clone M1/70 Ra IgG2b – BD Pha mingen TM #553309), TER-Bio(dMouse TER 119/E y h oid cells, clone TER 119 Ra IgG2b – BD Pha mingen TM #553672), GR1-Bio APC (dMouse Ly-6G/Ly-6C, clone RB6-8C5 Ra IgG2b – BD Pha mingen TM #553125), CD5-PE (dMouse CD5, clone 53-7.3 Ra IgG2a – BD Pha mingen TM #553023), c-ki -APC APC (d Mouse CD117, clone 2B8 Ra IgG2b – BD Pha mingen TM #553355) o 20 minu es, a 4uC, in he da k and washed wice wi h FACS bu e . The las s aining was done wi h SAV-PE (dMouse S ep a idin-Phye y h in, clone S ep a- idin – BD Pha mingen TM #554061) o 20 minu es, a 4uC, in he da k and he cells we e washed wice wi h FACS bu e . Cells esul ing om his p ocedu e we e so ed by FACS in a BD FACS A ia high-speed cell so e as abo e. PE was exci ed wi h he 488 nm line, and a 633 nm (18 mW ou pu ) JDS Uniphase HeNe ai -cooled lase was used o APC exci a ion. PE and APC emissions we e de ec ed using a 585/42 nm and a 660/30 nm band-pass il e s, espec i ely. Cells exp essing c-ki (APC posi i e) and nega i e o lineage ma ke s (PE nega i e) we e so ed and collec ed di ec ly in o an RNA la e solu ion (RNAla e Hsolu ion #AM7020-Ambion) and s o ed a 220uC. Bo h sample and collec ion ubes we e kep a 4uC h oughou so ing. Isola ion o Emb yonic Hea Cells Fo he isola ion mouse emb yonic hea s cells Balb/c mice we e used o emb yo collec ion. Females we e sac i iced by ce ical disloca ion nine days a e ma ing o ha es emb yos a he desi ed s age – E9. Emb yos we e dissec ed in PBS bu e and hea s we e collec ed, including he i s and second hea ield, ans e ed o RNA la e solu ion (RNAla e H#AM7020- Ambion) and s o ed a 280uC. RNA ex ac ion and quali y con ol was pe o med as desc ibed. RNA Isola ion To al RNA isola ion om samples (including miR ac ion) was pe o med wi h he mi Vana miR Isola ion Ki (Ambion - #AM1561), ollowing he manu ac u e ’s ins uc ions. Samples we e cha ac e ized in he Lab-on-a-chip 2100 Bioanalyze (Agilen ) using he pico6000 RNA chip o quan i ica ion and quali y con ol o RNA p ese a ion. miR P o iling The S em Cell miR qPCR A ay wi h Quan iMi TM (Sys em Biosciences #RA 620A-1) was used o quan i y miRs p esen in he di e en cell popula ions by quan i a i e eal- ime PCR acco ding o he manu ac u e ’s ins uc ions on a CFX Real Time Sys em c1000 The mal Cycle (BioRad) eal- ime qPCR ins u- men . TaqMan miR Assays (Applied Biosys ems) we e used o quan i ica ion o speci ic miRs and he con ol housekeeping RNA sno202 using 1 ng o o al RNA inpu as indica ed by he manu ac u e . mRNA Exp ession Analysis Remo al o genomic DNA om RNA samples was ca ied ou using DNase I (Fe man as). Re e se ansc ip ion was done using he Re e Aid TM H Minus Fi s S and cDNA Syn hesis Ki (Fe men as) wi h 1 ug o RNA and oligo dT p iming acco ding o he manu ac u e ’s ins uc ions. The PCR ampli ica ion o he cDNA p oduc s was pe o med wi h he D eamTaq TM DNA Polyme ase (Fe men as). The ollowing p ime s we e used o RT-PCR analysis: GAPD - Fo wa d p ime : TGCACCACCAACTGCTTAGC; Re e se p ime : GGCATGGACTGTGGTCATGAG; c-Myc - Fo wa d p ime : TGAGCCCCTAGTGCTGCAT; Re e se p ime : AGCCCGACTCCGACCTCTT; Isl1 - Fo wa d p ime : TATC- CAGGGGATGACAGGAA; Re e se p ime : TTGAC- CAGTTGCTGAAAAGC. mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 2 May 2013 | Volume 8 | Issue 5 | e63041 Da a Analysis Analysis o qPCR a ay da a was pe o med as ollows: aw C alues we e no malized by he quan ile me hod using HTqPCR package (D inge and Be one, 2009) implemen ed in Bioconduc- o (Gen leman e al. 2004). The quan ile me hod p oduces a uni o m empi ical dis ibu ion o C alues ac oss samples, allowing o di ec compa ison o C alues, and is especially use ul when housekeeping genes show signi ican a ia ion ac oss samples, as was he case in his s udy. miRs which we e ou side he 90% CI we e conside ed un eliable and miRs which had a C .38 o mo e han 3 lib a ies we e conside ed unde e mined and we e no conside ed o u he analysis. miRs wi h ela i ely cons an C le els a e less likely o be di e en ially exp essed, so including hem in he downs eam analysis would cause some loss o powe when adjus ing he p- alues o mul iple es ing ( he miR-by-miR hypo hesis es ing). Va ia ion ac oss samples was assessed using he in e quan ile ange alues (IQR) o each miR. All miRs wi h an IQR below 1.5 we e il e ed ou . Clus e ing analysis was pe o med by es ima ing he euclidean dis ance be ween samples using gplo s package o R (h p://c an. -p ojec .o g/web/packages/gplo s/index.h ml). Analysis o di e en ial exp ession was pe o med using he lm i unc ion o he Limma package o Bioconduc o (Smy h, 2004). The Limma package applies a linea model o he exp ession da a o each gene and es s o signi ican di e ences using a mode a ed - es based on an empi ical Bayes me hod o mode a e he s anda d e o s o he es ima ed log- old changes. This esul s in mo e s able in e ence and imp o ed powe , especially o expe imen s wi h small numbe s o eplica es. p alues we e adjus ed wi h he Benjamini-Hochbe g algo i hm o con ol o alse disco e y a e. mic oRNAs wi h an adjus ed p alue,0.01% we e conside ed o be di e en ially exp essed. E hics S a emen All animal wo k was pe o med acco ding o Po uguese laws and Eu opean Union Di ec i es. Mice we e exclusi ely used o collec ion o sample issues a e being sac i iced acco ding o s anda d p ocedu es. Resul s The miR Exp ession P o ile o Adul Mouse CSCs Re eals Commi men o Ca diac Lineages The cha ac e iza ion o he miR exp ession p o ile o a speci ic cell ype is expec ed o p o ide ele an insigh s in o he egula o y ne wo ks ha de ine i s biological p ope ies. Howe e , p o iling ansc ip le els om a e cell popula ions wi h low o al RNA le els can ep esen a echnical challenge. CSC isola ion has been epo ed by se e al labo a o ies wo ldwide, using p o ocols ha include issue diges ion and Fluo escence Ac i a ed Cell So ing (FACS) wi h s em cell memb ane ma ke s as c-ki , Sca-1 o MDR1 [2,21,22]. Howe e , p e ious s udies on CSC gene exp ession ha e ocused ei he on emb yonic cells [23] o on e al cells a e p oli e a ion in cul u e [24]. To ob ain high quali y o al RNA samples in o de o cha ac e ize he adul CSC miR exp ession p o ile, we de eloped a me hod o isola ed cells om mice hea s by so mechanical des uc ion o ca diac issue, ollowed by Sca-1 an igen labeling and FACS so ing (Figu e S1). Cells isola ed h ough his app oach could be g own in cul u e and induced o p oli e a e o di e en ia e in o spon aneously bea ing ca diomyocy es, as expec ed om bona ide ca diac p ogeni o s (da a no shown). As con ol, we isola ed bone ma ow c-ki +lineage- BMCs om he same mice. Quan i iable amoun s o high quali y o al RNA could be ob ained om so ed 10 5 BMCs, while o al RNA om 4610 5 CSCs emained below de ec ion limi s (50 pg/ml). Howe e , using RT-qPCR we could consis en ly de ec he exp ession o he housekeeping sRNA sno202 (no shown). The abundance o o al RNA is known o a y widely ac oss issues and, in pa icula , be ween p oli e a ing and quiescen cells [25]. The low le els o o al RNA in CSCs impose signi ican es ic ions o la ge scale p o iling s udies wi hou he use o bias- p one p e-ampli ica ion s eps. Howe e , highly sensi i e, qPCR based app oaches may be applied unde such condi ions. We he e o e gene a ed a ocused p o ile o he exp ession o 95 miRs in ol ed in s em cell main enance and di e en ia ion p ocesses in mouse CSCs using a comme cial RT-qPCR a ay (see Table S1) om h ee independen samples. Da a om hese samples showed a good co ela ion a e no maliza ion, wi h one hi d o he miRs analyzed being below de ec ion limi . The mos abundan miRs de ec ed - Table 1 – a e all known o ha e s ong unc ional co ela ions o ca dio ascula de elopmen and disease. In line wi h he known po en ial o CSC o gi e ise o dis inc ca diac lineages, he mos abundan ly exp essed miRs ound in hese cells a e conside ed speci ic o ca diomyocy e, endo helial and ascula smoo h muscle cells, e ealing possible egula o y mechanisms ha unde lie he CSC di e en ia ion abili y. Compa a i e P o iling o CSC, Emb yonic Hea Cells and Adul BMCs Re eals a Ca diac S em Cell Speci ic Signa u e In o de o u he iden i y key miRs egula ing CSC biology, we pe o med a compa a i e app oach wi h wo popula ions o mul ipo en p ogeni o s ha may gi e ise o ca diac cell lineages and e en ually ep esen he p ecu so s o s em cells isola ed om he adul hea : imma u e bone ma ow cells (BMCs; c-ki +, hema opoye ic lineage nega i e) and emb yonic hea cells om day E9. The compa ison be ween hese popula ions is expec ed o e eal some unde lying di e ences ega ding he ac i a ion o gene exp ession p og ams ela ed o s em cell main enance, p oli e a- ion and ca diac lineage commi men , p o iding impo an insigh s in o he o igins and biology o adul ca diac s em cells. To al RNA samples isola ed om h ee independen eplica es o mouse BMCs and E9 emb yonic hea s we e used o miR p o iling wi h he S em Cell miR q-PCR a ay (see Table S1). To ob ain an o e iew o he simila i ies and di e ences o hei miR exp ession p o ile ela i e o CSCs, we pe o med an unsupe ised clus e ing analysis o ou exp ession da ase s o bo h sample and miR, a e no malizing miR C alues ac oss samples wi h he quan ile me hod and il e ing ou miRs wi h low a ia ion ac oss all samples (Fig. 1). The biological eplica es o each cell ype clus e ed oge he , demons a ing he obus ness o his da ase . Su p isingly, CSCs seg ega ed independen ly om bo h BMCs and emb yonic hea samples, which a e g ouped in a common b anch. Analysis o he clus e ing p o ile sugges ed ha his was mainly de e mined by a g oup o nine miRs ha is highly exp essed in hese wo cell popula ions and absen om CSCs (Fig. 1A, inse ). Eigh o hese miRs belong o he miR-17-92 clus e amily, encoded in h ee ela ed genomic loci (Fig. 1B). The miR-17-92 clus e amily is highly exp essed in p oli e a ing cells and has been shown o ha e oncogenic po en ial [23,26,27]. Addi ionally, hey ha e been shown o be equi ed o no mal hea de elopmen [28–30] and, mo e in e es ingly, o con ol he di e en ia ion o ca diac p ogeni o s [6,28,31]. mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 3 May 2013 | Volume 8 | Issue 5 | e63041 CSCs Di e en ially Exp ess Key Regula o s o Ca diac and Vascula De elopmen The clus e ing analysis p esen ed abo e (Fig. 1) addi ionally e eals g oups o miRs ha dis inguish CSCs om bo h BMCs and emb yonic hea cells. In o de o unde s and how CSCs di e om BMCs we pe o med a di e en ial exp ession analysis be ween he wo samples and iden i ied en di e en ially exp essed miRs (adjus ed p alue,0.01), six o which a e up- egula ed in CSCs (Fig. 2A). As expec ed, h ee membe s o he miR-17-92 amily al eady iden i ied in he clus e ing analysis we e ound o be signi ican ly down- egula ed in CSCs, oge he wi h miR-223, a well-known egula o o hema opoie ic di e en ia ion [32–34]. Among he six up- egula ed miRs in CSCs we ind he ou mos highly exp essed miRs in hese cells: miR-125b, miR 126, miR- 133a and miR-24. miR-133a eme ged as he mos di e en ially exp essed be ween he wo cell ypes, wi h an 100 old highe exp ession le el in CSCs, ollowed by a membe o he same miR amily, miR-133b. These muscle-speci ic miRs a e key egula o s o he ca diomyocy e di e en ia ion p ocess and ha e been shown o con ol he exp ession o ca diomyocy e speci ic p o eins ( e iewed by [13,35,36]). The o he h ee miRs also ha e been linked o ca diac unc ions (see discussion). Addi ionally, miR-218 also displays a signi ican en ichmen in CSCs when compa ed o BMCs. miR-218 was ecen ly shown o unc ion in ascula de elopmen [37–39] and o be equi ed o hea ube o ma ion [28,39,40]. This CSC miR exp ession p o ile implies ha CSCs al eady display a signi ican deg ee o commi men o ca diac lineages. To u he explo e his aspec and disca d he possibili y o e en ual con amina ion o ou samples wi h di e en ia ed ca diomyocy es, we independen ly de e mined he exp ession le els o miR-1, a hallma k o ca diomyocy e di e en ia ion, and wo addi ional miRs known o be essen ial o muscle di e en i- a ion p ocesses: miR-208a and miR-206. miR-208a is encoded in an in on o he myosin hea y chain gene Myh6 [41,42] and is pa o a amily o so-called ‘myomi s’, named a e hei impo an oles in muscle di e en ia ion. miR-206 is ano he membe o he miR-1/133 amily ha exhibi s skele al muscle speci ic exp ession. Fo his pu pose, we used comme cially a ailable Taqman based RT-qPCR p obes, and compa ed hei exp ession le els in mouse hea issue. As a con ol, we quan i ied he exp ession o he abundan and ubiqui ously exp essed miR- 21. This analysis con i med ou p e ious obse a ion ha miR-1 canno be de ec ed in adul CSCs o in emb yonic hea cells a day E9, al hough i is highly exp essed in mouse hea issue (Figu e 2B). In con as , he exp ession le els o mi -208a a e e y simila in bo h cell ypes and hea issue, albei unde ec able in BMCs, con i ming he commi men o CSCs o he ca diomyocy e lineage. In e es ingly, his is in ag eemen wi h he iden i ica ion o ca diac myosin hea y chain-al a in a p o eomic p o iling o CSCs (B a´s-Rosa´ io, unpublished da a). As expec ed, miR-206 could no be de ec ed in any o he samples es ed. These esul s con i m ha CSCs al eady display a signi ican deg ee o commi men o ca diac lineages, displaying a miR exp ession p o ile ha is mo e simila o emb yonic ca diac p ogeni o s. O e exp ession o An i-p oli e a i e miRs Dis inguishes Ca diac S em Cells om Emb yo Hea Cells In o de o be e unde s and he simila i ies and di e ences be ween CSCs and emb yonic hea cells, we pe o med a di e en ial exp ession analysis be ween he wo da ase s and ound a o al o hi een miRs wi h ei he signi ican up- egula ion (se en miRs) o down- egula ion (six miRs) (adjus ed p alue,0.01) (Figu e 2C). Simila o wha was obse ed when compa ing ca diac and imma u e bone ma ow SCs, ou o he six down- egula ed miRs belong o he miR-17,92 clus e amily, co esponding o some o he mos highly exp essed miRs in emb yonic hea cells. O he o he wo down- egula ed miRs in CSCs, miR-302d has been desc ibed as emb yonic s em cell speci ic in bo h mouse and humans [43,44], whe eas miR-107 belongs o he miR-15/107 amily. In mouse his amily includes 11 miRs ha sha e he seed sequence AGCAGCA and a e encoded by independen genes [5,21,45]. The miR-15/107 amily has been shown o co- egula e se e al mRNA a ge s ha encode key p o eins o dis inc cellula unc ions, including me abolic egula ion, cell cycle con ol, con ol o me as asis and epi helial mesenchymal ansi ion and s em cell plas ici y [5]. To unde s and i he obse ed down- egula ion o miR-107 may e lec a CSC speci ic ine- uning o he pa hways egula ed by his g oup o miRs, we looked o he p esence o o he membe s o he miR-15/107 amily in ou da ase . Fou miRs, ep esen ing he mos highly exp essed membe s o his amily (miR-16, miR 103 and miR-195), we e p esen in he a ay used in ou s udy. S ikingly, hey all show simila exp ession le els in emb yonic hea , BMCs and CSCs, wi h he excep ion o miR-107 (Figu e 2D). Thus, down egula ion o miR-107 seems o be a dis inc i e ea u e o CSCs, implying a CSC speci ic egula o y p o ile o miR-15/107 a ge genes. The implica ions o his a e p esen ly unclea , as miR-107 seems o Table 1. Top 10% exp essed miRs in adul CSCs. miR A exp (C ) Repo ed unc ion Re e ence miR-125b 28.660.2 In ol ed in ca diac s ess esponse. [48] miR-126 29.261.0 Regula o o endo helial lineage and angiogenesis in ca dio ascula de elopmen . In ol ed in ca diac disease and adul ca diomyocy e hype ophy. [49] miR-133a 29.460.6 Regula ion o ca diomyocy e di e en ia ion. P omo ion o undi e en ia ed p ogeni o expansion. In ol ed in ca diac disease and adul ca diomyocy e hype ophy. [49] miR-23a 29.760.3 Response o ca diac inju y. [48] miR-24 29.960.8 Response o ca diac inju y. [48] miR-23b 30.160.4 Response o ca diac inju y. [48] miR-125a 30.1+0.5 Response o ca diac inju y. [48] miR-30c 30.1+0.3 In ol ed in ca diac disease and adul ca diomyocy e hype ophy. [49] miR-132 30.3+0.8 Regula o s o endo helial lineage and angiogenesis in ca dio ascula de elopmen . [31] doi:10.1371/jou nal.pone.0063041. 001 mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 4 May 2013 | Volume 8 | Issue 5 | e63041 sha e almos 80% o i s a ge s wi h bo h miR-16 and miR-103 and he e a e con adic o y epo s ega ding i s ole, o example, in cell cycle con ol [5,9]. In e es ingly, his amily o miRs was ecen ly linked o he con ol o he pos -na al mi o ic a es o ca diomyocy es [12], which seems o in ol e he up- egula ion o se e al miR-15 amily membe s, while miR-107 becomes down- Figu e 1. Compa a i e miR exp ession in p ogeni o cell popula ions wi h ca diogenic po en ial. A. Hie a chical clus e ing o samples and miRs o h ee independen eplica es o mouse CSCs (CSC), adul BMCs isola ed om mouse bone ma ow (BM) and mouse emb yonic hea day E9 (EMB). Box highligh s he miR b anch sepa a ing CSCs om BMCs and emb yonic hea cells, composed almos exclusi ely o miR-17/92 amily membe s. Da a shown e e s o no malized C alues (colo key) o il e ed subse o 41 di e en ially exp essed miRs, ou o he 95 miRs analyzed (see me hods). B. The mouse miR-17/92 amily loci. Exp ession le els o all membe s o his clus e we e de e mined, wi h he excep ion o miR-363, which was no p esen in he PCR a ay used in his s udy. doi:10.1371/jou nal.pone.0063041.g001 mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 5 May 2013 | Volume 8 | Issue 5 | e63041 egula ed. These esul s poin o a possible link be ween he exp ession o his miR and he main enance o a quiescen s a e in CSCs. In addi ion o his g oup o down- egula ed miRs, CSCs can be dis inguished om emb yonic hea cells on he basis o se en up- egula ed miRs: le -7a, le -7b, miR-24, miR-125b, miR-132, miR- 149 and miR-223 (Fig. 2C). As men ioned abo e, miR-24, miR-125b and miR-132 a e among he op exp essed miRs in CSCs. In con as , we obse ed ha miR-223 is down egula ed in CSCs in compa ison o BMCs, in ag eemen wi h i s es ablished ole as a egula o o hema opoyesis. Li le is known ega ding he unc ion o miR- 149, in addi ion o he ac ha i has been iden i ied as being down egula ed in esponse o ca diac inju y [18]. The le -7 miRs belong o a conse ed amily o genes known o be in ol ed in he con ol o s em cell p oli e a ion and di e en ia ion [21], ac ing as umo supp esso s. In e es ingly, le -7a a ge s he oncogenic ansc ip ions ac o s Ras and Myc and is nega i ely egula ed by he la e . Thus, high le els o le - 7a/b exp ession a e in ag eemen wi h he non-p oli e a ing pheno ype o CSCs, which seem o ha e se e al Myc-dependen exp ession ne wo ks silenced. miR-24 is also a known an i- Figu e 2. Di e en ial exp ession analysis o mic oRNAs. A. Di e en ially exp essed miRs in adul ca diac and imma u e bone ma ow s em cell popula ions (CSCs and BMCs).A e age log2 exp ession a io o all di e en ially exp essed miRs (p,0.01). B. Compa ison o exp ession o muscle speci ic miRs in emb yonic hea cells (EMB), BMCs and CSCs, and mouse hea issue using Taqman p obes (n = 3). Da a shows ela i e exp ession (2 2DC ) no malized o sno202 RNA exp ession le els. C. Di e en ially exp essed miRs in adul ca diac e sus emb yonic mouse hea cells. A e age log2 exp ession a io o all di e en ially exp essed miRs (p,0.01). D. miR-15/107 amily exp ession le els in he cell popula ions cha ac e ized in his s udy. Plo displays no malized C alues o each independen biological eplica e sample o miR-15/107 amily membe s p esen in he qPCR a ay. miR-107 is speci ically down egula ed in CSCs. Ho izon al ba ma ks a e age C . doi:10.1371/jou nal.pone.0063041.g002 mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 6 May 2013 | Volume 8 | Issue 5 | e63041 p oli e a i e miR ha ac s as a nega i e egula o o Myc exp ession [26]. Silencing o myc-dependen Pa hways in CSCs The compa ison o miRs exp essed in CSCs and emb yonic ca diac p ogeni o s sugges s ha hese cell popula ions di e in he ac i a ion o Myc dependen pa hways. Thus, CSCs o e -exp ess miR-24 and he le -7a/b miRs, which a e known o nega i ely egula e Myc exp ession, while showing a e y s ong down- egula ion o he miR-17/92 amily, which is a known ansc ip- ional a ge o Myc. In e es ingly, his miR amily was ecen ly shown o be equi ed o he e minal commi men o emb yonic ca diac p ogeni o cells om he seconda y hea ield o ca diomyocy e di e en ia ion [28]. This in ol es he di ec a ge ing o he mRNA encoding he LIM-homeodomain an- sc ip ion ac o Isle 1 (Isl1), a ma ke o plu ipo en undi e en i- a ed ca dio ascula p ogeni o s, which has been p oposed o ac as an an i-di e en ia ion ac o . Toge he wi h ou miR p o iling da a, hese obse a ions led us o p opose a ne wo k o ansc ip ional in e ac ions ha could unde lie he CSC pheno- ype (Fig. 3A). We he e o e decided o look a he exp ession o c- Myc and Isl1 in ou Sca1+CSC popula ions and compa ed i o emb yonic ca diac p ogeni o s and o al hea issue (Fig. 3B). In e es ingly, we ind ha , as p edic ed, c-myc exp ession is silenced in CSCs whe eas Isl1 exp ession can be de ec ed a ela i ely high le els when compa ed o emb yonic p ogeni o cells. Ou esul s sugges ha Isl1 may indeed ep esen a common ma ke o ca diac p ogeni o cells, and ha he ac i a ion o he miR-17-92 clus e may ac as a gene al o ches a o o ca diac p ogeni o di e en ia ion. Discussion In his s udy we p esen a ocused p o iling o he exp ession o s emness and di e en ia ion ela ed miRs in Sca1 posi i e adul CSCs. Ou esul s p o ide new insigh s in o ac i e egula o y ne wo ks unde lying he con ol o p oli e a ion and di e en ia- ion, wo c i ical aspec s o CSC biology. In spi e o he i s impo ance o he unde s anding o egula o y mechanisms con olling CSC unc ion, he cha ac e iza ion o ansc ip abundance in his cell popula ion is complica ed by h ee ac o s: he a i y o hese cells (less ha 2% o he o al hea cells [6]); he di icul y o isola ing good quali y samples om ib ous hea issues, and he compa a i ely low le els o o al mRNA p esen in hese cells. Indeed, while we whe e easily able o quan i y and e alua e he quali y o o al RNA isola ed om 10 5 Sca1+BMCs isola ed om he bonema ow (Fig. S1), o al RNA ob ained om ou imes as much Sca1+CSCs emained below de ec ion limi s (i.e, 50 pg/ml using he Agilen RNA 6000 Pico Ki ), in spi e o signi ican imp o emen s in pu i ica ion p oce- du es. This imposes signi ican es ic ions o he applica ion o la ge scale p o iling s udies, while allowing o he use o ocused, highly sensi i e, qPCR based miR-p o iling app oaches. The consis en iden i ica ion o miRs ha a e conside ed speci ic o he h ee cell lineages ha CSCs can di e en ia e in o - ca diomyocy e, endo helial and ascula smoo h muscle cells ([32], see discussion below) - unde sco es he obus ness o ou isola ion p ocedu e. O no e, endo helial pe icy es may also exp ess Sca-1 [35]. Howe e , he deg ee o en ichmen in ca diomyocy e speci ic miRs ha we obse ed makes i unlikely ha a signi ican amoun o hese cells may be p esen in ou samples. The ac ha we could no de ec exp ession o he ca diomyocy e-speci ic miR-1 in CSC samples using wo inde- penden me hods, while we con i med i o be highly exp essed in o al hea issue, u he demons a es he absence o signi ican con amina ion om o he ca diac cell ypes. The e o e ou p o iling s udy speci ically e lec s he miR- egula o y ne wo ks unde lying CSC unc ion and cell a e decision. The compa ison o CSC miR exp ession p o ile wi h ha o BMCs and emb yonic hea cells, which display simila di e en- ia ion po en ial and ha e bo h been hypo hesized o co espond o he CSC p ogeni o popula ion [37], gi es unp eceden ed in o ma ion on he possible miR egula ed pa hways in ol ed in es ablishing he CSC pheno ype. In e es ingly, silencing o he miR-17/92 clus e eme ges as he majo di e ence be ween CSCs and hei wo po en ial p ogeni o popula ions. In hea de elop- men , his clus e is ac i a ed by BMP signaling o down egula e he ca diac p ogeni o genes Isl1 and Tbx1 and p omo e ca diac di e en ia ion in a eed o wa d mechanism [28]. The e o e, he miR-17-92 clus e seems o play an essen ial ole in con olling he iming and di e en ia ion po en ial o Isl-1 posi i e ca diac p ogeni o cells, which ep esen a common mul ipo en p ogen- i o lineage p esen bo h in he emb yonic and adul hea , wi h he abili y o gene a e bo h ca diomyocy e, endo helial, and VSMC descenden s [4,46,47]. The miR-17-92 clus e is known o be egula ed by c-myc leading us o hypo hesize ha he exp ession o his ansc ip ion ac o is down- egula ed in CSCs. In ag eemen wi h his model, we we e unable o de ec c-myc ansc ips in CSCs, in con as wi h wha was obse ed in samples om adul and emb yonic hea . In pa allel wi h he down- egula ion o his gene, and in con as wi h p e ious s udies [6,7], we de ec ed a signi ican exp ession o he Isl1 ansc ip ion ac o . This disc epancy may be explained by a highe quali y o he CSCs RNA samples used in he p esen s udy, and sugges s ha Isl1 may indeed ep esen a common ma ke o all ca diac p ogeni o s, ending a long- e m unexplained disc epancy ega ding Sca1+cells [8,10,11]. In addi ion o he down- egula ion o he miR-17-92 clus e , he di e en ial exp ession analysis o CSCs in compa ison wi h BMCs and emb yonic ca diac cells iden i ied he o e -exp ession o se e al miRs in ol ed in he con ol o cellula di e en ia ion p ocesses. The exp ession o miR-133a, miR-133b and miR-208 is conside ed a speci ic ma k o ca diomyocy e lineage di e en ia ion [13–16]. In his s udy, we ha e ound ha hese miRs a e highly exp essed in CSCs, while exp ession o miR-1, he o he ca diomyocy e speci ic miR, could no be de ec ed. The muscle speci ic miR-1 and miR-133a a e encoded in he same bicis onic ansc ip ional uni , unde he con ol o he ca diogenic ansc ip ion ac o s MEF2 and SRF [19,20]. Bo h miRs ha e been shown o be in ol ed in he con ol o he exp ession o ca diac speci ic p o eins [2,22]. Addi ionally, miR-1 and miR- 133a a e key egula o s o ca diomyocy e p oli e a ion and di e en ia ion, assuming an agonis ic oles in hese p ocesses. Indeed, while miR-1 p omo es di e en ia ion o ES cells owa ds a ca diac a e, miR-133 inhibi s di e en ia ion in o ca diac muscle [23,27]. The di e en ial exp ession o miR-133 in CSCs is he e o e clea ly indica i e o a commi men o he ca diomyocy e lineage, compa ible wi h he main enance o an undi e en ia ed, non-p oli e a i e s a e. The pa allel iden i ica ion o miR-208 exp ession, an in onic miR encoded in he ca diac al a-myosin hea y chain (aMHC) gene, which p omo es he ansi ion om he emb yonic o adul iso o ms o ca diac con ac ile p o eins, u he s esses he CSC commi men o he adul ca diomyocy e lineage. Balancing he CSC commi men o he ca diomyocy e lineage is he iden i ica ion o a signi ican o e exp ession o miR- 126, conside ed he only miR cha ac e is ic o endo helial cells [29,30]. Some o he o he miRs iden i ied as highly exp essed in CSCs ha e also been speci ically implica ed in endo helial cell mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 7 May 2013 | Volume 8 | Issue 5 | e63041 de elopmen and egula ion. In pa icula , miR-132 is an induce o endo helial cell di e en ia ion and p oli e a ion, poin ing o he commi men o CSCs o his lineage [28,31]. In addi ion o he abo e men ioned ole as a egula o o endo helial di e en ia ion, miR-132 was ecen ly shown o egula e he exp ession o he b2 subuni o he ca diac L- ype calcium channel p o ein [33,34] and o unc ion as a pa ac ine ac i a o o hea healing [13,36]. miR- 23b is in ol ed in he mechano- ansduc ion o p oli e a i e signals in endo helial cells [38,39], whe eas miR-218 was ecen ly shown o be a c i ical egula o o asculogenesis and hea ube o ma ion du ing de elopmen [39,40]. One should also ema k ha bo h miR-126 and miR-218 in e ac wi h he VEGF pa hway, aising he hypo hesis ha VEGF is in ol ed in CSCs di e en- ia ion in o endo helial cells. Finally, CSCs a e also known o di e en ia e in o a hi d lineage, ascula smoo h muscle cells (VSMCs). VSBMCs display an unusual abili y o swi ch be ween a p oli e a i e and di e en ia ed (con ac ile) pheno ype an i was ecen ly shown ha miR-24 is in ol ed in he egula ion o his p ocess, p omo ing VSMC dedi e en ia ion [41,42]. Addi ionally, miR-24 was shown o supp ess ca diomyocy e apop osis [43,44]. These esul s sugges ha CSCs display a signi ican deg ee o commi men o di e en ia ion in o he h ee main ca diac lineages - ca diomyocy e, endo helial and ascula smoo h muscle cells - and p o ide e idence o he p esence o miR-dependen egula o y ne wo ks de ining an o e all ca diac-commi ed ye undi e en ia ed pheno ype. An adul s em cell popula ion needs o main ain i s numbe s, con ol he balance be ween cell di ision and he numbe o cells ha unde go di e en ia ion in o di e se cell lineages. Compa a i e p o iling o CSCs and emb yonic hea cells iden i ied he le - 7 miR amily membe s, le -7a, le -7b, miR-125a and miR-125b, as well as miR-223 as being up egula ed in CSCs. Addi ionally, ano he membe o he le -7 amily, miR-125a, was ound o be highly exp essed in CSCs. These miRs ha e epo ed oles as egula o s o s em cell p oli e a ion, apop osis and di e en ia ion, and a e likely o con ibu e o he main enance o a non- p oli e a i e and undi e en ia ed s a e, albei wi h limi ed po en ial [5,21,45]. All oge he , he miR exp ession p o ile o CSC con eys a pic u e o igh con ol o p oli e a ion and cell a e o ien a ion wi h h ee ca diac lineages – ca diomyocy e, endo helial cell and ascula smoo h muscle – in acco dance wi h p e ious known biological ac i i ies o CSCs, ein o cing he possible ole o miRs in hei con ol. A majo ques ion ha emains o be answe ed is whe he he Sca-1 posi i e cells cha ac e ized in his s udy ep esen a homogenous popula ion whe e hese egula o y ne wo ks a e all ac i e, o whe he speci ic sub ypes wi hin his popula ion di e en ially o e -exp ess ma ke s o each lineage and he e o e display a mo e de ined commi men s a e han wha may be in e ed om he analysis o he whole popula ion. Fu u e s udies will help add ess his ques ion and explo e he ole o speci ic miRs iden i ied in his wo k in he con ol o CSC unc ion. Figu e 3. Exp ession o myc and Isl1 in CSCs. A. P oposed egula o y ne wo k in ol ing di e en ially exp essed miRs in emb yonic hea (EMB) and CSCs. B. Exp ession o c-Myc and Isl1 in emb yonic hea and CSCs by semi-quan i a i e RT-PCR. Resul s a e ep esen a i e o h ee independen eplica e samples. C. Quan i ica ion o ela i e exp ession le els o c-Myc and Isl1 (n =3). Exp ession le els a e no malized o GAPDH. doi:10.1371/jou nal.pone.0063041.g003 mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 8 May 2013 | Volume 8 | Issue 5 | e63041 Suppo ing In o ma ion Figu e S1 Fluo escence ac i a ed cell so ing o Sca-1 exp essing cells isola ed om adul mouse hea . An uns ained sample (le plo , A) was used as nega i e con ol o de ine he so ing ga e. Sca-1 posi i e cells ( igh plo , A) we e iden i ied based on FITC-posi i e signal in he 530/30 nm channel, and dis inguished om nega i e cells wi h high au o luo escence using an au o luo escence channel wi h 585620 nm ange. (TIF) Table S1 Raw and no malized qPCR da a o miR exp ession p o iles in mouse adul ca diac s em cells (CSC), bonema ow lin nega i e, c-ki posi i e imma u e bone ma ow s em cells (BM) and mouse emb yonic hea (EMB). Excel ile, wo wo kshee s. (XLS) Au ho Con ibu ions Concei ed and designed he expe imen s: LB-R RG MG-C. Pe o med he expe imen s: LB-R AM AIP RG TL MG-C. Analyzed he da a: LB-R RG AA MG-C. Con ibu ed eagen s/ma e ials/analysis ools: LB-R RG MG- C. W o e he pape : LB-R MG-C. Re e ences 1. Bel ami AP, U banek K, Kajs u a J, Yan SM, Fina o N, e al. (2001) E idence ha human ca diac myocy es di ide a e myoca dial in a c ion. N Engl J Med 344: 1750–1757. doi:10.1056/NEJM200106073442303. 2. An e sa P, Kajs u a J, Le i A, Bolli R (2006) Li e and dea h o ca diac s em cells: a pa adigm shi in ca diac biology. Ci cula ion 113: 1451–1463. doi:10.1161/ CIRCULATIONAHA.105.595181. 3. S u zu AC, Wu SM (2011) De elopmen al and egene a i e biology o mul ipo en ca dio ascula p ogeni o cells. Ci c Res 108: 353–364. doi:10.1161/CIRCRESAHA.110.227066. 4. Olson EN (2006) Gene egula o y ne wo ks in he e olu ion and de elopmen o he hea . Science 313: 1922–1927. doi:10.1126/science.1132292. 5. Finne y JR, Wang W-X, He´be SS, Wil ed BR, Mao G, e al. (2010) The miR-15/107 g oup o mic oRNA genes: e olu iona y biology, cellula unc ions, and oles in human diseases. J Mol Biol 402: 491–509. doi:10.1016/ j.jmb.2010.07.051. 6. Oh H, B ad u e SB, Galla do TD, Nakamu a T, Gaussin V, e al. (2003) Ca diac p ogeni o cells om adul myoca dium: homing, di e en ia ion, and usion a e in a c ion. P oc Na l Acad Sci USA 100: 12313–12318. doi:10.1073/pnas.2132126100. 7. Bel ami AP, Ba lucchi L, To ella D, Bake M, Limana F, e al. (2003) Adul ca diac s em cells a e mul ipo en and suppo myoca dial egene a ion. Cell 114: 763–776. 8. Laugwi z K-L, Mo e i A, Ca on L, Nakano A, Chien KR (2008) Isle 1 ca dio ascula p ogeni o s: a single sou ce o hea lineages? De elopmen 135: 193–205. doi:10.1242/de .001883. 9. Chen P-S, Su J-L, Cha S-T, Ta n W-Y, Wang M-Y, e al. (2011) miR-107 p omo es umo p og ession by a ge ing he le -7 mic oRNA in mice and humans. J Clin In es 121: 3442–3455. doi:10.1172/JCI45390. 10. Mel on C, Judson RL, Blelloch R (2010) Opposing mic oRNA amilies egula e sel - enewal in mouse emb yonic s em cells. Na u e: 1–8. doi:10.1038/ na u e08725. 11. I ey KN, S i as a a D (2010) Mic oRNAs as egula o s o di e en ia ion and cell a e decisions. Cell S em Cell 7: 36–41. doi:10.1016/j.s em.2010.06.012. 12. Po ello ER, Johnson BA, Au o a AB, Simpson E, Nam Y-J, e al. (2011) miR- 15 amily egula es pos na al mi o ic a es o ca diomyocy es. Ci c Res 109: 670–679. doi:10.1161/CIRCRESAHA.111.248880. 13. Co des KR, S i as a a D (2009) Mic oRNA egula ion o ca dio ascula de elopmen . Ci c Res 104: 724–732. doi:10.1161/CIRCRE- SAHA.108.192872. 14. an Rooij E, Su he land LB, Qi X, Richa dson JA, Hill J, e al. (2007) Con ol o s ess-dependen ca diac g ow h and gene exp ession by a mic oRNA. Science 316: 575–579. doi:10.1126/science.1139089. 15. Callis TE, Pandya K, Seok HY, Tang R-H, Ta suguchi M, e al. (2009) Mic oRNA-208a is a egula o o ca diac hype ophy and conduc ion in mice. J Clin In es 119: 2772–2786. doi:10.1172/JCI36154. 16. Small EM, Olson EN (2011) Pe asi e oles o mic oRNAs in ca dio ascula biology. Na u e 469: 336–342. doi:10.1038/na u e09783. 17. Busha i N, Cohen SM (2007) mic oRNA unc ions. Annu Re Cell De Biol 23: 175–205. doi:10.1146/annu e .cellbio.23.090506.123406. 18. an Rooij E, Su he land LB, Tha che JE, DiMaio JM, Naseem RH, e al. (2008) Dys egula ion o mic oRNAs a e myoca dial in a c ion e eals a ole o miR-29 in ca diac ib osis. P oc Na l Acad Sci USA 105: 13027–13032. doi:10.1073/pnas.0805038105. 19. Liu N, Williams AH, Kim Y, McAnally J, Bezp oz annaya S, e al. (2007) An in agenic MEF2-dependen enhance di ec s muscle-speci ic exp ession o mic oRNAs 1 and 133. P oc Na l Acad Sci USA 104: 20844–20849. doi:10.1073/pnas.0710558105. 20. Flyn AS, Lai EC (2008) Biological p inciples o mic oRNA-media ed egula ion: sha ed hemes amid di e si y. Na u e e iews Gene ics 9: 831–842. doi:10.1038/n g2455. 21. Roush S, Slack FJ (2008) The le -7 amily o mic oRNAs. T ends Cell Biol 18: 505–516. doi:10.1016/j. cb.2008.07.007. 22. Liu N, Olson EN (2010) Mic oRNA egula o y ne wo ks in ca dio ascula de elopmen . De Cell 18: 510–525. doi:10.1016/j.de cel.2010.03.010. 23. I ey KN, Mu h A, A nold J, King FW, Yeh R-F, e al. (2008) Mic oRNA egula ion o cell lineages in mouse and human emb yonic s em cells. Cell S em Cell 2: 219–229. doi:10.1016/j.s em.2008.01.016. 24. Sluij e JPG, an Mil A, an Vlie P, Me z CHG, Liu J, e al. (2010) Mic oRNA- 1 and -499 egula e di e en ia ion and p oli e a ion in human-de i ed ca diomyocy e p ogeni o cells. A e ioscle Th omb Vasc Biol 30: 859–868. doi:10.1161/ATVBAHA.109.197434. 25. Ma gue a S, Schmid A, Codlin S, Chen W, Aebe sold R, e al. (2012) Quan i a i e analysis o ission yeas ansc ip omes and p o eomes in p oli e a ing and quiescen cells. Cell 151: 671–683. doi:10.1016/ j.cell.2012.09.019. 26. Lal A, Na a o F, Mahe CA, Maliszewski LE, Yan N, e al. (2009) miR-24 Inhibi s cell p oli e a ion by a ge ing E2F2, MYC, and o he cell-cycle genes ia binding o ‘‘seedless’’ 39UTR mic oRNA ecogni ion elemen s. Mol Cell 35: 610–625. doi:10.1016/j.molcel.2009.08.020. 27. Mendell JT (2008) miRiad oles o he miR-17–92 clus e in de elopmen and disease. Cell 133: 217–222. doi:10.1016/j.cell.2008.04.001. 28. Wang J, G eene SB, Bonilla-Claudio M, Tao Y, Zhang J, e al. (2010) Bmp signaling egula es myoca dial di e en ia ion om ca diac p ogeni o s h ough a Mic oRNA-media ed mechanism. De Cell 19: 903–912. doi:10.1016/j.de - cel.2010.10.022. 29. Nicoli S, S andley C, Walke P, Hu ls one A, Foga y KE, e al. (2010) Mic oRNA-media ed in eg a ion o haemodynamics and Veg signalling du ing angiogenesis. Na u e 464: 1196–1200. doi:10.1038/na u e08889. 30. Ven u a A, Young AG, Winslow MM, Lin aul L, Meissne A, e al. (2008) Ta ge ed dele ion e eals essen ial and o e lapping unc ions o he miR-17 h ough 92 amily o miRNA clus e s. Cell 132: 875–886. doi:10.1016/ j.cell.2008.02.019. 31. Anand S, Maje i BK, Ace edo LM, Mu phy EA, Muk ha a am R, e al. (2010) Mic oRNA-132-media ed loss o p120RasGAP ac i a es he endo helium o acili a e pa hological angiogenesis. Na Med 16: 909–914. doi:10.1038/ nm.2186. 32. Bea zi C, Ro a M, Hosoda T, Tillmanns J, Nascimbene A, e al. (2007) Human ca diac s em cells. P oc Na l Acad Sci USA 104: 14068–14073. doi:10.1073/ pnas.0706760104. 33. Ca illo ED, Escoba Y, Gonza´lez G, He na´ndez A, Galindo JM, e al. (2011) Pos ansc ip ional egula ion o he b2-subuni o ca diac L- ype Ca2+channels by Mic oRNAs du ing long- e m exposu e o isop o e enol in a s. J Ca dio asc Pha macol 58: 470–478. doi:10.1097/FJC.0b013e31822a789b. 34. Chen C-Z (2004) Mic oRNAs Modula e Hema opoie ic Lineage Di e en ia ion. Science 303: 83–86. doi:10.1126/science.1091903. 35. B ach ogel B, Moch H, Pausch F, Schlo¨ ze -Sch eha d U, Ho mann C, e al. (2005) Pe i ascula cells exp essing annexin A5 de ine a no el mesenchymal s em cell-like popula ion wi h he capaci y o di e en ia e in o mul iple mesenchymal lineages. De elopmen 132: 2657–2668. doi:10.1242/de .01846. 36. Ka a e R, Riu F, Mi chell K, Gube na o M, Campagnolo P, e al. (2011) T ansplan a ion o human pe icy e p ogeni o cells imp o es he epai o in a c ed hea h ough ac i a ion o an angiogenic p og am in ol ing mic o- RNA-132. Ci c Res 109: 894–906. doi:10.1161/CIRCRESAHA.111.251546. 37. Tang X-L, Rokosh DG, Guo Y, Bolli R (2010) Ca diac p ogeni o cells and bone ma ow-de i ed e y small emb yonic-like s em cells o ca diac epai a e myoca dial in a c ion. Ci c J 74: 390–404. 38. Wang K-C, Ga mi e LX, Young A, Nguyen P, T inh A, e al. (2010) Role o mic oRNA-23b in low- egula ion o Rb phospho yla ion and endo helial cell g ow h. P oc Na l Acad Sci USA 107: 3234–3239. doi:10.1073/ pnas.0914825107. 39. Small EM, Su he land LB, Rajagopalan KN, Wang S, Olson EN (2010) Mic oRNA-218 egula es ascula pa e ning by modula ion o Sli -Robo signaling. Ci c Res 107: 1336–1344. doi:10.1161/CIRCRESAHA.110.227926. 40. Fish JE, Wy he JD, Xiao T, B uneau BG, S ainie DYR, e al. (2011) A Sli / miR-218/Robo egula o y loop is equi ed du ing hea ube o ma ion in zeb a ish. De elopmen 138: 1409–1419. doi:10.1242/de .060046. 41. Chan MC, Hilya d AC, Wu C, Da is BN, Hill NS, e al. (2010) Molecula basis o an agonism be ween PDGF and he TGFbe a amily o signalling pa hways by con ol o miR-24 exp ession. EMBO J 29: 559–573. doi:10.1038/ emboj.2009.370. mic oRNA Regula ion o Ca diac S em Cells PLOS ONE | www.plosone.o g 9 May 2013 | Volume 8 | Issue 5 | e63041