Full text
Exp ession P o ile o mic oRNAs Regula ing P oli e a ion
and Di e en ia ion in Mouse Adul Ca diac S em Cells
Luis B a
´s-Rosa
´ io
1,2
*, Alex Ma suda
1.¤
, Ana Isabel Pinhei o
3.
, Rui Ga dne
1
, Telma Lopes
1
,
And eia Ama al
3
, Ma ga ida Gama-Ca alho
3
1Ins i u o Gulbenkian de Cie
ˆncia, Oei as, Po ugal, 2Cen o de Ca diologia da Uni e sidade de Lisboa, Faculdade de Medicina de Lisboa, Lisboa, Po ugal, 3Cen e o
Biodi e si y, Func ional and In eg a i e Genomics, Facul y o Sciences, Uni e si y o Lisbon, Lisbon, Po ugal
Abs ac
The iden i ica ion o ca diac cells wi h s em cell p ope ies changed he pa adigm o he hea as a pos mi o ic o gan. These
cells p oli e a e and di e en ia e in o ca diomyocy es, endo helial and ascula smoo h muscle cells, p o iding o ca diac
cell homeos asis and egene a ion. mic oRNAs a e mas e swi ches con olling p oli e a ion and di e en ia ion, in pa icula
egula ing s em cell biology and ca diac de elopmen . Modula ion o mic oRNAs - egula ed gene exp ession ne wo ks
holds he po en ial o con ol cell a e and p oli e a ion, wi h p edic able bio echnologic and he apeu ic applica ions. To
ob ain insigh s in o he egula o y ne wo ks ac i e in ca diac s em cells, we cha ac e ized he exp ession p o ile o 95
mic oRNAs wi h epo ed unc ions in s em cell and issue di e en ia ion in mouse ca diac s em cells, and compa ed i o
ha o mouse emb yonic hea and mesenchymal s em cells. The mos highly exp essed mic oRNAs iden i ied in ca diac
s em cells a e known o a ge key genes in ol ed in he con ol o cell p oli e a ion and adhesion, ascula unc ion and
ca diomyocy e di e en ia ion. We epo a subse o di e en ially exp essed mic oRNAs ha a e p oposed o ac as
egula o s o di e en ia ion and p oli e a ion o adul ca diac s em cells, p o iding no el insigh s in o ac i e gene
exp ession ne wo ks egula ing hei biological p ope ies.
Ci a ion: B a
´s-Rosa
´ io L, Ma suda A, Pinhei o AI, Ga dne R, Lopes T, e al. (2013) Exp ession P o ile o mic oRNAs Regula ing P oli e a ion and Di e en ia ion in
Mouse Adul Ca diac S em Cells. PLoS ONE 8(5): e63041. doi:10.1371/jou nal.pone.0063041
Edi o : Pie o An e sa, B igham and Women’s Hospi al, Uni ed S a es o Ame ica
Recei ed Feb ua y 19, 2013; Accep ed Ma ch 27, 2013; Published May 17, 2013
Copy igh : ß2013 B a
´s-Rosa
´ io e al. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License, which pe mi s
un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal au ho and sou ce a e c edi ed.
Funding: These au ho s ha e no suppo o unding o epo .
Compe ing In e es s: The au ho s decla e ha no compe ing in e es s exis .
* E-mail: [email p o ec ed]
¤ Cu en add ess: Cen e o Regene a i e Medicine, Ha a d Medical School, Bos on, Massachuse s, Uni ed S a es o Ame ica
.These au ho s con ibu ed equally o his wo k.
In oduc ion
The obse a ion o ca diomyocy e di ision i s ques ioned he
pa adigm ha he mammalian hea is a pos -mi o ic o gan. The
isola ion o adul hea cells exp essing ma ke s o s emness (c-ki ,
Sca-1 o MDR1) displaying he undamen al p ope ies o s em
cells: sel - enewal, clonogenici y, and mul ipo ency [1] u he
challenged his pa adigm.
I is es ima ed ha app oxima ely 3610
6
cells a e gene a ed in
he human hea e e y day, a ising om he mul iplica ion o
ca diac s em cells (CSCs) [2]. In e ms o pheno ype, CSCs a e
undi e en ia ed, keep quiescen un il induced o p oli e a e and
may di e en ia e in o one o he h ee ca diac cell lineages:
ca diomyocy es, endo helial cells and ascula smoo h muscle
cells.
The o igin o he CSC popula ion emains unclea . They a e
ei he belie ed o be he p ogeny o mesenchymal cells om he
bone ma ow, which homed o he hea h ough sys emic
ci cula ion, o o co espond o cellula emnan s o he emb yonic
hea [3]. Du ing emb yogenesis, a igh ly o ches a ed gene
exp ession p og am in ol ing ca diac speci ic genes and an-
sc ip ion ac o s ha a e ac i a ed in succession is ini ia ed,
coo dina ing hea de elopmen , along wi h he di e en ia ion o
he main ca diac cell lineages [4]. In e es ingly, genes ha con ol
ca diac o ma ion du ing de elopmen a e ac i e in CSCs.
Fu he mo e, du ing he di e en ia ion p ocess om CSCs o
ca diomyocy es, CSCs seem o eplica e he emb yonic p og am
[5–7]. Howe e , unlike emb yological cells de eloping in o
ca diomyocy es, o which once he p ocess begins i inexo ably
leads o he inal pheno ype, he adul CSC manages o become
s uck in an in e media e s age; bo h he mechanisms ha s op and
es a CSCs a e unknown.
In he las decade mic oRNAs (miRs) ha e been ound o play
impo an oles in he egula ion o mul iple biologic unc ions,
including he con ol o s em cell and issue di e en ia ion [5,8–
11], esponse o s ess and in pa icula , hea de elopmen and
disease [12–16]. The e a e app oxima ely a housand miRs in he
human genome, each one a ge ing mul iple RNAs and exe ing
an in luence on hei u no e and ansla ion o di e en deg ees,
depending on he speci ic cha ac e is ics o he miR-mRNA
in e ac ion [17]. As a consequence o hese mul iple in e ac ions,
miRs c ea e complex gene egula o y ne wo ks ha can se e
mul iple pu poses, om lending obus ness o cellula esponses, o
ac ing as de elopmen al swi ches o b oad en o ce s o issue and
cellula iden i y [18–20]. The e o e, he miR exp ession p o ile o
a gi en cell ype eme ges as a bona ide ma ke o he ac i e
egula o y ne wo ks ha de ine he cell’s biological cha ac e is ics.
The iden i ica ion o he CSC miR exp ession p o ile and o
hei ole in CSC biology has ne e been sys ema ically add essed.
PLOS ONE | www.plosone.o g 1 May 2013 | Volume 8 | Issue 5 | e63041
We epo he i s pa ial miR exp ession p o ile o CSCs isola ed
om adul mouse hea s, ocusing on a subse o miRs known o be
in ol ed in he egula ion o s em cell and issue di e en ia ion
p ocesses. Compa a i e analysis wi h emb yonic hea cells om
day E9 and imma u e c-ki posi i e bone ma ow p ogeni o cells
(BMCs) has allowed us o iden i y a di e en ial exp ession p o ile
ha co ela es s ongly wi h he biological p ope ies o his adul
s em cell popula ion, p o iding no el insigh s in o cell iden i y and
pheno ype.
Me hods
CSC Isola ion
a) Ca diac cell suspension. Balb/c mice we e sac i iced by
eu hanasia wi h CO2 asphyxia ion and he hea s we e emo ed
and washed by injec ing 1 ml o Hank’s Balanced Sal Solu ion
(HBSS) wi hou Ca2+eMg+(Sigma-Ald ich). The hea s we e
sliced in o small clumps (,1 mm3) in a mic o ube wi h 500 ul o
F12- Kaighn’s Media (F12-K) (GIBCO #21127) supplemen ed
wi h 10% Fe al Bo ine Se um (FBS - GIBCO), 3% Penicillin/
S ep omycin (GIBCO #15140-122) e 1% T ans e in Sodium
Seleni e (ITSS) (Sigma-Ald ich #1884) (F12-K+) and incuba ed
a 37uC o 20 minu es wi h agi a ion (140 pm). The issue
suspension was il e ed h ough a 40 mm nylon mesh a leas h ee
imes in o de o exclude he la ge ca diomyocy es om he hea
issue. The cell suspension was cen i uged a 12000 pm o 10
minu es a 4uC and hen he pelle was esuspended in 1 ml o
FACS bu e (HBSS and 5% FBS).
b) Fluo escen ac i a ed cell so ing. Ca diac cells we e
hen labeled wi h monoclonal an ibody, an i-Sca1 (dMouse LY-
6A/E, clone E13–161.7 Ra IgG2a – BD
Pha mingen
TM
#553355) conjuga ed wi h Fluo escein iso hiocya-
na e (FITC). S aining was done a 4uC in he da k o 30 minu es
and washed wi h FACS bu e . Cells esul ing om his p ocedu e
we e so ed by FACS in a FACS A ia high-speed cell so e
(Bec on Dickinson, San Jose´, CA, USA) wi h a 70 mm nozzle
a .5 MPa (70 psi). A 488 nm (15 mW ou pu ) cohe en Sapphi e
solid s a e lase was used o exci e FITC. Fluo escein emission was
de ec ed wi h a 530/30 band-pass il e . Sca-1-FITC posi i e cells
we e collec ed di ec ly in o an RNA la e solu ion (RNAla e H
solu ion #AM7020-Ambion) and s o ed a 220uC. Bo h sample
and collec ion ubes we e kep a 4uC h oughou so ing.
Bone Ma ow S em Cell Isola ion
a) Bone ma ow suspension. Isola ion o bone ma ow
lineage nega i e cells was pe o med as ollows: Balb/c mice we e
sac i iced by eu hanasia wi h CO2 asphyxia ion. The emu and
ibia we e emo ed and he bone ma ow was collec ed by lushing
wi h FACS bu e (HBSS and 5% FBS). The cell suspension was
il e ed h ough a 40 mm nylon mesh and cen i uged a
12000 pm o 3 minu es a 4uC. Cells we e washed once wi h
FACS bu e and he cell pelle was esuspended wi h 1 ml FACS
bu e .
b) Fluo escen ac i a ed cell so ing. Fo Fluo escen
Ac i a ed Cell So ing, samples we e ea ed wi h FcBlock (d
Mouse CD16/32, clone 2.4G2 Ra IgG2b - IGC) o 15 minu es,
a 4uC and washed once, s ained wi h an an ibody cock ail : B220-
Bio (dMouse CD45R, clone RA3 6B2 Ra IgG2b - IGC), Mac1-
Bio (dMouse CD11b, clone M1/70 Ra IgG2b – BD Pha mingen
TM
#553309), TER-Bio(dMouse TER 119/E y h oid cells, clone
TER 119 Ra IgG2b – BD Pha mingen
TM
#553672), GR1-Bio
APC (dMouse Ly-6G/Ly-6C, clone RB6-8C5 Ra IgG2b – BD
Pha mingen
TM
#553125), CD5-PE (dMouse CD5, clone 53-7.3
Ra IgG2a – BD Pha mingen
TM
#553023), c-ki -APC APC (d
Mouse CD117, clone 2B8 Ra IgG2b – BD
Pha mingen
TM
#553355) o 20 minu es, a 4uC, in he da k
and washed wice wi h FACS bu e . The las s aining was done
wi h SAV-PE (dMouse S ep a idin-Phye y h in, clone S ep a-
idin – BD Pha mingen
TM
#554061) o 20 minu es, a 4uC, in he
da k and he cells we e washed wice wi h FACS bu e . Cells
esul ing om his p ocedu e we e so ed by FACS in a BD FACS
A ia high-speed cell so e as abo e. PE was exci ed wi h he
488 nm line, and a 633 nm (18 mW ou pu ) JDS Uniphase HeNe
ai -cooled lase was used o APC exci a ion. PE and APC
emissions we e de ec ed using a 585/42 nm and a 660/30 nm
band-pass il e s, espec i ely. Cells exp essing c-ki (APC posi i e)
and nega i e o lineage ma ke s (PE nega i e) we e so ed and
collec ed di ec ly in o an RNA la e solu ion (RNAla e Hsolu ion
#AM7020-Ambion) and s o ed a 220uC. Bo h sample and
collec ion ubes we e kep a 4uC h oughou so ing.
Isola ion o Emb yonic Hea Cells
Fo he isola ion mouse emb yonic hea s cells Balb/c mice
we e used o emb yo collec ion. Females we e sac i iced by
ce ical disloca ion nine days a e ma ing o ha es emb yos a
he desi ed s age – E9. Emb yos we e dissec ed in PBS bu e and
hea s we e collec ed, including he i s and second hea ield,
ans e ed o RNA la e solu ion (RNAla e H#AM7020-
Ambion) and s o ed a 280uC. RNA ex ac ion and quali y
con ol was pe o med as desc ibed.
RNA Isola ion
To al RNA isola ion om samples (including miR ac ion) was
pe o med wi h he mi Vana miR Isola ion Ki (Ambion -
#AM1561), ollowing he manu ac u e ’s ins uc ions. Samples
we e cha ac e ized in he Lab-on-a-chip 2100 Bioanalyze
(Agilen ) using he pico6000 RNA chip o quan i ica ion and
quali y con ol o RNA p ese a ion.
miR P o iling
The S em Cell miR qPCR A ay wi h Quan iMi TM (Sys em
Biosciences #RA 620A-1) was used o quan i y miRs p esen in
he di e en cell popula ions by quan i a i e eal- ime PCR
acco ding o he manu ac u e ’s ins uc ions on a CFX Real Time
Sys em c1000 The mal Cycle (BioRad) eal- ime qPCR ins u-
men .
TaqMan miR Assays (Applied Biosys ems) we e used o
quan i ica ion o speci ic miRs and he con ol housekeeping
RNA sno202 using 1 ng o o al RNA inpu as indica ed by he
manu ac u e .
mRNA Exp ession Analysis
Remo al o genomic DNA om RNA samples was ca ied ou
using DNase I (Fe man as). Re e se ansc ip ion was done using
he Re e Aid
TM
H Minus Fi s S and cDNA Syn hesis Ki
(Fe men as) wi h 1 ug o RNA and oligo dT p iming acco ding o
he manu ac u e ’s ins uc ions.
The PCR ampli ica ion o he cDNA p oduc s was pe o med
wi h he D eamTaq
TM
DNA Polyme ase (Fe men as). The
ollowing p ime s we e used o RT-PCR analysis: GAPD -
Fo wa d p ime : TGCACCACCAACTGCTTAGC; Re e se
p ime : GGCATGGACTGTGGTCATGAG; c-Myc - Fo wa d
p ime : TGAGCCCCTAGTGCTGCAT; Re e se p ime :
AGCCCGACTCCGACCTCTT; Isl1 - Fo wa d p ime : TATC-
CAGGGGATGACAGGAA; Re e se p ime : TTGAC-
CAGTTGCTGAAAAGC.
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 2 May 2013 | Volume 8 | Issue 5 | e63041
Da a Analysis
Analysis o qPCR a ay da a was pe o med as ollows: aw C
alues we e no malized by he quan ile me hod using HTqPCR
package (D inge and Be one, 2009) implemen ed in Bioconduc-
o (Gen leman e al. 2004). The quan ile me hod p oduces a
uni o m empi ical dis ibu ion o C alues ac oss samples,
allowing o di ec compa ison o C alues, and is especially
use ul when housekeeping genes show signi ican a ia ion ac oss
samples, as was he case in his s udy. miRs which we e ou side he
90% CI we e conside ed un eliable and miRs which had a C .38
o mo e han 3 lib a ies we e conside ed unde e mined and we e
no conside ed o u he analysis. miRs wi h ela i ely cons an
C le els a e less likely o be di e en ially exp essed, so including
hem in he downs eam analysis would cause some loss o powe
when adjus ing he p- alues o mul iple es ing ( he miR-by-miR
hypo hesis es ing). Va ia ion ac oss samples was assessed using he
in e quan ile ange alues (IQR) o each miR. All miRs wi h an
IQR below 1.5 we e il e ed ou .
Clus e ing analysis was pe o med by es ima ing he euclidean
dis ance be ween samples using gplo s package o R (h p://c an.
-p ojec .o g/web/packages/gplo s/index.h ml).
Analysis o di e en ial exp ession was pe o med using he lm i
unc ion o he Limma package o Bioconduc o (Smy h, 2004).
The Limma package applies a linea model o he exp ession da a
o each gene and es s o signi ican di e ences using a
mode a ed - es based on an empi ical Bayes me hod o mode a e
he s anda d e o s o he es ima ed log- old changes. This esul s
in mo e s able in e ence and imp o ed powe , especially o
expe imen s wi h small numbe s o eplica es. p alues we e
adjus ed wi h he Benjamini-Hochbe g algo i hm o con ol o
alse disco e y a e. mic oRNAs wi h an adjus ed p alue,0.01%
we e conside ed o be di e en ially exp essed.
E hics S a emen
All animal wo k was pe o med acco ding o Po uguese laws
and Eu opean Union Di ec i es. Mice we e exclusi ely used o
collec ion o sample issues a e being sac i iced acco ding o
s anda d p ocedu es.
Resul s
The miR Exp ession P o ile o Adul Mouse CSCs Re eals
Commi men o Ca diac Lineages
The cha ac e iza ion o he miR exp ession p o ile o a speci ic
cell ype is expec ed o p o ide ele an insigh s in o he egula o y
ne wo ks ha de ine i s biological p ope ies. Howe e , p o iling
ansc ip le els om a e cell popula ions wi h low o al RNA
le els can ep esen a echnical challenge. CSC isola ion has been
epo ed by se e al labo a o ies wo ldwide, using p o ocols ha
include issue diges ion and Fluo escence Ac i a ed Cell So ing
(FACS) wi h s em cell memb ane ma ke s as c-ki , Sca-1 o
MDR1 [2,21,22]. Howe e , p e ious s udies on CSC gene
exp ession ha e ocused ei he on emb yonic cells [23] o on e al
cells a e p oli e a ion in cul u e [24].
To ob ain high quali y o al RNA samples in o de o
cha ac e ize he adul CSC miR exp ession p o ile, we de eloped
a me hod o isola ed cells om mice hea s by so mechanical
des uc ion o ca diac issue, ollowed by Sca-1 an igen labeling
and FACS so ing (Figu e S1). Cells isola ed h ough his app oach
could be g own in cul u e and induced o p oli e a e o
di e en ia e in o spon aneously bea ing ca diomyocy es, as
expec ed om bona ide ca diac p ogeni o s (da a no shown). As
con ol, we isola ed bone ma ow c-ki +lineage- BMCs om he
same mice. Quan i iable amoun s o high quali y o al RNA could
be ob ained om so ed 10
5
BMCs, while o al RNA om 4610
5
CSCs emained below de ec ion limi s (50 pg/ml). Howe e , using
RT-qPCR we could consis en ly de ec he exp ession o he
housekeeping sRNA sno202 (no shown).
The abundance o o al RNA is known o a y widely ac oss
issues and, in pa icula , be ween p oli e a ing and quiescen cells
[25]. The low le els o o al RNA in CSCs impose signi ican
es ic ions o la ge scale p o iling s udies wi hou he use o bias-
p one p e-ampli ica ion s eps. Howe e , highly sensi i e, qPCR
based app oaches may be applied unde such condi ions. We
he e o e gene a ed a ocused p o ile o he exp ession o 95 miRs
in ol ed in s em cell main enance and di e en ia ion p ocesses in
mouse CSCs using a comme cial RT-qPCR a ay (see Table S1)
om h ee independen samples. Da a om hese samples showed
a good co ela ion a e no maliza ion, wi h one hi d o he miRs
analyzed being below de ec ion limi . The mos abundan miRs
de ec ed - Table 1 – a e all known o ha e s ong unc ional
co ela ions o ca dio ascula de elopmen and disease. In line
wi h he known po en ial o CSC o gi e ise o dis inc ca diac
lineages, he mos abundan ly exp essed miRs ound in hese cells
a e conside ed speci ic o ca diomyocy e, endo helial and ascula
smoo h muscle cells, e ealing possible egula o y mechanisms
ha unde lie he CSC di e en ia ion abili y.
Compa a i e P o iling o CSC, Emb yonic Hea Cells and
Adul BMCs Re eals a Ca diac S em Cell Speci ic
Signa u e
In o de o u he iden i y key miRs egula ing CSC biology,
we pe o med a compa a i e app oach wi h wo popula ions o
mul ipo en p ogeni o s ha may gi e ise o ca diac cell lineages
and e en ually ep esen he p ecu so s o s em cells isola ed om
he adul hea : imma u e bone ma ow cells (BMCs; c-ki +,
hema opoye ic lineage nega i e) and emb yonic hea cells om
day E9.
The compa ison be ween hese popula ions is expec ed o e eal
some unde lying di e ences ega ding he ac i a ion o gene
exp ession p og ams ela ed o s em cell main enance, p oli e a-
ion and ca diac lineage commi men , p o iding impo an
insigh s in o he o igins and biology o adul ca diac s em cells.
To al RNA samples isola ed om h ee independen eplica es
o mouse BMCs and E9 emb yonic hea s we e used o miR
p o iling wi h he S em Cell miR q-PCR a ay (see Table S1). To
ob ain an o e iew o he simila i ies and di e ences o hei miR
exp ession p o ile ela i e o CSCs, we pe o med an unsupe ised
clus e ing analysis o ou exp ession da ase s o bo h sample and
miR, a e no malizing miR C alues ac oss samples wi h he
quan ile me hod and il e ing ou miRs wi h low a ia ion ac oss
all samples (Fig. 1).
The biological eplica es o each cell ype clus e ed oge he ,
demons a ing he obus ness o his da ase . Su p isingly, CSCs
seg ega ed independen ly om bo h BMCs and emb yonic hea
samples, which a e g ouped in a common b anch. Analysis o he
clus e ing p o ile sugges ed ha his was mainly de e mined by a
g oup o nine miRs ha is highly exp essed in hese wo cell
popula ions and absen om CSCs (Fig. 1A, inse ). Eigh o hese
miRs belong o he miR-17-92 clus e amily, encoded in h ee
ela ed genomic loci (Fig. 1B). The miR-17-92 clus e amily is
highly exp essed in p oli e a ing cells and has been shown o ha e
oncogenic po en ial [23,26,27]. Addi ionally, hey ha e been
shown o be equi ed o no mal hea de elopmen [28–30] and,
mo e in e es ingly, o con ol he di e en ia ion o ca diac
p ogeni o s [6,28,31].
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 3 May 2013 | Volume 8 | Issue 5 | e63041
CSCs Di e en ially Exp ess Key Regula o s o Ca diac and
Vascula De elopmen
The clus e ing analysis p esen ed abo e (Fig. 1) addi ionally
e eals g oups o miRs ha dis inguish CSCs om bo h BMCs
and emb yonic hea cells. In o de o unde s and how CSCs
di e om BMCs we pe o med a di e en ial exp ession analysis
be ween he wo samples and iden i ied en di e en ially exp essed
miRs (adjus ed p alue,0.01), six o which a e up- egula ed in
CSCs (Fig. 2A). As expec ed, h ee membe s o he miR-17-92
amily al eady iden i ied in he clus e ing analysis we e ound o be
signi ican ly down- egula ed in CSCs, oge he wi h miR-223, a
well-known egula o o hema opoie ic di e en ia ion [32–34].
Among he six up- egula ed miRs in CSCs we ind he ou mos
highly exp essed miRs in hese cells: miR-125b, miR 126, miR-
133a and miR-24. miR-133a eme ged as he mos di e en ially
exp essed be ween he wo cell ypes, wi h an 100 old highe
exp ession le el in CSCs, ollowed by a membe o he same miR
amily, miR-133b. These muscle-speci ic miRs a e key egula o s
o he ca diomyocy e di e en ia ion p ocess and ha e been shown
o con ol he exp ession o ca diomyocy e speci ic p o eins
( e iewed by [13,35,36]). The o he h ee miRs also ha e been
linked o ca diac unc ions (see discussion). Addi ionally, miR-218
also displays a signi ican en ichmen in CSCs when compa ed o
BMCs. miR-218 was ecen ly shown o unc ion in ascula
de elopmen [37–39] and o be equi ed o hea ube o ma ion
[28,39,40]. This CSC miR exp ession p o ile implies ha CSCs
al eady display a signi ican deg ee o commi men o ca diac
lineages. To u he explo e his aspec and disca d he possibili y
o e en ual con amina ion o ou samples wi h di e en ia ed
ca diomyocy es, we independen ly de e mined he exp ession
le els o miR-1, a hallma k o ca diomyocy e di e en ia ion, and
wo addi ional miRs known o be essen ial o muscle di e en i-
a ion p ocesses: miR-208a and miR-206. miR-208a is encoded in
an in on o he myosin hea y chain gene Myh6 [41,42] and is
pa o a amily o so-called ‘myomi s’, named a e hei
impo an oles in muscle di e en ia ion. miR-206 is ano he
membe o he miR-1/133 amily ha exhibi s skele al muscle
speci ic exp ession. Fo his pu pose, we used comme cially
a ailable Taqman based RT-qPCR p obes, and compa ed hei
exp ession le els in mouse hea issue. As a con ol, we quan i ied
he exp ession o he abundan and ubiqui ously exp essed miR-
21. This analysis con i med ou p e ious obse a ion ha miR-1
canno be de ec ed in adul CSCs o in emb yonic hea cells a
day E9, al hough i is highly exp essed in mouse hea issue
(Figu e 2B). In con as , he exp ession le els o mi -208a a e e y
simila in bo h cell ypes and hea issue, albei unde ec able in
BMCs, con i ming he commi men o CSCs o he ca diomyocy e
lineage. In e es ingly, his is in ag eemen wi h he iden i ica ion o
ca diac myosin hea y chain-al a in a p o eomic p o iling o CSCs
(B a´s-Rosa´ io, unpublished da a). As expec ed, miR-206 could no
be de ec ed in any o he samples es ed. These esul s con i m ha
CSCs al eady display a signi ican deg ee o commi men o
ca diac lineages, displaying a miR exp ession p o ile ha is mo e
simila o emb yonic ca diac p ogeni o s.
O e exp ession o An i-p oli e a i e miRs Dis inguishes
Ca diac S em Cells om Emb yo Hea Cells
In o de o be e unde s and he simila i ies and di e ences
be ween CSCs and emb yonic hea cells, we pe o med a
di e en ial exp ession analysis be ween he wo da ase s and
ound a o al o hi een miRs wi h ei he signi ican up-
egula ion (se en miRs) o down- egula ion (six miRs) (adjus ed p
alue,0.01) (Figu e 2C). Simila o wha was obse ed when
compa ing ca diac and imma u e bone ma ow SCs, ou o he
six down- egula ed miRs belong o he miR-17,92 clus e
amily, co esponding o some o he mos highly exp essed miRs
in emb yonic hea cells.
O he o he wo down- egula ed miRs in CSCs, miR-302d has
been desc ibed as emb yonic s em cell speci ic in bo h mouse and
humans [43,44], whe eas miR-107 belongs o he miR-15/107
amily. In mouse his amily includes 11 miRs ha sha e he seed
sequence AGCAGCA and a e encoded by independen genes
[5,21,45]. The miR-15/107 amily has been shown o co- egula e
se e al mRNA a ge s ha encode key p o eins o dis inc cellula
unc ions, including me abolic egula ion, cell cycle con ol,
con ol o me as asis and epi helial mesenchymal ansi ion and
s em cell plas ici y [5]. To unde s and i he obse ed down-
egula ion o miR-107 may e lec a CSC speci ic ine- uning o
he pa hways egula ed by his g oup o miRs, we looked o he
p esence o o he membe s o he miR-15/107 amily in ou
da ase . Fou miRs, ep esen ing he mos highly exp essed
membe s o his amily (miR-16, miR 103 and miR-195), we e
p esen in he a ay used in ou s udy. S ikingly, hey all show
simila exp ession le els in emb yonic hea , BMCs and CSCs,
wi h he excep ion o miR-107 (Figu e 2D). Thus, down egula ion
o miR-107 seems o be a dis inc i e ea u e o CSCs, implying a
CSC speci ic egula o y p o ile o miR-15/107 a ge genes. The
implica ions o his a e p esen ly unclea , as miR-107 seems o
Table 1. Top 10% exp essed miRs in adul CSCs.
miR A exp (C ) Repo ed unc ion Re e ence
miR-125b 28.660.2 In ol ed in ca diac s ess esponse. [48]
miR-126 29.261.0 Regula o o endo helial lineage and angiogenesis in ca dio ascula de elopmen . In ol ed
in ca diac disease and adul ca diomyocy e hype ophy.
[49]
miR-133a 29.460.6 Regula ion o ca diomyocy e di e en ia ion. P omo ion o undi e en ia ed p ogeni o expansion.
In ol ed in ca diac disease and adul ca diomyocy e hype ophy.
[49]
miR-23a 29.760.3 Response o ca diac inju y. [48]
miR-24 29.960.8 Response o ca diac inju y. [48]
miR-23b 30.160.4 Response o ca diac inju y. [48]
miR-125a 30.1+0.5 Response o ca diac inju y. [48]
miR-30c 30.1+0.3 In ol ed in ca diac disease and adul ca diomyocy e hype ophy. [49]
miR-132 30.3+0.8 Regula o s o endo helial lineage and angiogenesis in ca dio ascula de elopmen . [31]
doi:10.1371/jou nal.pone.0063041. 001
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 4 May 2013 | Volume 8 | Issue 5 | e63041
sha e almos 80% o i s a ge s wi h bo h miR-16 and miR-103
and he e a e con adic o y epo s ega ding i s ole, o example,
in cell cycle con ol [5,9]. In e es ingly, his amily o miRs was
ecen ly linked o he con ol o he pos -na al mi o ic a es o
ca diomyocy es [12], which seems o in ol e he up- egula ion o
se e al miR-15 amily membe s, while miR-107 becomes down-
Figu e 1. Compa a i e miR exp ession in p ogeni o cell popula ions wi h ca diogenic po en ial. A. Hie a chical clus e ing o samples
and miRs o h ee independen eplica es o mouse CSCs (CSC), adul BMCs isola ed om mouse bone ma ow (BM) and mouse emb yonic hea day
E9 (EMB). Box highligh s he miR b anch sepa a ing CSCs om BMCs and emb yonic hea cells, composed almos exclusi ely o miR-17/92 amily
membe s. Da a shown e e s o no malized C alues (colo key) o il e ed subse o 41 di e en ially exp essed miRs, ou o he 95 miRs analyzed (see
me hods). B. The mouse miR-17/92 amily loci. Exp ession le els o all membe s o his clus e we e de e mined, wi h he excep ion o miR-363,
which was no p esen in he PCR a ay used in his s udy.
doi:10.1371/jou nal.pone.0063041.g001
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 5 May 2013 | Volume 8 | Issue 5 | e63041
egula ed. These esul s poin o a possible link be ween he
exp ession o his miR and he main enance o a quiescen s a e in
CSCs.
In addi ion o his g oup o down- egula ed miRs, CSCs can be
dis inguished om emb yonic hea cells on he basis o se en up-
egula ed miRs: le -7a, le -7b, miR-24, miR-125b, miR-132, miR-
149 and miR-223 (Fig. 2C).
As men ioned abo e, miR-24, miR-125b and miR-132 a e
among he op exp essed miRs in CSCs. In con as , we obse ed
ha miR-223 is down egula ed in CSCs in compa ison o BMCs,
in ag eemen wi h i s es ablished ole as a egula o o
hema opoyesis. Li le is known ega ding he unc ion o miR-
149, in addi ion o he ac ha i has been iden i ied as being
down egula ed in esponse o ca diac inju y [18].
The le -7 miRs belong o a conse ed amily o genes known o
be in ol ed in he con ol o s em cell p oli e a ion and
di e en ia ion [21], ac ing as umo supp esso s. In e es ingly,
le -7a a ge s he oncogenic ansc ip ions ac o s Ras and Myc
and is nega i ely egula ed by he la e . Thus, high le els o le -
7a/b exp ession a e in ag eemen wi h he non-p oli e a ing
pheno ype o CSCs, which seem o ha e se e al Myc-dependen
exp ession ne wo ks silenced. miR-24 is also a known an i-
Figu e 2. Di e en ial exp ession analysis o mic oRNAs. A. Di e en ially exp essed miRs in adul ca diac and imma u e bone ma ow s em
cell popula ions (CSCs and BMCs).A e age log2 exp ession a io o all di e en ially exp essed miRs (p,0.01). B. Compa ison o exp ession o muscle
speci ic miRs in emb yonic hea cells (EMB), BMCs and CSCs, and mouse hea issue using Taqman p obes (n = 3). Da a shows ela i e exp ession
(2
2DC
) no malized o sno202 RNA exp ession le els. C. Di e en ially exp essed miRs in adul ca diac e sus emb yonic mouse hea cells. A e age
log2 exp ession a io o all di e en ially exp essed miRs (p,0.01). D. miR-15/107 amily exp ession le els in he cell popula ions cha ac e ized in his
s udy. Plo displays no malized C alues o each independen biological eplica e sample o miR-15/107 amily membe s p esen in he qPCR a ay.
miR-107 is speci ically down egula ed in CSCs. Ho izon al ba ma ks a e age C .
doi:10.1371/jou nal.pone.0063041.g002
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 6 May 2013 | Volume 8 | Issue 5 | e63041
p oli e a i e miR ha ac s as a nega i e egula o o Myc
exp ession [26].
Silencing o myc-dependen Pa hways in CSCs
The compa ison o miRs exp essed in CSCs and emb yonic
ca diac p ogeni o s sugges s ha hese cell popula ions di e in he
ac i a ion o Myc dependen pa hways. Thus, CSCs o e -exp ess
miR-24 and he le -7a/b miRs, which a e known o nega i ely
egula e Myc exp ession, while showing a e y s ong down-
egula ion o he miR-17/92 amily, which is a known ansc ip-
ional a ge o Myc. In e es ingly, his miR amily was ecen ly
shown o be equi ed o he e minal commi men o emb yonic
ca diac p ogeni o cells om he seconda y hea ield o
ca diomyocy e di e en ia ion [28]. This in ol es he di ec
a ge ing o he mRNA encoding he LIM-homeodomain an-
sc ip ion ac o Isle 1 (Isl1), a ma ke o plu ipo en undi e en i-
a ed ca dio ascula p ogeni o s, which has been p oposed o ac as
an an i-di e en ia ion ac o . Toge he wi h ou miR p o iling
da a, hese obse a ions led us o p opose a ne wo k o
ansc ip ional in e ac ions ha could unde lie he CSC pheno-
ype (Fig. 3A). We he e o e decided o look a he exp ession o c-
Myc and Isl1 in ou Sca1+CSC popula ions and compa ed i o
emb yonic ca diac p ogeni o s and o al hea issue (Fig. 3B).
In e es ingly, we ind ha , as p edic ed, c-myc exp ession is
silenced in CSCs whe eas Isl1 exp ession can be de ec ed a
ela i ely high le els when compa ed o emb yonic p ogeni o
cells. Ou esul s sugges ha Isl1 may indeed ep esen a common
ma ke o ca diac p ogeni o cells, and ha he ac i a ion o he
miR-17-92 clus e may ac as a gene al o ches a o o ca diac
p ogeni o di e en ia ion.
Discussion
In his s udy we p esen a ocused p o iling o he exp ession o
s emness and di e en ia ion ela ed miRs in Sca1 posi i e adul
CSCs. Ou esul s p o ide new insigh s in o ac i e egula o y
ne wo ks unde lying he con ol o p oli e a ion and di e en ia-
ion, wo c i ical aspec s o CSC biology.
In spi e o he i s impo ance o he unde s anding o egula o y
mechanisms con olling CSC unc ion, he cha ac e iza ion o
ansc ip abundance in his cell popula ion is complica ed by
h ee ac o s: he a i y o hese cells (less ha 2% o he o al hea
cells [6]); he di icul y o isola ing good quali y samples om
ib ous hea issues, and he compa a i ely low le els o o al
mRNA p esen in hese cells. Indeed, while we whe e easily able o
quan i y and e alua e he quali y o o al RNA isola ed om 10
5
Sca1+BMCs isola ed om he bonema ow (Fig. S1), o al RNA
ob ained om ou imes as much Sca1+CSCs emained below
de ec ion limi s (i.e, 50 pg/ml using he Agilen RNA 6000 Pico
Ki ), in spi e o signi ican imp o emen s in pu i ica ion p oce-
du es. This imposes signi ican es ic ions o he applica ion o
la ge scale p o iling s udies, while allowing o he use o ocused,
highly sensi i e, qPCR based miR-p o iling app oaches.
The consis en iden i ica ion o miRs ha a e conside ed
speci ic o he h ee cell lineages ha CSCs can di e en ia e in o
- ca diomyocy e, endo helial and ascula smoo h muscle cells
([32], see discussion below) - unde sco es he obus ness o ou
isola ion p ocedu e. O no e, endo helial pe icy es may also
exp ess Sca-1 [35]. Howe e , he deg ee o en ichmen in
ca diomyocy e speci ic miRs ha we obse ed makes i unlikely
ha a signi ican amoun o hese cells may be p esen in ou
samples. The ac ha we could no de ec exp ession o he
ca diomyocy e-speci ic miR-1 in CSC samples using wo inde-
penden me hods, while we con i med i o be highly exp essed in
o al hea issue, u he demons a es he absence o signi ican
con amina ion om o he ca diac cell ypes. The e o e ou
p o iling s udy speci ically e lec s he miR- egula o y ne wo ks
unde lying CSC unc ion and cell a e decision.
The compa ison o CSC miR exp ession p o ile wi h ha o
BMCs and emb yonic hea cells, which display simila di e en-
ia ion po en ial and ha e bo h been hypo hesized o co espond
o he CSC p ogeni o popula ion [37], gi es unp eceden ed
in o ma ion on he possible miR egula ed pa hways in ol ed in
es ablishing he CSC pheno ype. In e es ingly, silencing o he
miR-17/92 clus e eme ges as he majo di e ence be ween CSCs
and hei wo po en ial p ogeni o popula ions. In hea de elop-
men , his clus e is ac i a ed by BMP signaling o down egula e
he ca diac p ogeni o genes Isl1 and Tbx1 and p omo e ca diac
di e en ia ion in a eed o wa d mechanism [28]. The e o e, he
miR-17-92 clus e seems o play an essen ial ole in con olling he
iming and di e en ia ion po en ial o Isl-1 posi i e ca diac
p ogeni o cells, which ep esen a common mul ipo en p ogen-
i o lineage p esen bo h in he emb yonic and adul hea , wi h
he abili y o gene a e bo h ca diomyocy e, endo helial, and
VSMC descenden s [4,46,47].
The miR-17-92 clus e is known o be egula ed by c-myc
leading us o hypo hesize ha he exp ession o his ansc ip ion
ac o is down- egula ed in CSCs. In ag eemen wi h his model,
we we e unable o de ec c-myc ansc ips in CSCs, in con as
wi h wha was obse ed in samples om adul and emb yonic
hea . In pa allel wi h he down- egula ion o his gene, and in
con as wi h p e ious s udies [6,7], we de ec ed a signi ican
exp ession o he Isl1 ansc ip ion ac o . This disc epancy may
be explained by a highe quali y o he CSCs RNA samples used in
he p esen s udy, and sugges s ha Isl1 may indeed ep esen a
common ma ke o all ca diac p ogeni o s, ending a long- e m
unexplained disc epancy ega ding Sca1+cells [8,10,11].
In addi ion o he down- egula ion o he miR-17-92 clus e , he
di e en ial exp ession analysis o CSCs in compa ison wi h BMCs
and emb yonic ca diac cells iden i ied he o e -exp ession o
se e al miRs in ol ed in he con ol o cellula di e en ia ion
p ocesses. The exp ession o miR-133a, miR-133b and miR-208 is
conside ed a speci ic ma k o ca diomyocy e lineage di e en ia ion
[13–16]. In his s udy, we ha e ound ha hese miRs a e highly
exp essed in CSCs, while exp ession o miR-1, he o he
ca diomyocy e speci ic miR, could no be de ec ed. The muscle
speci ic miR-1 and miR-133a a e encoded in he same bicis onic
ansc ip ional uni , unde he con ol o he ca diogenic
ansc ip ion ac o s MEF2 and SRF [19,20]. Bo h miRs ha e
been shown o be in ol ed in he con ol o he exp ession o
ca diac speci ic p o eins [2,22]. Addi ionally, miR-1 and miR-
133a a e key egula o s o ca diomyocy e p oli e a ion and
di e en ia ion, assuming an agonis ic oles in hese p ocesses.
Indeed, while miR-1 p omo es di e en ia ion o ES cells owa ds a
ca diac a e, miR-133 inhibi s di e en ia ion in o ca diac muscle
[23,27]. The di e en ial exp ession o miR-133 in CSCs is
he e o e clea ly indica i e o a commi men o he ca diomyocy e
lineage, compa ible wi h he main enance o an undi e en ia ed,
non-p oli e a i e s a e. The pa allel iden i ica ion o miR-208
exp ession, an in onic miR encoded in he ca diac al a-myosin
hea y chain (aMHC) gene, which p omo es he ansi ion om
he emb yonic o adul iso o ms o ca diac con ac ile p o eins,
u he s esses he CSC commi men o he adul ca diomyocy e
lineage. Balancing he CSC commi men o he ca diomyocy e
lineage is he iden i ica ion o a signi ican o e exp ession o miR-
126, conside ed he only miR cha ac e is ic o endo helial cells
[29,30]. Some o he o he miRs iden i ied as highly exp essed in
CSCs ha e also been speci ically implica ed in endo helial cell
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 7 May 2013 | Volume 8 | Issue 5 | e63041
de elopmen and egula ion. In pa icula , miR-132 is an induce
o endo helial cell di e en ia ion and p oli e a ion, poin ing o he
commi men o CSCs o his lineage [28,31]. In addi ion o he
abo e men ioned ole as a egula o o endo helial di e en ia ion,
miR-132 was ecen ly shown o egula e he exp ession o he b2
subuni o he ca diac L- ype calcium channel p o ein [33,34] and
o unc ion as a pa ac ine ac i a o o hea healing [13,36]. miR-
23b is in ol ed in he mechano- ansduc ion o p oli e a i e
signals in endo helial cells [38,39], whe eas miR-218 was ecen ly
shown o be a c i ical egula o o asculogenesis and hea ube
o ma ion du ing de elopmen [39,40]. One should also ema k
ha bo h miR-126 and miR-218 in e ac wi h he VEGF pa hway,
aising he hypo hesis ha VEGF is in ol ed in CSCs di e en-
ia ion in o endo helial cells. Finally, CSCs a e also known o
di e en ia e in o a hi d lineage, ascula smoo h muscle cells
(VSMCs). VSBMCs display an unusual abili y o swi ch be ween a
p oli e a i e and di e en ia ed (con ac ile) pheno ype an i was
ecen ly shown ha miR-24 is in ol ed in he egula ion o his
p ocess, p omo ing VSMC dedi e en ia ion [41,42]. Addi ionally,
miR-24 was shown o supp ess ca diomyocy e apop osis [43,44].
These esul s sugges ha CSCs display a signi ican deg ee o
commi men o di e en ia ion in o he h ee main ca diac lineages
- ca diomyocy e, endo helial and ascula smoo h muscle cells -
and p o ide e idence o he p esence o miR-dependen
egula o y ne wo ks de ining an o e all ca diac-commi ed ye
undi e en ia ed pheno ype.
An adul s em cell popula ion needs o main ain i s numbe s,
con ol he balance be ween cell di ision and he numbe o cells
ha unde go di e en ia ion in o di e se cell lineages. Compa a i e
p o iling o CSCs and emb yonic hea cells iden i ied he le -
7 miR amily membe s, le -7a, le -7b, miR-125a and miR-125b,
as well as miR-223 as being up egula ed in CSCs. Addi ionally,
ano he membe o he le -7 amily, miR-125a, was ound o be
highly exp essed in CSCs. These miRs ha e epo ed oles as
egula o s o s em cell p oli e a ion, apop osis and di e en ia ion,
and a e likely o con ibu e o he main enance o a non-
p oli e a i e and undi e en ia ed s a e, albei wi h limi ed
po en ial [5,21,45].
All oge he , he miR exp ession p o ile o CSC con eys a
pic u e o igh con ol o p oli e a ion and cell a e o ien a ion
wi h h ee ca diac lineages – ca diomyocy e, endo helial cell and
ascula smoo h muscle – in acco dance wi h p e ious known
biological ac i i ies o CSCs, ein o cing he possible ole o miRs
in hei con ol. A majo ques ion ha emains o be answe ed is
whe he he Sca-1 posi i e cells cha ac e ized in his s udy
ep esen a homogenous popula ion whe e hese egula o y
ne wo ks a e all ac i e, o whe he speci ic sub ypes wi hin his
popula ion di e en ially o e -exp ess ma ke s o each lineage and
he e o e display a mo e de ined commi men s a e han wha may
be in e ed om he analysis o he whole popula ion. Fu u e
s udies will help add ess his ques ion and explo e he ole o
speci ic miRs iden i ied in his wo k in he con ol o CSC
unc ion.
Figu e 3. Exp ession o myc and Isl1 in CSCs. A. P oposed egula o y ne wo k in ol ing di e en ially exp essed miRs in emb yonic hea (EMB)
and CSCs. B. Exp ession o c-Myc and Isl1 in emb yonic hea and CSCs by semi-quan i a i e RT-PCR. Resul s a e ep esen a i e o h ee independen
eplica e samples. C. Quan i ica ion o ela i e exp ession le els o c-Myc and Isl1 (n =3). Exp ession le els a e no malized o GAPDH.
doi:10.1371/jou nal.pone.0063041.g003
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 8 May 2013 | Volume 8 | Issue 5 | e63041
Suppo ing In o ma ion
Figu e S1 Fluo escence ac i a ed cell so ing o Sca-1
exp essing cells isola ed om adul mouse hea . An
uns ained sample (le plo , A) was used as nega i e con ol o
de ine he so ing ga e. Sca-1 posi i e cells ( igh plo , A) we e
iden i ied based on FITC-posi i e signal in he 530/30 nm
channel, and dis inguished om nega i e cells wi h high
au o luo escence using an au o luo escence channel wi h
585620 nm ange.
(TIF)
Table S1 Raw and no malized qPCR da a o miR exp ession
p o iles in mouse adul ca diac s em cells (CSC), bonema ow lin
nega i e, c-ki posi i e imma u e bone ma ow s em cells (BM) and
mouse emb yonic hea (EMB). Excel ile, wo wo kshee s.
(XLS)
Au ho Con ibu ions
Concei ed and designed he expe imen s: LB-R RG MG-C. Pe o med he
expe imen s: LB-R AM AIP RG TL MG-C. Analyzed he da a: LB-R RG
AA MG-C. Con ibu ed eagen s/ma e ials/analysis ools: LB-R RG MG-
C. W o e he pape : LB-R MG-C.
Re e ences
1. Bel ami AP, U banek K, Kajs u a J, Yan SM, Fina o N, e al. (2001) E idence
ha human ca diac myocy es di ide a e myoca dial in a c ion. N Engl J Med
344: 1750–1757. doi:10.1056/NEJM200106073442303.
2. An e sa P, Kajs u a J, Le i A, Bolli R (2006) Li e and dea h o ca diac s em cells:
a pa adigm shi in ca diac biology. Ci cula ion 113: 1451–1463. doi:10.1161/
CIRCULATIONAHA.105.595181.
3. S u zu AC, Wu SM (2011) De elopmen al and egene a i e biology o
mul ipo en ca dio ascula p ogeni o cells. Ci c Res 108: 353–364.
doi:10.1161/CIRCRESAHA.110.227066.
4. Olson EN (2006) Gene egula o y ne wo ks in he e olu ion and de elopmen o
he hea . Science 313: 1922–1927. doi:10.1126/science.1132292.
5. Finne y JR, Wang W-X, He´be SS, Wil ed BR, Mao G, e al. (2010) The
miR-15/107 g oup o mic oRNA genes: e olu iona y biology, cellula unc ions,
and oles in human diseases. J Mol Biol 402: 491–509. doi:10.1016/
j.jmb.2010.07.051.
6. Oh H, B ad u e SB, Galla do TD, Nakamu a T, Gaussin V, e al. (2003)
Ca diac p ogeni o cells om adul myoca dium: homing, di e en ia ion, and
usion a e in a c ion. P oc Na l Acad Sci USA 100: 12313–12318.
doi:10.1073/pnas.2132126100.
7. Bel ami AP, Ba lucchi L, To ella D, Bake M, Limana F, e al. (2003) Adul
ca diac s em cells a e mul ipo en and suppo myoca dial egene a ion. Cell
114: 763–776.
8. Laugwi z K-L, Mo e i A, Ca on L, Nakano A, Chien KR (2008) Isle 1
ca dio ascula p ogeni o s: a single sou ce o hea lineages? De elopmen 135:
193–205. doi:10.1242/de .001883.
9. Chen P-S, Su J-L, Cha S-T, Ta n W-Y, Wang M-Y, e al. (2011) miR-107
p omo es umo p og ession by a ge ing he le -7 mic oRNA in mice and
humans. J Clin In es 121: 3442–3455. doi:10.1172/JCI45390.
10. Mel on C, Judson RL, Blelloch R (2010) Opposing mic oRNA amilies egula e
sel - enewal in mouse emb yonic s em cells. Na u e: 1–8. doi:10.1038/
na u e08725.
11. I ey KN, S i as a a D (2010) Mic oRNAs as egula o s o di e en ia ion and
cell a e decisions. Cell S em Cell 7: 36–41. doi:10.1016/j.s em.2010.06.012.
12. Po ello ER, Johnson BA, Au o a AB, Simpson E, Nam Y-J, e al. (2011) miR-
15 amily egula es pos na al mi o ic a es o ca diomyocy es. Ci c Res 109:
670–679. doi:10.1161/CIRCRESAHA.111.248880.
13. Co des KR, S i as a a D (2009) Mic oRNA egula ion o ca dio ascula
de elopmen . Ci c Res 104: 724–732. doi:10.1161/CIRCRE-
SAHA.108.192872.
14. an Rooij E, Su he land LB, Qi X, Richa dson JA, Hill J, e al. (2007) Con ol o
s ess-dependen ca diac g ow h and gene exp ession by a mic oRNA. Science
316: 575–579. doi:10.1126/science.1139089.
15. Callis TE, Pandya K, Seok HY, Tang R-H, Ta suguchi M, e al. (2009)
Mic oRNA-208a is a egula o o ca diac hype ophy and conduc ion in mice.
J Clin In es 119: 2772–2786. doi:10.1172/JCI36154.
16. Small EM, Olson EN (2011) Pe asi e oles o mic oRNAs in ca dio ascula
biology. Na u e 469: 336–342. doi:10.1038/na u e09783.
17. Busha i N, Cohen SM (2007) mic oRNA unc ions. Annu Re Cell De Biol 23:
175–205. doi:10.1146/annu e .cellbio.23.090506.123406.
18. an Rooij E, Su he land LB, Tha che JE, DiMaio JM, Naseem RH, e al.
(2008) Dys egula ion o mic oRNAs a e myoca dial in a c ion e eals a ole o
miR-29 in ca diac ib osis. P oc Na l Acad Sci USA 105: 13027–13032.
doi:10.1073/pnas.0805038105.
19. Liu N, Williams AH, Kim Y, McAnally J, Bezp oz annaya S, e al. (2007) An
in agenic MEF2-dependen enhance di ec s muscle-speci ic exp ession o
mic oRNAs 1 and 133. P oc Na l Acad Sci USA 104: 20844–20849.
doi:10.1073/pnas.0710558105.
20. Flyn AS, Lai EC (2008) Biological p inciples o mic oRNA-media ed egula ion:
sha ed hemes amid di e si y. Na u e e iews Gene ics 9: 831–842.
doi:10.1038/n g2455.
21. Roush S, Slack FJ (2008) The le -7 amily o mic oRNAs. T ends Cell Biol 18:
505–516. doi:10.1016/j. cb.2008.07.007.
22. Liu N, Olson EN (2010) Mic oRNA egula o y ne wo ks in ca dio ascula
de elopmen . De Cell 18: 510–525. doi:10.1016/j.de cel.2010.03.010.
23. I ey KN, Mu h A, A nold J, King FW, Yeh R-F, e al. (2008) Mic oRNA
egula ion o cell lineages in mouse and human emb yonic s em cells. Cell S em
Cell 2: 219–229. doi:10.1016/j.s em.2008.01.016.
24. Sluij e JPG, an Mil A, an Vlie P, Me z CHG, Liu J, e al. (2010) Mic oRNA-
1 and -499 egula e di e en ia ion and p oli e a ion in human-de i ed
ca diomyocy e p ogeni o cells. A e ioscle Th omb Vasc Biol 30: 859–868.
doi:10.1161/ATVBAHA.109.197434.
25. Ma gue a S, Schmid A, Codlin S, Chen W, Aebe sold R, e al. (2012)
Quan i a i e analysis o ission yeas ansc ip omes and p o eomes in
p oli e a ing and quiescen cells. Cell 151: 671–683. doi:10.1016/
j.cell.2012.09.019.
26. Lal A, Na a o F, Mahe CA, Maliszewski LE, Yan N, e al. (2009) miR-24
Inhibi s cell p oli e a ion by a ge ing E2F2, MYC, and o he cell-cycle genes ia
binding o ‘‘seedless’’ 39UTR mic oRNA ecogni ion elemen s. Mol Cell 35:
610–625. doi:10.1016/j.molcel.2009.08.020.
27. Mendell JT (2008) miRiad oles o he miR-17–92 clus e in de elopmen and
disease. Cell 133: 217–222. doi:10.1016/j.cell.2008.04.001.
28. Wang J, G eene SB, Bonilla-Claudio M, Tao Y, Zhang J, e al. (2010) Bmp
signaling egula es myoca dial di e en ia ion om ca diac p ogeni o s h ough a
Mic oRNA-media ed mechanism. De Cell 19: 903–912. doi:10.1016/j.de -
cel.2010.10.022.
29. Nicoli S, S andley C, Walke P, Hu ls one A, Foga y KE, e al. (2010)
Mic oRNA-media ed in eg a ion o haemodynamics and Veg signalling du ing
angiogenesis. Na u e 464: 1196–1200. doi:10.1038/na u e08889.
30. Ven u a A, Young AG, Winslow MM, Lin aul L, Meissne A, e al. (2008)
Ta ge ed dele ion e eals essen ial and o e lapping unc ions o he miR-17
h ough 92 amily o miRNA clus e s. Cell 132: 875–886. doi:10.1016/
j.cell.2008.02.019.
31. Anand S, Maje i BK, Ace edo LM, Mu phy EA, Muk ha a am R, e al. (2010)
Mic oRNA-132-media ed loss o p120RasGAP ac i a es he endo helium o
acili a e pa hological angiogenesis. Na Med 16: 909–914. doi:10.1038/
nm.2186.
32. Bea zi C, Ro a M, Hosoda T, Tillmanns J, Nascimbene A, e al. (2007) Human
ca diac s em cells. P oc Na l Acad Sci USA 104: 14068–14073. doi:10.1073/
pnas.0706760104.
33. Ca illo ED, Escoba Y, Gonza´lez G, He na´ndez A, Galindo JM, e al. (2011)
Pos ansc ip ional egula ion o he b2-subuni o ca diac L- ype Ca2+channels
by Mic oRNAs du ing long- e m exposu e o isop o e enol in a s. J Ca dio asc
Pha macol 58: 470–478. doi:10.1097/FJC.0b013e31822a789b.
34. Chen C-Z (2004) Mic oRNAs Modula e Hema opoie ic Lineage Di e en ia ion.
Science 303: 83–86. doi:10.1126/science.1091903.
35. B ach ogel B, Moch H, Pausch F, Schlo¨ ze -Sch eha d U, Ho mann C, e al.
(2005) Pe i ascula cells exp essing annexin A5 de ine a no el mesenchymal
s em cell-like popula ion wi h he capaci y o di e en ia e in o mul iple
mesenchymal lineages. De elopmen 132: 2657–2668. doi:10.1242/de .01846.
36. Ka a e R, Riu F, Mi chell K, Gube na o M, Campagnolo P, e al. (2011)
T ansplan a ion o human pe icy e p ogeni o cells imp o es he epai o
in a c ed hea h ough ac i a ion o an angiogenic p og am in ol ing mic o-
RNA-132. Ci c Res 109: 894–906. doi:10.1161/CIRCRESAHA.111.251546.
37. Tang X-L, Rokosh DG, Guo Y, Bolli R (2010) Ca diac p ogeni o cells and
bone ma ow-de i ed e y small emb yonic-like s em cells o ca diac epai
a e myoca dial in a c ion. Ci c J 74: 390–404.
38. Wang K-C, Ga mi e LX, Young A, Nguyen P, T inh A, e al. (2010) Role o
mic oRNA-23b in low- egula ion o Rb phospho yla ion and endo helial cell
g ow h. P oc Na l Acad Sci USA 107: 3234–3239. doi:10.1073/
pnas.0914825107.
39. Small EM, Su he land LB, Rajagopalan KN, Wang S, Olson EN (2010)
Mic oRNA-218 egula es ascula pa e ning by modula ion o Sli -Robo
signaling. Ci c Res 107: 1336–1344. doi:10.1161/CIRCRESAHA.110.227926.
40. Fish JE, Wy he JD, Xiao T, B uneau BG, S ainie DYR, e al. (2011) A Sli /
miR-218/Robo egula o y loop is equi ed du ing hea ube o ma ion in
zeb a ish. De elopmen 138: 1409–1419. doi:10.1242/de .060046.
41. Chan MC, Hilya d AC, Wu C, Da is BN, Hill NS, e al. (2010) Molecula basis
o an agonism be ween PDGF and he TGFbe a amily o signalling pa hways
by con ol o miR-24 exp ession. EMBO J 29: 559–573. doi:10.1038/
emboj.2009.370.
mic oRNA Regula ion o Ca diac S em Cells
PLOS ONE | www.plosone.o g 9 May 2013 | Volume 8 | Issue 5 | e63041