scieee AI-readable full text Open interactive document viewer

Early Holocenic and historic mtDNA African signatures in the Iberian Peninsula: the Andalusian region as a paradigm

Hernández, CL,Soares, P,Dugoujon, JM,Novelletto, A,Rodríguez, JN,Rito, T,Oliveira, M,Melhaoui, M,Baali, A,Pereira, L,Calderón, R

Abstract

Determining the timing, identity and direction of migrations in the Mediterranean Basin, the role of "migratory routes" in and among regions of Africa, Europe and Asia, and the effects of sex-specific behaviors of population movements have important implications for our understanding of the present human genetic diversity. A crucial component of the Mediterranean world is its westernmost region. Clear features of transcontinental ancient contacts between North African and Iberian populations surrounding the maritime region of Gibraltar Strait have been identified from archeological data. The attempt to discern origin and dates of migration between close geographically related regions has been a challenge in the field of uniparental-based population genetics. Mitochondrial DNA (mtDNA) studies have been focused on surveying the H1, H3 and V lineages when trying to ascertain north-south migrations, and U6 and L in the opposite direction, assuming that those lineages are good proxies for the ancestry of each side of the Mediterranean. To this end, in the present work we have screened entire mtDNA sequences belonging to U6, M1 and L haplogroups in Andalusians--from Huelva and Granada provinces--and Moroccan Berbers. We present here pioneer data and interpretations on the role of NW Africa and the Iberian Peninsula regarding the time of origin, number of founders and expansion directions of these specific markers. The estimated entrance of the North African U6 lineages into Iberia at 10 ky correlates well with other L African clades, indicating that U6 and some L lineages moved together from Africa to Iberia in the Early Holocene. Still, founder analysis highlights that the high sharing of lineages between North Africa and Iberia results from a complex process continued through time, impairing simplistic interpretations. In particular, our work supports the existence of an ancient, frequently denied, bridge connecting the Maghreb and Andalusia.

Full text

1 Supporting Information Early Holocenic and historic mtDNA African signatures in the Iberian Peninsula: the Andalusian region as a paradigm Candela L. Hernández, Pedro Soares, Jean M. Dugoujon, Andrea Novelletto, Juan N. Rodríguez, Teresa Rito, Marisa Oliveira, Mohammed Melhaoui, Abdellatif Baali, Luisa Pereira & Rosario Calderón Supporting Tables ....................................................................................................................... 2 Table A. Complete mtDNA haplotypes of Andalusian and Moroccan samples ...................... 2 Table B. TMRCA estimates of U6, M1 and L lineages ........................................................... 8 Table C. TaqMan Genotyping Assays design .......................................................................... 9 Table D. Database of HVS-I sequences ................................................................................. 10 Supporting Figures .................................................................................................................... 14 Figure A. Geographic location of populations used for contour maps ................................... 14 Figure B. Spatial distribution of haplogroup U6 .................................................................... 15 Figure C. Spatial distribution of haplogroup M1 ................................................................... 16 Figure D. Spatial distribution of haplogroup L2a................................................................... 17 Figure E. Spatial distribution of haplogroup L2b................................................................... 18 Figure F. Spatial distribution of haplogroup L3b ................................................................... 19 Figure G. Spatial distribution of haplogroup L3d .................................................................. 20 Figure H. Spatial distribution of haplogroup L3f ................................................................... 21 Figure I. Spatial distribution of haplogroup L3h1b ................................................................ 22 Figure J. U6a and L1b specific median-joining networks ..................................................... 23 Figure K. Probabilistic proportion of L founder clusters in two migration events ................ 24 Figure L. Graphical depiction of the frequency of L founders in two migration events ........ 25 Other Supporting files S1 Dataset (.xls). U6 Tree. U6 phylogeny built using 266 mitogenomes S2 Dataset (.xls). M1 Tree. M1 phylogeny built using 114 mitogenomes S3 Dataset (.xls). L1 Tree. L1 phylogeny built using 422 mitogenomes S4 Dataset (.xls). L2 Tree. L2 phylogeny built using 706 mitogenomes S5 Dataset (.xls). L3 Tree. L3 phylogeny built using 674 mitogenomes S6 Dataset (.xls). Database of 2,182 complete mitochondrial DNA genomes 2 Table A. Complete mtDNA haplotypes of Andalusian and Moroccan Berber samples. Haplogroups are indicated as reported in respective trees (S1-S5 Datasets). Base change is shown only in transversions and indels. GenBank accession number is provided. Code Accession number Population Haplogroup Haplotype H090 KT819205 Western Andalusia (Huelva) L1b1a12a 73 152 182 185T 195 198 247 263 315insC 357 522delCA 709 710 750 769 825A 1018 1462 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8860 9540 10398 10688 10810 10873 11002 11719 12519 12705 13105 13506 13650 13789 13880A 14178 14203 14560 14766 14769 15115 15326 16126 16187 16189 16223 16264 16270 16278 16293 16311 16400 16519 H088 KT819206 Western Andalusia (Huelva) L1b1a6 73 151 152 182 185T 195 247 263 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7805 7867 8248 8468 8655 8701 8860 9540 9755 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14110 14178 14203 14560 14766 14769 15115 15326 16126 16187 16189 16223 16264 16270 16278 16293 16311 16519 H092 KT819207 Western Andalusia (Huelva) L2a1 73 143 146 152 195 263 309insC 315insC 750 769 1018 1438 2416 2706 2789 3594 4104 4769 5460 7028 7175 7256 7274 7521 7771 8206 8701 8860 9221 9540 10115 10398 10873 11719 11914 11944 12693 12705 13590 13623 13650 13803 14566 14766 15218 15301 15326 15784 16093 16189 16192 16223 16260 16278 16294 16309 16390 16519 H093 KT819208 Western Andalusia (Huelva) L2a1c6 73 143 146 152 189 195 263 309insC 315insC 523delAC 750 769 1018 1438 2416 2706 2789 3010 3594 4104 4164 4769 6663 7028 7175 7256 7274 7521 7771 8206 8701 8860 9201 9221 9540 10115 10398 10873 10954 11719 11914 11944 12693 12705 13590 13650 13803 14566 14766 15301 15326 15784 16169 16223 16239 16278 16294 16309 16390 H095 KT819209 Western Andalusia (Huelva) L2b1a 73 150 152 182 195 198 204 263 315insC 418 523delAC 750 769 1018 1438 1442 1706 2332 2358 2416 2706 3594 4104 4158 4370 4767 4769 5027 5231 5331A 5814 6026 6131 6713 7028 7119 7256 7521 7624A 8080 8206 8387 8419 8701 8860 9221 9540 10115 10398 10828 10873 11719 11944 12236 12705 12948 13590 13650 13924 14059 14569 14766 15110 15217 15301 15326 16114A 16129 16213 16223 16278 16294 16355 16362 16390 H094 KT819210 Western Andalusia (Huelva) L2b3a 73 146 150 152 182 195 198 204 207 263 315insC 750 769 1018 1438 1442 1706 2332 2358 2416 2706 3594 4104 4158 4185 4370 4767 4769 5027 5331A 5744 5814 6713 7028 7256 7521 7624A 8080 8206 8387 8701 8860 8925 9221 9540 10115 10398 10873 11719 11944 12236 12705 12948 13590 13650 14059 14544 14766 15110 15217 15236 15301 15928 15944insT 16093 16114A 16129 16213 16223 16271 16278 16390 H159 KT819211 Western Andalusia (Huelva) L3f1b1 73 189 200 263 315insC 750 1438 1822 2706 3396 4218 4769 5601 7028 7819A 8527 8701 8860 8932 9540 9950 10398 10873 11440 11719 12705 14766 14769 15301 15326 15514 15944delT 16209 16223 16292 16295 16311 16519 H161 KT819212 Western Andalusia (Huelva) M1a1b1 73 195 263 309insCC 315insC 489 750 813 930 1438 2706 3705 4769 6446 6671 6680 7028 7853 8701 8860 9540 10398 10400 10873 11719 11809 12346 12403 12705 12950C 14110 14766 14769 14783 15043 15301 15326 16129 16183C 16189 16223 16249 16311 16359 16519 3 H140 KT819213 Western Andalusia (Huelva) U6a1a1a 73 263 309insC 315insC 523delAC 750 1438 2706 3348 3969 4172A 4769 7028 7805 8860 11467 11719 11938 12308 12372 14179 14766 14927 15326 16172 16183C 16189 16219 16239 16278 H162 KT819214 Western Andalusia (Huelva) U6a1a1a 73 263 309insC 315insC 750 1438 2706 3348 3969 4172A 4769 7028 7805 8860 9185G 11467 11719 11938 12308 12372 14179 14766 14927 15326 16093 16172 16183C 16189 16219 16239 16278 16291 H139 KT819215 Western Andalusia (Huelva) U6a1a1a 73 263 309insC 315insC 750 1438 2706 3348 3969 4172A 4769 7028 7805 8860 9185G 11467 11719 11938 12308 12372 14179 14766 14927 15326 16172 16183C 16189 16219 16239 16278 16291 H143 KT819216 Western Andalusia (Huelva) U6a3b 73 146 152 185 188 263 309insC 315insC 750 1211 1438 2706 3348 4769 7028 7805 8860 11268 11467 11719 12308 12372 13431 14142A 14179 14766 15326 15634 15790 16172 16183C 16189 16219 16278 H144 KT819217 Western Andalusia (Huelva) U6a3b 73 146 152 185 188 263 309insC 315insC 750 1211 1438 2706 3348 4769 7028 7805 8860 11268 11467 11719 12308 12372 13431 14142A 14179 14766 15326 15634 15790 16172 16183C 16189 16219 16278 H165 KT819218 Western Andalusia (Huelva) U6a3b1 73 146 152 185 188 263 309insC 315insC 750 1211 1438 2706 3348 4769 7028 7805 8860 11268 11467 11719 12308 12372 13431 14179 14766 15326 15634 15790 16172 16183C 16189 16219 16278 16311 H167 KT819219 Western Andalusia (Huelva) U6a3b1 73 146 152 185 188 263 309insC 315insC 750 1211 1438 2706 3348 4769 7028 7805 8860 11268 11467 11719 12308 12372 13431 14179 14766 15326 15634 15790 16172 16183C 16189 16219 16278 16311 H137 KT819220 Western Andalusia (Huelva) U6a7a1b 73 150 152 263 315insC 750 794A 1193 1438 1692T 2706 3348 4769 5120 5471 7028 7805 8473 8860 11467 11719 12308 12372 14179 14766 15043 15326 15530 15632 16172 16219 16278 H134 KT819221 Western Andalusia (Huelva) U6c2b 73 150 194 263 315insC 437 522delCA 750 793 1438 2706 3348 3688C 4769 4965 5081 6340 7028 8860 11013 11467 11719 12076 12308 12372 13879 14308 14766 15244 15326 16169 16172 16189 H147 KT819222 Western Andalusia (Huelva) U6d3a 73 263 315insC 750 1438 2706 3348 4336 4769 7028 8860 10397 11467 11719 11947 12308 12372 12501 12530 14518 14766 15326 16172 16174 16188 16219 16311 H168 KT819223 Western Andalusia (Huelva) U6d3a 73 263 315insC 750 1438 2706 3348 4336 4769 7028 8860 10397 11467 11719 11947 12308 12372 12501 12530 14518 14766 15326 16172 16174 16188 16219 16311 G123 KT819224 Eastern Andalusia (Granada) L2a1b 73 143 146 152 195 263 309insCC 315insC 750 769 1018 1438 2416 2706 2789 3594 4104 4769 7028 7175 7256 7274 7521 7771 8206 8701 8838 8860 9221 9540 10115 10143 10398 10873 11650 11719 11914 11944 12406 12693 12705 13590 13650 13803 14566 14766 15301 15326 15784 16093 16129 16189 16223 16278 16294 16309 16390 G124 KT819225 Eastern Andalusia (Granada) L3d1b1 73 150 152 263 309insC 315insC 522delCA 750 921 1438 2706 3459 4769 5046 5147 5605 6272 6680 6842 7028 7424 8618 8701 8860 9156 9540 10398 10873 11719 12705 13105 13886 14284 14766 15301 15326 16093 16124 16223 16311 G125 KT819226 Eastern Andalusia (Granada) L3d3b 73 152 263 315insC 523delAC 750 921 1393 1438 1719 2706 4688 4769 5147 5773 6722 7028 7389 7424 8277 8279 8618 8701 8860 9540 10398 10873 11719 11779 12046T 12705 13105 13752 13886 14284 14766 15061 15301 15326 16124 16223 G126 KT819227 Eastern Andalusia (Granada) L3h1b1a 73 152 189C 194 195 263 309insC 315insC 522delCA 750 1438 1719 2706 3777 4388 4769 5300 6359 7028 7717 7861 8152 8701 8860 9509 9540 9575 10044 10398 10873 11590 11719 12705 14410 14766 15301 15326 16179 16223 16243 16256A 16284 16311 16320 16519 4 G127 KT819228 Eastern Andalusia (Granada) L3x2b1 73 150 194 200 249delA 263 315insC 494 650 750 1438 2706 3483 4769 5656 5899insC 6401 7028 7933 8158 8311 8584 8701 8817 8860 9254 9540 9941 10398 10819 10873 11719 12705 13708 14766 15301 15326 15519 15758 15928 16169 16193 16195 16223 16243 16261 G086 KT819229 Eastern Andalusia (Granada) M1a2a1 73 152 195 263 315insCCC 489 513 750 813 1438 2706 4769 6446 6671 6680 7028 8701 8860 9540 10398 10400 10873 11719 12403 12705 12950C 14110 14127 14766 14783 15043 15172 15301 15326 15884 16129 16183C 16189 16223 16249 16311 16519 G129 KT819230 Eastern Andalusia (Granada) M1a3b 73 195 263 309insCC 315insC 489 750 813 1438 2706 4769 6446 6671 6680 7028 8701 8860 9039 9540 10398 10400 10475 10873 11719 12403 12414 12705 12950C 13637 14110 14766 14783 15043 15301 15326 15930 16129 16182C 16183C 16189 16249 16311 16519 G128 KT819231 Eastern Andalusia (Granada) M1b2c 73 195 263 309insC 315insC 489 750 1007 1438 2706 3736 4769 6446 6680 7028 7258 8472 8512 8701 8860 9540 10398 10400 10873 10895 11719 12403 12705 12950C 12968 13111 14110 14766 14783 15043 15301 15326 16129 16182C 16183C 16189 16223 16249 16311 16399 16519 G132 KT819232 Eastern Andalusia (Granada) U6a6b1 73 263 315insC 750 1438 2706 3348 4769 5471 7028 7391 7805 8407A 8557C 8860 11084 11467 11719 12308 12372 12501 12618 13440 13984 14179 14766 15326 16172 16219 16278 16290 G131 KT819233 Eastern Andalusia (Granada) U6a1b2 73 195 263 309insC 315insC 750 1438 2706 3348 4769 6018 7028 7805 8860 10364 11467 11719 12308 12372 14179 14562 14766 14927 15326 16172 16219 16235 16278 16294 G130 KT819234 Eastern Andalusia (Granada) U6a3b 73 146 152 185 188 263 309insCC 315insC 750 1211 1438 2706 3348 4769 7028 7805 8860 11268 11467 11719 12308 12372 13431 14179 14766 15326 15634 15790 16172 16179 16183C 16189 16219 16278 G116 KT819235 Eastern Andalusia (Granada) U6a7a1 73 152 263 315insC 523delAC 750 794A 1193 1438 1692T 2706 3348 4769 5120 5471 7028 7805 8167 8473 8860 11467 11719 12308 12372 14179 14766 15043 15326 15530 15632 16172 16219 16278 G134 KT819236 Eastern Andalusia (Granada) U6b 73 259 263 315insC 508 523delAC 750 1438 2706 3348 4225 4769 7028 8860 9438 11467 11719 12308 12372 14766 15326 15601 16172 16219 16311 16519 A02 KT819237 Morocco Berber (Asni) L1b1a6 73 152 182 185T 195 247 263 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4164 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8835 8860 9540 9755 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14110 14178 14203 14560 14766 14769 15115 15326 16187 16189 16223 16264 16270 16278 16293 16311 16519 A108 KT819238 Morocco Berber (Asni) L2a1 73 143 146 152 195 263 315insC 750 769 1018 1438 1628 2416 2706 2789 3594 4104 4769 5460 7028 7175 7256 7274 7521 7771 8206 8701 8860 9221 9540 10115 10398 10873 11719 11914 11944 12693 12705 13590 13623 13650 13803 14566 14766 15301 15326 15747 15784 16093 16189 16223 16278 16294 16309 16390 16519 A27 KT819239 Morocco Berber (Asni) L2b1a 73 150 152 182 195 198 204 207 260 263 309insC 315insC 418 523delAC 750 769 1018 1438 1442 1706 2332 2358 2416 2706 3594 4104 4158 4370 4767 4769 5027 5331A 5814 6026 6713 7028 7256 7521 7624A 8080 8206 8387 8701 8860 8939 9221 9540 9663 10115 10398 10828 10873 11654 11719 11944 12236 12705 12793 12948 13590 13650 13814 13924 14003 14059 14766 15110 15217 15301 15326 16093 16114A 16129 16148 16213 16223 16278 16355 16362 16368 16390 A107 KT819240 Morocco Berber (Asni) L2b1a2 73 150 152 182 195 198 263 315insC 418 523delAC 590insA 750 769 1018 1118 1438 1442 1706 2332 2358 2416 2706 3594 4104 4158 4370 4767 4769 5027 5331A 5814 6026 6713 7028 7256 7521 7569 7624A 8080 8206 8387 8701 8860 9221 9540 10115 10398 10828 10873 11719 11944 12007 12236 12705 12948 13590 13650 13924 14059 14180 14766 15110 15217 15301 15326 16114A 16129 16213 16223 16278 16355 16362 16390 5 A18 KT819241 Morocco Berber (Asni) L3e5 73 150 263 309insC 315insC 398 523delAC 1438 2352 2706 4769 7028 8392 8701 8860 9540 10398 10819 10873 11719 12705 14212 14766 15301 15326 16041 16223 16355 16519 A78 KT819242 Morocco Berber (Asni) L3e5a 73 150 152 242 263 309insC 315insC 398 523delAC 1438 2352 2706 4769 7028 8392 8701 8860 9540 10398 10751 10819 10873 11719 12705 13317 13934 14212 14766 14798 15301 15326 16041 16124 16223 16519 A07 KT819243 Morocco Berber (Asni) U6a7a1 73 152 263 315insC 750 794A 1193 1438 1692T 2706 3348 4769 5120 5471 7028 7805 8473 8860 9389 11467 11719 12308 12372 14179 14766 15043 15326 15530 15632 16172 16219 16278 B67 KT819244 Morocco Berber (Bouhria) L1b1a 73 152 182 185T 195 247 263 309insC 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8860 9540 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14178 14203 14560 14766 14769 15115 15326 16093 16126 16187 16189 16223 16264 16270 16278 16311 16519 B86 KT819245 Morocco Berber (Bouhria) L1b1a 73 152 182 185T 195 247 263 309insC 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8860 9540 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14178 14203 14560 14766 14769 15115 15326 16093 16126 16187 16189 16223 16264 16270 16278 16311 16519 B126 KT819246 Morocco Berber (Bouhria) L1b1a6 73 152 182 185T 195 247 263 309insC 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8860 9540 9755 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14110 14178 14203 14560 14766 14769 15115 15262 15326 16126 16187 16189 16223 16264 16270 16278 16293 16311 16519 B120 KT819247 Morocco Berber (Bouhria) L2a1k 73 143 146 152 195 263 315insC 750 769 1018 1438 2416 2706 2789 3594 4104 4769 6722 7028 7175 7256 7274 7521 7771 8206 8701 8860 9221 9540 10115 10398 10873 11719 11914 11944 12693 12705 13590 13650 13803 14566 14766 15064 15301 15326 15784 16129 16189 16192 16223 16278 16294 16309 16390 16519 B28 KT819248 Morocco Berber (Bouhria) L2a1c 73 143 146 152 195 263 309insC 315insC 523delAC 750 769 1018 1438 2416 2706 2789 3010 3594 4104 4769 6164 6663 7028 7175 7256 7274 7521 7679 7771 8065 8206 8701 8860 9221 9320 9540 10115 10398 10873 11719 11914 11944 12693 12705 13488 13590 13650 13803 14002 14566 14766 15301 15326 15784 16223 16278 16294 16390 16519 B130 KT819249 Morocco Berber (Bouhria) L3e5a 73 150 263 315insC 398 523delAC 1438 2352 2706 4769 7028 8392 8701 8860 9540 10398 10819 10873 11719 12705 13317 14212 14766 15301 15326 16041 16223 16519 B21 KT819250 Morocco Berber (Bouhria) U6a8a 73 143 263 309insC 315insC 1438 2706 3348 4769 7028 7805 8062 8282 8860 10172 11467 11539 11719 12308 12372 14179 14766 15326 16172 16183C 16189 16219 16278 Fig05 KT819251 Morocco Berber (Figuig) L1b1a8 73 146 152 182 185T 195 247 263 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7298 7389 7521 7867 8248 8468 8655 8701 8860 9540 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14178 14203 14560 14766 14769 15115 15326 16126 16187 16189 16223 16264 16278 16293 16311 16519 Fig39 KT819252 Morocco Berber (Figuig) L1b1a6 73 152 182 185T 195 198 247 263 309insC 315insC 357 523delAC 709 710 750 769 825A 1018 1738 2352 2706 2758 2768 2885 3308 3594 3666 3693 4104 4769 5036 5046 5393 5655 6548 6827 6989 7028 7055 7146 7256 7389 7521 7867 8248 8468 8655 8701 8860 9540 9755 10398 10688 10810 10873 11719 12519 12705 13105 13506 13650 13789 13880A 14110 14178 6 14203 14305 14560 14766 14769 15115 15326 15903 16093 16126 16172 16187 16189 16223 16264 16270 16278 16293 16311 16519 Fig08 KT819253 Morocco Berber (Figuig) L2a1k 73 143 146 152 195 263 315insC 750 769 1018 1438 2416 2706 2789 3594 4104 4769 6722 7028 7175 7256 7274 7521 7771 8206 8701 8860 9221 9540 10115 10398 10873 11719 11914 11944 12693 12705 13590 13650 13803 14566 14766 15301 15326 15784 16041 16129 16189 16192 16223 16278 16294 16309 16390 Fig69 KT819254 Morocco Berber (Figuig) L2a1k 73 143 146 152 195 263 315insC 750 769 1018 1438 2416 2706 2789 3594 4104 4769 6722 7028 7175 7256 7274 7521 7771 8206 8701 8860 9221 9540 10115 10398 10873 11719 11914 11944 12693 12705 13590 13650 13803 14566 14766 15301 15326 15784 16041 16129 16189 16192 16223 16278 16294 16309 16390 Fig84 KT819255 Morocco Berber (Figuig) L2e 73 146 152 182 199 263 309insCC 315insC 479 719 750 769 1018 1211 1438 2416 2706 3537 3594 4104 4205 4481 4512 4562 4769 5069T 5228 6014 6261 7028 7256 7521 8206 8383 8522 8701 8860 9221 9377 9380 9540 9635 9971 10115 10398 10873 11719 11930 11935 12189 12441 12705 13590 13650 13708 14299 14766 15301 15326 15697 15734 15889 15930 16111A 16145 16184 16189 16223 16239 16259 16278 16355 16390 16399 16400 16519 Fig13 KT819256 Morocco Berber (Figuig) L3b1 73 151 152 263 315insC 523delAC 750 1438 2071 2706 3450 4769 5417 5773 6221 7028 8701 8860 9174 9449 9540 10086 10373 10398 10601 10873 11380 11719 12705 13105 13914A 14766 15301 15311 15314 15326 15824 15944delT 16124 16223 16234 16278 16362 16409 16519 Fig14 KT819257 Morocco Berber (Figuig) L3b1a9 73 152 263 315insC 523delAC 750 1438 2706 3450 4769 5773 6221 7028 8701 8860 9449 9540 10086 10373 10398 10873 11002 11719 12705 13105 13914A 14766 15301 15311 15326 15824 15944delT 16051 16223 16256 16278 16362 16519 Fig115 KT819258 Morocco Berber (Figuig) L3b1a3 73 263 309insC 315insC 503 523delAC 750 1193 1438 2706 3450 4769 5773 6221 7028 8251 8701 8860 9449 9540 10086 10373 10398 10873 11002 11719 12705 13105 13914A 13933 14766 15301 15311 15326 15824 15944delT 16124 16223 16278 16311 16362 16519 Fig06 KT819259 Morocco Berber (Figuig) L3b1a5 73 152 263 309insC 315insC 480 499 523delAC 750 1438 1780 2706 3450 4769 5063 5773 6221 7028 8701 8860 9449 9540 9615 10086 10373 10398 10700 10873 11002 11719 12612 12705 13105 13914A 14766 15301 15311 15326 15824 15944delT 16124 16223 16278 16293 16362 16519 Fig03 KT819260 Morocco Berber (Figuig) L3e2b 73 150 152 195 263 315insC 750 1438 1676 2352 2706 3834 4769 6956 7028 8701 8848 8860 9540 10398 10819 10873 11719 12705 13263 14212 14766 14905 15301 15326 16172 16182C 16183C 16189 16223 16320 16519 Fig09 KT819261 Morocco Berber (Figuig) L3e2b1a2 73 150 152 195 263 315insC 750 1438 2352 2483 2706 3277 4769 4811 5899delC 7028 8701 8860 9377 9540 10398 10819 10873 11719 12406 12432 12705 14212 14766 14905 15301 15326 16172 16183C 16189 16223 16320 16519 Fig04 KT819262 Morocco Berber (Figuig) L3e5a 73 150 152 263 309insC 315insC 398 523delAC 1438 2352 2706 4769 7028 8392 8701 8860 9102 9540 10398 10819 10873 11719 12705 13317 13934 14212 14766 15301 15326 16041 16223 16519 Fig18 KT819263 Morocco Berber (Figuig) L3e5a1 73 150 152 263 315insC 398 523delAC 1438 2352 2706 2833 4769 7028 8392 8701 8860 9540 10398 10819 10873 11719 12705 13317 14073 14212 14766 15301 15326 16041 16188 16223 16519 Fig72 KT819264 Morocco Berber (Figuig) M1a1b2 73 195 207 263 315insC 489 750 813 930 1438 1820 2706 3705 4769 6446 6671 6680 7028 7853 8537 8701 8860 9540 10398 10400 10873 11719 12346 12403 12705 12950C 14110 14766 14783 14788 15043 15301 15326 15497 16129 16189 16223 16249 16311 16359 16519 7 Fig92 KT819265 Morocco Berber (Figuig) U6a7a1 73 152 263 315insC 750 794A 1193 1438 1692T 2706 3348 4769 5120 5471 7028 7805 8473 8860 11467 11719 12308 12372 14179 14766 15043 15326 15530 15632 16172 16219 16278 Fig01 KT819266 Morocco Berber (Figuig) U6a7c1 73 263 309insC 315insC 750 1438 2706 3348 4769 7028 7337 7805 8860 11467 11719 12308 12372 14766 15043 15326 16172 16182C 16183C 16189 16219 16278 8 Table B. TMRCA estimates of most common sub-clades of U6, M1 and L lineages Haplogroup ρ whole-mtDNA age estimate ρ synonymous age estimate Maximum Likelihood age estimate U6 35352 [24682 - 46435]* 34529 [20161 - 48897] 35454 [23982 - 47404] U6a 25944 [20350 - 31670] 32121 [21535 - 42707] 25392 [20213 - 30685] U6b 12472 [7416 - 17670] 7884 [3430 - 12337] 11328 [7724 - 15005] U6d 13206 [7035 - 19586] 14376 [3431 - 25322] 12034 [6940 - 17272] U6c 10820 [5286 - 16531] 9096 [0 - 18380] 9924 [5013 - 14976] M1 26280 [17939 - 34916] 26902 [12069 - 41735] 26137 [18651 - 33861] M1a 21224 [15123 - 27497] 19493 [10209 - 28777] 20996 [16503 - 25582] M1b 20259 [12644 - 28150] 17139 [8225 - 26052] 22416 [14810 - 30287] L1 122789 [98301 - 147841] 124149 [89583 - 158715] 138413 [103499 - 174245] L1b 29278 [15961 - 43323] 37084 [11807 - 62360] 35757 [17744 - 54974] L1c 91163 [73724 - 109057] 93524 [70066 - 116982] 87211 [70058 - 104831] L2 77931 [57873 - 98728] 85997 [51183 - 120810] 96869 [77126 - 117149] L2a 58685 [37826 - 80637] 80119 [39501 - 120738] 79306 [59869 - 99423] L2b 29383 [19627 - 39522] 29839 [14528 - 45150] 26271 [20284 - 32409] L2c 17261 [13993 - 20582] 15768 [11911 - 19624] 20291 [16429 - 24223] L2d 18261 [10105 - 26748] 23237 [5831 - 40642] 14347 [7984 - 20926] L2e 35805 [26454 - 45467] 45333 [28298 - 62367] 35929 [26074 - 46131] L3 54012 [45043 - 63190] 58241 [44289 - 72192] 68179 [56232 - 80425] L3a 48295 [34860 - 62255] 57816 [34780 - 80851] 56442 [42270 - 71127] L3b 19373 [12383 - 26599] 28289 [9423 - 47156] 23719 [14005 - 33858] L3d 30640 [22589 - 38944] 36553 [24576 - 48529] 33296 [24372 - 42518] L3c 9245 [2343 - 16433] 15768 [315 - 31220] 10108 [2128 - 18467] L3f 48466 [33507 - 64079] 43234 [22990 - 63478] 53297 [40936 - 66065] L3e 33669 [25738 - 41832] 35551 [22994 - 48108] 39970 [29738 - 50550] L3i 33538 [21464 - 46161] 46091 [23412 - 68769] 45326 [30929 - 60361] L3k 27266 [13741 - 41573] 30222 [8520 - 51923] 27260 [15724 - 39359] L3x 36534 [26272 - 47170] 33037 [18769 - 47306] 38823 [28227 - 49801] L3h 72146 [54007 - 90944] 76496 [48708 - 104284] 64029 [52049 - 76330] *Age estimates in years with 95% confidence intervals. Negative lower values were ignored 9 Table C. TaqMan design for genotyping U6 and L/M lineages Nucleotide position Haplogroup Sequence (5'-3') Final concentration (μM) 3348 U6 primers 3311F CCATGGCCAACCTCCTACTC 0.9 3381R TCGTTCGGTAAGCATTAGGAATG 0.9 probes allele A VIC-ATTGTACCCATTCTAATC 0.2 allele G FAM-ATTGTACCCATTCTGAT 0.2 10873 L or M primers 10837F CACAACCACCCACAGCCTAATT 0.9 10981R GGGTAGGAGTCAGGTAGTTAGTATTAGGA 0.9 probes allele T VIC-CATCCCTCTACTATT 0.2 allele C FAM-TCATCCCCCTACTATTTT 0.2 0.0 - 1.5 1.5 - 3.1 3.1 - 4.6 4.6 - 6.2 6.2 - 7.7 7.7 - 9.2 9.2 - 10.8 10.8 - 12.3 12.3 - 13.9 13.9 - 15.4 A Figure C. Spatial distribution of haplogroup M1 in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 1.5 1.5 - 3.1 3.1 - 4.6 4.6 - 6.2 6.2 - 7.7 7.7 - 9.2 9.2 - 10.8 10.8 - 12.3 12.3 - 13.9 13.9 - 15.4 B 16 0.0 - 3.5 3.5 - 7.0 7.0 - 10.5 10.5 - 14.0 14.0 - 17.5 17.5 - 21.0 21.0 - 24.5 24.5 - 28.0 28.0 - 31.5 31.5 - 35.0 A Figure D. Spatial distribution of haplogroup L2a in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 3.5 3.5 - 7.0 7.0 - 10.5 10.5 - 14.0 14.0 - 17.5 17.5 - 21.0 21.0 - 24.5 24.5 - 28.0 28.0 - 31.5 31.5 - 35.0 B 17 0.0 - 0.6 0.6 - 1.3 1.3 - 1.9 1.9 - 2.6 2.6 - 3.2 3.2 - 3.9 3.9 - 4.5 4.5 - 5.1 5.1 - 5.8 5.8 - 6.4 A Figure E. Spatial distribution of haplogroup L2b in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 0.6 0.6 - 1.3 1.3 - 1.9 1.9 - 2.6 2.6 - 3.2 3.2 - 3.9 3.9 - 4.5 4.5 - 5.1 5.1 - 5.8 5.8 - 6.4 B 18 0.0 - 1.4 1.4 - 2.8 2.8 - 4.2 4.2 - 5.7 5.7 - 7.1 7.1 - 8.5 8.5 - 9.9 9.9 - 11.3 11.3 - 12.7 12.7 - 14.2 A Figure F. Spatial distribution of haplogroup L3b in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 1.4 1.4 - 2.8 2.8 - 4.2 4.2 - 5.7 5.7 - 7.1 7.1 - 8.5 8.5 - 9.9 9.9 - 11.3 11.3 - 12.7 12.7 - 14.2 B 19 0.0 - 1.4 1.4 - 2.8 2.8 - 4.2 4.2 - 5.6 5.6 - 7.0 7.0 - 8.4 8.4 - 9.9 9.9 - 11.3 11.3 - 12.7 12.7 - 14.1 A Figure G. Spatial distribution of haplogroup L3d in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 1.4 1.4 - 2.8 2.8 - 4.2 4.2 - 5.6 5.6 - 7.0 7.0 - 8.4 8.4 - 9.9 9.9 - 11.3 11.3 - 12.7 12.7 - 14.1 B 20 0.0 - 1.3 1.3 - 2.5 2.5 - 3.8 3.8 - 5.0 5.0 - 6.3 6.3 - 7.6 7.6 - 8.8 8.8 - 10.1 10.1 - 11.3 11.3 - 12.6 A Figure H. Spatial distribution of haplogroup L3f in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 1.3 1.3 - 2.5 2.5 - 3.8 3.8 - 5.0 5.0 - 6.3 6.3 - 7.6 7.6 - 8.8 8.8 - 10.1 10.1 - 11.3 11.3 - 12.6 B 21 0.0 - 0.3 0.3 - 0.6 0.6 - 0.9 0.9 - 1.2 1.2 - 1.5 1.5 - 1.8 1.8 - 2.1 2.1 - 2.5 2.5 - 2.8 2.8 - 3.1 A Figure I. Spatial distribution of haplogroup L3h1b in a broad geographic range (A) and in the Mediterranean Basin (B). 0.0 - 0.3 0.3 - 0.6 0.6 - 0.9 0.9 - 1.2 1.2 - 1.5 1.5 - 1.8 1.8 - 2.1 2.1 - 2.5 2.5 - 2.8 2.8 - 3.1 B 22 16189 16235 16145 16354 16362 16235! 16292 16355 16189 16234 16294 16234 16300 16311 16295 16189 16180 16092 16126A 16219! 16222 16192 16290 16311 16271 16129 16189 16126 16169 16239 16190A 16179 16362 16293 16234 16291 16093 16311 16356 16093 16256 16274 16261 16174 16293 16111 16147 16257 16362 16399 16079 16274 16189 16184 1635416356 16292 16390T 16293! 16362 16289 16293 16320 16104 16126! 16264! 16239 16293 16270! 16264! 16111 16093 16183T 16264! 16162 16215T 16355 16318T 16270! 16400 16360 16214 16093 16259 16261 16362 16256 16357 16399 16265 16189! 16213 16260 16293! 16114A 16223! 16362 16235 16114 16215C 16172 16301 16093 16145 16189! 16075 16108 16126!16293 16086 16224 16305 16093 16269 16240 16192 16218 16270! 16215 16172 16085 16260 16394 16293 North Portugal Azores Madeira Morocco Tunisia Egypt Mauritania Italy Algeria Libya Sicily West Sahara Ethiopia Cantabria Galicia Zamora Huelva Kenya Granada Canary Islands Center Portugal South Portugal Sardinia Córdoba U6a L1b * * B A Figure J. Specific median-joining networks for lineages U6a and L1b found in Iberia, Italy and Africa. MJ genealogies are based on 209 (U6a) and 175 (L1b) HVS-I sequences. Asterisks indicate basal nodes with the following mutations respect to the rCRS: 16172-16219-16278 (U6a) and 16126-16187-16189-16223-16264-16270-16278-16293-16311 (L1b). See population details and references in Table D. 23 Figure K. Probabilistic proportion of founder clusters considering two migration events (at 0.5 and 8.0 ka), using f1 and f2 criteria, for migrations of L lineages into North Africa, Iberia and Mediterranean Europe. f1 f2 f1 f2 f1 f2 24 Figure L. Haplogroup L founders introduced into North Africa and Mediterranean. Red circles indicate clades probably introduced during early Holocene and blue circles indicate clades probably introduced in historic times in each region. The size of each circle is proportional to the frequency of each founder within the total L haplogroup founders in the analyses for the two regions with two founder selection criteria (f1* and f2). The highest and lowest frequencies for each analysis are indicated in the Figure. * Founders must have at least one (f1) or two (f2) derived branches in the source population. 25