Hepcidin-dependent regulation of erythropoiesis during anemia in a teleost fish, dicentrarchus labrax

RESEARCH ARTICLE Hepcidin-Dependent Regulation of Erythropoiesis during Anemia in a Teleost Fish, Dicentrarchus labrax João V. Neves 1,2 *, Carolina Caldas 1,2 , Miguel F. Ramos 1,2 , Pedro N. S. Rodrigues 1,2,3 1Instituto de Investigação e Inovação em Saúde, Universidade do Porto, Porto, Portugal, 2Iron and Innate Immunity, Instituto de Biologia Molecular e Celular (IBMC), Universidade do Porto, Porto, Portugal, 3Instituto de Ciências Biomédicas Abel Salazar (ICBAS), Universidade do Porto, Porto, Portugal *[email protected] Abstract Anemia is a common disorder, characterized by abnormally low levels of red blood cells or hemoglobin. The mechanisms of anemia development and response have been thoroughly studied in mammals, but little is known in other vertebrates, particularly teleost fish. In this study, different degrees of anemia were induced in healthy European sea bass specimens (Dicentrarchus labrax) and at pre-determined time points hematological parameters, liver iron content and the expression of genes involved in iron homeostasis and hematopoiesis, with particular attention on hepcidins, were evaluated. The experimental anemia prompted a decrease in hamp1 expression in all tested organs, in accordance to an increased need for iron absorption and mobilization, with slight increases in hamp2 in the kidney and intestine. The liver was clearly the major organ involved in iron homeostasis, decreasing its iron content and showing a gene expression profile consistent with an increased iron release and mobilization. Although both the spleen and head kidney are involved in erythropoiesis, the spleen was found to assume a more preponderant role in the recovery of erythrocyte levels. The intestine was also involved in the response to anemia, through the increase of iron transporting genes. Administration of Hamp1 or Hamp2 mature peptides showed that only Hamp1 affects hematological parameters and liver iron content. In conclusion, the molecular mechanisms of response to anemia present in sea bass are similar to the ones described for mammals, with these results indicating that the two hepcidin types from teleosts assume different roles during anemia. Introduction Anemia is one of the most common disorders of the blood, resulting from an abnormally low level of red blood cells or hemoglobin. Anemia symptoms can range from asymptomatic to weakness, shortness of breath, fatigue, and in the most severe cases, organ damage and heart failure, leading to death. Although numerous types of anemia have been characterized, they can be divided into three major groups: caused by blood loss, by excessive hemolysis or by PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 1/17 a11111 OPEN ACCESS Citation: Neves JV, Caldas C, Ramos MF, Rodrigues PNS (2016) Hepcidin-Dependent Regulation of Erythropoiesis during Anemia in a Teleost Fish, Dicentrarchus labrax. PLoS ONE 11(4): e0153940. doi:10.1371/journal.pone.0153940 Editor: Tzong-Yueh Chen, National Cheng Kung University, TAIWAN Received: August 10, 2015 Accepted: April 6, 2016 Published: April 21, 2016 Copyright: © 2016 Neves et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper. Funding: This work was funded by FEDER—Fundo Europeu de Desenvolvimento Regional funds through the COMPETE 2020 - Operational Programme for Competitiveness and Internationalization (POCI), Portugal 2020, and by Portuguese funds through FCT - Fundação para a Ciência e a Tecnologia/ Ministério da Ciência, Tecnologia e Inovação in the framework of the projects "Institute for Research and Innovation in Health Sciences" (POCI-01-0145-FEDER-007274) and FCOMP-01-0124-FEDER-029339 (PTDC/MARBIO/3204/2012). JVN is supported by FCT under the impaired erythropoiesis. There are several causes that can lead to the development of anemia, but the most common is iron deficiency [1]. Iron is essential for the synthesis of hemoglobin, the key component of red blood cells responsible for oxygen binding and transport [2,3], as well as numerous other cellular processes [4–8]. Iron deficiency is usually derived from insufficient iron uptake (low dietary iron), deficiencies in iron absorption, storage or transport, or significant blood loss. When anemia is established, one of the results is a decrease in the levels of oxygen that the blood is able to carry, which can eventually lead to hypoxia. In hypoxia, less oxygen is available for normal cellular processes, leading to decreased energy production, compromised cell proliferation and repair, reduced muscular activity and, in extreme cases, severe oxygen deprivation to the brain, which could lead to death. As such, it is clear that there is a tight interconnection between red blood cell levels, oxygen homeostasis and iron metabolism. The existing studies addressing the mechanisms involved in the establishment of anemia and the genes involved in hematopoiesis are mostly focused on mammals and there are still numerous gaps in the understanding of these processes in lower vertebrates, particularly fish. With the continuous depletion of the natural fish stocks, many believe that in the years to come aquaculture will represent one of the major food sources. Consequently, a better understanding of the mechanisms of iron metabolism in response to anemia and to the need for an enhanced erythropoiesis is crucial for the increased welfare of aquaculture species. Assuming a central role in iron metabolism is hepcidin, a small cysteine-rich peptide that is considered to be the key regulator of iron metabolism [9–12]. Hepcidin is mostly produced in the liver hepatocytes, but it has also been described in other cell types and tissues. As an iron metabolism regulator, hepcidin synthesis is regulated by several stimuli through a myriad of pathways (reviewed in [13,14]), being induced by elevated iron levels and infection/inflammation and decreased by low iron levels, anemia and hypoxia. When iron stores are adequate or high, or during infection, hepcidin binds to the iron exporter ferroportin, causing its internalization and degradation, thus blocking the release of iron from macrophages, hepatocytes and enterocytes, and in the later, also leading to decreased iron absorption [15,16]. Inflammation also leads to a limitation in iron availability not only for pathogens but also for normal erythropoiesis, which could lead to the so called anemia of inflammation [17,18]. On the other hand, when iron or oxygen levels are low, hepcidin production is attenuated or suppressed, increasing cellular iron efflux and consequently intestinal uptake. An interesting fact about fish hepcidins is that, contrary to mammals, where a single gene exists (with the mouse being the sole known exception [19]) and performs both as an antimicrobial peptide and iron regulator, many teleost fish present two types of hepcidin (commonly referred to as hamp1 and hamp2) [20–24] and although the full extent of their roles remains unclear, one is usually more associated with iron metabolism regulation and the other with the antimicrobial response. With the present work, we intend to clarify the molecular mechanisms of response to anemia in a commercially relevant teleost fish, the European sea bass (Dicentrarchus labrax), by investigating the expression of several genes known to be involved in iron homeostasis and hematopoiesis, with a particular focus in understanding the roles of the different hepcidin genes. Materials and Methods Animals European sea bass (Dicentrarchus labrax), with an average weight of 50g, were provided by a commercial fish farm in the south of Portugal (Piscicultura do Vale da Lama, Lagos, Portugal). Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 2/17 grant SFRH/BPD/86380/2012. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. Fish were kept in 500 liters recirculating sea water tanks at 21±1°C, with a 12-hour light/dark cycle and fed daily to satiation. Before each treatment, fish were anaesthetized with ethylene glycol monophenyl ether (2-phenoxyethanol, 0.3 ml/liter, Merck, Algés, Portugal). All animal experiments were carried out in strict compliance with national and international animal use ethics guidelines, approved by the animal welfare and ethic committee of the Instituto de Biologia Molecular e Celular (IBMC), with permit ref. Ofício Circular n° 99, 0420/000/000 of 09/11/ 2009 from the Direcção Geral de Alimentação e Veterinária (DGAV), Portuguese Ministry of Agriculture and Sea, and conducted by FELASA Category C/DGAV certified investigators. Experimental anemias Fish were individually weighted and bled from the caudal vessels the equivalent v/w of either 1% (“light”anemia) or 2.5% (“severe”anemia) body mass. Control fish were subjected to the same manipulation (anesthesia, weighting, pinching) but no blood was removed. One, four, seven and fourteen days after treatment, four fish from each of the experimental groups were anaesthetized and blood was drawn from the caudal vessels for evaluation of hematological parameters. Subsequently, fish were euthanized with an overdose of anesthetic, dissected and major tissues involved in iron homeostasis and hematopoiesis (liver, spleen, head kidney and intestine) were collected, snap frozen in liquid nitrogen and stored at -80°C until further use. Hematological parameters and liver iron content To determine the impact of the experimental bleeding on the hematological parameters, peripheral blood was drawn from the caudal vessels at each experimental time point in terminally sampled animals. For red blood cell counts and hematocrit determination, 150 μl samples of blood were used in 1:1 dilutions with heparin in PBS (1000 units/ml). For determination of serum parameters, non-heparinized blood was transferred into 1.5 ml microcentrifuge tubes, and allowed to clot for 8 h at 4°C. The samples were centrifuged twice at 16000×g until a clear serum was obtained. Serum iron and transferrin saturation were determined by the Liquid Ferrozine1method (Thermo Electron, Victoria, Australia) according to the manufacturer’s specifications. Non-heme iron was measured in livers by the bathophenanthroline method [25]. Briefly, liver samples with an average weight of 100 mg were placed in iron-free Teflon vessels (ACV-Advanced Composite Vessel, CEM Corporation, Matthews NC, USA) and dried in a microwave oven (MDS 2000, CEM Corporation). Subsequently, dry tissue weights were determined and samples digested in an acid mixture (30% hydrochloric acid and 10% trichloroacetic acid) for 20 h at 65°C. After digestion, a chromogen reagent (5 volumes of deionised water, 5 volumes of saturated sodium acetate and 1 volume of 0.1% bathophenanthroline sulfonate/1% thioglycollic acid) was added to the samples in order to react with iron and obtain a colored product that was measured spectrophotometrically at 535 nm. The extinction coefficient for bathophenanthroline is 22.14 mM -1 cm -1 . RNA isolation and cDNA synthesis Total RNA was isolated from liver, spleen, head kidney and posterior intestine with the PureLink RNA Mini Kit protocol for animal tissues (Invitrogen, Life Technologies) with the optional on-column PureLink DNase treatment (Invitrogen), according to the manufacturer’s instructions. Total RNA quantification was performed using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham MA, USA) and quality was assessed by running the samples in an Experion Automated Electrophoresis Station (Bio-Rad). For all samples, 1.25 μgof Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 3/17 each were converted to cDNA by Thermoscript™and an oligo (dT) 20 primer (Invitrogen), for 40 min at 50°C, according to the manufacturer’s protocol. Analysis of gene expression by quantitative RT-PCR Relative levels of several genes mRNAs were quantified in relevant organs of untreated, control and anemic fish, by real-time PCR. Genes analyzed include genes involved in iron homeostasis and regulation (hamp1,hamp2,tmprss6,hjv,bmp6,bmpr2,smad4,smad1/5/8,tfr1 and tfr2), hematopoiesis (epo,epor,hgb and gata2), hypoxia (hif1a), iron uptake (slc11a2a and slc11a2b), iron storage (fth), iron export (fpn) and iron transport (tf). One μl of each cDNA sample was added to a reaction mix containing 10 μl iQ SYBR Green Supermix (Bio-Rad), 8.5 μlof dd H 2 0 and 250 nM of each primer (Table 1), making a total volume of 20 μl per reaction. A non-template control was included for each set of primers. The cycling profile was as follows: 94°C for 3.5 min, 40 cycles of 94°C for 30 s, 59°C for 30 s and 72°C for 30 s. Samples were prepared in duplicates, a melting curve was generated for every PCR product to confirm the specificity of the assays and a dilution series was prepared to check the efficiency of the reactions. β-actin was used as the housekeeping gene. The comparative CT method (2 -ΔΔCT method) based on cycle threshold (CT) values was used to analyze gene expression levels. Peptide administration To evaluate the biological effects of sea bass hepcidin on the hematological parameters and liver iron content, synthetic peptides coding for the predicted mature peptides of Hamp1 (QS HLSLCRWCCNCCRGNKGCGFCCKF), Hamp2.1 (HSSPGGCRFCCNCCPNMSGCGVCC TF), and Hamp2.2 (HSSPGGCRFCCNCCPNMSGCGVCCRF) were commercially produced Table 1. Primers used for gene expression analysis. Forward (5'!3') Reverse (5'!3') actb CAGAAGGACAGCTACGT GTCATCTTCTCCCTGTTGGC hamp1 CATTGCAGTTGCAGTGACACT CAGCCCTTGTTGCCTCTG hamp2 CTGCTGTCCCAGTCACTGA ACCACATCCGCTCATATTAGG bmp6 AAGCAGCCTTTCATGGTGGC GGTTCATCAGGTGCACCAG bmpr2 GCTGTAGCAGCCTTCTTTGG CTCCTTTGAAGAGCTCGGTGT epo AGGCCAATCTGTGACCTGAG GCAGTGCTGTGTTGGTGACT epor GCCTATGTCACCCTCAATGC GAGTCTGCCACTGCCATGTA fpn GGCCTACTACAACCAGAACAT AGGCCGCACTTCTTGCGAA fth AACCATGAGTTCTCAGGTGAG TTAGCTGCTCTCTTTGCCCAG gata2 CCCTGACCATGAAGAAGGAAG TAGGCAGCATGTGTCCAGAG hgb CCAGGCTTTGACCAGACTTC TGGACATCAGGGGTGAACTG hif1a AGCGGAGGAAGGAGAAGTC CCATGAGAAAACCCTCCAGAG hjv AGGGCATCGAGGACCTGCT CGCTCACCACCGAGCCAT slc11a2a CGCGTTCAACCTCCTCTCCTCT AGCCCTCGCAGTACGGCACA slc11a2b TGCTCTCAACCTTCTCTCTGTG AGCCGGCGCAGTAAGGTAAG smad4 CAGTGCCACAGACAGATGCA TGTGCAGGACCTCGTCCAG smad1/5/8 CCATCGTCTACTACGAACTCAAC GTGACGTCCTGTCGGTGATA tf CAACAGTATGGGTGCTGACG ACTGGCAGAGCACTTGGACT tfr1 CTCCTTCAACCACACCCAGT GACCAGTACCGAGGTTCCAA tfr2 GCCTACTTCAGTCTGGACCA CCTCTGGACTGCAGCTCTG tmprss6 CGCACTAATCTCCAGCCAGT ATTCTGGGAGTGACCAGGTG doi:10.1371/journal.pone.0153940.t001 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 4/17 in the oxidized, folded form (with disulfide bonds) (Bachem AG, Bubendorf, Switzerland) [22] and administered to healthy sea bass. Briefly, peptides were diluted in 1× PBS to a final concentration of 100 μM and each fish was i.p. injected with 100 μl. Control animals received a similar volume of saline. At 1, 4, 7, 10 and 14 d post peptide administration, four fish from each group were anesthetized, blood was drawn from the caudal vessels for evaluation of hematological parameters and liver collected for liver iron determination, as previously described. Statistical analysis Statistical analysis was carried out using GraphPad Prism 5 (GraphPad Software, Inc). Data normality was checked by performing Kolmogorof-Smirnoff test and Student’s T-test was used for estimating statistical significance. Multiple comparisons were performed with Two-way ANOVA and post hoc Tukey test. A p value of less than 0.05 was considered statistically significant. Results Hematological parameters and liver iron Hematological parameters and liver iron content were measured to validate and follow the progression of the experimental models of anemia (Fig 1). Similar significant decreases were observed in red blood cell numbers, hematocrit, serum iron and transferrin saturation in both light and severe anemia groups, although all parameters were consistently lower in the severe anemia group. Liver iron content was significantly reduced in the severe anemia group 1 day after anemia induction, whereas no significant variations were observed for the light anemia group. Gene constitutive expression Constitutive expression of several genes was evaluated in relevant organs involved in iron homeostasis and hematopoiesis, including the liver, spleen, head kidney and posterior intestine. Overall, most genes presented the highest expression in the liver, with some exceptions (Table 2), with noticeable genes being hamp1,hamp2,fth,tf,slc11a2b and tmprss6. Also of relevance are the high levels of epor,hgb and tfr1 in the head kidney, and of slc11a2a in the posterior intestine. Fig 1. Hematological parameters and liver iron content. Results are presented as mean ±SD (n = 4). Differences were considered significant between control and treated groups as a, p<0.05; b, p<0.01; c, p<0.001; and between treated groups as d, p<0.05; e, p<0.01; f, p<0.001. doi:10.1371/journal.pone.0153940.g001 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 5/17 Gene expression under experimental conditions Hamp1 and hamp2 expression in the liver, spleen, head kidney and posterior intestine. Similar patterns of expression were observed in the liver, spleen, head kidney and intestine for both experimental anemias (Fig 2). In the liver, hamp1 expression was found to be significantly decreased throughout the whole experiment, with minimum levels reached as soon as day 1 and a gradual recovery towards day 14. In turn, hamp2 was only significantly decreased at day 4 in the severe anemia group. In the spleen, no significant variations were observed in hamp1 expression up to day 7, when an abrupt decrease occurred, followed by a slight recovery towards day 14. No changes were observed for hamp2. In the head kidney, hamp1 expression dropped significantly at day 1 and gradually recovered up to day 14. Hamp2 on the other hand, was increased at day 4 in the severe anemia group, returning to normal levels at day 7. Although not significant, the same tendency was observed for the light anemia group. In the intestine, a decrease in hamp1 was observed as soon as day 1 way for the severe anemia group, and only at day 4 in the light anemia group, with both gradually recovering towards day 14. Hamp2 expression was increased at day 4 in the severe anemia group, kept at still higher than normal levels at day 7 and returned to normal levels at day 14. Gene expression in the liver. In the liver, we evaluated the expression of genes involved in hepcidin regulation, iron mobilization, hypoxia sensing and hematopoiesis/erythropoiesisrelated factors. Overall, the severe anemia elicited a much more intense response in gene expression changes (Fig 3). Several genes associated with the iron-sensing pathways of hepcidin regulation were found to be down-regulated in the severe anemia group, such as bmp6 and its receptor bmpr2 and co-receptor hjv, and also the signaling molecules smad4 and smad1/5/8. The only gene found to be upregulated was tmprss6, at day 4. In the light anemia group, the Table 2. Constitutive expression of several iron-related genes in sea bass liver, spleen, head kidney and posterior intestine, measured by realtime PCR. Each sample was normalized to beta actin, calculated by the comparative CT method (2 -ΔΔCT ). Values are presented as means (n = 4). N.D.–not detected. Liver Spleen Head Kidney Posterior Intestine hamp1 1,000,000 15,000 13,500 24,000 hamp2 200,000 20,000 2,500 12,000 bmp6 33,000 3,000 700 9000 bmpr2 25,000 900 900 1,400 epo 900 560 40 110 epor 8,100 22,000 46,000 1,700 fpn 8,800 8,500 3,800 9,200 fth 7,830,000 460,000 1,100,000 1,470,000 gata2 3,300 11,000 7,000 9,600 hgb 460,000 1,000,000 11,500,000 75,000 hif1a 160 50 40 70 hjv 19,300 1 N.D. 2 slc11a2a 2,200 260 290 10,000 slc11a2b 150,000 300 250 2,900 smad4 5,200 600 200 140 smad5 2,800 200 250 500 tf 9,000,000 10 1 6 tfr1 80,000 4,500 36,000 7,300 tfr2 6,500 90 50 260 tmprss6 900,000 400 200 30 doi:10.1371/journal.pone.0153940.t002 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 6/17 Fig 2. Hamp1 and hamp2 mRNA expression. Measured in in the liver, spleen, head kidney and posterior intestine by real-time PCR, after 1, 4, 7 and 14 of experimental anemias. Results are presented as mean ±SD (n = 4). Differences were considered significant between control and treated groups as a, p<0.05; b, p<0.01; c, p<0.001. doi:10.1371/journal.pone.0153940.g002 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 7/17 only changes observed were a decrease in smad4 expression at day 4. When looking at genes involved in iron mobilization, we observed a decrease in fth expression in the severe anemia group. Significant up-regulations were observed for the iron transporter tf, as well as its receptors, tfr1 and tfr2, and also of the iron exporter fpn, for both anemia levels. Finally, when looking at hematopoiesis-related factors, there was a significant increase in epo expression in both groups, although at different time points. A significant increase was also observed for hif1a at day 4 for both anemias, whereas for gata2 a significant decrease was observed at days 7 and 14 in the severe anemia group and day 14 in the light anemia group. Gene expression in the spleen. Expression studies in the spleen were focused on genes involved in hematopoiesis (Fig 4). Similar responses were observed in response to both experimental anemias, although overall more pronounced in the severe anemia group. Expression increases were observed at days 4 and 7 for epo,epor and hgb, at day 1 for tfr1 and day 14 for tfr2.Gata2 was the only gene found to be down-regulated, reaching minimal levels at day 7 and with a gradual recovery towards day 14. Gene expression in the head kidney. Expression studies in the head kidney were also focused on genes involved in hematopoiesis (Fig 5). Expression levels of epo were found to be Fig 3. Gene expression in the liver, after 1, 4, 7 and 14 days of experimental anemias. Genes analyzed include genes encoding for hematopoietic transcription factors (gata2) and erythropoiesis-related factors (epo/epor), from the two major pathways of iron-sensing (tmprss6/hjv/bmp6/bmpr2/smad and tf/tfr1/tfr2), for response to hypoxia (hif1a), iron storage (fth) and iron export (fpn). Values are presented as mean ±SD (n = 4). Differences were considered significant between control and treated groups as a, p<0.05; b, p<0.01; c, p<0.001; and between treated groups as d, p<0.05; e, p<0.01; f, p<0.001. doi:10.1371/journal.pone.0153940.g003 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 8/17 increased at days 4 and 7 in the severe anemia group, and day 7 in the light anemia group. However, variations in the expression of its receptor (epor) were only observed in the severe anemia group, presenting increased expression also at days 4 and 7. Gata2 levels were found to be similarly decreased at days 1 and 4 in both groups, but while levels recovered to normal values in the light anemia group at day 7, they were kept down-regulated in the severe anemia group until the end of the experiment. Variations in the expression of transferrin receptors were only observed for the severe anemia group, with an up-regulation of tfr1 at day 14 and tfr2 at day 4. Gene expression in the posterior intestine. In the posterior intestine (Fig 6), expression levels of genes commonly associated with iron uptake (slc11a2a/b), export (fpn) and storage (fth) in the enterocytes were measured, as well as of a possible intestine-secreted regulator of liver hepcidin (bmp6). A significant increase of slc11a2a expression was observed in the severe anemia group, starting at day 4 and kept up-regulated until day 14. An increase was also observed at day 7 in the light anemia group. No significant changes where observed for slc11a2b in either group. In the severe anemia group, a down-regulation of bmp6 and fth was also observed, at days 14 and 7, respectively. A similar pattern of fpn expression was observed for both groups, with an up-regulation starting at day 1, reaching the peak at day 4 and gradually dropping to control levels towards day 14. Fig 4. Gene expression in the spleen, after 1, 4, 7 and 14 days of experimental anemias. Genes analyzed include genes encoding hematopoietic transcription factors (gata2) and erythropoiesis-related factors (epo/epor/hg), and involved in iron homeostasis (tfr1 and tfr2). Values are presented as mean ±SD (n = 4). Differences were considered significant between control and treated groups as a, p<0.05; b, p<0.01; c, p<0.001; and between treated groups as d, p<0.05; e, p<0.01; f, p<0.001. doi:10.1371/journal.pone.0153940.g004 Fig 5. Gene expression in the head kidney, after 1, 4, 7 and 14 days of experimental anemias. Genes analyzed include genes encoding hematopoietic transcription factors (gata2) and erythropoiesis-related factors (epo/epor/hg), and involved in iron homeostasis (tfr1 and tfr2). Values are presented as mean ±SD (n = 4). Differences were considered significant between control and treated groups as a, p<0.05; b, p<0.01; c, p<0.001; and between treated groups as d, p<0.05; e, p<0.01; f, p<0.001. doi:10.1371/journal.pone.0153940.g005 Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 9/17 27. Rodrigues PN, Vazquez-Dorado S, Neves JV, Wilson JM. Dual function of fish hepcidin: response to experimental iron overload and bacterial infection in sea bass (Dicentrarchus labrax). Dev Comp Immunol. 2006; 30(12):1156–67. Epub 2006/04/18. S0145-305X(06)00039-5 [pii] doi: 10.1016/j.dci.2006.02. 005 PMID: 16616368. 28. Neves JV, Caldas C, Wilson JM, Rodrigues PN. Molecular mechanisms of hepcidin regulation in sea bass (Dicentrarchus labrax). Fish Shellfish Immunol. 2011; 31(6):1154–61. Epub 2011/10/25. S10504648(11)00364-0 [pii] doi: 10.1016/j.fsi.2011.10.006 PMID: 22019826. 29. Hu X, Camus AC, Aono S, Morrison EE, Dennis J, Nusbaum KE, et al. Channel catfish hepcidin expression in infection and anemia. Comp Immunol Microbiol Infect Dis. 2007; 30(1):55–69. Epub 2006/11/28. S0147-9571(06)00089-0 [pii] doi: 10.1016/j.cimid.2006.10.004 PMID: 17126400. 30. Nicolas G, Chauvet C, Viatte L, Danan JL, Bigard X, Devaux I, et al. The gene encoding the iron regulatory peptide hepcidin is regulated by anemia, hypoxia, and inflammation. J Clin Invest. 2002; 110 (7):1037–44. Epub 2002/10/09. doi: 10.1172/JCI15686 PMID: 12370282; PubMed Central PMCID: PMC151151. 31. Nam YK, Cho YS, Lee SY, Kim BS, Kim DS. Molecular characterization of hepcidin gene from mud loach (Misgurnus mizolepis; Cypriniformes). Fish Shellfish Immunol. 2011; 31(6):1251–8. doi: 10.1016/ j.fsi.2011.09.007 PMID: 21959039. 32. Andriopoulos B Jr., Corradini E, Xia Y, Faasse SA, Chen S, Grgurevic L, et al. BMP6 is a key endogenous regulator of hepcidin expression and iron metabolism. Nat Genet. 2009; 41(4):482–7. Epub 2009/ 03/03. ng.335 [pii] doi: 10.1038/ng.335 PMID: 19252486. 33. Meynard D, Kautz L, Darnaud V, Canonne-Hergaux F, Coppin H, Roth MP. Lack of the bone morphogenetic protein BMP6 induces massive iron overload. Nat Genet. 2009; 41(4):478–81. Epub 2009/03/ 03. ng.320 [pii] doi: 10.1038/ng.320 PMID: 19252488. 34. Arndt S, Maegdefrau U, Dorn C, Schardt K, Hellerbrand C, Bosserhoff AK. Iron-induced expression of bone morphogenic protein 6 in intestinal cells is the main regulator of hepatic hepcidin expression in vivo. Gastroenterology. 2010; 138(1):372–82. Epub 2009/09/30. S0016-5085(09)01698-9 [pii] doi: 10. 1053/j.gastro.2009.09.048 PMID: 19786029. 35. Kautz L, Besson-Fournier C, Meynard D, Latour C, Roth MP, Coppin H. Iron overload induces BMP6 expression in the liver but not in the duodenum. Haematologica. 2011; 96(2):199–203. doi: 10.3324/ haematol.2010.031963 PMID: 20952515; PubMed Central PMCID: PMC3031686. 36. Silvestri L, Pagani A, Nai A, De Domenico I, Kaplan J, Camaschella C. The serine protease matriptase2 (TMPRSS6) inhibits hepcidin activation by cleaving membrane hemojuvelin. Cell Metab. 2008; 8 (6):502–11. Epub 2008/11/04. S1550-4131(08)00319-7 [pii] doi: 10.1016/j.cmet.2008.09.012 PMID: 18976966; PubMed Central PMCID: PMC2648389. 37. Catton WT. Blood cell formation in certain teleost fishes. Blood. 1951; 6(1):39–60. PMID: 14791599. 38. Saboor M, Moinuddin, Naureen A. Soluble transferrin receptor: a differentiating marker between iron deficiency anaemia and anaemia of chronic disorders. Journal of Ayub Medical College, Abbottabad: JAMC. 2011; 23(3):115–8. PMID: 23272450. 39. Pinto JP, Ribeiro S, Pontes H, Thowfeequ S, Tosh D, Carvalho F, et al. Erythropoietin mediates hepcidin expression in hepatocytes through EPOR signaling and regulation of C/EBPalpha. Blood. 2008; 111(12):5727–33. Epub 2008/03/11. blood-2007-08-106195 [pii] doi: 10.1182/blood-2007-08-106195 PMID: 18326822; PubMed Central PMCID: PMC2597200. 40. Huang H, Constante M, Layoun A, Santos MM. Contribution of STAT3 and SMAD4 pathways to the regulation of hepcidin by opposing stimuli. Blood. 2009; 113(15):3593–9. Epub 2009/02/11. blood2008-08-173641 [pii] doi: 10.1182/blood-2008-08-173641 PMID: 19204324; PubMed Central PMCID: PMC2891008. 41. Peyssonnaux C, Zinkernagel AS, Schuepbach RA, Rankin E, Vaulont S, Haase VH, et al. Regulation of iron homeostasis by the hypoxia-inducible transcription factors (HIFs). J Clin Invest. 2007; 117 (7):1926–32. Epub 2007/06/09. doi: 10.1172/JCI31370 PMID: 17557118; PubMed Central PMCID: PMC1884690. 42. Imagawa S, Yamamoto M, Miura Y. Negative regulation of the erythropoietin gene expression by the GATA transcription factors. Blood. 1997; 89(4):1430–9. PMID: 9028967. 43. Ingley E, Tilbrook PA, Klinken SP. New insights into the regulation of erythroid cells. IUBMB life. 2004; 56(4):177–84. doi: 10.1080/15216540410001703956 PMID: 15230344. 44. Esteban MA, Meseguer J, Garcia Ayala A, Agulleiro B. Erythropoiesis and thrombopoiesis in the headkidney of the sea bass (Dicentrarchus labrax L.): an ultrastructural study. Arch Histol Cytol. 1989; 52 (4):407–19. PMID: 2513852. 45. Worthen CA, Enns CA. The role of hepatic transferrin receptor 2 in the regulation of iron homeostasis in the body. Frontiers in pharmacology. 2014; 5:34. doi: 10.3389/fphar.2014.00034 PMID: 24639653; PubMed Central PMCID: PMC3944196. Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 16 / 17 46. Gunshin H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, et al. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature. 1997; 388(6641):482–8. Epub 1997/07/31. doi: 10.1038/41343 PMID: 9242408. 47. Bury N, Grosell M. Iron acquisition by teleost fish. Comp Biochem Physiol C Toxicol Pharmacol. 2003; 135(2):97–105. Epub 2003/07/16. S1532045603000218 [pii]. PMID: 12860048. 48. Bury NR, Grosell M, Wood CM, Hogstrand C, Wilson RW, Rankin JC, et al. Intestinal iron uptake in the European flounder (Platichthys flesus). J Exp Biol. 2001; 204(Pt 21):3779–87. Epub 2001/11/24. PMID: 11719541. 49. Neves JV, Wilson JM, Kuhl H, Reinhardt R, Castro LF, Rodrigues PN. Natural history of SLC11 genes in vertebrates: tales from the fish world. BMC Evol Biol. 2011; 11:106. Epub 2011/04/20. 1471-214811-106 [pii] doi: 10.1186/1471-2148-11-106 PMID: 21501491; PubMed Central PMCID: PMC3103463. 50. Drakesmith H, Nemeth E, Ganz T. Ironing out Ferroportin. Cell Metab. 2015; 22(5):777–87. doi: 10. 1016/j.cmet.2015.09.006 PMID: 26437604; PubMed Central PMCID: PMC4635047. Hepcidin and Anemia in Teleosts PLOS ONE | DOI:10.1371/journal.pone.0153940 April 21, 2016 17 / 17