Sestrin prevents atrophy of disused and aging muscles by integrating anabolic and catabolic signals

ARTICLE Sestrin prevents atrophy of disused and aging muscles by integrating anabolic and catabolic signals Jessica Segalés1,2, Eusebio Perdiguero 1,12, Antonio L. Serrano1,12, Pedro Sousa-Victor1,10,12, Laura Ortet1, Mercè Jardí1, Andrei V. Budanov3,4, Laura Garcia-Prat1,2,11, Marco Sandri5, David M. Thomson6, Michael Karin7, Jun Hee Lee 8& Pura Muñoz-Cánoves1,2,9* A unique property of skeletal muscle is its ability to adapt its mass to changes in activity. Inactivity, as in disuse or aging, causes atrophy, the loss of muscle mass and strength, leading to physical incapacity and poor quality of life. Here, through a combination of transcriptomics and transgenesis, we identify sestrins, a family of stress-inducible metabolic regulators, as protective factors against muscle wasting. Sestrin expression decreases during inactivity and its genetic deficiency exacerbates muscle wasting; conversely, sestrin overexpression suffices to prevent atrophy. This protection occurs through mTORC1 inhibition, which upregulates autophagy, and AKT activation, which in turn inhibits FoxO-regulated ubiquitin–proteasomemediated proteolysis. This study reveals sestrin as a central integrator of anabolic and degradative pathways preventing muscle wasting. Since sestrin also protected muscles against aging-induced atrophy, our findings have implications for sarcopenia. https://doi.org/10.1038/s41467-019-13832-9 OPEN 1Department of Experimental & Health Sciences, University Pompeu Fabra, CIBERNED, 08003 Barcelona, Spain. 2Centro Nacional de Investigaciones Cardiovasculares, 28019 Madrid, Spain. 3School of Biochemistry and Immunology, Trinity Biomedical Sciences Institute, Trinity College Dublin, Dublin D02 R590, Ireland. 4Engelhardt Institute of Molecular Biology, Center for Precision Genome Editing and Genetic Technologies for Biomedicine, 119991 Moscow, Russia. 5Department of Biomedical Science, University of Padova, 35100 Padova, Italy. 6Department of Physiology and Developmental Biology, Brigham Young University, Provo, UT 84602, USA. 7Department of Pharmacology, University of California San Diego, La Jolla, CA 92093, USA. 8Department of Molecular and Integrative Physiology, University of Michigan, Ann Arbor, MI 48109-2200, USA. 9ICREA, 08003 Barcelona, Spain. 10 Present address: Instituto de Medicina Molecular (iMM), Faculdade de Medicina, Universidade de Lisboa, 1649 Lisbon, Portugal. 11 Present address: Princess Margaret Cancer Centre, University Health Network, Toronto M5G 1L7 ON, Canada. 12 These authors contributed equally: Eusebio Perdiguero, Antonio L. Serrano, Pedro Sousa-Victor. *email: [email protected] NATURE COMMUNICATIONS | (2020) 11:189 | https://doi.org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications 1 1234567890():,; The control of mass in adult skeletal muscle is determined by a dynamic balance between anabolic and catabolic processes triggered by changes in activity or pathological conditions1. Muscle hypertrophy is associated with increased protein synthesis induced by activated AKT and mammalian target of rapamycin complex 1 (mTORC1) pathways1. Unlike muscle hypertrophy, muscle atrophy always involves a proteostatic shift in favor of catabolic versus anabolic processes1,2. Chief among these implicated catabolic changes is the activation of the autophagy-lysosome and ubiquitin–proteasome pathways, in particular the induction of muscle-specific ubiquitin ligases of the atrophy-related gene family, also known as atrogenes. Atrogenes, which are regulated by FoxO transcription factors (TF), remove proteins and organelles in atrophying fibers, whereas anabolic myofiber growth depends on AKT and mTOR activation3–7. AKT phosphorylates FoxO TF and impedes their nuclear activity, thus suppressing FoxO-dependent atrogene expression8. A complex scenario is thus emerging in which catabolic signaling connects with biosynthetic pathways during muscle atrophy, although little is known about how these connections are established. Skeletal muscle atrophy is a major health problem and is the consequence of a wide variety of pathological conditions, including inactivity (immobilization or nerve injury), chronic diseases, and neuromuscular disorders. Muscle atrophy also complicates many aging-associated diseases, lowers life quality, and increases mortality. Regardless of the driving origin, muscle atrophy always involves loss of muscle mass, strength, and function1,2. Preventing or reversing muscle atrophy is therefore of the utmost importance, yet the mechanisms driving muscle atrophy are largely unknown. Through a transcriptomic/bioinformatic screen for potential atrophy regulators, we identify the sestrin genes, particularly sestrin1 (but also sestrin 2), as genes downregulated rapidly in several models of muscle atrophy in vivo, including disuse, denervation, and aging (sarcopenia). Sestrins are a family of stress-inducible metabolic regulators that are conserved throughout metazoans9. Cell-based studies showed that sestrins have an antioxidant function that suppresses reactive oxygen species (ROS)9,10. Genetic studies of Drosophila sestrin (dSesn) revealed that, by activating AMPK, dSesn also functions as negative regulator of dTORC1, leading to several age-related pathologies11. Similar age-associated metabolic defects are also observed in cSesn-mutated Caenorhabditis elegans12. Recent studies indicate that mouse sestrins attenuate obesity-associated metabolic liver diseases, such as insulin resistance and steatohepatitis by suppressing oxidative stress or modulating AMPK/ mTORC1 activity10,13–15. However, the role of mammalian sestrins in the regulation of muscle mass control is unknown, despite skeletal muscle being the site of maximal sestrin 1 (Sesn1) expression in humans and mice16. In this study, we have made the surprising observation that not all catabolic activities are enhanced during muscle atrophy; rather, while proteasome activity is induced in response to inactivity, autophagy is blunted. Using sestrin gain-of-function and ablation approaches in mice, we find that sestrin preserves muscle mass and force in atrophying conditions by coordinating anabolic and catabolic pathways. This protective effect extends to age-induced muscle atrophy. Our results reveal that sestrin is a key instructor of skeletal muscle mass. Results Sestrins protect from disuse-induced muscle atrophy.Through a bioinformatic analysis of the atrophy-associated transcriptome, we searched for potential growth and atrophy regulators. Sesn1 was identified as one of six genes dysregulated in distinct models of muscle wasting in vivo, such as disuse and denervation (Fig. 1aand Supplementary Data 1). Sesn1 belongs to a conserved stressinducible family of proteins with antioxidant and metabolic functions, which in vertebrates are encoded by the Sesn1,Sesn2,and Sesn3 loci9. Sesn1, among sestrins, is highly expressed in mammalian skeletal muscle16 (Supplementary Fig. 1a). Considering that sestrins control mTOR and AKT pathways9,11,14,17,18,critical regulators of muscle function1,2, we examined the influence of Sesn1 downregulation on muscle atrophy. Sesn1 RNA and protein expression decreased in mouse skeletal muscle after immobilization-induced limb inactivity (Fig. 1b), correlating with muscle atrophy and loss of force (Fig. 1c–f, white and gray charts). To investigate the involvement of Sesn1 in disuse atrophy, we generated transgenic mice overexpressing human Sesn1 (96% homologous to murine Sesn1) in skeletal muscle under the MCK promoter (Sesn1SkM-Tg mice). Sesn1SkM-Tg mice expressed Sesn1 in both fast and slow muscles, without changes in Sesn2 and Sesn3 expression (Supplementary Fig. 1b, c), were of normal weight, and showed no obvious muscle abnormalities under normal conditions when compared to littermate Sesn1WT (wild-type, WT) mice (Supplementary Fig. 1d, e). However, Sesn1SkM-Tg mouse muscle, but not the control Sesn1WT muscle, was strongly protected against all measures of disuse atrophy, including muscle weight, myofiber size, fibrosis index, and force production by the extensor digitorum longus (EDL) (Fig. 1c, d, navy and blue charts, and Supplementary Fig. 1f) and soleus muscles (Supplementary Fig. 1g, navy and blue charts). No changes in myonuclear number were observed (Supplementary Fig. 1h). Importantly, Sesn1 also protected from atrophy induced by denervation, as shown by the preservation of myofiber size and muscle force in Sesn1SkM-Tg mice compared to Sesn1WT mice upon sciatic denervation (Supplementary Fig. 1i, j). Given the high sequence homology of mammalian sestrins (Sesn1–3), and to discriminate whether the atrophy-preventing effect was specific for Sesn1 or could also be exerted by another sestrin family member, we tested muscle atrophy protection with a transgenic mouse line overexpressing human Sesn2 (92% homologous to murine Sesn2) in skeletal muscle (Sesn2SkM-Tg mice), in comparison to littermate control Sesn2WT mice (Supplementary Fig. 2a–c). Sesn2SkM-Tg overexpression provided similar protection from disuse atrophy and force loss (Fig. 1e, f and Supplementary Fig. 2d), indicating that, upon overexpression, Sesn1 and Sesn2 are equally effective at preventing immobilization-induced muscle atrophy. Transgenic Sesn1/2 expression throughout development has the potential to produce adaptive effects unrelated to sestrin activity that may mask sestrin functions in the adult. To exclude this, we overexpressed Sesn1 and Sesn2 in skeletal muscle of 4month-old WT mice via adeno-associated virus (AAV) transduction (Supplementary Fig. 2e, f). Consistent with the results from transgenic mice, AAV-based Sesn1 or Sesn2 overexpression in WT muscle also prevented disuse-induced muscle atrophy and weakness (Fig. 1g, h). Sestrins may function as antioxidants through their oxidoreductase activity10,19, prompting us to test the effect of an oxidoreductase-disrupting C130 mutation in Sesn10,19. Overexpression of Sesn1-C130S still impeded disuse muscle atrophy (Supplementary Fig. 2g), indicating that the protective action of sestrin is independent of its antioxidant function. Loss of Sesn 1 aggravates disuse-induced muscle atrophy.Of the three sestrins, Sesn1 is the main form expressed in muscle10,16,19 (Supplementary Fig. 1a). We therefore analyzed mice deficient in Sesn1 (Sesn1KO mice)20 in comparison to their WT controls. Although these mice showed no detectable ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 2NATURE COMMUNICATIONS | (2020) 11:189 | https://doi.org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications alterations in muscle weight, myofiber size, or force under basal conditions (Supplementary Fig. 3a–d), they showed more pronounced myofiber atrophy and force loss in EDL and soleus muscles in response to inactivity (Fig. 2a–d). No changes in Sesn2/Sesn3 levels were found in muscles of Sesn1KO mice (Supplementary Fig. 3e); Sesn1 is thus critical for preventing muscle wasting. We next evaluated whether sestrin provided equal protection to distinct types of muscle fibers. Disuse muscle atrophy was associated with muscle fiber-type switching from IIA/IIX to IIB fibers in WT mice and in Sesn1SkM-Tg mice (Supplementary Fig. 3f). Preservation of muscle mass upon Sesn1 overexpression and increased atrophy after Sesn1 deletion was observed in type IIA/IIX and type IIB fibers (Supplementary Fig. 3f, g), indicating 3d Den (This study) Growth & atrophy regulators 14d Imm (Renaud 2013) 3000 1549 2245 20 1901 522 3 1265 4 1225 60 28 5 ab –2 30.5 14d Den 3d Den 14d Imm Cilp Igfbp5 Mtor Itfg2 Rnf152 Sesn1 0 0.5 1.0 1.5 Basal 10d Imm Basal 3d 10d 0 0.5 1.0 1.5 ** Imm Sesn1 Tubulin Relative protein levels Basal 10d Imm * c * d 0 1000 2000 3000 0 1000 2000 3000 * 0 500 1000 1500 2000 2500 Freq (Hz) 0 50 100 150 Freq (Hz) Freq (Hz) 0 50 100 150 0 50 100 150 200 250 0 50 100 150 200 250 Absolute force (mN) * Relative Sesn1 mRNA expression * * * 0 500 1000 1500 2000 2500 0 50 100 150 200 250 ef 0 50 100 150 200 Freq (Hz) 0 50 100 150 200 0 100 200 300 0 50 100 150 200 250 * 50 150 250 g AAV-Control AAV-Sesn1 Immobilization AAV-Control basal AAV-Control Imm AAV-Sesn1 Imm AAV-Control basal AAV-Control Imm AAV-Sesn2 Imm 0 1000 2000 3000 * 0 100 200 300 ** h * 0 50 100 150 200 250 ** 14d Den (Sartori 2013) CSA (µm 2 ) CSA (µm 2 ) CSA (µm 2 ) CSA (µm 2 ) CSA (µm 2 ) CSA (µm 2 ) Weight (mg)Weight (mg) Weight (mg)Weight (mg) Absolute force (mN)Absolute force (mN)Absolute force (mN) Max specific force (mN mm –2 ) Sesn1 WT Sesn1 SkM-Tg Sesn1 WT Imm Sesn2 WT Sesn2 WT Imm Sesn2 WT Sesn2 WT Imm Sesn2 WT Sesn2 WT Imm Sesn1 WT Sesn1 WT Imm Sesn1 WT Sesn1 WT Imm Sesn1 SkM-Tg Imm Sesn2 SkM-Tg Sesn2 SkM-Tg Imm Sesn2 SkM-Tg Sesn2 SkM-Tg Imm Sesn2 SkM-Tg Sesn2 SkM-Tg Imm Sesn1 SkM-Tg Sesn1 SkM-Tg Imm Sesn1 SkM-Tg Sesn1 SkM-Tg Imm Maximum force (mN) Maximum force (mN) Specific force (mN mm –2 ) Specific force (mN mm –2 ) AAV-Control basal AAV-Control AAV-Sesn2 Immobilization AAV-Control basal * 0 10 20 30 40 50 60 70 0 10 20 30 40 50 60 0 50 100 150 200 250 300 Max specific force (mN mm –2 ) 0 50 100 150 200 250 300 Max specific force (mN mm –2 ) Max specific force (mN mm –2 ) 0 50 100 150 200 250 300 0 10 20 30 40 50 60 70 0 10 20 30 40 50 60 0 100 200 300 0 1000 2000 3000 0 50 100 150 200 kDa 55 55 NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 ARTICLE NATURE COMMUNICATIONS | (2020) 11:189 | https://doi .org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications 3 that sestrin protects against muscle atrophy independently of fiber-type changes. Sestrin blunts FoxO-dependent atrogenes in disused muscle. To interrogate the mechanistic basis of sestrin-mediated protection against muscle atrophy, we performed RNAseq analysis on control and immobilized TA muscles of all available mouse genotypes: Sesn1SkM-Tg, Sesn2SkM-Tg, and Sesn1KO mice, and their respective WT counterparts. Like other atrophy models21, muscle immobilization enriched gene expression signatures for apoptosis, inflammation, cell-cycle inhibition, and anabolic regulation in all mouse groups (Fig. 3a and Supplementary Data 2). Interestingly, the association between immobilization and anabolic signaling hallmarks (PI3K/AKT/mTORC1 regulation) was strengthened by Sesn1/2 overexpression, whereas these hallmarks correlated negatively with Sesn1 deficiency (Fig. 3a). We also performed a hierarchical clustering analysis to identify genes regulated by both immobilization and sestrins (Supplementary Fig. 4a). We focused on gene clusters whose immobilizationdependent induction was increased or decreased by Sesn overexpression (Clusters A and B) but were behaving contrarily in Sesn1-deficient muscles (Clusters C and D) (Supplementary Fig. 4a and Supplementary Data 3). Intersection between clusters A/C and clusters B/D yielded a gene set (defined as Sestrin-regulated genes) that was highly enriched in canonical pathways implicated in ubiquitin–proteasome-mediated proteolysis, including proteasome subunits and the E3 ubiquitin-ligase atrogenes MuRF1 (Trim63) and Atrogin1 (Fbxo32)6,22–24 (Supplementary Fig. 4a and Supplementary Data 3). Other proteostasis pathways, such as macroautophagy-lysosome degradation, were also enriched (Supplementary Fig. 4b). Interestingly, genes regulated by immobilization and sestrins were often found to contain binding sites for FoxO, Myc/Maz, and Sp1 TF (Fig. 3b). FoxO TF-binding sites were highly enriched in atrogenes and autophagy genes present in the sestrin-regulated gene set (Supplementary Fig. 4c, left and right). Of note, a significant overlap was found between sestrin-regulated atrogenes and a previously described list of FoxO-regulated atrogenes24 (Supplementary Fig. 4c, middle). These results are consistent with the former findings that upregulation of atrogenes, particularly Atrogin1 and MuRF1, is directed by FoxO3a and required for muscle atrophy3,6,7,24. Based on these findings, we examined the status of AKT-FoxO signaling in immobilized muscle of Sesn1/2 transgenic mice. Immobilized muscles of Sesn1SkM-Tg and Sesn2SkM-Tg mice had higher levels of AKT and FoxO3 phosphorylation than WT counterparts (Fig. 3c, d; Supplementary Fig. 5a). Notably, sestrin overexpression in muscle upregulated both PDK1-dependent AKT phosphorylation at Thr308 and mTORC2-dependent phosphorylation at Ser473 (Fig. 3d). Phosphorylation at both sites activates AKT kinase activity, while AKT-mediated phosphorylation of FoxO inhibits its transcriptional activity by retaining it in the cytoplasm8. Consequently, immobilized Sesn1/2SkM-Tg muscle exhibited lower expression of well-known FoxO targets24 such as Atrogin1 and MuRF1 (Fig. 3e and Supplementary Fig. 5b), consistent with reduced FoxO transcriptional activity and with the transcriptome studies (Supplementary Figs. 4b, c and 5c). In contrast, disused muscle of Sesn1KO mice expressed higher levels of these atrogenes (Supplementary Fig. 5d). In line with atrogenemediated upregulation of ubiquitin–proteasome activity, the immobilization-induced increase in chymotrypsin-like proteasome activity in muscles of WT mice was blunted by sestrin overexpression (Fig. 3f). Conversely, blocking proteasome activity with bortezomib prevented the disuse atrophy in WT mice (Supplementary Fig. 5e). These results suggest that sestrins protect disused muscles from wasting, at least in part, by repressing the induction of FoxO-regulated atrogenes encoding muscle proteolytic enzymes. Involvement of FoxO in sestrin-mediated muscle protection was confirmed through genetic modulation of FoxO. Musclespecific overexpression of constitutively active FoxO3 (FoxO3 TM7) abolished the protective effect of Sesn1 against muscle atrophy in Sesn1SkM-Tg mice (Fig. 3g). Contrarily, muscle-specific genetic deletion of all three FoxO genes (FoxO1,3,4SkM-KO tripleknockout mice) (Supplementary Fig. 5f) produced strong protection against inactivity-induced muscle atrophy-like Sesn1/ 2 overexpression (Fig. 3h, see Fig. 1for comparison). AKT activation by sestrin thus blocks ubiquitin–proteasome-dependent proteolysis via FoxO-signaling inhibition, subsequently attenuating muscle wasting during disuse. Sestrin coaxes autophagy by blunting mTORC1 to protect muscle. Gene set enrichment analysis (GSEA) also identified mTORC1-signaling regulation as another hallmark of sestrin modulation in muscle (Fig. 4a). mTORC1 is a major anabolic factor, classically associated with promotion of muscle growth and hypertrophy. Although mTORC1 was originally thought to decline during muscle atrophy1,2, we found sustained—and even increased—mTORC1 activity in immobilized atrophic muscles of non-transgenic mice, as revealed by phosphorylation of the mTORC1 downstream targets S6 and ULK (Fig. 4b). Overexpression of Sesn1 or Sesn2, which restores muscle mass in the disuse condition, strongly inhibited mTORC1 signaling Fig. 1 Sestrins prevent disuse-induced skeletal muscle atrophy. a Left Venn diagram showing overlap between a gene set of growth and atrophy regulators (see the “Methods”section) and dysregulated genes in immobilized (Imm) or denervated (Den) muscles reported in published muscle atrophy models or identified in our RNAseq comparison. Right Heat map for the six genes dysregulated in all gene sets analyzed. bAnalysis of Sesn1 mRNA (left) and protein (right) in tibialis anterior (TA) muscles from non-immobilized (basal) and immobilized (Imm) limbs of WT mice for the indicated number of days (d). cTA muscle weight of and mean TA fiber cross-sectional area (CSA) in Sesn1SkM-Tg mice (overexpressing human Sesn1) and corresponding wild type (WT) mice (Sesn1WT) in basal conditions and after 10 days of limb immobilization. dForce measurements in extensor digitorum longus (EDL) muscle of Sesn1WT and Sesn1SkM-Tg mice in basal conditions and after 10 days of limb immobilization. Charts show force–frequency curves (left) and maximum specific force (maximum force normalized by muscle area) (right). eWeight of TA muscles and mean TA fiber CSA in Sesn2SkM-Tg mice (overexpressing human Sesn2) and corresponding WT mice (Sesn2WT) in basal conditions and after 10 days of limb immobilization. fForce measurements in EDL muscles of Sesn2WT and Sesn2SkM-Tg mice in basal conditions and after 10 days of limb immobilization. Charts show force–frequency curves and maximum specific force. gHistology and muscle force in EDL muscles of young mice transduced with AAV-Sesn1 or AAV-Control followed 4 days later by limb immobilization for 10 additional days. The upper panels show representative images of hematoxylin/eosin (H/E) staining in basal and immobilized muscles. Scale bar =50 µm. The charts show fiber size (CSA), maximum force, and specific force. hHistology and muscle force in EDL muscles transduced with AAV-Sesn2 or AAV-Control and treated as described in g. Scale bar =50 µm. All data are shown as mean with SEM. Statistical comparisons by unpaired two-tailed Student's t-test (*p< 0.05 vs. basal conditions). Sample numbers were n=4–6 mice per group for c–fand n=4 mice per condition for g,h. Source data are provided as a Source Data file. ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 4NATURE COMMUNICATIONS | (2020) 11:189 | https://doi.org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications (i.e. reduced S6 and ULK1 phosphorylation) after immobilization (Fig. 4b), whereas Sesn1KO muscle showed constitutive mTORC1-signaling activation even in resting muscle (Supplementary Fig. 6a). Therefore, muscle immobilization unexpectedly conveys mTORC1 activation, whereas sestrins strongly downregulate it. mTORC1-mediated ULK1 phosphorylation inhibits autophagy13,25, another major protein and organelle degradation pathway. The autophagy pathway was also found in the sestrinregulated gene set, which included many autophagy-related genes enriched in FoxO TF-binding sites (Supplementary Fig. 4b, c and Supplementary Data 3). Skeletal muscle autophagy flux was determined in vivo using colchicine, which blocks autophagosome degradation26. Colchicine-triggered marked accumulation of the autophagosome marker LC3-II in WT and sestrin-overexpressing muscles (Fig. 4c, left panel, and Supplementary Fig. 6b), indicating that basal autophagy flux is active in all these tissues, being barely affected by Sesn1/2 overexpression in non-disuse conditions. However, muscle immobilization in WT mice strongly decreased colchicine-dependent LC3-II accumulation (Fig. 4c, right panel, and Supplementary Fig. 6c), indicating that autophagy flux was attenuated. Importantly, autophagy flux was preserved in ab cd * * 0 1000 2000 3000 * 0 20 40 60 * * WT WT Imm * * * 0 100 200 300 0 100 200 300 EDL Soleus ** 0 50 100 150 200 250 0 50 100 150 200 250 * ** 250 Freq (Hz) Freq (Hz) 0 50 100 150 200 Freq (Hz) 0 50 100 150 200 0 50 100 150 200 0 100 200 300 0 50 100 150 200 Freq (Hz) 0 50 100 150 200 0 50 100 150 200 0 50 100 150 200 250 * * * * 50 150 250 CSA (µm 2 ) Weight (mg) Max specific force (mN mm –2 ) Max specific force (mN mm –2 ) Sesn1 KO Sesn1 KO Imm WT WT Imm WT WT Imm WT WT Imm Sesn1 KO Sesn1 KO Imm Sesn1 KO Sesn1 KO Imm Sesn1 KO Sesn1 KO Imm WT WT Imm Sesn1 KO Sesn1 KO Imm WT WT Imm Sesn1 KO Sesn1 KO Imm Maximum force (mN) Maximum force (mN) Absolute force (mN)Absolute force (mN) Absolute force (mN)Absolute force (mN) * * Fig. 2 Loss of sestrin1 exacerbates disuse-induced muscle atrophy. a Mean CSA of TA fibers from WT and Sesn1KO mice in basal conditions and after 10 days of limb immobilization. bTA muscle weight in WT and Sesn1KO mice in basal conditions and after 10 days of limb immobilization. c,dForce measurements in EDL cand soleus dmuscles of WT and Sesn1KO mice in basal conditions and after 10 days of limb immobilization. Charts show maximum and specific force (top) and force–frequency curves (bottom). All data are shown as mean with SEM. Comparisons by unpaired two-tailed Student's t-test (*p< 0.05). N=3–7 mice per genotype and condition. Source data are provided as a Source Data file. NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 ARTICLE NATURE COMMUNICATIONS | (2020) 11:189 | https://doi .org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications 5 immobilized muscles overexpressing Sesn1 or Sesn2 (Fig. 4c, right panel, and Supplementary Fig. 6c). This observation is consistent with downregulation of mTORC1-dependent ULK1 activation by overexpression of sestrins during immobilization conditions (Fig. 4b). These findings were reinforced by experiments with a tandem fluorescent autophagy flux reporter (mRFP-GFP-LC327) (Fig. 4d). Although mature autolysosomes (red LC3 puncta) were abundant in basal WT muscle, the red LC3 signal was eliminated by muscle immobilization, leaving only yellow puncta (undegraded autophagosomes). Sesn1/2 overexpression substantially preserved Enrichment plot: AKT_MTORC1_SIGNALING Enrichment plot: AKT_MTORC1_SIGNALING Enrichment score (ES) Ranked list metric (Signal2Noise) Enrichment score (ES) Ranked list metric (Signal2Noise) 'Sesn1-2Skm Tg' (positively correlated) 'WT' (negatively correlated) Zero cross at 7350 'Sesn1KO' (positively correlated) 'WT' (negatively correlated) Zero cross at 6642 0 0.20 0.15 0.10 0.05 0.00 –0.05 –0.5 1.5 1.0 0.5 0.0 –1.0 0.10 0.05 0.00 –0.05 –0.10 –0.15 –0.20 –2 –1 0 1 2 3 50002500 7500 10,000 Rank in Ordered Dataset Rank in Ordered Dataset Enrichment profile Hits Ranking metric scores 12,500 0 5000 2500 7500 10,000 Enrichment profile Hits Ranking metric scores 12,500 c pFoxO3 Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm * pFoxO3/FoxO3 pFoxO1/FoxO1pAKTT308/AKT pAKTThr308 pAKTS473 pAKTS473/AKT Basal pFoxO3 3d Imm Tubulin pAKT S473 pAKTT308 Tubulin pFoxO1 d pFoxO1 Tubulin pAKT S473 pAKT T308 Tubulin pAKTT308/AKT pFoxO3 pFoxO1 pFoxO1/FoxO1 pAKT S473 pAKTS473/AKT pAKT T308 pFoxO3 * Atrogin1 Basal 3d Imm Basal 3d Imm Basal 3d Imm MurF1 0 1 2 3 4Cathepsin L 0 0.5 1.0 1.5 2.0 *** gh * ns ** Basal Imm C.A. FoxO3 Imm 0 500 1000 1500 2000 2500 FoxO1,3,4WT FoxO1,3,4SkM-KO FoxO1,3,4SkM-KOImm FoxO1,3,4WTImm * e 0 25 50 75 100 125 ns Genes –log10 p value –log10 p value –log10 p value TNFA SIGNALING VIA NFKB KRAS SIGNALING UP E2F TARGETS ALLOGRAFT REJECTION APOPTOSIS P53 PATHWAY INTERFERON GAMMA RESPONSE INFLAMMATORY RESPONSE G2M CHECKPOINT PI3K AKT MTOR SIGNALING versus WT Imm 5 10 15 20 10 20 30 Immobilization hallmarks ab 10 20 30 40 50 100 150 Genes E12 Maz Maz Myc AP4 SP1 SP1 NFAT ETS2 ELK1 NRF1 AP1 TATA FOXO FOXO MEF2 Pax4 Unknown LEF1 LEF1 Imm Sesn-regulated genes Genes 25 50 75 100 200 300 f Sesn1SkM-TgImm Sesn2SkM-TgImm versus WT Imm Sesn1KOImm MTORC1_SIGNALING Sesn1WT Sesn1SkM-Tg Sesn1WT Sesn1SkM-Tg Basal 3d Imm Sesn2WT Sesn2SkM-Tg Sesn2WT Sesn2SkM-Tg Sesn1WT Sesn1SKM-Tg Sesn1WT Sesn1WT Sesn1WTImm Sesn1SKM-TgImm Sesn1SKM-Tg Sesn1SKM-Tg Sesn2WT Sesn2SKM-Tg Relative mRNA expression CSA (µm2) CSA (% of basal) Sesn1WT Sesn1SKm-Tg Proteasome activity (FU µg–1 prot) * AKT AKT FoxO1 FoxO3 FoxO1 FoxO3 pFoxO1 * * * *** * 0 1 2 3 0 1 2 3 4 pFoxO3/FoxO3 0 1 2 3 4 0 1 2 3 4 0 1 2 3 4* 0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 0 5 10 15 0 1 2 3 4 5 0 1 2 3 4 5 0 20 40 60 80 kDa 70 70 55 55 55 55 55 70 100 70 70 70 kDa 70 70 55 55 55 55 55 70 100 70 70 70 100 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 6NATURE COMMUNICATIONS | (2020) 11:189 | https://doi.org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications the red LC3 puncta during immobilization (Fig. 4d). Conversely, Sesn1KO mice showed impaired autophagy flux already in basal conditions, with reduced colchicine-dependent LC3-II accumulation (Supplementary Fig. 6d) and loss of red LC3 puncta in the reporter assay (Fig. 4e). The defective autophagy in nonimmobilized muscle of Sesn1KO mice could be explained by the constitutive mTORC1-dependent ULK1 activation in the absence of sestrin (Supplementary Fig. 6a), since stress-induced sestrin expression inhibits mTORC1 signaling via activation of AMPK28. Consistent with this idea, AMPK activation was readily observed in non-immobilized Sesn1-overexpressing muscle, providing a mechanistic explanation for how sestrin inhibits mTORC1 and activates autophagy (Supplementary Fig. 6e). We further tested whether sestrin-induced autophagy is important for attenuating disuse atrophy through genetic and pharmacological approaches. Sesn1-mediated protection against disuse atrophy was abolished upon constitutive mTORC1 activation by silencing TSC2, the negative regulator of mTORC129–31 (Fig. 4f and Supplementary Fig. 6f). Conversely, rapamycin, which inhibits mTORC1 and induces autophagy32, increased WT muscle autophagy flux (Supplementary Fig. 7a), and substantially attenuated muscle atrophy (Fig. 4g), like sestrins. A similar protective effect against muscle atrophy was exerted by the autophagy inducer spermidine32,33 (Fig. 4h). Autophagy activation through Atg7 overexpression32 also protected myofibers from disuse-induced atrophy (Supplementary Fig. 7b, c), whereas muscle-specific genetic deletion of Atg7 (Atg7SkM-KO) (Supplementary Fig. 7d) nullified Sesn1-mediated protection against disuse-induced muscle atrophy (Fig. 4i). No significant crosstalk between both catabolic activities was observed during muscle immobilization (not shown). Taken together, these data demonstrate that muscle inactivity produces detrimental effects by differentially acting on catabolic mechanisms (i.e. decreasing autophagic while inducing proteasomal pathways). By reversing this concert, sestrins preserve autophagy that is essential for muscle homeostasis, while preventing proteasome overactivation that wastes muscle by majorly driving loss of muscle mass during disuse condition. Sestrins protect muscle against aging-associated atrophy.We finally investigated whether sestrins can also protect against agingassociated muscle atrophy (sarcopenia). Compared with young mice (4 months old), aged mice (24 months old) showed lower expression of Sesn1 protein in skeletal muscle (Fig. 5a) accompanied by pronounced loss of skeletal muscle force and mass and myofiber atrophy (Fig. 5b–e). All these muscle parameters were improved by transduction of AAV-Sesn1 for one month, including a slight reduction in muscle fibrosis (Fig. 5c–eandSupplementary Fig. 7e), suggesting that sestrin activation presents a promising strategy for protecting against age-associated muscle atrophy and related conditions. No changes in myonuclear number were observed (Supplementary Fig. 7f). Mechanistically, we found that mTORC1 activity is increased in muscles of aged mice and is reduced by Sestrin overexpression (Fig. 5f), correlating with the protection exerted by Sestrin on age-related muscle atrophy. Finally, we compared publicly available transcriptomic data of skeletal muscles of young and old mice (GEO: GSE53959)34 to assess for potential gene expression similarities between aged and immobilized muscles. Interestingly, we found that aged-muscle transcriptome was enriched in gene expression signatures for apoptosis, inflammation, cell-cycle inhibition, UV response, Myc targets, and anabolic signaling (PI3K/AKT/mTORC1 regulation) (Fig. 5g). Supporting the existence of commonalities between genes induced by muscle immobilization and aging, the aged muscle transcriptome was found to be also enriched in atrogenes (Fig. 5h), while the upregulated genes contained binding sites for E12, Myc/Maz, Sp1, and FoxO TFs (Fig. 5i). In fact, the transcriptome of old mice was enriched in FoxO and Sestrinregulated atrogenes24, including the E3 ubiquitin-ligases Atrogin1 and Musa1 (Fbxo30)23 and autophagy-related genes Bnip3 and p62 (Sqstm1) (Fig. 5i). Taken together, these results suggest that, similar to disuse-induce muscle atrophy, sestrins may protect muscle against aging-associated muscle atrophy by coordinating anabolic and catabolic pathways. Discussion Autophagy and ubiquitin–proteasome proteolytic activities have been independently linked to muscle wasting6,31,35. Our analysis combining unbiased transcriptomics and targeted transgenesis approaches has identified an important mechanism for protecting muscle from wasting during disuse and aging. Sestrins, strongly downregulated by disuse, preserve muscle mass by coordinately inhibiting atrophic proteolysis and activating homeostatic autophagy. Sestrins may achieve disuse-induced protection by regulating the balance between distinct growth-associated mTOR complexes, strongly inhibiting mTORC128 while supporting mTORC2 activity14. Through upregulation of AKT, sestrins inhibit FoxO-dependent transcription of atrogenes, which normally promote muscle wasting by accelerating protein degradation. At the same time, through the activation of AMPK and inhibition of mTORC128, sestrins upregulate autophagy, thus maintaining proteostasis and organelle quality for homeostatic preservation of muscle mass and force. Of interest, the protective effect of sestrin was also extended to denervation-induced muscle Fig. 3 Sestrin blunts FoxO-dependent upregulation of muscle atrogenes. a Gene set enrichment analysis (GSEA) of immobilization-related genes. Bubble plot of enriched GSEA hallmarks in the dysregulated genes upon 3-day muscle immobilization in WT mice (left). Enrichment plots of the combined PI3KAKT-MTOR signaling and mTORC1-signaling hallmarks (AKT-MTORC1 signaling) in comparisons of Sesn1/2SkM-Tg vs. WT mice and Sesn1KO vs. WT mice (right). bBubble plot of enriched transcription factor-binding sites (GSEA) among immobilization-dysregulated genes (left) and the sestrin-regulated gene set defined in Supplementary Fig. 4a (right). cWestern blot analysis showing phosphorylation levels of FoxO1, FoxO3, and AKT in muscles of Sesn1WT and Sesn1SkM-Tg mice in basal conditions and after 3 days of immobilization. Representative blots are shown (left) with corresponding quantification. For each experimental condition (basal and immobilization) values of Sesn1SkM-Tg are referred to averaged values for Sesn1WT samples, which were set to one. dWestern blot analysis of the phosphorylation levels of FoxO1, FoxO3, and AKT in muscles of Sesn2WT and Sesn2SkM-Tg mice in basal conditions and after 3 days of immobilization. Representative blots are shown (left) with corresponding quantification (right), relatively to Sesn2WT values, as in c.eAtrogin1, MurF1, and Cathepsin L mRNA levels in skeletal muscle from Sesn1WT and Sesn1SkM-Tg mice in basal conditions and after 3 days of immobilization. fProteasome activity in total homogenates of TA muscles from Sesn1WT and Sesn1SkM-Tg mice in basal conditions and after 3 days of immobilization. gMean myofiber CSA in TA muscle from Sesn1WT and Sesn1SkM-Tg mice electrotransferred with control vector or with a plasmid encoding constitutively active FoxO3 (C.A. FoxO3) and then immobilized for 10 days. Values are relative to basal conditions. hMean myofiber CSA in TA muscle from FoxO1,3,4WT and FoxO1,3,4SkM-KO mice in basal conditions and after 10 days of immobilization. All data are shown as mean with SEM. Comparisons by Student's t-test (*p< 0.05). Sample numbers were n=3–4 mice per group for c,d,n=3–6 animals for e–gand n=3–5 mice per genotype and condition for h. Source data are provided as a Source Data file. NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 ARTICLE NATURE COMMUNICATIONS | (2020) 11:189 | https://doi .org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications 7 wasting and age-associated muscle atrophy. The relevance of our data is further supported by recent findings demonstrating reduction of sestrins’protein levels in muscles of aging human individuals36 including muscles from the frail elderly population37. Future studies should explore the effect of Sestrin/mTOR modulators such as NV-513838 on these conditions. Loss of muscle mass and force significantly affects health, life quality, and even survival. Given their beneficial effects on muscle wasting during disuse and aging, sestrins should be regarded as nodal regulators of mammalian muscle growth with potentially broad applications in the treatment of common catabolic conditions. a b pS6 S6 Tubulin pULK1 ULK1 pS6 * pS6/S6 AAV-Control AAV-Sesn1 ––– +++ ––– +++ cd * * 0 20 40 60 80 100 WT WT Imm * * shC shTSC2 shC shTSC2 AAV-Control AAV-Sesn1 Basal Imm 0 1000 2000 3000 4000 *** ns Basal 10d Imm Basal rapamycin 10d Imm rapamycin ** * AAV-Control AAV-Control Imm AAV-Sesn1 AAV-Sesn1Imm Atg7 WT Atg7 SkM-KO * 0 500 1000 1500 2000 * * 0 1000 2000 3000 ns i e WT 0 20 40 60 80 * * fg h * * CSA (µm 2 ) CSA (µm 2 ) –– ––––+ +++ Colchicine: GAPDH AAV-Control AAV-Sesn1 AAV-Control AAV-Sesn1 LC3-I LC3-II Colchicine: GAPDH LC3-I LC3-II LC3-II/GAPDH LC3-II/GAPDH –+–+ Colchicine: –+–+ Colchicine: AAVSesn1 AAVControl AAVSesn1 AAVControl AAVSesn1 AAVControl AAVSesn1 AAVControl * * Basal 3d Imm Sesn2 WT Sesn2 SkM-Tg Imm Imm AAV-Control AAV-Control Imm AAV-Sesn1 AAV-Control Imm RFP+GFP+ puncta (%) RFP+GFP+ puncta (%) AAVSesn1 AAVControl AAVSesn1 AAVControl Sesn1 KO Sesn1 KO Sesn1 KO Imm RFP+GFP+ puncta (%) LC3-II/GAPDH (fold increase colchicine vs vehicle) LC3-II/GAPDH (fold increase colchicine vs vehicle) * pS6/S6 * pS6 Basal 3d Imm Basal 3d Imm Basal 3d Imm Basal 3d Imm * pULK1 0.0 0.5 1.0 1.5 ** pULK1/ULK1 Basal Sesn2 WT Sesn2 SkM-Tg Sesn2 WT Sesn2 SkM-Tg 3d Imm Basal 3d Imm * Sesn2 SkM-Tg Sesn2 WT Sesn2 SkM-Tg Sesn2 SkM-Tg Imm Sesn2 WT Sesn2 WT Imm 0.0 0.5 1.0 1.5 2.0 0.0 0.5 1.0 1.5 2.0 * pULK1/ULK1 pULK1 5 10 15 20 25 10 20 30 40 mTORC1 signaling EMT UV response Myc targets V1 p53 targets Sesn-regulated genes hallmarks Genes –log10 p value 0 1000 2000 3000 CSA (µm 2 ) 0 1000 2000 3000 CSA (µm 2 ) CSA (µm 2 )CSA (µm 2 ) 0 1000 2000 3000 Basal Basal spermidine 10d imm 10d imm spermidine * ns 0 1 2 3 0 1 2 3 4 0 1 2 3 4 0 1 2 3 0.0 0.5 1.0 1.5 2.0 2.5 0 20 40 60 80 * * kDa 35 35 55 130 130 kDa 35 35 55 130 130 kDa 15 35 kDa 15 35 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 8NATURE COMMUNICATIONS | (2020) 11:189 | https://doi.org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications Methods Animals. The different mouse models used in this study were generated as follows: The skeletal muscle-specific Sesn1 transgenic mouse model (Sesn1SkM-Tg)was generated in C57BL/6 background and carry a transgene coding for human Sesn1 under the control of MCK promoter. The human Sesn1 cDNA sequence (from LV-Sesn119) was subcloned into the pBluescript-MCK plasmid (a kind gift from Markus Rüegg). A 4 kb PacI digestion fragment was excised, microdialyzed, and microinjected into the pronuclei of fertilized mouse eggs (C57BL/6J × C57BL/6J) at the Mouse Mutant Core Facility, Institute for Research in Biomedicine (Barcelona, Spain). Embryos were implanted into pseudo-pregnant foster females (ICR), and transgenic pups were identified. DNA samples from tail clips of subsequent litters were screened by PCR with primers spanning different sequences of MCK promoter and Sesn1 cDNA (Primer set 1 forward CTGCCCCCGGGTCACCACC reverse TCGATTCAGGTCATATAGCGGGT; Primer set 2 forward CAGGGCTTATAC GTGCCTGGGACTC reverse TGTGGGTGGAAAACCATCACTAACG; Primer set 3 forward GCCCCCGGGTCACCACCAAG reverse GGCCAAGCGCATGGATCC TTTTA) that amplified a 1550, 600, and 76 bp fragments, respectively. The transgene was maintained on the C57BL/6J background throughout the study. The skeletal muscle-specific Sesn2 transgenic mouse model (Sesn2SkM-Tg)was generated by crossing mice that express Sesn2 from a Tet-regulated promoter (provided by Dr. M. Karin, UCSD, San Diego, USA) with mice harboring the skeletal muscle-specific MCK-tTA construct (obtained from Dr. M. Ruegg, Biozentrum, Basel, Switzerland). Non-transgenic littermates (that were WT for Sesn1 and Sesn2 expressions) were used as controls for the two transgenic mouse lines, and named Sesn1WT and Sesn2WT mice, respectively. Sesn1 KO mice were provided by Dr. J.H. Lee (University of Michigan, USA) and analyzed in comparison with normal, control WT mice. Atg7SkM-KO mice were generated as previously described32, and FoxO1,3,4SkM-KO mice were obtained by crossing FoxO1/3/4-floxed mice (a kind gift from Dr. M. Sandri, University of Padova, Italy) with the Pax7Cre line (provided by Dr. M. Capecchi, University of Utah, USA). Non-transgenic littermates (that were WT for FoxO1,3,4 and for Atg7 expression) were used as controls for Atg7SkM-KO mice and for FoxO1,3,4SkM-KO mice, and named Atg7WT and FoxO1,3,4WT mice, respectively. Therefore, Sesn1WT, Sesn2WT, WT, Atg7WT, and FoxO1,3,4WT mice are all equally WT, non-transgenic mice, but each one is used as littermate control of each individual genetically modified mouse line. Mice were housed in standard cages under 12 h light/dark cycles with ad libitum access to food and water. All experiments were performed on 4–5-monthold male mice. All animal experiments were approved by the Ethics Committee of the Barcelona Biomedical Research Park (PRBB) and performed according to Catalan and European legislation. Induction of muscle atrophy. The immobilization protocol was performed unilaterally on anesthetized animals as formerly described39. Briefly, the right hindlimb was immobilized with rigid plastic sticks fixed with a medical adhesive bandage. This procedure prevented movement of the immobilized leg alone. Denervation was performed as previously described40. In brief, a 5 mm segment of the sciatic nerve was surgically removed down to the gluteus maximum from the right leg. Mice not subjected to atrophy-promoting conditions were used as controls (Basal). Muscles were removed at 3 or 10 days after atrophy induction and frozen in liquid nitrogen for subsequent analyses. In vivo gene electrotransfer and AAV injection. Expression plasmids used for electrotransfer studies were purified using a Endofree plasmid kit (Qiagen) and dissolved in 0.9% NaCl. 45 min before electrotransfer, muscles were pretreated with hyaluronidase (10 U/muscle). Afterwards, naked plasmids (60 μg DNA) were injected into the tibialis anterior muscle and 10 pulses of 20 ms each were applied to each hindlimb at 175 V/cm and 1 Hz using an electroporator (ECM 830; BTX). Empty vector was used as control. AAV for in vivo expression of Sesn1 and Sesn2 were generated and provided by the Virus Production Unit (UPV, UAB, Barcelona). AAVs were diluted in 0.9% NaCl at 0.25*1013 gc/ml and directly injected into muscles (40 µl/TA and 10 µl/EDL and soleus muscles). AAV-GFP was used as a control. Four days after transduction mice were subjected to the immobilization protocol. Pharmacological treatments. Mice were injected with rapamycin (4 mg/kg body weight) (which induces autophagy) or vehicle (DMSO) intraperitoneally (i.p.) every other day for 2 weeks. Colchicine (which inhibits autophagy) was injected i.p. (0.4 mg/kg*day) 2 days before sacrifice. The proteasome inhibitor Bortezomib (0.1 mg/kg) or vehicle (DMSO) was injected i.p. every other day for 2 weeks. Mice were treated with 3 mM spermidine in drinking water for 2 weeks. Muscle force measurement. Ex vivo force measurements of EDL and soleus muscles was assessed as previously described41. Briefly, mice were sacrificed, and muscles were immediately excised and placed into a dish containing oxygenated Krebs–Henseleit solution. Muscles were mounted vertically in a temperature controlled (30 °C) chamber and immersed in the Krebs–Ringer bicarbonate buffer solution, with 10 mM glucose, also continuously oxygenated. One end of the muscle was linked to a fixed clamp, while the other end was connected to the leverarm of an Aurora Scientific Instruments 300B actuator/transducer system, using a nylon thread. The optimum muscle length (Lo) was determined from micromanipulations of muscle length to produce the maximum isometric twitch force. Maximum isometric-specific tetanic force was determined from the plateau of the curve of the relationship between specific isometric force with a stimulation frequency ranging from 1 to 200 Hz. Force was normalized per muscle area (determined by dividing the muscle mass by the product of longitude and the density of muscle (1.06 mg/mm3)) to calculate the specific force (mN/mm2). Muscle histology and immunohistochemistry. Muscles were embedded in OCT solution (TissueTek), frozen in isopentane cooled with liquid nitrogen and stored at −80 °C until analysis. 10 μm muscle cryosections were collected and stained for hematoxylin/eosin (H/E) or Sirius red (Sigma-Aldrich). For immunohistochemistry assays, muscle cryosections were examined by standard immunohistochemical procedures for the expression of myosin heavy chain (MHC) isoforms. The primary monoclonal antibodies employed were antimyosin I (A4.840), anti-myosin IIA (A4.74), and anti-myosin IIB (BF-F3) (Developmental Studies Hybridoma Bank). Digital images were acquired using the Leica DMR600B microscope equipped with a DFC300FX camera. Fiber type distribution, CSA, and percentage of muscle area positive for Sirius red staining were quantified using Image J software, as previously reported42,43. For myonuclei quantification, muscle sections were immunostained for dystrophin (1/400), the secondary antibody was coupled to Alexa-488 and nuclei were stained with DAPI (Invitrogen). Images were acquired using a Leica TCS SP5 confocal scanning microscope system. Fluorescence microscopy analysis of muscle sections. TA muscles were removed, fixed in PFA 2% for 4 h at 4 °C and incubated with 15% sucrose overnight at 4 °C. Then, muscles were embedded in OCT solution (TissueTek), immediately frozen in liquid nitrogen-cooled isopentane and stored at −80 °C. 10 μm cryosections of TA muscle (which has been transfected with mRFP-GFP-LC344) were analyzed using a Leica TCS SP5 confocal scanning microscope system. Colocalization of RFP-LC3 and GFP-LC3 puncta was determined on the maximum Fig. 4 Autophagy induction via sestrin-mediated mTORC1 blockade prevents atrophy. a Bubble plot showing the main molecular hallmarks (GSEA) enriched in the sestrin-regulated gene set defined in Supplementary Fig. 4a. bWestern blot analysis and quantification of S6 and ULK1 phosphorylation in muscles from Sesn2WT and Sesn2SkM-Tg mice (left) and in muscles transduced with AAV-Sesn1 or AAV-Control (right) in basal conditions and at 3 days post-immobilization. Values were normalized to basal control conditions. cWestern blot analysis and quantification of LC3I and LC3II in TA muscles transduced with AAV-Sesn1 or AAV-Control in basal conditions and at 3 days post-immobilization. Treatment of mice with colchicine or vehicle is indicated. Lower chart shows the fold increase in LC3II content in colchicine-treated versus vehicle-treated mice. dRepresentative confocal images of 3-day-immobilized TA muscle electrotransferred with a tandem mRFP-GFP-LC3 reporter plasmid to enable detection of autophagosomes (yellow puncta) and autolysosomes (red puncta). The chart shows double RFP+GFP+puncta as a percentage of total puncta for the indicated genotypes. Scale bar =5µm. eRepresentative confocal images of non-immobilized muscles in WT and Sesn1KO mice treated as in d. The chart shows RFP+GFP+puncta as a percentage of total puncta. Scale bar =5µm. fMean TA myofiber CSA in basal conditions and at 10 days post-immobilization in muscles transduced with AAV-Control or AAV-Sesn1 and electrotransferred with control short hairpin (sh) or sh targeting TSC2. gMean TA myofiber CSA in basal conditions and at 10 days post-immobilization in WT mice treated with vehicle (top) or rapamycin (bottom). hMean TA myofiber CSA in basal conditions and at 10 days post-immobilization in WT mice treated with vehicle or spermidine. iMean TA myofiber CSA in basal conditions and at 10 days post-immobilization in Atg7WT and Atg7SkM-KO mice transduced with AAV-Control or AAV-hSesn1. All data are shown as mean with SEM. Comparisons by Student's t-test (*p< 0.05 and **p< 0.01 vs. basal). Sample numbers were n=3 mice per group for b,d,e,n=3–5 animals for c,f,g,iand n=4 for h. Source data are provided as a Source Data file. NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-13832-9 ARTICLE NATURE COMMUNICATIONS | (2020) 11:189 | https://doi .org/10.1038/s41467-019-13832-9 | www.nature.com/naturecommunications 9