Co-occurrence of entomopathogenic nematodes and earthworms enhances enduring biocontrol activity and microbial diversity in a naturalized plant-soil system

Perspective Co-occurrence of entomopathogenic nematodes and earthworms enhances enduring biocontrol activity and microbial diversity in a naturalized plant-soil system Maryam Chelkha a,b , Rub´ en Blanco-P´ erez c , David Labarga b , María de Toro d , Jorge Due˜ nas-Hernani b , Kyle Wickings a , Raquel Campos-Herrera b,* a Department of Entomology, Cornell University, Cornell AgriTech, 15 Castle Creek Drive, Geneva 14456, NY, USA b Department of Viticulture, Instituto de Ciencias de la Vid y del Vino (ICVV, CSIC-Gobierno de La Rioja-Universidad de La Rioja), Finca La Grajera, Logro˜ no 26007, Spain c Soils, Biosystems, and Agroforestry Ecology Department, Misi´ on Biol´ ogica de Galicia (BMG-CSIC), Pontevedra 36143, Spain d Genomics &Bioinformatics Core Facility, Center for Biomedical Research of La Rioja (CIBIR), Logro˜ no 26006, Spain HIGHLIGHTS GRAPHICAL ABSTRACT •Entomopathogenic nematodes (EPNs) and earthworms (EW) interaction poorly studied. •Adding EPN +EWs or EPN +cutaneous excreta (CEx) can modulate plant-soil biota system. •EPN virulence was higher in EWs and CEx soils than in control after 30 days. •Bacterial alpha diversity was higher in EPN or EPN +EW/CEx soils after 30 days. •Time revealed to modulate the EPN + EW/CEx interactions in plant-soil systems. ARTICLE INFO Keywords: Eisenia fetida Microbiome High throughput sequencing Solanum lycopersicum Steinernema feltiae Sustainable agriculture ABSTRACT Soil ecosystems host diverse microorganisms and fauna essential for terrestrial processes, with earthworms (EWs) and entomopathogenic nematodes (EPNs) playing crucial roles. EWs enhance soil health by improving aeration, porosity, and nutrient cycling, while EPNs, such as Steinernema and Heterorhabditis, manage pests by killing insects. This study aimed to assess the impact of EWs and their derivatives (cutaneous excreta, CEx), alone or combined with EPNs, on soil–plant dynamics, hypothesizing that their co-occurrence would alter soil properties, bacterial communities, EPN virulence, and plant performance. Using tomato plants and field soil, the study investigated different treatments: control, EW (Eisenia fetida), EPN (Steinernema feltiae), CEx, and combinations of EPN-EW and EPN-CEx, at two and four weeks post-application. Assessments included plant growth, EPN infectivity, soil properties, and bacterial profiling via 16S rRNA gene sequencing. Results showed no significant impact on plant growth. However, EPN virulence decreased after 30 days when applied alone but was maintained or enhanced when combined with EW or CEx. Combined applications of EPNs and CEx reduced Mg and Ca * Corresponding author. E-mail address: [email protected] (R. Campos-Herrera). Contents lists available at ScienceDirect Biological Control journal homepage: www.elsevier.com/locate/ybcon https://doi.org/10.1016/j.biocontrol.2024.105685 Received 26 October 2024; Received in revised form 19 December 2024; Accepted 23 December 2024 Biological Control 200 (2025) 105685 Available online 26 December 2024 1049-9644/© 2024 The Author(s). Published by Elsevier Inc. This is an open access article under the CC BY-NC license ( http://creativecommons.org/licenses/bync/4.0/ ). contents, while organic matter increased in the EPN-EW treatment. Bacterial community changes were observed 30 days post-inoculation, with increased alpha diversity in co-applications of EPNs and EWs. The co-application of EPNs and EWs resulted in beneficial impacts on soil properties, EPN virulence, and bacterial diversity. Timing post-inoculation was crucial in assessing these effects, only detecting those changes after 30 days, suggesting the need for further extended research to understand the duration of these changes. This study highlights the intricate interactions between EWs, EPNs, and plant-soil systems, emphasizing their potential impact on plant growth, soil nutrient dynamics, and soil organisms, highlighting the importance of timing in evaluating these interactions. 1. Introduction Soil, a non-renewable resource, is home to a significant portion of the Earth’s biodiversity (Wall, 2012; Ferreira et al., 2022). Its inhabitants, including archaea, bacteria, oomycetes, fungi, nematodes, mites, springtails, earthworms, snails, vertebrates, and more, interact to provide essential ecosystem functions (Wall, 2012; Delgado-Baquerizo et al., 2020). These functions include maintaining soil structure, regulating hydrological processes, and decomposing organic matter, directly impacting nutrient cycles (Wall, 2012; Delgado-Baquerizo et al., 2020). Furthermore, from an agricultural standpoint, soil biodiversity plays a crucial role in promoting plant growth and aiding in pest and disease control by providing mechanisms to regulate their populations, among other functions (Garbach et al., 2014; Bommarco et al., 2018; F´ elix et al., 2018). Therefore, preserving soil biodiversity is essential for ensuring food security in a rapidly changing world (El Mujtar et al., 2019). Numerous soil organisms improve crop health and yields in varying ways, for example, by limiting damage caused by pests and diseases, enhancing water availability or nutrient intake (Bommarco et al., 2018; F´ elix et al., 2018; El Mujtar et al., 2019). Worldwide distributed earthworms (EWs), for instance, improve soil structure, facilitate organic matter decomposition, and generate organic compounds (in their excreta) that act as plant growth enhancers (Muscolo et al., 1999; Eisenhauer &Scheu, 2008; Wall, 2012; Kos et al., 2017). EWs can also contribute to modulating soil biota and the functions they provide (Byzov et al., 2007; Hoeffner et al., 2018; Buivydait˙ e et al., 2023; Ferlian et al., 2024). For example, their movement can enhance the distribution of other beneficial soil organisms, such as entomopathogenic fungi and nematodes (Shapiro-Ilan and Brown, 2013). EW feeding activity has also been found to contribute to the reduction of plant-parasitic nematode populations (Dash et al., 1980; Boyer et al., 2013), and hence, EWs can play an important role in protecting plant roots from their attack and contributing to securing crop yields. One cryptic but possibly equal important player of EWs is the bacteria associated with the gut and the secretion of cutaneous excreta (CEx). Overall, the EW gut hosts a species-specific microbial community influenced by habitat and environmental conditions (Aira and Domínguez, 2011; G´ omez-Brand´ on et al., 2012). Oxygen and nutrient levels play crucial roles in shaping bacterial composition within the gut compared to adjacent soils, favoring anaerobic and facultative anaerobic bacteria like Proteobacteria, Firmicutes, Bacteroidetes, and Actinobacteria (Horn et al., 2003; Drake and Horn, 2007). Indeed, it was described that the bacterial community in the EW cast differs from the surrounding soils (Sampedro and Whalen, 2007; Aira et al., 2015, Aira et al., 2016), and hence, their long-term presence could drive bacterial composition. In addition, EWs secrete certain substances, such as the CEx, through dorsal pores, which can include urine, coelomic fluid, and mucus, containing even immune cells like coelomocytes with defense functions (Homa et al., 2008; Santocki et al., 2016). Coelomic fluid has been described to exhibit antimicrobial and proteolytic properties, potentially affecting soil organisms upon contact (Dales and Kalaç, 1992; Bilej et al., 1995; Kasschau et al., 2007). In this line, Plavˇ sin et al. (2017) demonstrated that coelomic fluids from certain EW species inhibit the growth of phytopathogenic fungi. Conversely, springtails such as Heteromurus nitidus actively seek CEx from earthworms, suggesting its significance in their habitat (Salmon and Ponge, 2001). Hence, all EW actions (moving and feeding) and their area of influence, the drilosphere, can modulate soil biota and their functions. Similarly, entomopathogenic nematodes (EPNs) are also well-known beneficial soil organisms (Lacey et al., 2015), widespread in natural and agricultural soils (Stuart et al., 2015; Campos-Herrera et al., 2019). EPNs occur in soils as a resistance stage named infective juvenile (IJ), capable of actively locating, penetrating, and releasing symbiotic bacteria (Xenorhabdus for Steinernema and Photorhabdus for Heterorhabditis), in the insect hemocoel (Dillman et al., 2012; Stock, 2015). Inside the insect, both nematodes and bacteria produce by-products responsible for killing the host within 2–3 days (Dowds and Peters, 2002) and reproduce within the cadaver, protected by the emission of specific volatiles and signals to avoid scavenger and saprophytic activity (Gulcu et al., 2012; Blanco-P´ erez et al., 2019). Once the food is depleted, and the signal for overcroding are present, a new cohort of IJs incorporates some bacteria inside and emerges from the cadaver, searching for new hosts (Stock, 2015). In the agricultural context, inoculation of biological control agents (e.g., EPNs) and biofertilizers (e.g., EWs) can contribute to beneficial functions that support increased productivity (Berendsen et al., 2012). However, understanding the complex multitrophic interactions among beneficial soil organisms and their surrounding environment is challenging but crucial to advancing the sustainability of agricultural practices. Regarding EWs and EPNs, limited studies have focused on the study of their interactions in soils. Still, it is known that the cooccurrence of both soil organisms can enhance the EPN dispersal and its virulence against insect pest, even if species-specific (Shapiro et al., 1995; Shapiro-Ilan and Brown, 2013; Chelkha et al., 2021). Some negative impacts have also been found. For example, Campos-Herrera et al. (2006) confirmed the transit of IJs throughout the digestive tract of EWs but with limited survival, and Chelkha et al. (2020) reported reduced EPN virulence and reproductivity after co-occurring with EWs. The CEx produced by EWs might also be relevant since adverse effects on EPN virulence have been reported for some species-specific interactions (Chelkha et al., 2020, 2021; Fattore et al., 2020). However, most of these studies involve laboratory approaches using autoclaved substrates and short time-frames which may limit insights into EW-EPN interactions (Shapiro et al., 1995; Campos-Herrera et al., 2006; Shapiro-Ilan and Brown, 2013; Chelkha et al., 2020, Chelkha et al., 2021). This significant gap might be addressed by exploring EW-EPN co-occurrence within more naturalized and complex systems, such as those involving natural soils with their biota and living plant roots. This study aimed to investigate the impact of the co-occurrence of EWs or their CEx with EPNs on (i) plant performance, (ii) nematode virulence, (iii) soil physical–chemical properties, and (iv) soil microbiota. We hypothesized significant changes in the measurements of these variables but then rapidly reverted to the original conditions. Two postexposure intervals—15 and 30 days—to explore the temporal dynamics were evaluated. The experiments were performed on tomato plants, a well-established model for studying physiological processes and disease impacts (Díaz-Pend´ on et al., 2010; Gilbertson &Batuman, 2013). This choice also holds significant potential for integrating EPN applications into belowand aboveground Integrated Pest Management (IPM) strategies (Batalla-Carrera et al., 2010; Garcia-del-Pino et al., 2013, 2018; M. Chelkha et al. Biological Control 200 (2025) 105685 2 Lahiri and Orr, 2018; Campos-Herrera et al., 2021). In this study, we used natural (no pre-treated or autoclaved) soil from commercial tomato plantations to illustrate the changes in plant growth, soil abiotic properties, and microbiota. We selected bacterial soil community profilling since they play a crucial role in soil microhabitats, contributing significantly to biogeochemical cycles involving carbon, nitrogen, sulfur, and phosphorus (Long et al., 2016) and influencing nutrient absorption by altering root structure or physiology (Vessey, 2003). Overall, using a holistic approach with mesocosms, we expect to unravel the interactions between these beneficial soil organisms (EWs and EPNs) while coapplied to determine whether it is possible to enhance their positive effects without compromising other soil properties or plant development. 2. Materials and methods 2.1. Experimental materials and preparation procedures A Clay Loam texture soil from a commercial tomato crop plantation (Cooperativa El Raso, Calahorra, La Rioja, Spain, 42.3188 N 1.9581 W) with no prior EPN application was collected in 2020 at two different times: April 22nd and May 14th. At each sampling time, approximately 40 kg of soil (0–20 cm depth) was retrieved from random locations, combined in coolers, and stored at 4 ◦C for 2–3 days before experiment procedures. The soil was manually homogenized, removing large rock fragments (>2–5 cm). Its physical–chemical characteristics were: 39 % sand, 30 % silt, 31 % clay, 3.5 % organic matter (OM), C/N ratio of 9, pH 7.6, and electrical conductivity (EC) of 1.01 S/cm (La Grajera Regional Laboratory, La Rioja). Plastic pots (11x11x11 cm) were filled with 700 g of fresh soil from the corresponding mixed soil date and maintained in a growth chamber (22 ◦C, 16L:8D photoperiod, and 60 % Relative Humidity, RH) for two weeks to allow any possible tomato plants and any weed to emerge from the soil seed bank. All emerging plants were manually removed. At this time (T0), 50 g of soil from each pot was saved at −80 ◦C for further analysis of the soil bacterial community (see section 2.4). Two commercial tomato seeds (Solanum lycopersicum—Solanales: Solanaceae—var. Moneymaker) (La Tienda Fito Agrícola, S.L., Castell´ on, Spain) were planted per plot filled with the experimental soil and maintained in the same chamber conditions. Once tomato plants emerged, only one was kept per pot (removing any additional emerging plants if necessary). Before initiating the experiment, the plants were allowed to grow for four weeks and watered every 2–3 days with 50 ml of tap water to reach a vegetative stage (when developing three true leaves). Steinernema feltiae (Rhabditida: Steinernematidae) RM-107 (ITS region, GenBank accession number MW480131) —the predominant EPN species in Europe (Hominick, 2002) and commonly found in natural habitats and crops, also in La Rioja (Campos-Herrera et al., 2007, 2008; Blanco-P´ erez et al., 2022)—was used in this study. Nematodes were cultured at the Institute of Grapevine and Wine Sciences (ICVV, Logro˜ no, Spain) using the last instar of Galleria mellonella (Lepidoptera: Pyralidae) and stored at 14 ◦C until use, with IJs harvested two weeks before each experiment (Blanco-P´ erez et al., 2022). The EW species Eisenia fetida (Haplotaxida: Lumbricidae), a model organism with widespread distribution in soils (Hendrix et al., 2008), was used for this study. Adults of similar size (0.3–0.5 g and length 5.0–5.5 cm) obtained from a commercial source (“O Minhocario”, Pedro Jos´ e Lanza, Lisbon, Portugal) were kept in laboratory conditions at 22–24 ◦C in the dark. Before the start of each experiment, EW were starved for 24 h in autoclaved moistened soil to prevent crosscontamination with their casts (Chelkha et al., 2021). Fresh CEx were obtained by exposing EWs to a petroleum ether-saturated atmosphere (El Harti et al., 2001). The CEx equivalent to same amount of EWs in each experiment was recovered in distilled water to ensure to provide 2 ml per experimental unit (see section 2.2) and kept on ice. For each experiment, fresh CEx and new EW shipment were used. 2.2. Experimental design and treatment application The experiment was divided into two groups (A and B) in a growth chamber, with treatments randomly allocated to each group following a split-plot design (Supplementary data 1,Fig. S1). Treatments (n =8) included: (i) negative control (C), (ii) earthworm (EW), (iii) EW cutaneous excreta (CEx), (iv) entomopathogenic nematodes (EPN), (v) EPN +EW, and (vi) EPN +CEx. In treatments with EWs, three individuals were added per pot. For the CEx treatments, 2 ml (equivalent to the excreta of three EWs) was added per pot and re-inoculated after one week. For EPN treatments, 3000 IJs per pot (equivalent to 25 IJs/cm 2 ) were applied (Shapiro-Ilan et al., 2002). All pots were covered with a fabric net to contain the EWs. Plant and soil evaluations were conducted after two and four weeks (T1 and T2, respectively), with four plants per treatment (two in each block, A and B) (Fig. S1). Experimental growth chamber conditions were 24 ◦C day, 18 ◦C night, under a 16L:8D photoperiod, and 60 % RH. All the pots were watered every 2–3 days with 50 ml of tap water to ensure the same conditions. The experiment was conducted twice with new material, fresh soil (from each of the sampling times), and organism applications. 2.3. Plant response, virulence analysis, earthworm survival, and soil characterizatoin procedures We assessed plant macronutrient contents to measure the plant response, focusing on total Nitrogen content as an indicator of stress and potential nutritional deficiencies. Using a non-destructive optical sensor, Dualex™force A, Scientific (Actylab, Spain), we measured chlorophyll (CLR) and flavonol (FLV) content indices (Cerovica et al., 2012). Measurements were taken in duplicate on each plant’s fourth and fifth leaves. Each plant was carefully removed from the pot, and the soil was gently separated from the roots, mixed with the rest of the bulk soil of each pot, and saved for subsequent analysis. The roots were washed, and the plants were dried at 40 ◦C for one week to obtain their dry weight. Simultaneously, 50 g of mixed soil was collected from each pot and stored at −80 ◦C for bacterial soil community analysis (see section 2.4). Additionally, 200 g of mixed soil from pots with EPN applications were placed in plastic containers and baited with ten G. mellonella larvae to evaluate EPN virulence (Blanco-P´ erez et al., 2022). Containers were kept at 22 ◦C and 60 % RH in darkness for four days. Dead larvae were transferred to White traps (White, 1927) to confirm nematode-induced mortality. Surviving larvae were held for an additional 24 h to assess late mortality. Cadavers were observed every 3–4 days to ensure IJ emergence from larvae. Also, at the end of the experiment, survival of the earthworms in the corresponding treatments were confirmed. Comprehensive soil analyses were conducted only for the four-week post-application (T2). An aliquot of 200 g of the mixed soil from each pot was sieved to 2 mm and analyzed separately for pH (Millennia and Markewitz, 2004), OM % (Walkley and Black, 1934), macro-nutrients (N, P, and K), and oligo-nutrients (Mg, Ca, and Na) (Eurofins Agroambiental SA, ESA25244849). 2.4. Metataxonomical bacterial community analysis: Library preparation For each of the two trials, we independently evaluated three soil samples per treatment (T0, T1, and T2; stored at −80 ◦C) for soil bacterial community analyses. DNA procedures were conducted using the PowerSoil DNA isolation kit (MO BIO Laboratories, San Diego biotech corridor, Carlsbad, CA, USA). First, 0.25 g of each soil sample was placed in a PowerBead tube. Then, following the kit protocol, solution C1 of this kit was added, and the samples were homogenized twice with a highspeed homogenizer (speed 6.0 m/sec, adapter: QuickPrep, time 40sec, Listing matrix A, FastPrep-24™, MP Biomedicals). After that, DNA M. Chelkha et al. Biological Control 200 (2025) 105685 3 extraction was performed as described in the kit and stored at −20 ◦C until their processing for the bacterial soil community characterization. Further DNA analysis were performed at the Center for Biomedical Research of La Rioja (CIBIR, Logro˜ no, La Rioja, Spain). Initial DNA integrity and quantity were assessed by Capillary Gel Electrophoresis (Fragment Analyzer, Genomic DNA Kit, Agilent Technologies) and fluorimetry (Qubit 3.0, dsDNA HS Assay kit, Thermo Fisher Scientific, MA, USA), respectively. NGS libraries were prepared from 12.5 ng of DNA according to the 16S Metagenomic Sequencing Library Preparation protocol (Illumina, n.d.). The primers used amplified the V3-V4 region of the 16S rRNA gene: 16S Amplicon PCR Forward Primer =5 ′ TCG TCGGCAGCAGCGTCAGATGTGTAT AAGAGAGACAGCCTACGGGNGGC WGCAG, and 16S Amplicon PCR Reverse Primer =5 ′ GTCTCGTGGG CTCGGAGATGTGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC. The quality of the libraries was assessed using Fragment Analyzer (dsDNA Reagent Kit, 35–5000 bp, Agilent Technologies). In addition, the DNA concentration was precisely measured with a Qubit 3.0 fluorometer (dsDNA HS Assay kit, Thermo Fisher Scientific, MA, USA). Libraries were then pooled equimolarly and sequenced on an Illumina MiSeq platform employing a 300-cycle paired-end run. For quality assurance, commercial mock communities were incorporated as internal controls in the final sequencing run, including Control Gut (MSA-1006) and Control Soil (MSA-3001) as microbiome standards, processed identically to the other samples. 2.5. Bacterial soil community analysis: Bioinformatic procedures Post-analysis quality assessment was conducted using FastQC v0.11.9 (Babraham Institute, 2023) and MultiQC v1.9 (Ewels et al., 2016). Subsequently, bioinformatic analysis was performed using the Qiime2 v2022.8 pipeline (Bolyen et al., 2019). The Illumina sequencer provided demultiplexed raw sequences, which were then imported into the Qiime2 pipeline and processed using DADA2 (Nearing et al., 2018; Prodan et al., 2020). This process involved several steps: adapter and primer trimming, noise filtering, dereplication, paired-read joining, identification of Amplicon Sequence Variants (ASVs) at 99 % sequencing similarity, and chimera removal. Taxonomic assignment was accomplished using the SILVA database (version 132), pre-trained with the V3-V4 amplification primers used during wet-lab processing at a 70 % confidence level with default parameters. ASVs assigned to chloroplasts or Archaea were excluded from further analysis. Feature and taxonomy tables were generated in “biom”and “tsv”formats for subsequent analysis. Sequence data (raw files) have been uploaded to the GenBank SRA database under accession numbers SAMN41943565-, SAMN41943642 and the BioProject accession number is PRJNA1126460. 2.6. Statistical analysis We employed linear mixed models (LMMs) and generalized linear mixed models (GLMMs) to assess the effect of the treatments (C, EW, CEx, EPN, EPN +EW, and EPN +CEx), time (T1 and T2), and their interaction (all fixed factors) on EPN virulence, plant response (plant dry weight, CLR and FLV indexes), soil properties, bacterial alpha biodiversity indices (Chao1 and Shannon), and ASV detections for specific taxa related to biocontrol (Bacillus, Pseudomonas, and Xenorhabdus). We conducted goodness-of-fit tests to determine the most appropriate distribution for the analyzed variables (Table S1). We controlled for variations within trials by including this variable as a random factor in each model. In the bacterial soil community analysis, the acquired data underwent normalization (Total Sum Scaling, TSS) and the estimation of rarefaction curves, relative abundance, alpha-diversity, and betadiversity using MicrobiomeAnalyst (Dhariwal et al., 2017; Chong et al., 2020; Lu et al., 2023). We used the rarefaction curves to evaluate sample quality. Also, Chao1 richness and Shannon diversity (alphadiversity) were computed. The relationship between bacterial communities was explored through Bray-Curtis metrics (beta-diversity), followed by Permutational Multivariate Analysis of Variance (PERMANOVA) and visualization using Principal Coordinate Analysis (PCoA) plots. Statistical analyses were performed in R version 4.3.0 (R Core Team, 2023). Goodness-of-fit tests were conducted using the fitdistrplus package in R (Delignette-Muller &Dutang, 2015). We ran the GLM and GLMM tests using the lmer and glmer functions, respectively, from the lme4 package (Bates et al., 2015). Post-hoc analyses at P<0.05 significance level were performed using the estimated marginal means (EMMeans) approach with the emmeans function (Lenth, 2023). PERMANOVA was performed using the vegan package. Diversity indexes were represented in PCoAs and boxplots at the ASV level using the ggplot2 package. 3. Results 3.1. Plant response, virulence analysis, earthworm survival, and soil characterizatoin procedures No significant differences were found among treatments for the plant response parameters evaluated (plant dry weight, CLR, and FLV indices) but for the detection time post-applications (Supplementary data 2, Fig. S2 and Table S2). In contrast, EPN virulence decreased significantly 30 days post-inoculations when EPNs were applied alone compared to when they were applied in combination with EWs (Fig. 1). All earthworms survived to the treatments after 30 days exposure (data not shown). Regarding soil properties, we only found significant differences among treatments for the percentage of organic matter and Ca and Mg contents (Fig. 2 and Table 1;Supplementary data 2,Fig. S3). Specifically, OM% was significantly higher for the combination of EPN +EW than control and CEx treatments (Fig. 2A), while Ca and Mg contents were significantly lower for the combination of EPN +CEx compared to control treatments, and for Mg, also compared to CEx and EPN +CEx treatments (Fig. 2B,C). 3.2. Soil bacteria community composition A total of 72 samples (36 from each independent trial) were evaluated since all reached the quality and quantity standards followed in the CIBIR Genomics &Bioinformatics Core Facility. We obtained 13,682,371 sequences after the bioinformatics treatment of the raw sequences (paired-end alignments, quality evaluations, including the removal of chimeric sequences and singletons). The minimum number of sequences per sample was 124,833, and the maximum was 233,177, with a mean of 171,030 and a median of 170,130. We established the minimum number of sequences at 32,565, retaining 2,540,070 (55.9 %) features across 76 samples at the specified sampling depth. We identified 19,174 distinct bacterial ASVs with assigned fragments varying 282–540 bp lengths, averaging 416 ±13 bp. There was minimal variability in the total number of sequences among samples. The rarefaction curves indicated that most samples reached saturation, making them optimal for further analysis (Supplementary data 2,Fig. S4). Finally, the presence of specific bacteria taxa in the genera Bacillus, Pseudomonas, and Xenorhabdus was not affected by any of the treatments evaluated, nor for the detection time post-applications (Supplementary data 2, Fig. S5 and Table S3). 3.3. Soil bacterial diversity We found significant differences in alpha diversity indices, Chao1 and Shannon, among treatments and for their interaction with the detection time post-applications (Fig. 3 and Table 2). Specifically, both indices were significantly lower for CEx applied alone than the control 15 days post-inoculations (Fig. 3). Similar patterns between indices were M. Chelkha et al. Biological Control 200 (2025) 105685 4 also observed 30 days post-applications, with significantly lower values for control treatments and notably higher values for EPNs combined with EWs (Fig. 3). For the PCoAs based on the Bray-Curtis index, although we found similar significances for the investigated factors as for the alpha indices, no clear distinctions in clustering formations of bacterial community composition were observed among treatments or between T1 and T2 (Fig. 4). 4. Discussion This study provided new insights into how co-occurring beneficial soil organisms, such as EWs and EPNs, affect nematode virulence and abiotic and biotic (microbiota) soil characteristics within a complex, naturalized plant-soil system. Additionally, data was collected at two intervals following treatment exposure —15 and 30 days—to ensure a comprehensive analysis. Our findings revealed that, after 30 days, EPN activity and microbial diversity were enhanced when both beneficial organisms co-occur compared to individual treatments or no applications (control treatment). These results suggest a potential long-term indirect benefit to plants, possibly mediated not only by biotic changes but also by abiotic soil characteristics, such as the increase of OM in the EW-EPN treatment. However, in this regard, no significant differences were observed in plant growth-related metrics. Longer-term studies as well as other species combination of EW and EPN may be necessary to identify the possible specific drivers promoting plant health and crop protection affected by the co-occurrence of EPNs and EWs or their CEx. Diverse studies examining the interaction between EPNs and EWs, including their CEx, have shown contrasting results—positive, neutral, or detrimental—depending on the species and experimental setup (Campos-Herrera et al., 2006; Shapiro-Ilan and Brown, 2013; Chelkha et al., 2020, 2021; Fattore et al., 2020). Several studies have employed microcosms (e.g., Petri dishes, tubes, 24-well plates) with autoclaved substrates and short interaction periods to ensure contact between organisms (Campos-Herrera et al., 2006; Chelkha et al., 2020, Chelkha et al., 2021). In contrast, Fattore et al. (2020) conducted a field mesocosm experiment within two cropping systems, revealing that EWs enhanced EPN infection rates, thereby boosting their biocontrol potential against root-feeding pests. This finding aligns with our observations of increased EPN virulence when combined with EWs/CEx after 30 days Fig. 1. Nematode virulence assessed by insect larval mortality 15 and 30 days post-application of entomopathogenic nematodes alone (EPN) or combined with earthworms (EPN +EW) or EW cutaneous excreta (EPN +CEx). Asterisks represent statistically significant differences for MIXED model tests at ** P<0.01 and * P <0.05. Different letters indicate statistically significant differences (P<0.05) for pairwise comparisons within treatments. Fig. 2. Impact of the evaluated treatments on the soil properties (A) percentage of organic matter (OM) and nutrient contents of (B) Ca and (C) Mg, measured 30 days post-applications. Treatments: control (C), earthworm (EW), EW cutaneous excreta (CEx), entomopathogenic nematodes (EPN), and the combinations EPN +EW and EPN +CEx. Different letters indicate statistically significant differences (P<0.05) for pairwise comparisons within treatments. Statistical analysis details can be found in Table 1. Table 1 Summary of results from MIXED models testing for the effects of the evaluated treatments on soil properties. Asterisks represent statistically significant differences within treatments at ** P<0.01; n.s., not significant. Values are represented in Fig. 2 and Fig. S3. Treatments Soil Variables χ 2 5 P pH 3,55 n.s. OM 15,90 ** N 2,07 n.s. P 7,03 n.s. K 1,02 n.s. Ca 16.82 ** Mg 19,92 ** Na 6,61 n.s. M. Chelkha et al. Biological Control 200 (2025) 105685 5 post-exposure. This positive interaction might be attributed to EWs’ ability to mix the soil, as Shapiro-Ilan and Brown (2013) described. However, Fattore et al. (2020) also reported that EPNs avoided plants watered with CEx, possibly due to adverse effects on their fitness (Chelkha et al., 2020, Chelkha et al., 2021). Conversely, we observed high EPN virulence maintenance after 30 days post-exposure to EWs or their CEx compared with the reduction in the EPN-alone control in a complex system, as Fattore et al. (2020) designed. The natural soil likely buffered the negative impact on EPN virulence in direct exposure experiments (Chelkha et al., 2020, 2021; Fattore et al., 2020). Soil properties like OM and clay content can interact with organic compounds (Lehmann and Kleber, 2015). A recent study indicated that EW-CEx comprises proteins, amino acids, carbohydrates, fatty acids, polysaccharides, alcohol, phenol, and ester organic substances (Huan et al., 2023). All these compounds interact with the soil fraction and biota when performing different functions (Tiedje et al., 1999; Kasschau et al., 2007; Homa et al., 2008; Lehmann and Kleber, 2015; Santocki et al., 2016), potentially modifying their impact on EPNs. Therefore, differences in soil biotic and abiotic composition might explain the discrepancies between our findings and those of previous studies (Chelkha et al., 2020, 2021; Fattore et al., 2020). Hence, additional studies, including different types of soil (texture, organic matter percentage, etc.) derived from other crops with potentially varying soil biota, are necessary to extend our observations to a more general application. Similarly, EWs can significantly alter other soil biota in diverse soil biomes (e.g., drilosphere, rhizosphere, bulk soil) through their movement and feeding activities (Aira et al., 2015, 2016; Wang et al., 2017; Hoeffner et al., 2018; Medina-Sauza et al., 2019, Medina-Sauza et al., 2023). However, although EW feeding can, for instance, decrease bacterial soil diversity after passing through their gut, this effect depends on soil type (Koubov´ a et al., 2015). Our results noted a slight decrease in bacterial alpha diversity in the EWs treatments after 15 days postexposure, but it did not persist beyond 30 days. Furthermore, Aira et al. (2016) found that EWs can modulate the bacterial composition of a substrate, suggesting that EWs select and build their cast microbiome from ingested bacteria. Time is a critical factor in this process, as seen in vermicomposting systems where bacterial diversity initially increases but later declines in mature vermicomposts (Vivas et al., 2009). Specifically, Gopal et al. (2017) observed an increase in alpha diversity until the 75th day, followed by a decline after the 105th day in mature vermicompost. Our findings are consistent with these observations, particularly for the co-occurrence of EPNs and EWs, which exhibited Fig. 3. Alpha diversity indexes (A) Chao1 and (B) Shannon for bacterial soil community analyses 15 and 30 days post-applications. Treatments: control (C), earthworm (EW), EW cutaneous excreta (CEx), entomopathogenic nematodes (EPN), and the combinations EPN +EW) and EPN +CEx. Different letters indicate statistically significant differences (P<0.05) for pairwise comparisons within treatments. Statistical analysis details can be found in Table 2. Table 2 Summary of results from MIXED models testing for the effects of the evaluated treatments on bacterial alpha biodiversity at 15 and 30 days post-application. Asterisks represent statistically significant differences within treatments at ** P<0.01 and *** P<0.001; n.s., not significant. Values are represented in Fig. 3. Treatments (Tx) Time Tx * Time Diversity index χ 2 df P χ 2 df P χ 2 df P Chao1 42.87 5 *** 0.42 1 n. s. 29.26 5 *** Shannon 17.71 5 ** >0.01 1 n. s. 18.71 5 ** Fig. 4. Principal component analysis for the bacterial beta diversity displaying groups of association by (A) treatments: control (C), earthworm (EW), EW cutaneous excreta (CEx), entomopathogenic nematodes (EPN), and the combinations EPN +EW) and EPN +CEx; and (B) time (15 and 30 days postapplication). Asterisks represent statistically significant differences at *** P <0.001; n.s., not significant. M. Chelkha et al. Biological Control 200 (2025) 105685 6 increased bacterial alpha diversity 30 days post-application. However, we understand that the length of the study was a limitation since 2 and 4 weeks seem to be too short to detect those interactions. Hence, extending the duration of our study may have revealed the point at which bacterial diversity begins to decline and, thus, a deeper understanding of the changes within the soil-microbiota-plant system. While our study sheds light on the impact of EPN application on the soil bacterial community, there is still much to be investigated (de Nardo et al., 2006; Li et al., 2024), notably for interactions with other soil organisms such as EWs. We found that 15 days post-EPN application, there were no significant changes in the soil bacterial community. This finding is consistent with Li et al. (2024) for bacterial community, but also noted changes in the fungal community associated with EPN occurrence. Consequently, future research should include fungal diversity when examining the combined effects of EPNs and EWs/CEx to provide a more comprehensive understanding of ecosystem dynamics. However, we observed increased bacterial soil diversity after 30 days, suggesting that these changes require a longer time frame. This effect, in any case, disagrees with de Nardo et al. (2006), who reported no increase in soil microbial biomass, respiration, or nitrogen pools 64 days post-application of the EPN species Steinernema carpocapsae. Besides differences in soil types and EPN species involved (S. carpocapsae vs. S. feltiae) or, for instance, the presence of tomato roots in our system, the discrepancies might be attributed to the indirect measurement methods used by de Nardo et al. (2006) as opposed to the molecular approach based on HTS in our study. Notably, we observed differences in the bacterial alpha diversity between T0 (soil sampled before planting the tomato seeds and applying any treatment and excluded from the analysis to observe treatment effects) and post-treatment times (T1 and T2). Regarding the target genera of interest in biocontrol —Pseudomonas, Bacillus, and Xenorhabdus (Lacey et al., 2015; Vicente-Díez et al., 2023)—we did not observe differences among treatments, even those including EPNs hosting the bacterium Xenorhabdus. It is important to note that the soil bacteria analysis was performed on 0.25 g of bulk soil from each treatment. While this approach was necessary for our study, it could have reduced the likelihood of taking a representative sample for EPN-associated bacteria. Future research should consider larger or more representative soil samples to understand better the interactions between EPNs, their associated bacteria, and the soil microbial community. Besides preserving EPN virulence and increasing bacterial alpha diversity, the EPN-EW interactions in our study had minimal effects on plant parameters and only in specific treatments for certain soil properties. Since plant roots absorb nitrogen and other essential macronutrients supporting chlorophyll production and other vital processes (Wall, 2012; Fathi, 2022; Hussain Shah et al., 2024), we expected the treatments to affect plant traits. We employed the novel, non-destructive Dualex™approach to measure plant growth and development over time, specifically after 2 and 4 weeks. This system consists of a precise optical technique to assess nitrogen levels that uses specific UV excitation beams for flavonoids and chlorophyll (Tremblay et al., 2010, 2012; Overbeck et al., 2018). Congruent with Becagli et al. (2021), we reported decreased chlorophyll levels over time, but no significant treatment effects. However, some studies found opposite patterns, for example, increased chlorophyll levels over time when evaluating the use of vermicompost as an organic fertilizer (Jankauskien˙ e et al., 2022) or specific bacteria associated with EWs (Banerjee et al., 2019). This difference can be attributed to the extremely different conditions between soil under active vermicomposting action (with a high density of EWs) and natural soil, as investigated herein. Conflicting findings in this respect highlight the dependence of EW-plant interactions on multiple aspects, such as soil type, species involved, and associated biota. On the other hand, flavonol contents in leaves and overall plant growth (e.g., dry weight) increased over time without significant differences among treatments. Since Zhang et al. (2009) showed that CEx significantly promotes tomato seedling growth, the lack of differences in our study might be due to variations in tomato cultivars, soil type, and specific CEx compositions of diverse E. fetida populations. Further studies, mainly in long-term research, are needed to identify the critical drivers related to the effect of EWs and their derivatives on plant growth. Regarding EPNplant root interactions, previous studies have shown that plant root architecture (Dermata et al., 2014) and chemical cues from root-herbivore attacks (Rasmann et al., 2005; Turlings et al., 2012) influence EPN occurrence and behavior. Our study found no effect on chlorophyll and flavonol contents and plant growth after one month of EPN exposure. However, since only one study (Helms et al., 2019) has also directly explored the impact of EPNs on plant growth and defenses, more research is needed to understand EPN-plant interactions in soils. Our study reported only significant variation in plant nutrient availability in specific parameters, increasing OM in the EPN-EW treatment and decreasing Ca and Mg in the EPN-CEx treatment. These results contrast with the well-documented ability of EWs to improve soil fertility and provide essential nutrients such as N, K, and Ca (Lavelle et al., 2016; Medina-Sauza et al., 2023). One plausible explanation for this discrepancy is that the experiment may require additional time to produce measurable changes in soil properties (van der Heijden et al., 2008). As observed for the soil bacterial community, significant differences among the treatments became apparent only after 30 days in our study. Therefore, we suggest conducting further studies with extended observation periods of 3–6 months to comprehensively assess the impact of the evaluated treatments on soil properties. Achieving the goals for sustainable agriculture, as outlined by the UN and supported by initiatives like the European Green Deal (European Commission, 2020), requires developing new biotools to replace chemical fertilizers and pesticides. A comprehensive understanding of the interactions between beneficial organisms, soil, and crops is essential for gaining public confidence and encouraging the adoption of these biotechnologies. This study showed that interactions between beneficial soil organisms, such as EPNs and EWs, are complex, time-dependent, and species-specific. Further research is needed to fill knowledge gaps, incorporating different augmented EWs and EPN species, soil types, target soil organisms (bacteria, fungi, microarthropods, nematodes, etc.), crops, and environments. CRediT authorship contribution statement Maryam Chelkha: Writing –original draft, Methodology, Investigation, Formal analysis, Conceptualization. Rub´ en Blanco-P´ erez: Writing –review &editing, Investigation, Formal analysis. David Labarga: Writing –review &editing, Formal analysis. María de Toro: Writing –review &editing, Formal analysis, Conceptualization. Jorge Due˜ nas-Hernani: Writing –review &editing, Methodology. Kyle Wickings: Writing –review &editing. Raquel Campos-Herrera: Writing –review &editing, Supervision, Funding acquisition, Formal analysis, Conceptualization. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments We want to thank the technicians at Cooperativa El Raso from Calahorra (La Rioja, Spain) for their assistance in locating a suitable field with tomatoes for the experiment. MC was supported by Vocational Training, Higher Education and Scientific Research, and the travel assistance associated with the grant CSIC I-COOP+2018 grant (COOPA20231). RBP was financed with a Juan de la Cierva contract JDC2022-048978-I funded by MCIN/AEI/ 10.13039/501100011033 and by “European Union NextGenerationEU/PRTR”. DL was supported M. Chelkha et al. Biological Control 200 (2025) 105685 7 by an FPI-UR/CAR 2022 fellowship from the Universidad de La Rioja (Spain). JDH is supported by the Programa Investigo from the Government of La Rioja and the “European Union NextGenerationEU/PRTR. This study was supported by the CSIC I-COOP+2018 grant (COOPA20231) and the Instituto de Estudios Riojanos grant (Resolution N◦18/2020). This study forms part of the AGROALNEXT program and was supported by MCIN with funding from European Union NextGenerationEU (PRTR-C17.I1). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi. org/10.1016/j.biocontrol.2024.105685. References Aira, M., Bybee, S., P´ erez-Losada, M., Domínguez, J., 2015. Feeding on microbiomes: Effects of detritivory on the taxonomic and phylogenetic bacterial composition of animal manures. FEMS Microbiol. Ecol. 91, 117. https://doi.org/10.1093/femsec/ fiv117. Aira, M., Domínguez, J., 2011. Earthworm effects without earthworms: Inoculation of raw organic matter with worm-worked substrates alters microbial community functioning. PLoS One 6, e16354. https://doi.org/10.1371/journal.pone.0016354. Aira, M., Olcina, J., P´ erez-Losada, M., Domínguez, J., 2016. Characterization of the bacterial communities of casts from Eisenia andrei fed with different substrates. Appl. Soil Ecol. 98, 103–111. https://doi.org/10.1016/j.apsoil.2015.10.002. Banerjee, A., Biswas, J.K., Pant, D., Sarkar, B., Chaudhuri, P., Rai, M., Meers, E., 2019. Enteric bacteria from the earthworm (Metaphire posthuma) promote plant growth and remediate toxic trace elements. J. Environ. Manage. 250, 109530. https://doi. org/10.1016/j.jenvman.2019.109530. Batalla-Carrera, L., Morton, A., García-del-Pino, F., 2010. Efficacy of entomopathogenic nematodes against the tomato leafminer Tuta absoluta in laboratory and greenhouse conditions. BioControl 55, 523–530. https://doi.org/10.1007/s10526-010-9284-z. Bates, D., M¨ achler, M., Bolker, B.M., Walker, S.C., 2015. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48. https://doi.org/10.18637/JSS.V067. I01. Becagli, M., Guglielminetti, L., Cardelli, R., 2021. Effects of combined biochar and vermicompost solution on leachate characterization and nitrogen balance from a greenhouse tomato (Solanum Lycopersicum) cultivation soil. Comm. Soil Sci. Plant Anal. 52, 1879–1893. https://doi.org/10.1080/00103624.2021.1900225. Berendsen, R.L., Pieterse, C.M.J., Bakker, P.A.H.M., 2012. The rhizosphere microbiome and plant health. Trends Plant Sci. 17, 478–486. https://doi.org/10.1016/j. tplants.2012.04.001. Bilej, M., Brys, L., Beschin, A., Lucas, R., Vercauteren, E., Hanuˇ sov´ a, R., De Baetselier, P., 1995. Identification of a cytolytic protein in the coelomic fluid of Eisenia foetida earthworms. Immunol. Lett. 45, 123–128. https://doi.org/10.1016/0165-2478(94) 00248-P. Blanco-P´ erez, R., Bueno-Pallero, F.´ A., Vicente-Díez, I., Marco-Manceb´ on, V.S., P´ erezMoreno, I., Campos-Herrera, R., 2019. Scavenging behavior and interspecific competition decrease offspring fitness of the entomopathogenic nematode Steinernema feltiae. J. Invertebr. Pathol. 164, 5–15. https://doi.org/10.1016/j. jip.2019.04.002. Blanco-P´ erez, R., Vicente-Díez, I., Ramos-S´ aez de Ojer, J.L., Marco-Manceb´ on, V.S., P´ erez-Moreno, I., Campos-Herrera, R., 2022. Organic viticulture enhanced the activity of native entomopathogenic nematodes in DOCa Rioja soils (North of Spain). Agr. Ecosyst. Environ. 332, 107931. https://doi.org/10.1016/j.agee.2022.107931. Bolyen, E., Rideout, J.R., Dillon, M.R., Bokulich, N.A., Abnet, C.C., Al-Ghalith, G.A., Alexander, H., Alm, E.J., Arumugam, M., Asnicar, F., Bai, Y., Bisanz, J.E., Bittinger, K., Brejnrod, A., Brislawn, C.J., Brown, C.T., Callahan, B.J., CaraballoRodríguez, A.M., Chase, J., Cope, E.K., Da Silva, R., Diener, C., Dorrestein, P.C., Douglas, G.M., Durall, D.M., Duvallet, C., Edwardson, C.F., Ernst, M., Estaki, M., Fouquier, J., Gauglitz, J.M., Gibbons, S.M., Gibson, D.L., Gonzalez, A., Gorlick, K., Guo, J., Hillmann, B., Holmes, S., Holste, H., Huttenhower, C., Huttley, G.A., Janssen, S., Jarmusch, A.K., Jiang, L., Kaehler, B.D., Kang, K.B., Keefe, C.R., Keim, P., Kelley, S.T., Knights, D., Koester, I., Kosciolek, T., Kreps, J., Langille, M.G.I., Lee, J., Ley, R., Liu, Y.X., Loftfield, E., Lozupone, C., Maher, M., Marotz, C., Martin, B.D., McDonald, D., McIver, L.J., Melnik, A.V., Metcalf, J.L., Morgan, S.C., Morton, J.T., Naimey, A.T., Navas-Molina, J.A., Nothias, L.F., Orchanian, S.B., Pearson, T., Peoples, S.L., Petras, D., Preuss, M.L., Pruesse, E., Rasmussen, L.B., Rivers, A., Robeson, M.S., Rosenthal, P., Segata, N., Shaffer, M., Shiffer, A., Sinha, R., Song, S.J., Spear, J.R., Swafford, A.D., Thompson, L.R., Torres, P.J., Trinh, P., Tripathi, A., Turnbaugh, P.J., Ul-Hasan, S., van der Hooft, J.J.J., Vargas, F., V´ azquez-Baeza, Y., Vogtmann, E., von Hippel, M., Walters, W., Wan, Y., Wang, M., Warren, J., Weber, K. C., Williamson, C.H.D., Willis, A.D., Xu, Z.Z., Zaneveld, J.R., Zhang, Y., Zhu, Q., Knight, R., Caporaso, J.G., 2019. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 37, 852–857. https://doi. org/10.1038/s41587-019-0209-9. Bommarco, R., Vico, G., Hallin, S., 2018. Exploiting ecosystem services in agriculture for increased food security. Glob. Food Sec. 17, 57–63. https://doi.org/10.1016/j. gfs.2018.04.001. Boyer, J., Reversat, G., Lavelle, P., Chabanne, A., 2013. Interactions between earthworms and plant-parasitic nematodes. Eur. J. Soil Biol. 59, 43–47. https://doi.org/10.1016/ j.ejsobi.2013.10.004. Buivydait˙ e, ˇ Z., Lilja, M.A., Sapkota, R., Hansen, B.W., Ellegaard-Jensen, L., Hendriksen, N.B., Krogh, P.H., Winding, A., 2023. Earthworms shape prokaryotic communities and affect extracellular enzyme activities in agricultural soil. Eur. J. Soil Biol. 115, 103474. https://doi.org/10.1016/j.ejsobi.2023.103474. Byzov, B.A., Khomyakov, N.V., Kharin, S.A., Kurakov, A.V., 2007. Fate of soil bacteria and fungi in the gut of earthworms. Eur. J. Soil Biol. 43, 149–156. https://doi.org/ 10.1016/j.ejsobi.2007.08.012. Campos-Herrera, R., Trigo, D., Guti´ errez, C., 2006. Phoresy of the entomopathogenic nematode Steinernema feltiae by the earthworm Eisenia fetida. J. Invertebr. Pathol. 92, 50–54. https://doi.org/10.1016/j.jip.2006.01.007. Campos-Herrera, R., Escuer, M., Labrador, S., Robertson, L., Barrios, L., Guti´ errez, C., 2007. Distribution of the entomopathogenic nematodes from La Rioja (Northern Spain). J. Invertebr. Pathol. 95, 125–139. https://doi.org/10.1016/j. jip.2007.02.003. Campos-Herrera, R., G´ omez-Ros, J.M., Escuer, M., Cuadra, L., Barrios, L., Guti´ errez, C., 2008. Diversity, occurrence, and life characteristics of natural entomopathogenic nematode populations from La Rioja (Northern Spain) under different agricultural management and their relationships with soil factors. Soil Biol. Biochem. 40, 1474–1484. https://doi.org/10.1016/j.soilbio.2008.01.002. Campos-Herrera, R., Blanco-P´ erez, R., Bueno-Pallero, F.´ A., Duarte, A., Nolasco, G., Sommer, R.J., Rodríguez Martín, J.A., 2019. Vegetation drives assemblages of entomopathogenic nematodes and other soil organisms: evidence from the Algarve, Portugal. Soil Biol. Biochem. 128, 150–163. https://doi.org/10.1016/j. soilbio.2018.10.019. Campos-Herrera, R., Vicente-Díez, I., Galeano, M., Chelkha, M., del Mar Gonz´ alezTrujillo, M., Puelles, M., Labarga, D., Pou, A., Calvo, J., Belda, J.E., 2021. Intraspecific virulence of entomopathogenic nematodes against the pests Frankliniella occidentalis (Thysanoptera: Thripidae) and Tuta absoluta (Lepidoptera: Gelechiidae). J. Nematol. 53, 1–14. https://doi.org/10.21307/jofnem-2021-102. Cerovica, Z.G., Masdoumier, G., Ghozlen, N.B., Latouche, G., 2012. A new optical leafclip meter for simultaneous non-destructive assessment of leaf chlorophyll and epidermal flavonoids. Physiol. Plant. 146, 251–260. https://doi.org/10.1111/ j.1399-3054.2012.01639.x. Chelkha, M., Blanco-P´ erez, R., Bueno-Pallero, F.´ A., Amghar, S., El Harti, A., CamposHerrera, R., 2020. Cutaneous excreta of the earthworm Eisenia fetida (Haplotaxida: Lumbricidae) might hinder the biological control performance of entomopathogenic nematodes. Soil Biol. Biochem. 141, 107691. https://doi.org/10.1016/j. soilbio.2019.107691. Chelkha, M., Blanco-P´ erez, R., Vicente-Díez, I., Bueno-Pallero, F.´ A., Amghar, S., El Harti, A., Campos-Herrera, R., 2021. Earthworms and their cutaneous excreta can modify the virulence and reproductive capability of entomopathogenic nematodes and fungi. J. Invertebr. Pathol. 184, 107620. https://doi.org/10.1016/j. jip.2021.107620. Chong, J., Liu, P., Zhou, G., Xia, J., 2020. Using MicrobiomeAnalyst for comprehensive statistical, functional, and meta-analysis of microbiome data. Nat. Protoc. 15, 799–821. https://doi.org/10.1038/s41596-019-0264-1. Dales, R.P., Kalaç, Y., 1992. Phagocytic defence by the earthworm Eisenia foetida against certain pathogenic bacteria. Comp. Biochem. Physiol. A Physiol. 101, 487–490. https://doi.org/10.1016/0300-9629(92)90499-G. Dash, M.C., Senapati, B.K., Mishra, C.C., 1980. Nematode feeding by tropical earthworms. Oikos 322–325. De Nardo, E.A.B., Grewal, P.S., McCartney, D., Stinner, B.R., 2006. Non-target effects of entomopathogenic nematodes on soil microbial community and nutrient cycling processes: a microcosm study. Appl. Soil Ecol. 34, 250–257. https://doi.org/ 10.1016/j.apsoil.2006.01.004. Delgado-Baquerizo, M., Reich, P.B., Trivedi, C., Eldridge, D.J., Abades, S., Alfaro, F.D., Bastida, F., Berhe, A.A., Cutler, N.A., Gallardo, A., García-Vel´ azquez, L., Hart, S.C., Hayes, P.E., He, J.Z., Hseu, Z.Y., Hu, H.W., Kirchmair, M., Neuhauser, S., P´ erez, C.A., Reed, S.C., Santos, F., Sullivan, B.W., Trivedi, P., Wang, J.T., Weber-Grullon, L., Williams, M.A., Singh, B.K., 2020. Multiple elements of soil biodiversity drive ecosystem functions across biomes. Nat. Ecol. Evol. 4, 210–220. https://doi.org/ 10.1038/s41559-019-1084-y. Delignette-Muller, M.L., Dutang, C., 2015. fitdistrplus: an R package for fitting distributions. J. Stat. Softw. 64 (4), 1–34. https://doi.org/10.18637/jss.v064.i04. Dermata, L., Hibbard, B.E., Bohn, M.O., Hiltpold, I., 2014. The role of root architecture in foraging behavior of entomopathogenic nematodes. J. Invertebr. Pathol. 122, 32–39. https://doi.org/10.1016/j.jip.2014.08.002. Dhariwal, A., Chong, J., Habib, S., King, I.L., Agellon, L.B., Xia, J., 2017. MicrobiomeAnalyst: A web-based tool for comprehensive statistical, visual and meta-analysis of microbiome data. Nucleic Acids Res. 45, 180–188. https://doi.org/ 10.1093/nar/gkx295. Díaz-Pend´ on, J.A., Ca˜ nizares, M.C., Moriones, E., Bejarano, E.R., Czosnek, H., NavasCastillo, J., 2010. Tomato yellow leaf curl viruses: M´ enage ` a trois between the virus complex, the plant and the whitefly vector. Mol. Plant Pathol 11, 441–450. https:// doi.org/10.1111/j.1364-3703.2010.00618.x. Dillman, A.R., Chaston, J.M., Adams, B.J., Ciche, T.A., Goodrich-Blair, H., Stock, S.P., Sternberg, P.W., 2012. An entomopathogenic nematode by any other name. PLoS Pathog. 8, e1002527. https://doi.org/10.1371/journal.ppat.1002527. Dowds, B.C.A., Peters, A., 2002. Virulence mechanisms. In: Entomopathogenic Nematology. CABI Publishing, Wallingford UK, pp. 79–98. https://doi.org/10.1079/ 9780851995670.0079. M. Chelkha et al. Biological Control 200 (2025) 105685 8 Drake, H.L., Horn, M.A., 2007. As the worm turns: The earthworm gut as a transient habitat for soil microbial biomes. Revue Microbiol. 61, 169–189. https://doi.org/ 10.1146/annurev.micro.61.080706.093139. Eisenhauer, N., Scheu, S., 2008. Earthworms as drivers of the competition between grasses and legumes. Soil Biol. Biochem. 40, 2650–2659. https://doi.org/10.1016/j. soilbio.2008.07.010. El Harti, A., Saghi, M., Molina, J.A.E., Teller, G., 2001. Production d’une substance rhizog` ene ` a effet similaire ` a celui de l’acide indole ac´ etique par le ver de terre Lumbricus terrestris. Can. J. Zool. 79, 1911–1920. https://doi.org/10.1139/cjz-79-111911. El Mujtar, V., Mu˜ noz, N., Cormick, P.M., Pulleman, M., Tittonell, P., 2019. Role and management of soil biodiversity for food security and nutrition; where do we stand? Glob. Food Sec. 20, 132–144. https://doi.org/10.1016/j.gfs.2019.01.007. European Commission, 2020. Communication from the Commission to the European Parliament, the Council, the European Economic and Social Committee and the Committee of the Regions. A Farm to Fork Strategy for a Fair, Healthy and Environmentally-Friendly. European Commission food system COM/2020/381 final. Ewels, P., Magnusson, M., Lundin, S., K¨ aller, M., 2016. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32, 3047–3048. Fathi, A., 2022. Role of nitrogen (N) in plant growth, photosynthesis pigments, and N use efficiency: a review. Agric. Sostenible 28, 1–8. Fattore, S., Xiao, Z., Godschalx, A.L., R¨ oder, G., Turlings, T.C.J., Le Bayon, R.C., Rasmann, S., 2020. Bioturbation by endogeic earthworms facilitates entomopathogenic nematode movement toward herbivore-damaged maize roots. Sci. Rep. 10, 21316. https://doi.org/10.1038/s41598-020-78307-0. F´ elix, G.F., Scholberg, J.M.S., Clermont-Dauphin, C., Cournac, L., Tittonell, P., 2018. Enhancing agroecosystem productivity with woody perennials in semi-arid West Africa. A meta-analysis. Agron. Sustainable Develop. 38, 57. https://doi.org/ 10.1007/s13593-018-0533-3. Ferlian, O., Goldmann, K., Bonkowski, M., Dumack, K., Wubet, T., Eisenhauer, N., 2024. Invasive earthworms shift soil microbial community structure in northern North American forest ecosystems. Iscience 27. https://doi.org/10.1016/j. isci.2024.108889. Ferreira, C.S.S., Seifollahi-Aghmiuni, S., Destouni, G., Ghajarnia, N., Kalantari, Z., 2022. Soil degradation in the European Mediterranean region: Processes, status and consequences. Sci. Total Environ. 805, 150106. https://doi.org/10.1016/j. scitotenv.2021.150106. Garbach, K., Milder, J.C., Montenegro, M., Karp, D.S., DeClerck, F.A.J., 2014. Biodiversity and Ecosystem Services in Agroecosystems. Encyclopedia of Agriculture and Food Systems. 2, 21–40. https://doi.org/10.1016/B978-0-444-52512-3.000139. Garcia-del-Pino, F., Alabern, X., Morton, A., 2013. Efficacy of soil treatments of entomopathogenic nematodes against the larvae, pupae and adults of Tuta absoluta and their interaction with the insecticides used against this insect. BioControl 58, 723–731. https://doi.org/10.1007/s10526-013-9525-z. Gilbertson, R.L., Batuman, O., 2013. Emerging viral and other diseases of processing tomatoes: biology, diagnosis and management. In XII International Symposium on the Processing Tomato. 971, 35–48. doi: 10.17660/ActaHortic.2013.971.2. G´ omez-Brand´ on, M., Lores, M., Domínguez, J., 2012. Species-specific effects of epigeic earthworms on microbial community structure during first stages of decomposition of organic matter. PLoS One 7, e31895. https://doi.org/10.1371/journal. pone.0031895. Gopal, M., Bhute, S.S., Gupta, A., Prabhu, S.R., Thomas, G.V., Whitman, W.B., Jangid, K., 2017. Changes in structure and function of bacterial communities during coconut leaf vermicomposting. Anton. Leeuw. Int. J. Gen. Mol. Microbiol. 110, 1339–1355. https://doi.org/10.1007/s10482-017-0894-7. Gulcu, B., Hazir, S., Kaya, H.K., 2012. Scavenger deterrent factor (SDF) from symbiotic bacteria of entomopathogenic nematodes. J. Invertebr. Pathol. 110, 326–333. https://doi.org/10.1016/j.jip.2012.03.014. Helms, A.M., Ray, S., Matulis, N.L., Kuzemchak, M.C., Grisales, W., Tooker, J.F., Ali, J.G., 2019. Chemical cues linked to risk: Cues from below-ground natural enemies enhance plant defences and influence herbivore behaviour and performance. Funct. Ecol. 33, 798–808. https://doi.org/10.1111/1365-2435.13297. Hendrix, P.F., Callaham Jr., M.A., Drake, J.M., Huang, C.Y., James, S.W., Snyder, B.A., Zhang, W., 2008. Pandora’s box contained bait: the global problem of introduced earthworms. Annu. Rev. Ecol. Evol. Syst. 39, 593–613. https://doi.org/10.1146/ annurev.ecolsys.39.110707.173426. Hoeffner, K., Monard, C., Santonja, M., Cluzeau, D., 2018. Feeding behaviour of epianecic earthworm species and their impacts on soil microbial communities. Soil Biol. Biochem. 125, 1–9. https://doi.org/10.1016/j.soilbio.2018.06.017. Homa, J., Bzowska, M., Klimek, M., Plytycz, B., 2008. Flow cytometric quantification of proliferating coelomocytes non-invasively retrieved from the earthworm, Dendrobaena Veneta. Develop. Comp. Immunol. 32, 9–14. https://doi.org/10.1016/ j.dci.2007.04.007. Hominick, W.M., 2002. Biogeography. In: Entomopathogenic Nematology. CABI, Wallingford, UK. doi: 10.1079/9780851995670.0035. Horn, M.A., Schramm, A., Drake, H.L., 2003. The earthworm gut: An ideal habitat for ingested N2O-producing microorganisms. Appl. Environ. Microbiol. 69, 1662–1669. https://doi.org/10.1128/AEM.69.3.1662-1669.2003. Huan, H., Wang, X., Chu, Z., Yu, X., Fan, T., Li, G., Xu, X., Zhen, Q., Sun, L., Dong, Z., Zha, S., 2023. Compositional changes and ecological characteristics of earthworm mucus under different electrical stimuli. Sci. Rep. 13, 2332. https://doi.org/ 10.1038/s41598-023-29125-7. Jankauskien˙ e, J., Lauˇ zik˙ e, K., Kavaliauskait˙ e, D., 2022. Effects of vermicompost on quality and physiological parameters of cucumber (Cucumis sativus L.) seedlings and plant productivity. Horticulturae. 8, 1009. https://doi.org/10.3390/ horticulturae8111009. Kasschau, M.R., Ngo, T.D., Sperber, L.M., Tran, K.L., 2007. Formation of filopodia in earthworm (Lumbricus terrestris) coelomocytes in response to osmotic stress. Zoology 110, 66–76. https://doi.org/10.1016/j.zool.2006.07.002. Kos, M., Jing, J., Keesmaat, I., Declerck, S.A.J., Wagenaar, R., Bezemer, T.M., 2017. After-life effects: living and dead invertebrates differentially affect plants and their associated aboveand belowground multitrophic communities. Oikos 126, 888–899. https://doi.org/10.1111/oik.03734. Koubov´ a, A., Chroˇ n´ akov´ a, A., Piˇ zl, V., S´ anchez-Monedero, M.A., Elhottov´ a, D., 2015. The effects of earthworms Eisenia spp. on microbial community are habitat dependent. Eur. J. Soil Biol. 68, 42–55. https://doi.org/10.1016/j.ejsobi.2015.03.004. Lacey, L.A., Grzywacz, D., Shapiro-Ilan, D.I., Frutos, R., Brownbridge, M., Goettel, M.S., 2015. Insect pathogens as biological control agents: Back to the future. J. Invertebr. Pathol. 132, 1–41. https://doi.org/10.1016/j.jip.2015.07.009. Lahiri, S., Orr, D., 2018. Biological control in tomato production systems: theory and practice. In: Sustainable Management of Arthropod Pests of Tomato. Academic Press, pp. 253–267. https://doi.org/10.1016/B978-0-12-802441-6.00011-5. Lavelle, P., Spain, A., Blouin, M., Brown, G., Deca¨ ens, T., Grimaldi, M., Jim´ enez, J.J., McKey, D., Mathieu, J., Velasquez, E., Zangerl´ e, A., 2016. Ecosystem engineers in a self-organized soil: a review of concepts and future research questions. Soil Sci. 181, 91–109. https://doi.org/10.1097/SS.0000000000000155. Lehmann, J., Kleber, M., 2015. The contentious nature of soil organic matter. Nature 528 (7580), 60–68. https://doi.org/10.1038/nature16069. Lenth, R. V. (2023). emmeans: Estimated Marginal Means, aka Least-Squares Means. R package version 1.8.5. https://CRAN.R-project.org/package=emmeans. Li, X., Yi, S., Chen, L., Hafeez, M., Zhang, Z., Zhang, J., Zhou, S., Dong, W., Huang, J., Lu, Y., 2024. The application of entomopathogenic nematode modified microbial communities within nesting mounds of the red imported fire ants, Solenopsis invicta. Sci. Total Environ. 912, 168748. https://doi.org/10.1016/j.scitotenv.2023.168748. Long, P.E., Williams, K.H., Hubbard, S.S., Banfield, J.F., 2016. Microbial metagenomics reveals climate-relevant subsurface biogeochemical processes. Trends Microbiol. 24, 600–610. https://doi.org/10.1016/j.tim.2016.04.006. Lu, Y., Zhou, G., Ewald, J., Pang, Z., Shiri, T., Xia, J., 2023. MicrobiomeAnalyst 2.0: Comprehensive statistical, functional and integrative analysis of microbiome data. Nucleic Acids Res. 51, 310–318. https://doi.org/10.1093/nar/gkad407. Medina-Sauza, R.M., ´ Alvarez-Jim´ enez, M., Delhal, A., Reverchon, F., Blouin, M., Guerrero-Analco, J.A., Cerd´ an, C.R., Guevara, R., Villain, L., Barois, I., 2019. Earthworms building up soil microbiota, a review. Front. Environ. Sci. 7, 81. https:// doi.org/10.3389/fenvs.2019.00081. Medina-Sauza, R.M., Solís-García, I.A., Blouin, M., Villain, L., Guevara, R., Barois, I., Reverchon, F., 2023. Microniches harbor distinct bacterial communities at the soilplant-earthworm interface. Eur. J. Soil Biol. 118, 103531. https://doi.org/10.1016/ j.ejsobi.2023.103531. Muscolo, A., Bovalo, F., Gionfriddo, F., Nardi, S., 1999. Earthworm humic matter produces auxin-like effects on Daucus carota cell growth and nitrate metabolism. Soil Biol. Biochem. 31, 1303–1311. https://doi.org/10.1016/S0038-0717(99)00049-8. Nearing, J.T., Douglas, G.M., Comeau, A.M., Langille, M.G.I., 2018. Denoising the Denoisers: An independent evaluation of microbiome sequence error-correction approaches. PeerJ 6, e5364. Overbeck, V., Schmitz, M., Tartachnyk, I., Blanke, M., 2018. Identification of light availability in different sweet cherry orchards under cover by using non-destructive measurements with a DualexTM. Eur. J. Agron. 93, 50–56. https://doi.org/10.1016/ j.eja.2017.11.006. Plavˇ sin, I., Velki, M., Eˇ cimovi´ c, S., Vrandeˇ ci´ c, K., ´ Cosi´ c, J., 2017. Inhibitory effect of earthworm coelomic fluid on growth of the plant parasitic fungus Fusarium oxysporum. Eur. J. Soil Biol. 78, 1–6. https://doi.org/10.1016/j.ejsobi.2016.11.004. Prodan, A., Tremaroli, V., Brolin, H., Zwinderman, A.H., Nieuwdorp, M., Levin, E., 2020. Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing. PLoS One 15, e0227434. https://doi.org/10.1371/journal.pone.0227434. R Core Team, 2023. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria https://www.R-project.org/. Rasmann, S., K¨ ollner, T.G., Degenhardt, J., Hiltpold, I., Toepfer, S., Kuhlmann, U., Gershenzon, J., Turlings, T.C.J., 2005. Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434, 732–737. https://doi.org/10.1038/ nature03451. Salmon, S., Ponge, J.F., 2001. Earthworm excreta attract soil springtails: Laboratory experiments on Heteromurus Nitidus (Collembola: Entomobryidae). Soil Biol. Biochem. 33, 1959–1969. https://doi.org/10.1016/S0038-0717(01)00129-8. Sampedro, L., Whalen, J.K., 2007. Changes in the fatty acid profiles through the digestive tract of the earthworm Lumbricus terrestris L. Appl. Soil Ecol. 35, 226–236. https:// doi.org/10.1016/j.apsoil.2006.04.007. Santocki, M., Falniowski, A., Plytycz, B., 2016. Restoration of experimentally depleted coelomocytes in juvenile and adult composting earthworms Eisenia andrei, E. fetida and Dendrobaena veneta. Appl. Soil Ecol. 104, 163–173. https://doi.org/10.1016/j. apsoil.2015.08.022. Shah, I.H., Jinhui, W., Li, X., Hameed, M.K., Manzoor, M.A., Li, P., Zhang, Y., Niu, Q., Chang, L., 2024. Exploring the role of nitrogen and potassium in photosynthesis implications for sugar: Accumulation and translocation in horticultural crops. Sci. Hortic. 327, 112832. https://doi.org/10.1016/j.scienta.2023.112832. Shapiro, D.I., Tylka, G.L., Berry, E.C., Lewis, L.C., 1995. Effects of earthworms on the dispersal of Steinernema spp. J. Nematol. 27, 21. Shapiro-Ilan, D.I., Brown, I., 2013. Earthworms as phoretic hosts for Steinernema carpocapsae and Beauveria bassiana: implications for enhanced biological control. Biol. Control 66, 41–48. https://doi.org/10.1016/j.biocontrol.2013.03.005. M. Chelkha et al. Biological Control 200 (2025) 105685 9