Glucose Oxidation to Pyruvate Is Not Essential for Brucella suis Biovar 5 Virulence in the Mouse Model

micb-11-620049 Janua y 5, 2021 Time: 17:33 # 1 ORIGINAL RESEARCH published: 14 Janua y 2021 doi: 10.3389/ micb.2020.620049 Edi ed by: Roy Ma in Roop II, Eas Ca olina Uni e si y, Uni ed S a es Re iewed by: Sean C osson, Michigan S a e Uni e si y, Uni ed S a es Clay on Caswell, Vi ginia Tech, Uni ed S a es *Co espondence: Amaia Zúñiga-Ripa azuniga@una .es Special y sec ion: This a icle was submi ed o In ec ious Diseases, a sec ion o he jou nal F on ie s in Mic obiology Recei ed: 21 Oc obe 2020 Accep ed: 02 Decembe 2020 Published: 14 Janua y 2021 Ci a ion: Láza o-An ón L, de Miguel MJ, Ba bie T, Conde-Ál a ez R, Muñoz PM, Le esson JJ, I ia e M, Mo iyón I and Zúñiga-Ripa A (2021) Glucose Oxida ion o Py u a e Is No Essen ial o B ucella suis Bio a 5 Vi ulence in he Mouse Model. F on . Mic obiol. 11:620049. doi: 10.3389/ micb.2020.620049 Glucose Oxida ion o Py u a e Is No Essen ial o B ucella suis Bio a 5 Vi ulence in he Mouse Model Le icia Láza o-An ón1,2, Ma ía Jesús de Miguel3,4, Thibaul Ba bie 5, Raquel Conde-Ál a ez1,2, Pila M. Muñoz3,4, Jean Jacques Le esson5, Mai e I ia e1,2, Ignacio Mo iyón1,2 and Amaia Zúñiga-Ripa1,2* 1Depa men o Mic obiology and Pa asi ology, Facul ad de Medicina, ISTUN Ins i u o de Salud T opical, Uni e si y o Na a a, Pamplona, Spain, 2Na a a Ins i u e o Heal h Resea ch (IdiSNA), Pamplona, Spain, 3Unidad de P oducción y Sanidad Animal, Cen o de In es igación y Tecnología Ag oalimen a ia de A agón (CITA), Za agoza, Spain, 4Ins i u o Ag oalimen a io de A agón-IA2, CITA-Uni e sidad de Za agoza, Za agoza, Spain, 5Resea ch Uni in Biology o Mic oo ganisms (URBM), NARILIS, Uni e si y o Namu , Namu , Belgium B ucella species cause b ucellosis, a wo ldwide ex ended zoonosis. The b ucellae a e ela ed o ee-li ing and plan -associa ed α2-P o eobac e ia and, since hey mul iply wi hin hos cells, hei me abolism p obably e lec s his adap a ion. To in es iga e his, we used he oden -associa ed B ucella suis bio a 5, which in con as o he uminan -associa ed B ucella abo us and B ucella meli ensis and o he B. suis bio a s, is as -g owing and conse es he ances al En ne -Doudo o pa hway (EDP) p esen in he plan -associa ed ela i es. We cons uc ed mu an s in Edd (glucose-6-phospha e dehyd a ase; i s EDP s ep), PpdK (py u a e phospha e dikinase; phosphoenolpy u a e py u a e), and Pyk (py u a e kinase; phosphoenolpy u a e →py u a e). In a chemically de ined medium wi h glucose as he only C sou ce, he Edd mu an showed educed g ow h a es and he iple Edd-PpdK-Pyk mu an did no g ow. Mo eo e , he iple mu an was also unable o g ow on ibose o xylose. The e o e, B. suis bio a 5 suga ca abolism p oceeds h ough bo h he Pen ose Phospha e shun and EDP, and EDP absence and exclusi e use o he shun could explain a leas in pa he compa a i ely educed g ow h a es o B. meli ensis and B. abo us. The iple Edd- PpdK-Pyk mu an was no a enua ed in mice. Thus, al hough an anabolic use is likely, his sugges s ha hexose/pen ose ca abolism o py u a e is no essen ial o B. suis bio a 5 mul iplica ion wi hin hos cells, a hypo hesis consis en wi h he lack o classical glycolysis in all B ucella species and o EDP in B. meli ensis and B. abo us. These esul s and hose o p e ious wo ks sugges ha wi hin cells, he b ucellae use mos ly 3 and 4 C subs a es ed in o anaple o ic pa hways and only a limi ed supply o 5 and 6 C suga s, hus a o ing he EDP loss obse ed in some species. Keywo ds: B ucella, me abolism, glucose, En ne -Doudo o , i ulence F on ie s in Mic obiology | www. on ie sin.o g 1Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 2 Láza o-An ón e al. Glucose Oxida ion in B ucella suis INTRODUCTION Membe s o he genus B ucella a e α2-P o eobac e ia ha in ec a wide ange o e eb a es causing b ucellosis in mammals (Al Dahouk e al., 2008;Wha mo e, 2009;Sole -Llo éns e al., 2016), a zoonosis wi h a high impac on de eloping coun ies wo ldwide (McDe mo e al., 2013). Al hough he genus includes an inc easing numbe o species (Mo eno, 2020), B ucella abo us, B ucella meli ensis, and B ucella suis (o en e e ed o as he classical smoo h spp.) a e by a hose ha ing he mo e se e e impac on bo h li es ock and humans and hey we e di ided long ago in o bio a s ollowing pheno ypic c i e ia (Al on, 1987). Al hough o a long ime hough o be a e y homogeneous g oup (Hoye and McCullough, 1968;Ve ge e al., 1987), he iden i ica ion o new spp. and phylogenomic s udies show ha B. abo us,B. meli ensis,B. suis,B ucella neo omae,B ucella o is, and B ucella canis plus isola es om sea mammals and he common ole o m a ela i ely he e ogeneous co e g oup sepa a ed om se e al ea ly di e ging b ucellae (Wa am e al., 2014;Sole -Llo éns e al., 2016;Mo eno, 2020). These s udies also show ha , while all B. abo us and B. meli ensis bio a s g oup in o wo clades, he i e B. suis bio a s show a g ea e di e si y ha is inconsis en wi h hei cu en axonomic s a us as a single sp. (Mo eno and Mo iyón, 2002;Al Dahouk e al., 2008;Scholz e al., 2008a;Wha mo e, 2009;Mo eno, 2020). The weigh o he e idence shows ha he b ucellae ha e e ol ed om en i onmen al α2-P o eobac e ia (Mo eno, 2020). Since hey a e acul a i e in acellula pa hogens unable o pe sis in na u e ou side hei hos s, his o igin implies ha hey ha e p obably adap ed hei me abolism o he peculia i ies o he B ucella con aining acuoles (BCV) whe e hey mul iply. Undoub edly because o hei ea ly iden i ica ion and g ea e impac on domes ic li es ock and humans, me abolism has been in es iga ed almos exclusi ely in B. abo us, B. meli ensis, and bio a s 1 and 3 o B. suis. These spp. and bio a s, al hough auxo ophic only o a ew i amins and occasionally o a ew amino acids (Ge ha d and Wilson, 1948;Plomme , 1991), a e o en desc ibed as as idious because o hei complex equi emen s o p ima y isola ion (pep one-yeas ex ac media, o en supplemen ed wi h se um) and slow g ow h. Howe e , B. suis bio a 5 and B ucella mic o i, bo h oden -associa ed b ucellae, display much as e g ow h (Scholz e al., 2008b; Zúñiga-Ripa e al., 2018), which sugges s a mo e ances al me abolism. Consis en wi h his, we ha e ecen ly ound (Machela e al., 2020) ha , like he en i onmen al α2- P o eobac e ia neighbo s, he En ne -Doudo o pa hway (EDP) is ully ac i e in hose oden -associa ed spp. so ha glucose is ueled in o he ica boxylic acid cycle (TCA) mos ly h ough EDP wi h li le con ibu ion o he Pen ose Phospha e Pa hway (PPP). Thus, whe eas B. suis bio a 5 mu an s in edd (coding o he 6-phosphoglucona e dehyd a ase in ol ed in he i s s ep o EDP) ha e a se e e g ow h de ec , mu a ion o gnd (6-phosphoglucona e dehyd ogenase o he i s s ep o PPP) has only a educed e ec . On he o he hand, B. abo us, B. meli ensis, and B. suis o he han bio a 5 ely exclusi ely on PPP because all ca y a disabling mu a ion in edd. This shows he dispensabili y o EDD in he spp. ha cause disease in li es ock and, consis en wi h he lack o he phospho uc okinase o he Embden-Meye ho -Pa nas (classical glycolysis) in all b ucellae (Ba bie e al., 2018), suppo s he hypo hesis ha glucose ueling in o TCA is no essen ial in BCVs and was hus los in some clades. Al hough B. suis bio a 5 and B. mic o i ep esen a sui able mode o es his hypo hesis, we ha e consis en ly ailed o ob ain a double edd-gnd mu an , in all likelihood because PPP becomes essen ial when EDD is no unc ional (Machela e al., 2020). Howe e , as ha hypo hesis can be es ed by blocking py u a e syn hesis a o he le els o he cen al C pa hways, in his wo k we applied his app oach by dele ing edd in B. suis bio a 5 and, ins ead o gnd, he genes pu a i ely coding o py u a e phospha e dikinase (ppdK) and py u a e kinase (pyk) (Figu e 1). He e, we p esen expe imen s ha con i m he co esponding p edic ed me abolic pheno ypes as well as he esul s o an assessmen o i ulence in he mouse model o b ucellosis. MATERIALS AND METHODS Bac e ial S ains and G ow h Condi ions The bac e ial s ains and plasmids used a e lis ed in Supplemen a y Table 1. A he Uni e si y o Na a a, bac e ia we e ou inely g own in pep one-glucose [TSB, bioMe ieux; bio-T ypcase (17 g/L), bio-Soyase (3 g/L), glucose (2.5 g/L), NaCl (5 g/L), and K2HPO4(2.5 g/L)], o on his medium supplemen ed wi h aga (TSA). Fo he animal expe imen s a CITA (see below), he inocula we e g own on Blood Aga Base No. 2 [BAB2, Oxoid; p o eose pep one (15 g/L), li e diges (2.5 g/L), yeas ex ac (5 g/L), NaCl (5 g/L), and aga (12 g/L)] a basal medium p e iously shown o be equi alen o TSA wi h a la ge numbe o s ains (in p elimina y expe imen s, i was con i med ha he s ains used in his s udy g ew simila ly on bo h media, as expec ed) (De Miguel e al., 2011). To s udy he pheno ype o he me abolic mu an s, a base medium [modi ied Plomme ’s medium; (Plomme , 1991;Ba bie , 2014)] was used: 9.2 g/L K2HPO4; 3.0 g/L KH2PO4; 0.1 g/L Na2S2O3; 5.0 g/L NaCl; 0.2 g/L nico inic acid; 0.2 g/L hiamine; 0.07 g/L pan o henic acid; 0.5 g/L (NH4)2SO4; 0.01 g/L MgSO4; 0.1 mg/L MnSO4; 0.1 mg/L FeSO4; 0.1 mg/L bio in. Fo me abolic s udies, his base medium was supplemen ed wi h he app op ia e C sou ce a 1 g/L. When necessa y, pep one-glucose was supplemen ed wi h kanamycin (50 µg/ml), polymyxin B (2 µg/ml), o suc ose (5%). All s ains we e s o ed in skimmed milk (Scha lau) a −80◦C. G ow h Cu es The ollowing p o ocol was used o a oid any nu ien ca y o e . Bac e ia we e i s g own in 10 ml o pep one-glucose in a 50 ml lask a 37◦C o 18 h wi h o bi al agi a ion, ha es ed by cen i uga ion, and hen esuspended in 10 ml o base medium supplemen ed wi h he app op ia e C sou ce a an op ical densi y o 0.1 a 600 nm (O.D.600nm). This b o h was incuba ed wi h o bi al agi a ion a 37◦C o 18 h, cells ha es ed by cen i uga ion, esuspended o an O.D.600nm o 0.1 in 1 ml o he same medium, and ans e ed o Biosc een pla es (200 µl/well) in echnical iplica es. G ow h was moni o ed e e y 0.5 h a 420−580 nm wi h con inuous shaking a 37◦C in a Biosc een C F on ie s in Mic obiology | www. on ie sin.o g 2Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 3 Láza o-An ón e al. Glucose Oxida ion in B ucella suis FIGURE 1 | Topology o he h ee glycoly ic ou es in B ucella (adap ed om Zúñiga-Ripa e al., 2018). Embden-Meye ho -Pa nas (EMP) pa hway, o en e e ed o as glycolysis, is shown in blue wi h a dashed a ow ma king he eac ion ca alyzed by he key enzyme P k absen in b ucellae. Pen ose Phospha e (PP) pa hway is comple e and highligh ed in yellow. The En ne -Doudo o (ED) pa hway is shown in g een wi h a do ed a ow ma king he s ep ca alyzed by Edd. Reac ions ha a e sha ed by he h ee pa hways a e highligh ed in g ay. The enzymes co esponding o he genes in es iga ed a e ma ked wi h and as e isk. Abb e ia ions used a e Me aboli es: 1,3,bPG, 1,3-bisphosphoglyce a e; KDPG, 2-ke o-3-deoxy-phosphoglucona e; 2PG, 2-phosphoglyce a e; 3PG, 3-phosphoglyce a e; 6PGL, 6-P- (Con inued) F on ie s in Mic obiology | www. on ie sin.o g 3Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 4 Láza o-An ón e al. Glucose Oxida ion in B ucella suis FIGURE 1 | Con inued gluconolac one; 6PG, 6-phosphoglucona e; AcCoA, ace yl-coenzyme A; AKG, alpha-ke oglu a a e; CIT, ci a e; ICIT, isoci a e; DHAP, dihyd oxyace one-P; E4P, e y h ose-4-P; F1,6bP, uc ose-1,6-bisphospha e; F6P, uc ose-6-P; FUM, uma a e; G6P, glucose-6-P; GAP, glyce aldehyde-3-P; G3P, glyce ol-3-P; GLX, glyoxyla e; MAL, mala e; OAA, oxaloace a e; PEP, phosphoenolpy u a e; PYR, py u a e; R5P, ibose-5-P; RIB5P, ibulose-5-P; S7P, sedohep ulose-7-P; SUC, succina e; SucCoA, succinyl-coenzyme A; X5P, xylulose-5-P. Enzymes: Edd, 6-phospho-D-glucona e dehyd a ase; Gnd, 6-phosphoglucona e dehyd ogenase; Pgl,6-phosphogluconolac onase; Acs, ace yl-coenzyme A syn he ase; Acn, aconi a e hyd a ase; Akgdh, alpha-ke oglu a a e dehyd ogenase; Gl A, ci a e syn hase; Eno, enolase; Fbp, GlpX, uc ose-1,6-bisphospha ase; Fba, uc ose bisphospha e aldolase; Fum, uma ase; Zw , glucose-6-P dehyd ogenase; Pgi, glucose-6-P isome ase; Gdh, glu ama e dehyd ogenase; Gapdh, glyce aldehyde-3-P dehyd ogenase; GlpD, glyce ol-3-P dehyd ogenase; GlpK, glyce ol kinase; Idh, isoci a e dehyd ogenase; AceA, isoci a e lyase; Eda, 2-dehyd o-3-deoxy-phosphoglucona e aldolase; Ldh, lac a e dehyd ogenase; Mdh, mala e dehyd ogenase; AceB, mala e syn hase; Mae, malic enzyme; PckA, phosphoenolpy u a e ca boxykinase; P k, phospho uc okinase; Pgk, phosphoglyce a e kinase; Gpm, phosphoglyce a e mu ase; Pyc, py u a e ca boxylase; Pdh, py u a e dehyd ogenase; Pyk, py u a e kinase; PpdK, py u a e phospha e dikinase; Rpi, ibose-5-phospha e isome ase; Rpe, ibulose-5-P-3-epime ase; Sdh, succina e dehyd ogenase; S k, succinyl-coenzyme A syn he ase; Tal, ansaldolase; Tk , anske olase; Tpi, iose P isome ase. incuba o (Lab Sys ems) using wells wi h s e ile medium as he blank. All expe imen s we e epea ed a leas h ee imes. DNA Manipula ions Genomic sequences o B. suis 513 ( he e e ence s ain o he B. suis bio a 5) we e ob ained om he Kyo o Encyclopedia o Genes and Genomes (KEGG) da abase1. Sea ches o DNA and p o ein homologies we e ca ied ou using he Na ional Cen e o Bio echnology In o ma ion (NCBI)2, he Eu opean Molecula Biology Labo a o y (EMBL)-Eu opean Bioin o ma ics Ins i u e se e 3, and The B oad Ins i u e o Ha a d and MIT-B ucella g oup da abases. P ime s we e syn hesized by he Sigma-Genosys (Ha e hill, Uni ed Kingdom). Res ic ion- modi ica ion enzymes we e used as ecommended by he manu ac u e s. Plasmid DNAs we e ex ac ed wi h he QIAp ep Spin Minip ep (Qiagen GmbH, Hilden, Ge many) and genomic DNAs om indi idual colonies by boiling in wa e . When needed, DNA was pu i ied om aga ose gels using he QIAquick Gel Ex ac ion Ki (Qiagen). Mu agenesis The B. suis 513 Bs51ppdK in- ame mu an in ppdK [desc ibed in a p e ious wo k (Zúñiga-Ripa e al., 2018)] ca ied a dele ion encompassing 86% o he co esponding gene. To ob ain Bs51pyk, a i s plasmid (pAZI-36; Supplemen a y Table 1) was p epa ed as ollows. Fi s , wo PCR agmen s we e gene a ed using oligonucleo ides Pyk-F1 (50- GCTGACGTCGCGCTATTATT-30) and Pyk-R2 (50-CGTGGCGAGAATCTTGACC-30), which ampli ied a 282 bp agmen including codons 1–12 o pyk, as well as 246 bp ups eam o he pyk s a codon; and oligonucleo ides Pyk-F3 (50- GGTGCAAGATTCTCGCCACGGGTGCAACCAATATGCTGC- 30) and Pyk-R4 (50-CGCTCTGAATTCGCATTTG-30), which ampli ied a 296 bp agmen including he las 60 bp o pyk. To join he wo agmen s, a hi d PCR used oligonucleo ides Pyk-F1 and Pyk-R4 o ampli ica ion and he complemen a y egions be ween Pyk-R2 and Pyk-F3 o o e lapping. The esul ing agmen , con aining he pyk dele ion lacking 96% o he wild- ype ORF, was cloned in o pCR2.1 (In i ogen) o ob ain pAZI-36. A e sequence e i ica ion, he dele ion allele 1h p://www.genome.jp/kegg/ 2h p://www.ncbi.nlm.nih.go / 3h p://www.ebi.ac.uk/ was excised using BamHI–No I and cloned in o a pJQKm suicide ec o (Scupham and T iple , 1997). The esul ing pLZI-1 mu a o plasmid (Supplemen a y Table 1) was ans o med in o E. coli s ains TOP10F’ and S17λpi and ans e ed o B.suis 513 by conjuga ion. In eg a ion o he suicide ec o in he ch omosome was selec ed by polymyxin (B. suis 513 is in insically esis an ) and kanamycin esis ance, and excision o pLZI-1 (p oducing Bs51pyk by allelic exchange) by polymyxin and suc ose esis ance and kanamycin sensi i i y. The esul ing colonies we e sc eened by PCR wi h p ime s Pyk-F1 and Pyk-R4, which ampli ied a agmen o 578 bp and 1917 bp in he mu an and pa en al s ain, espec i ely. Bs51ppdK1pyk was cons uc ed in oducing pLZI-1 in o Bs51ppdK by conjuga ion and selec ion by polymyxin and suc ose esis ance and kanamycin sensi i i y, and con i med by PCR using oligonucleo ides Pyk-F1 and Pyk-R4. To check o bo h mu a ions, he in e nal p ime Pyk-R5 (50- TTTTCCGTCATCGATCAACA -30) hyb idizing in he dele ed egion was used. To cons uc mu an Bs51edd, he suicide mu a o plasmid pNPTS1edd (Supplemen a y Table 1), ca ying he edd dele ed allele (Machela e al., 2020) was in oduced in o E. coli S17λpi by ans o ma ion. Then, pNPTS1edd was in oduced in o B. suis 513 by conjuga ion. Following he p o ocol desc ibed abo e, colonies om he second ecombina ion we e sc eened by PCR wi h p ime s Edd-F1 (50-GGCACGATTTCATCAGCGCA- 30) and Edd-R4 (50-CCGCCATTCATGGCATTCTGG-30), which ampli ied a agmen o 1,447 bp in he mu an and a agmen o 3,271 bp in he pa en al s ain. The dele ion emo ed 56% o he ORF and was iden i ied using he in e nal p ime Edd- R5 (50-TCCTGAATGCGTTTATGTGC-30) which hyb idized in he dele ed egion. To cons uc Bs51pyk1edd, Bs51ppdK1edd, and Bs51ppdK1pyk1edd, pNPTS1edd was in oduced in o Bs51pyk, Bs51ppdK, and Bs51ppdK1pyk by conjuga ion and p ime s Edd-F1, Edd-R4, and Edd-R5 we e used o sc een he esul ing colonies. Vi ulence Assays in Mice Se en-week-old emale BALB/c mice (En igo-Ha lan Labo a o ies, Ba celona, Spain) we e accommoda ed unde BSL-3 biosa e y con ainmen condi ions in he acili y o Cen o de In es igación y Tecnología Ag oalimen a ia de A agón F on ie s in Mic obiology | www. on ie sin.o g 4Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 5 Láza o-An ón e al. Glucose Oxida ion in B ucella suis (CITA; Regis a ion code ES502970012025) wi h wa e and ood ad libi um. The animal handling and p ocedu es we e in acco dance wi h he cu en Eu opean (di ec i e 86/609/EEC) and Spanish (RD/53/2013) legisla ion and au ho ized by he Animal Wel a e Commi ee o he ins i u ion. Fo each s ain, inoculum was p epa ed om a 24 h cul u e on Blood Aga Base No. 2 (see abo e “Bac e ial S ains and G ow h Condi ions”) a 37◦C. Bac e ial suspensions in s e ile phospha e bu e ed saline (0.85% NaCl, 0.1% KH2PO4, 0.2% K2HPO4; pH 6.85) we e spec opho ome ically adjus ed o 1 ×109colony o ming uni s (CFU) and dilu ed o he equi ed concen a ion. Mice (n= 5) we e inocula ed in ape i oneally wi h app oxima ely 1×105CFU in 0.1 mL o he co esponding inoculum (exac doses we e e ospec i ely assessed by CFU accoun s on BAB pla es) and hen eu hanized 2 and 8 weeks a e inocula ion. Spleens we e asep ically emo ed, indi idually weighed, homogenized in nine olumes o s e ile saline bu e and se ial 10- old dilu ions pla ed by iplica e on BAB pla es o CFU accoun s. The iden i y o he isola es was con i med by PCR. Indi idual da a (mean CFU/spleen) we e no malized by loga i hmic ans o ma ion and he mean log CFU/spleen alues and he s anda d de ia ion (n= 5) calcula ed o s a is ical compa isons by one-way ANOVA ollowed by he Dunne ’s es . RESULTS The Simul aneous Dele ion o edd,ppdK, and pyk Abolishes B. suis 513 G ow h on 5 and 6 C Suga s Whe eas he oxida i e PPP yields phosphoenolpy u a e (PEP) ha is hen con e ed in o py u a e, he EDP p oduces PEP and di ec ly py u a e (Figu e 1). Since py u a e can be con e ed di ec ly in o ace yl-CoA o eed he TCA, when glucose is he only C sou ce i can be p edic ed: (i) ha he s eps connec ing PEP and py u a e should be dispensable o g ow h i EDP is ac i e; and (ii) ha an edd mu an de ec i e in hese s eps should no g ow on glucose. Acco ding o genomic p edic ions, he B. suis 513 ( he e e ence s ain o he B. suis bio a 5) enzymes in ol ed in PEP-py u a e con e sions would be a (pu a i e) py u a e phospha e dikinase (PpdK) and a (pu a i e) py u a e kinase (Pyk) (Figu e 1). The e o e, as a i s es o hose p edic ions, we examined Bs51ppdK and Bs51pyk o g ow h on glucose and on pep one-glucose as a con ol. As can be seen in he uppe le panel o Figu e 2,Bs51ppdK g ew on glucose eaching he le el o he pa en al s ain wi h a sho delay and simila gene a ion imes (abou 8 h du ing he exponen ial phase). On glucose, al hough Bs51pyk displayed a longe gene a ion ime (abou 11 h), i also eached a s a iona y phase le el like ha o he pa en al s ain (Figu e 2, uppe le panel). Bo h mu an s g ew no mally in pep one-glucose (Figu e 2, lowe le panel). As a con ol, we included a mu an in edd. Whe eas his Bs51edd mu an g ew no mally on pep one- glucose (Figu e 2, lowe le panel), we obse ed ha i g ew less and mo e slowly han i s pa en al B. suis 513 s ain on glucose (Figu e 2, uppe le panel). This esul con i ms he unc ionally o he EDP and, since g ow h was no ab oga ed, i also shows a mino ac i i y o a complemen a y glucose oxida i e ou e, which should be he oxida i e PPP because o he lack o phospho uc okinase and hence classical glycolysis in all b ucellae. Based on hese esul s, we hen cons uc ed and es ed he double Bs51ppdK1pyk and iple Bs51ppdK1pyk1edd mu an s. We ound ha , while g ow h o he double mu an Bs51ppdK1pyk was delayed bu no a es ed on glucose (Figu e 2, uppe cen al panel), edd became essen ial o g ow h when bo h ppdK and pyk we e mu a ed (Figu e 2, uppe igh panel). On he o he hand, hese mu an s g ew no mally in complex medium (Figu e 2, lowe cen al igh panels). These esul s s ongly sugges ha PpdK and Pyk a e unc ional, con i m ha B. suis 513 has an ope a i e ED ou e and a e consis en wi h ou p edic ions. In he expe imen s p esen ed hus a , we no iced ha Bs51ppdK g ew as e han Bs51pyk, which implies ha ppdK canno ully eplace pyk when he bac e ia a e g owing on glucose (Figu e 2, uppe le panel). This p omp ed us o in es iga e whe he he eac ions ca alyzed by hese wo enzymes a e simila ly e ec i e when combined wi h he EDP. Fo his, we compa ed mu an s Bs51ppdK1edd and Bs51pyk1edd on glucose. Unexpec edly, he esul s (Figu e 2, uppe cen al panel) showed no g ow h o Bs51ppdK1edd and gene a ion imes o Bs51pyk1edd no e y di e en om hose o he Bs51edd single mu an , sugges ing a majo and no dispensable ole o PpdK. No g ow h de ec was appa en on pep one-glucose (Figu e 2, lowe cen al panel). We also no iced ha Bs51edd showed longe gene a ion imes and s a iona y phase yields lowe han hose o Bs51ppdK o Bs51pyk (Figu e 2, le panel). As indica ed abo e, g ow h o Bs51edd unde hese condi ions should occu only h ough he oxida i e PPP, being in his ega d simila o he h ee classical smoo h B ucella spp. The PPP yields PEP h ough glyce aldehyde-3-P (GAP), and hen PEP yields py u a e h ough he Pyk and PpdK ca alyzed eac ions (Figu e 1). The e o e, a di ec p oo o PPP as he only suga ca abolic ou e emaining in mu an Bs51edd would be ha Pyk and Ppdk become essen ial o g ow h on pen oses when EDP is no unc ional. We con i med his p edic ion (Figu e 3) by aking ad an age o he abili y o B.suis 513 o g ow on xylose and ibose as he only C sou ce (Zúñiga-Ripa e al., 2018). The Simul aneous Dele ion o edd,ppdK, and pyk Does No A ec B. suis 513 Vi ulence in Mice The pheno ype o he Bs51ppdK1pyk1edd p o ided a ool o in es iga e whe he he ca abolism o 6 (and 5 C) suga s was essen ial du ing in ec ion. To in es iga e his, we inocula ed BALB/c mice wi h Bs51ppdK1pyk1edd and, as con ols, Bs51ppdK and B. suis 513, and de e mined he CFU/spleen a e 2 o 8 weeks (acu e and ch onic phase o in ec ion, espec i ely). We ound ha he iple mu an Bs51ppdK1pyk1edd was no a enua ed in his i ulence model (Figu e 4). F on ie s in Mic obiology | www. on ie sin.o g 5Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 6 Láza o-An ón e al. Glucose Oxida ion in B ucella suis FIGURE 2 | Dele ion o ppdk,pyk, and edd ab oga es g ow h o B. suis 513 on glucose as sole C sou ce. G ow h cu es we e ob ained in modi ied base Plomme ’s medium supplemen ed wi h glucose (uppe panels) o in pep one-glucose b o hs (lowe panels). Each poin ep esen s he mean ±s anda d e o o an expe imen pe o med in echnical iplica es (e o ba s a e wi hin he size o he symbols). The expe imen s we e epea ed a leas h ee imes wi h simila esul s. FIGURE 3 | A iple Bs51ppdk1pyk1edd mu an canno g ow on xylose o ibose. Each poin ep esen s he mean ±s anda d e o o an expe imen pe o med in echnical iplica es (e o ba s a e wi hin he size o he symbols). The expe imen was epea ed a leas h ee imes wi h simila esul s. DISCUSSION In his wo k, we con i m and ex end ou p e ious esul s suppo ing he exis ence o an ac i e ED ou e in B. suis 513 (bio a 5) ha oge he wi h he oxida i e PPP sus ains g ow h o his bio a on glucose as he only C sou ce in i o (Machela e al., 2020). In keeping wi h he p edic ion ha hese ou es p oduce PEP/py u a e, we also ound ha g ow h equi es PpdK and Pyk, he o me appa en ly playing a majo and non- dispensable ole in i o. Indeed, simul aneous dys unc ion o Edd, PpdK, and Pyk also abolished he abili y o B. suis 513 o g ow on xylose o ibose. Indi ec ly, he da a also con i m he lack o an ac i e EMP pa hway, consis en wi h he absence o phospho uc okinase in all b ucellae (Ba bie e al., 2018). I has o be no ed ha bu o he ppdK one (Zúñiga-Ripa e al., 2018), he mu an s in es iga ed we e no complemen ed despi e se e al a emp s (Láza o-An ón, Mo iyón and Zúñiga-Ripa; unpublished esul s). We ha e al eady de ec ed his expe imen al di icul y wi h some B ucella mu an s a ec ed in in e media y C pa hways, and his could be due o he in icacies o me abolic egula o y loops, plasmid s abili y, and o he ac o s (Zúñiga- Ripa e al., 2014). Howe e , while s ic p oo would equi e such expe imen s, i has o be s essed ha he pheno ype o he mu an s s udied he e ully co espond wi h he p edic ed ones, which s ongly sugges s ha he conclusions ha can be d awn a e alid. Also wo h commen ing is ha , while u he esea ch is necessa y o asce ain he me abolic peculia i ies o he slow- and as -g owing b ucellae, he obse a ion ha dele ion F on ie s in Mic obiology | www. on ie sin.o g 6Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 7 Láza o-An ón e al. Glucose Oxida ion in B ucella suis FIGURE 4 | The iple mu an Bs51ppdk1pyk1edd is no a enua ed in he mouse model. Each poin is he mean ±s anda d de ia ion (n= 5) o he logs o CFUs pe spleen in echnical iplica es. The e we e no s a is ical di e ences a any o he wo imes es ed (one-way ANOVA ollowed by Dunne ’s es ; p>0.5). o edd conside ably educes he g ow h a es o B. suis 513 sugges s ha he shi om EDD o PPP as he majo ou e o suga me abolism could be one o he easons o hese di e en pheno ypes. On he connec ion i ulence-me abolism in b ucellae, he e we examined whe he glucose oxida ion beyond py u a e is necessa y o B. suis 513 i ulence in he mouse model, and we ob ained a nega i e answe . Conside ing he in i o pheno ypes o B. suis 513 and i s Bs51ppdK1pyk1edd mu an , his conclusion can be ex ended o a leas xylose and ibose, wo pen oses eeding in o he PPP. As discussed below, hese conclusions do no exclude o he uses o hexoses and/o pen oses by he b ucellae. Se e al wo ks o e insigh on he ole o hexose/pen ose me abolism in B ucella i ulence. A signa u e- agged mu agenesis sc eening in mice iden i ied a gluP [glucose/galac ose anspo e ; (Essenbe g e al., 1997)] mu an o B. abo us 2308 among hose a enua ed 8 weeks a e in ec ion bu no among hose iden i ied as a enua ed a 2 weeks pos -in ec ion (Hong e al., 2000). This mu an , howe e , was no c i ically comp omised [ i ulen /gluP mu an co-in ec ion compe i i e index a week 8 23.4 as compa ed o 72.4 o a gl D (glu ama e syn hase) mu an es ed in pa allel]. In subsequen wo k wi h gluP,Xa ie e al. (2013) p oposed ha an inc eased glucose a ailabili y media ed by pe oxisome p oli e a o - ac i a ed ecep o γ(PPARγ) acili a es B. abo us 2308 su i al du ing he ch onic phase in al e na i e ac i a ed mac ophages. Al hough o he au ho s ha e in e p e ed hese esul s o mean ha glycolysis may play an impo an ole in me abolism and i ulence o in acellula B ucella (Gao e al., 2016), he mul iplica ion o B. abo us in mouse spleens occu s ea ly du ing in ec ion [when no ole o gluP was obse ed (Hong e al., 2000)] be o e he numbe s o bac e ia each a sho pla eau a e which i dec eases p og essi ely (G illó e al., 2012). The e o e, he gluP s udies sugges ha glucose o galac ose a e used a e he acu e phase o in ec ion o pu poses o he han majo C/ene gy sou ces o mul iplica ion in a leas hose labo a o y models. Simila conside a ions can explain he mild a enua ion o B. suis 1330 ibose kinase ( bsk) and 6-phosphoglucona e dehyd ogenase (gnd) Tn5 mu an s obse ed in mac ophage-like human THP-1 cells 48 h a e in ec ion (log CFU educ ion o bo h mu an s o 1.8 s. 5 o genes in ol ed in amino acid syn hesis) (Köhle e al., 2002). Mo eo e , in ou hands a B. suis 1330 mu an in gnd is se e ely a enua ed (Machela e al., 2020). On he o he hand, o he wo ks ha p o ide esul s on how i ulence is a ec ed by mu a ion o enzymes o hexose/pen ose me abolism canno be unequi ocally in e p e ed in e ms o me abolism. Fo example, a 3 log CFU a enua ion was ound o aB. suis 1330 P-glucose isome ase (pgi) Tn5 mu an (Foulongne e al., 2000) bu , indeed, his mu a ion has pleio opic e ec s, including ha on he syn hesis o mannose and hexosamine, wo suga s equi ed o lipopolysaccha ide building. Simila ly, a glucose-6-P dehyd ogenase (zw ) mu an o B. abo us 544 was desc ibed as comple ely unable o mul iply in Hela cells bu su p isingly he mu an was se e ely hampe ed in in asi eness (Kim e al., 2003), a pheno ype ha s ongly sugges s de ec s no ela ed o i s abili y o mul iply wi hin cells. Whe eas ou esul s a e no in open con lic wi h hose summa ized in he p e ious pa ag aph, he lack o a ole in i ulence o pyk and ppdK mani es ed in he pheno ype in mice o Bs51ppdK1pyk1edd appa en ly con adic s conclusions ob ained in o he s udies. Gao e al. (2016) cons uc ed a B. abo us S2308 pyk mu an ha , in con as o he pa en al s ain, was impai ed o g ow h on glucose bu no on py u a e. This B. abo us pyk mu an did no mul iply in RAW 264.7 mac ophages and was a enua ed in BALB/c mice (app oxima ely 2.5 log CFU less han he pa en al s ain 1 and 5 weeks a e in ec ion). Mo e ecen ly, Pi ze e al. (2018) epo ed ha a B. abo us 2308 pyk mu an p o ed o be de ec i e in he ac i i y o Pyk displayed educed abili y o me abolize glucose, uc ose, and galac ose bu no ibose, xylose, a abinose o e y h i ol, and was a enua ed in C57BL/6 mice. The easons o he disc epancies in bo h a enua ion and he ange o subs a es used in i o a e no ob ious. Fo he a enua ion, a plausible explana ion would be ha hese s udies ha e been conduc ed in B. abo us 2308 and ou s wi h B. suis 513. As emphasized in he In oduc ion, B. suis 513 (bu no B. abo us 2308) is as -g owing and can use a wide menu o subs a es as he only sou ce o C and ene gy including lac a e and glu ama e, which by hemsel es do no suppo g ow h o B. abo us 2308W (Zúñiga-Ripa e al., 2018). In he hos , hese abili ies o B. suis 513 could p o ide a way o ci cum en he PEP →py u a e con e sion as lac a e can p o ide py u a e, and he TCA cycle can also be ed by glu ama e (Zúñiga-Ripa e al., 2018). Disc epancies in he use o C sou ces in i o by B. abo us in di e en wo ks could be explained by sub le di e ences be ween s ains 2308 and 2308W, as hey a e no gene ically iden ical (Suá ez-Esqui el e al., 2016) and/o by he expe imen al condi ions. Gao e al. (2016) es ed 2308 g ow h in a medium con aining glucose o py u a e and mine al sal s bu also 0.1% yeas ex ac , which makes he medium non- minimal and could hus accoun o he di e ences in g ow h on glucose o 2308 and 2308W. Also, he u iliza ion o hexoses and pen oses by 2308 in he wo k o Pi ze e al. (2018) was es ed in a Biolog sys em, which implies an unde ined medium and, he e o e, p o ides no in o ma ion on he use o hose subs a es as he only C/ene gy sou ces. Like in he s udy o Gao e al. (2016) he minimal medium used by Pi ze e al. (2018) con ained 0.1% yeas ex ac . F on ie s in Mic obiology | www. on ie sin.o g 7Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 8 Láza o-An ón e al. Glucose Oxida ion in B ucella suis Rega ding ppdK, we epo ed in a p e ious wo k ha his gene is necessa y o B. abo us 2308W i ulence (Zúñiga-Ripa e al., 2014), and his was con i med in he s udy o Pi ze e al. (2018). Recen ly, we showed ha he homologous ppdK mu an in B. suis 513 was no a enua ed in mice and we elucida ed he easons o his disc epancy: his B. suis bio a 5 s ain can use PpdK and PEP ca boxykinase (PckA) o PEP syn hesis in i o (Figu e 1), PckA ca alyzing oxaloace a e con e sion in o PEP, while B. abo us 2308W uses only PpdK, ha ca alyzes he PEP-py u a e in e con e sion (Zúñiga-Ripa e al., 2018). Indeed, we showed ha B. suis 513 a enua ion occu s in he double PckA-PpdK mu an (Zúñiga-Ripa e al., 2018). Consis en wi h he absence o phospho uc okinase (P k) in all b ucellae and he dispensabili y o he EDP, ou esul s a e in line wi h he hypo hesis ha hexose/pen ose ca abolism h ough he TCA is no necessa y o g ow h in BCVs, which may accoun o he loss o EDP in B. abo us,B. meli ensis, and some B. suis bio a s. As PpdK ca alyzes an amphibolic eac ion ha can suppo he syn hesis o 3 o 6 C biosyn he ic p ecu so s and Pyk is ca abolic, his could explain why he o me seems o ha e a mo e impo an ole o g ow h o a leas B. suis 513. The da a p esen ed he e oge he wi h hose o p e ious wo ks a e consis en wi h a model (Zúñiga-Ripa e al., 2014, 2018) in which he b ucellae h i e in acellula ly by using 3 and 4 C subs a es wi h a limi ed supply o 5 and 6 C suga s ha a e de o ed o biosyn hesis. DATA AVAILABILITY STATEMENT The aw da a suppo ing he conclusions o his a icle will be made a ailable by he au ho s, wi hou undue ese a ion. ETHICS STATEMENT The animal s udy was e iewed and app o ed by he Animal Wel a e Commi ee o CITA. AUTHOR CONTRIBUTIONS AZ-R, JL, MI, and IM concei ed and coo dina ed he s udy. LL-A and AZ-R ca ied ou he genomic analyses, mu an s cons uc ion, and me abolic es s. MM, TB, RC-Á, and PM con ibu ed in mu an cons uc ion, g ow h measu emen s, and expe imen s in mice. AZ-R, LL-A, and IM w o e he manusc ip . All au ho s analyzed he esul s and app o ed he manusc ip con en . FUNDING Resea ch a he Uni e si y o Na a a was suppo ed by he MINECO (g an s AGL2014-58795-C4-1-R and PID2019- 107601RA-C32) and he Ins i u e o T opical Heal h unde s (Ob a Social la CAIXA -LCF/PR/PR13/11080005- and Fundación Caja Na a a, Fundación Ma ía F ancisca de Ro i al a, Ubesol and In e siones Ga cilaso de la Vega S.L). Resea ch a URBM was suppo ed by g an s om he “Fonds Na ional de la Reche che Scien i ique” (FNRS) (Con en ion No. n◦2.4521.10. om Fonds de la Reche che Scien i ique Médicale–FNRS, Belgium), and by he In e uni e si y A ac ion Poles P og amme ini ia ed by he Belgian Science Policy O ice. Wo k a CITA was suppo ed by MINECO (g an s AGL2014- 58795-C4-1-R and PID2019-107601RA-C32) and “Gobie no de A agón” (Consolida ed G oup A14). ACKNOWLEDGMENTS We hank Sa a Se ano o he excellen echnical assis ance. SUPPLEMENTARY MATERIAL The Supplemen a y Ma e ial o his a icle can be ound online a : h ps://www. on ie sin.o g/a icles/10.3389/ micb. 2020.620049/ ull#supplemen a y-ma e ial REFERENCES Al Dahouk, S., Jubie -Mau in, V., Scholz, H. C., Tomaso, H., Ka ges, W., Neubaue , H., e al. (2008). Quan i a i e analysis o he in amac ophagic B ucella suis p o eome e eals me abolic adap a ion o la e s age o cellula in ec ion. P o eomics 8, 3862–3870. doi: 10.1002/pmic.200800026 Al on, G. G. (1987). Con ol o B ucella meli ensis in ec ion in sheep and goa s: a e iew. T op. Anim. Heal h P od. 19, 65–74. doi: 10.1007/BF02297320 Ba bie , T. (2014). Re ision o he e y h i ol ca abolic pa hway and o he cen al me abolism o he pa hogen B ucella. 1–241. P oc. Na l. Acad. Sci. 111, 17815– 17820. doi: 10.1073/pnas.1414622111 Ba bie , T., Zúñiga-Ripa, A., Moussa, S., Plo ie , H., S e non, J. F., Láza o-An ón, L., e al. (2018). B ucella cen al ca bon me abolism: an upda e. C i . Re . Mic obiol. 44, 182–211. doi: 10.1080/1040841X.2017.1332002 De Miguel, M. J., Ma ín, C. M., Muñoz, P. M., Dies e, L., G illó, M. J., Blasco, J. M. e al. (2011). De elopmen o a selec i e cul u e medium o p ima y isola ion o he main B ucella species. J. Clin. Mic obiol. 49, 1458–1463. doi: 10.1128/jcm.02301-10 Essenbe g, R. C., Candle , C., and Nida, S. K. (1997). B ucella abo us s ain 2308 pu a i e glucose and galac ose anspo e gene: cloning and cha ac e iza ion. Mic obiology 143, 1549–1555. doi: 10.1099/00221287-143-5- 1549 Foulongne, V., Bou g, G., Caze ieille, C., Michaux-Cha achon, S., and O’Callaghan, D. (2000). Iden i ica ion o B ucella suis genes a ec ing in acellula su i al in an in i o human mac ophage in ec ion model by signa u e- agged ansposon mu agenesis. In ec . Immun. 68, 1297–1303. doi: 10.1128/IAI.68.3.1297-1303.2000 Gao, J., Tian, M., Bao, Y., Li, P., Liu, J., Ding, C., e al. (2016). Py u a e kinase is necessa y o B ucella abo us ull i ulence in BALB/c mouse. Ve . Res. 47:87. doi: 10.1186/s13567-016-0372-7 Ge ha d , P., and Wilson, J. B. (1948). The nu i ion o B ucellae: g ow h in simple chemically de ined media. J. Bac e iol. 56, 17–24. doi: 10.1128/jb.56.1.17-24. 1948 G illó, M. J., Blasco, J. M., Go el, J.-P. P., Mo iyón, I., and Mo eno, E. (2012). Wha ha e we lea ned om b ucellosis in he mouse model? Ve . Res. 43, 1–35. doi: 10.1186/1297-9716-43-29 F on ie s in Mic obiology | www. on ie sin.o g 8Janua y 2021 | Volume 11 | A icle 620049 micb-11-620049 Janua y 5, 2021 Time: 17:33 # 9 Láza o-An ón e al. Glucose Oxida ion in B ucella suis Hong, P. C., Tsolis, R. M., and Fich , T. A. (2000). Iden i ica ion o genes equi ed o ch onic pe sis ence o B ucella abo us in mice. In ec . Immun. 68, 4102– 4107. doi: 10.1128/iai.68.7.4102-4107.2000 Hoye , B. H., and McCullough, N. B. (1968). Polynucleo ide homologies o B ucella deoxy ibonucleic acids. J. Bac e iol. 95, 444–448. doi: 10.1128/jb.95.2.444-448. 1968 Kim, S., Wa a ai, M., Kondo, Y., E denebaa a , J., Makino, S., and Shi aha a, T. (2003). Isola ion and cha ac e iza ion o Mini-Tn5Km2 inse ion mu an s o B ucella abo us de icien in in e naliza ion and in acellula g ow h in HeLa cells. In ec . Immun. 71, 3020–3027. doi: 10.1128/iai.71.6.3020-3027.2003 Köhle , S., Foulongne, V., Ouah ani-Be ache, S., Bou g, G., Teyssie , J., Ramuz, M., e al. (2002). The analysis o he in amac ophagic i ulome o B ucella suis deciphe s he en i onmen encoun e ed by he pa hogen inside he mac ophage hos cell. P oc. Na l. Acad. Sci. U S A. 99, 15711–6. doi: 10.1073/pnas.232 454299 Machela , A., Willema , K., Zúñiga-Ripa, A., Goda d, T., Plo ie , H., Conde- Ál a ez, R., e al. (2020). Con e gen e olu ion o zoono ic B ucella species owa ds he selec i e use o he pen ose phospha e pa hway. P oc. Na l. Acad. Sci. 117, 26374–26381. doi: 10.1073/PNAS.2008939117 McDe mo , J. J., G ace, D., and Zinss ag, J. (2013). Economics o b ucellosis impac and con ol in low-income coun ies. Sci. Tech. Re . O . In . des Epizoo . 32, 249–261. doi: 10.20506/ s .32.1.2197 Mille , V. L., and Mekalanos, J. J. (1988). A no el suicide ec o and i s use in cons uc ion o inse ion mu a ions: osmo egula ion o ou e memb ane p o eins and i ulence de e minan s in Vib io chole ae equi es oxR. J. Bac e iol. 170, 2575–2583. doi: 10.1128/jb.170.6.2575-2583.1988 Mo eno, E. (2020). The one hund ed yea jou ney o he genus B ucella (Meye and Shaw 1920). FEMS Mic obiol. Re . 44: uaa045. doi: 10.1093/ ems e/ uaa045 Mo eno, E., and Mo iyón, I. (2002). B ucella meli ensis: a nas y bug wi h hidden c eden ials o i ulence. P oc. Na l. Acad. Sci. 99, 1–3. doi: 10.1073/pnas. 022622699 Pi ze , J. E., Zeczycki, T. N., Baumga ne , J. E., Ma in, D. W., and Roop, R. M. (2018). The manganese-dependen py u a e kinase PykM is equi ed o wild- ype glucose u iliza ion by B ucella abo us 2308 and i s i ulence in C57BL/6 Mice. J. Bac e iol. 200:e00471-18. doi: 10.1128/JB.00471-18 Plomme , M. (1991). Minimal equi emen s o g ow h o B ucella suis and o he B ucella species. Zen albl.Bak e iol. 275, 436–450. doi: 10.1016/s0934-8840(11) 80165-9 Scholz, H. C., Al Dahouk, S., Tomaso, H., Neubaue , H., Wi e, A., Schlo e , M., e al. (2008a). Gene ic di e si y and phylogene ic ela ionships o bac e ia belonging o he Och obac um–B ucella g oup by ecA and 16S RNA gene- based compa a i e sequence analysis. Sys . Appl. Mic obiol. 31, 1–16. doi: 10. 1016/j.syapm.2007.10.004 Scholz, H. C., Hubalek, Z., Sedlacek, I., Ve gnaud, G., Tomaso, H., Al Dahouk, S., e al. (2008b). B ucella mic o i sp. no ., isola ed om he common ole Mic o us a alis.In . J. Sys . E ol. Mic obiol. 58, 375–382. doi: 10.1099/ijs.0.65356-0 Scupham, A. J., and T iple , E. W. (1997). Isola ion and cha ac e iza ion o he UDP-glucose 4’-epime ase-encoding gene, galE, om B ucella abo us 2308. Gene 202, 53–59. doi: 10.1016/s0378-1119(97)00453-8 Simon, L. D., Randolph, B., I win, N., and Binkowski, G. (1983). S abiliza ion o p o eins by a bac e iophage T4 gene cloned in Esche ichia coli.P oc. Na l. Acad. Sci. U S A. 80, 2059–62. doi: 10.1073/pnas.80.7.2059 Sole -Llo éns, P. F., Quance, C. R., Lawhon, S. D., S ube , T. P., Edwa ds, J. F., Fich , T. A., e al. (2016). A B ucella spp. isola e om a Pac-Man og (Ce a oph ys o na a) e eals cha ac e is ics depa ing om classical B ucellae.F on . Cell. In ec . Mic obiol. 6:116. doi: 10.3389/ cimb.2016.00116 Sp a , B. G. J., Hedge, P., Heesen, S., Edelman, A., and B oome-Smi h, J. K. (1986). Kanamycin- esis an ec o s ha a e analogues o plasmids pUC8, pUC9, pEMBL8 and pEMBL9. Gene 41, 337–342. doi: 10.1016/0378-1119(86)90117-4 Suá ez-Esqui el, M., Ruiz-Villalobos, N., Cas illo-Zeledón, A., Jiménez-Rojas, C., Roop Ii, R. M., Come ci, D. J., e al. (2016). B ucella abo us S ain 2308 Wisconsin genome: impo ance o he de ini ion o e e ence s ains. F on . Mic obiol. 7:1557. doi: 10.3389/ micb.2016.01557 Ve ge , J. M., G imon , F., G imon , P. A., and G ayon, M. (1987). Taxonomy o he genus B ucella.Ann. Ins . Pas eu . Mic obiol. 138, 235–238. doi: 10.1016/ 0769-2609(87)90199-2 Ve shilo a, P. A., Liamkin, G. I., and Maliko , V. E. (1983). B ucella s ains om mouselike oden s in sou hwes e n USSR. In . J. Sys . Bac e iol. 33, 399–400. doi: 10.1099/00207713-33-2-399 Wa am, A. R., Fos e , J. T., Mane, S. P., Becks om-S e nbe g, S. M., Becks om- S e nbe g, J. M., Dicke man, A. W., e al. (2014). Compa a i e phylogenomics and e olu ion o he B ucellae e eal a pa h o i ulence. J. Bac e iol. 196, 920–930. doi: 10.1128/JB.01091-13 Wha mo e, A. M. (2009). Cu en unde s anding o he gene ic di e si y o B ucella, an expanding genus o zoono ic pa hogens. In ec . Gene . E ol. 9, 1168–1184. doi: 10.1016/j.meegid.2009.07.001 Xa ie , M. N., Win e , M. G., Spees, A. M., den Ha igh, A. B., Nguyen, K., Roux, C. M., e al. (2013). PPARγ-media ed inc ease in glucose a ailabili y sus ains ch onic B ucella abo us in ec ion in al e na i ely ac i a ed mac ophages. Cell Hos Mic obe 14, 159–170. doi: 10.1016/j.chom.2013. 07.009 Zúñiga-Ripa, A., Ba bie , T., Conde-Ál a ez, R., Ma ínez-Gómez, E., Palacios- Cha es, L., Gil-Ramí ez, Y., e al. (2014). B ucella abo us depends on py u a e phospha e dikinase and malic enzyme bu no on Fbp and GlpX uc ose- 1,6-bisphospha ases o ull i ulence in labo a o y models. J. Bac e iol. 196, 3045–3057. doi: 10.1128/JB.01663-14. Zúñiga-Ripa, A., Ba bie , T., Láza o-An ón, L., de Miguel, M. J., Conde-Ál a ez, R., Muñoz, P. M., e al. (2018). The as -g owing B ucella suis bio a 5 depends on phosphoenolpy u a e ca boxykinase and py u a e phospha e dikinase bu no on Fbp and GlpX F uc ose-1,6-bisphospha ases o isoci a e lyase o ull i ulence in labo a o y models. F on . Mic obiol. 9:641. doi: 10.3389/ micb. 2018.00641 Con lic o In e es : The au ho s decla e ha he esea ch was conduc ed in he absence o any comme cial o inancial ela ionships ha could be cons ued as a po en ial con lic o in e es . Copy igh © 2021 Láza o-An ón, de Miguel, Ba bie , Conde-Ál a ez, Muñoz, Le esson, I ia e, Mo iyón and Zúñiga-Ripa. This is an open-access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (CC BY). The use, dis ibu ion o ep oduc ion in o he o ums is pe mi ed, p o ided he o iginal au ho (s) and he copy igh owne (s) a e c edi ed and ha he o iginal publica ion in his jou nal is ci ed, in acco dance wi h accep ed academic p ac ice. No use, dis ibu ion o ep oduc ion is pe mi ed which does no comply wi h hese e ms. F on ie s in Mic obiology | www. on ie sin.o g 9Janua y 2021 | Volume 11 | A icle 620049