Full text
Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=kvir20 Virulence ISSN: 2150-5594 (Print) 2150-5608 (Online) Journal homepage: https://www.tandfonline.com/loi/kvir20 Lethality of Brucella microti in a murine model of infection depends on the wbkE gene involved in Opolysaccharide synthesis Safia Ouahrani-Bettache, María P. Jiménez De Bagüés, Jorge De La Garza, Luca Freddi, Juan P. Bueso, Sébastien Lyonnais, Sascha Al Dahouk, Daniela De Biase, Stephan Köhler & Alessandra Occhialini To cite this article: Safia Ouahrani-Bettache, María P. Jiménez De Bagüés, Jorge De La Garza, Luca Freddi, Juan P. Bueso, Sébastien Lyonnais, Sascha Al Dahouk, Daniela De Biase, Stephan Köhler & Alessandra Occhialini (2019) Lethality of Brucella�microti in a murine model of infection depends on the wbkE gene involved in O-polysaccharide synthesis, Virulence, 10:1, 868-878, DOI: 10.1080/21505594.2019.1682762 To link to this article: https://doi.org/10.1080/21505594.2019.1682762 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. View supplementary material Published online: 02 Nov 2019. Submit your article to this journal Article views: 832 View related articles View Crossmark data Citing articles: 3 View citing articles
RESEARCH PAPER Lethality of Brucella microti in a murine model of infection depends on the wbkE gene involved in O-polysaccharide synthesis Safia Ouahrani-Bettache a , María P. Jiménez De Bagüés b , Jorge De La Garza a , Luca Freddi a # , Juan P. Bueso c , Sébastien Lyonnais d , Sascha Al Dahouk e , Daniela De Biase f , Stephan Köhler a *, and Alessandra Occhialini a * a IRIM, CNRS, University Montpellier, INSERM, Montpellier, France; b Unidad de Tecnología en Producción y Sanidad Animal, Centro de Investigación y Tecnología Agroalimentaria, Instituto Agroalimentario de Aragón, Universidad de Zaragoza, Zaragoza, Spain; c Laboratorio Agroalimentario, Gobierno de Aragón, Zaragoza, Spain; d CEMIPAI, CNRS, University Montpellier, Montpellier, France; e Department of Biological Safety, German Federal Institute for Risk Assessment, Berlin, Germany; f Department of Medico-Surgical Sciences and Biotechnologies, Sapienza University of Rome, Laboratory affiliated to the Istituto Pasteur Italia –Fondazione Cenci Bolognetti, Latina, Italy ABSTRACT Brucella microti was isolated a decade ago from wildlife and soil in Europe. Compared to the classical Brucella species, it exhibits atypical virulence properties such as increased growth in human and murine macrophages and lethality in experimentally infected mice. A spontaneous rough (R) mutant strain, derived from the smooth reference strain CCM4915 T , showed increased macrophage colonization and was non-lethal in murine infections. Whole-genome sequencing and construction of an isogenic mutant of B. microti and Brucella suis 1330 revealed that the R-phenotype was due to a deletion in a single gene, namely wbkE (BMI_I539), encoding a putative glycosyltransferase involved in lipopolysaccharide (LPS) O-polysaccharide biosynthesis. Complementation of the R-strains with the wbkE gene restored the smooth phenotype and the ability of B. microti to kill infected mice. LPS with an intact O-polysaccharide is therefore essential for lethal B. microti infections in the murine model, demonstrating its importance in pathogenesis. ARTICLE HISTORY Received 3 September 2019 Revised 11 October 2019 Accepted 13 October 2019 KEYWORDS Brucella; virulence; lipopolysaccharide (LPS); O-polysaccharide; glycosyltransferase; rough phenotype; atomic force microscopy Introduction Brucellae are Gram-negative facultative intracellular coccobacilli causing brucellosis, a major bacterial zoonosis with 500,000 human cases globally reported every year [1]. In the last decade, new species of Brucella,suchas Brucella microti, Brucella inopinata and isolates from Australian rodents and amphibians, have been described [2]. These strains are metabolically more active, acidresistant and fast-growing when compared to the wellknown classical, human-pathogenic Brucella species, which include Brucella abortus, Brucella melitensis, Brucella suis and Brucella canis [2–7]. Their isolation from hitherto unknown wildlife hosts and the environment raised the question whether Brucella may be transmitted from these reservoirs to livestock and humans living in officially brucellosis-free areas of the world. B. microti was isolated from common vole, red fox, wild boar, and soil in Central Europe and, more recently, from a domestic marsh frog farm [8,9]. Phylogenetically, this species is closer to those pathogenic for human and livestock than to the group of newly described atypical species/strains [2,10]. However, in the absence of clinical reports, the pathogenic potential of B. microti remains to be verified. We were the first to describe that, unlike the classical Brucella species, B. microti is lethal in mice when injected intraperitoneally (i.p.) at a standard dose [11]. The lethalphenotypeinmicedependsonthetypeIVsecretion system VirB [12] and is also a general unambiguous criterion to establish if a specific Brucella gene plays a role in virulence of B. microti, as wild-type bacteria kill the murine host at the infection dose of 10 5 CFU (colony-forming units); in contrast, in classical species virulence has been correlated to the capacity of a strain to establish or maintain various degrees of chronic infection of the spleen and/ or the liver, necessitating repeated bacterial enumeration in these organs to follow up the course of infection. On the other hand, at sub-lethal doses (≤10 4 CFU), B. microti is rapidly cleared from infected mice, never gives rise to chronic infection and confers protection [11]. Lethality in mice was later also demonstrated for B. inopinata BO1 and CONTACT Stephan Köhler [email protected] *These authors contributed equally to this work. # Current affiliation: Unité des Zoonoses Bactériennes, ANSES, Maisons-Alfort, France. supplemental data for this article can be accessed here. VIRULENCE 2019, VOL. 10, NO. 1, 868–878 https://doi.org/10.1080/21505594.2019.1682762 © 2019 The Author(s). Published by Informa UK Limited, trading as Taylor & Francis Group. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Brucella strain 83–210 [13].Weandothersassumedthat the ability of these Brucella species to kill the murine host may be due to differences in surface antigens, in particular the structure of lipopolysaccharide (LPS) with a possibly higher endotoxic potential [13,14]. Because of its low endotoxicity, the LPS of classical Brucella species is considered as non-canonical in comparison with that of Escherichia coli and other pathogenic bacteria, enabling Brucella to establish chronic infections and evade TLR4 detection [15–17]. The LPS is a major component of the outer membrane and consists of three key elements: (1) the lipid A, which provides the hydrophobic LPS anchor in theoutermembrane,(2)aninnerandoutercorecomposed of branched-chain oligosaccharides, and (3) an O-polysaccharide (O-PS), linked to the outer core and protruding into the extracellular environment. In Brucella, the O-PS is characterized by a homopolymeric linear chain of N-formyl-perosamine residues linked via α1,2 and/or α-1,3 glycosidic bonds [18]. Depending on the relative abundance and distribution of these bonds, the O-PS provides the A, M, and common (C) epitopes widely used for serotyping [19,20]. Depending on the presence or absence of the O-PS, the colony phenotype is either smooth (S) or rough (R). All Brucella species that infect humans and livestock are naturally S, except for Brucella ovis and B. canis [21]. For vaccination of livestock against brucellosis, Sand R-strains have been used [22]. Notably, a specific interaction between intact LPS and the lipid rafts in phagocytic cells is responsible for the selective entry of Brucella S-strains into the host cells and trafficking along the endocytic pathway [23–26]. In contrast, R strains do not enter the cell through the lipid rafts and are rapidly eliminated [25]. In this study, we characterized a spontaneous R-mutant (BmR SM ) of the B. microti reference strain CCM4915 T . Its complete genome sequence helped to identify a mutation inactivating the wbkE gene, known to be involved in the synthesis of O-PS [27]. To correlate this mutation with the R phenotype and virulence, we constructed a knock-out mutant (BmR ΔwbkE )by allelic exchange. The fate of R SM ,R ΔwbkE and their complemented strains in cellular and murine infection models was studied and compared to that of the zoonotic strain B. suis 1330. Material and methods Bacterial strains, culture conditions and phenotypic characterization E. coli and Brucella strains (Table 1)weregrownunder aerobic conditions at 37°C in Luria Bertani (LB, Invitrogen) and Tryptic Soy (TS, Difco) media, respectively. When necessary, media were supplemented with kanamycin or ampicillin at 50 µg/ml, or with chloramphenicol at 25 µg/ml. All experiments with viable Brucella were performed in a BSL-3 facility. The smooth (S) and rough (R) phenotypes of Brucella were assessed by crystal violet staining [28] and by agglutination tests using anti-R polyclonal antiserum and anti-A and anti-M monospecific sera (ANSES, France). Bacterial morphology was observed by atomic force microscopy (AFM). DNA analysis and mutant strains construction Genomic DNA of B. microti was isolated using the Qiagen Mini Kit. Whole-genome shotgun sequencing of the spontaneous rough strain (BmR SM ) was performed using Illumina paired-end sequencing with a library insert size of 300 bp and an average target coverage of 484 x (GATC). BmR ΔwbkE of B. microti was obtained by replacing an internal portion of gene BMI_I539 with a Kan R cassette. A recombinant wbkEKan R -containing plasmid derived from pGEM®-T was created as previously described [5,30]. Briefly, two DNA fragments (A, 526 bp and B, 595 bp) each carrying an EcoRI restriction site in a 46-bp homology region at the 3ʹand 5ʹ-end, respectively, were amplified by PCR. The fragments were fused in a second PCR, to yield fragment AB (1075 bp) containing the EcoRI site in the middle and missing 608 out of 1110 bp of the target gene BMI_I539 (i.e. from positions 71 to 678; Table 1). Following cloning of fragment AB in pGEM-T, the resulting plasmid (pGEM-T-AB; Table 1) was digested with EcoRI and ligated with the Kan R cassette (1282 bp) excised from plasmid pUC4K. The resulting plasmid (pGEM-T-ABKan, 5357 bp; Table 1) was electroporated into B. microti. The Kan R /Amp S clones arising from double-crossover were selected and verified by PCR (primers in Table 1). Same constructions and protocols were used to obtain the ΔwbkE mutant of B. suis (BsR ΔwbkE ;Table 1). Using electroporation, the three mutant strains (BmR SM ,BmR ΔwbkE ,BsR ΔwbkE ) were complemented with pBBR1MCS-wbkE vector, containing the wildtype B. microti wbkE gene and its upand downstream regions (Table 1). Atomic force microscopy Bacteria were grown to stationary phase in TS, washed in PBS, fixed for 1 h in 2.5% glutaraldehyde and stored in PBS at 5 × 10 9 bacteria/ml. FluoroDish™cell culture dishes (World Precision Instruments, UK) were coated overnight at 4°C with 0.1% poly-L-lysine, washed with PBS, air dried and stored at 4°C. Bacteria were diluted VIRULENCE 869
20-fold in PBS and added to the functionalized dish. Images were recorded with qp-BioAC CB2 cantilevers using the quantitative imaging mode available on the NanoWizard IV AFM (JPK Instruments –Bruker). The applied force was kept at 0.3 nN, and a constant approach/retract speed of 80 µm/s (z range of 800 nm). Macrophage infection with Brucella strains Murine J774A.1 macrophage-like cells were infected with B. microti and B. suis strains at a multiplicity of infection (MOI) of 20 as described previously [11]. All experiments were performed in triplicate. Infection of Balb/c mice with B. microti strains Approved animal experimentation guidelines were followed in the mouse experiments and the working protocol was approved by the CITA ethical animal experiment committee. A procedure for the assessment of pain, distress and discomfort in experimental animals, adapted from [31] was followed, assigning a score to each animal regarding several variables (weight loss, appearance, spontaneous behavior, responses to external stimuli and clinical signs). If the score rose to 15–20 points prior to spontaneous death, animals were euthanized and considered as having succumbed to infection. Bacteria were inoculated i.p [11]. To test the lethality of the bacterial strains, groups of six 9-weeks-old Balb/c female mice (Janvier Labs) each were infected i.p. with 10 5 CFU of the wild-type, BmR ΔwbkE and complemented BmR ΔwbkE strains or with 10 8 and 10 9 CFU of BmR SM and BmR ΔwbkE mutant strains. Mice survival was monitored over a period of 25 days post-infection (d.p.i.). To study the course of infection in mice, Balb/c were inoculated i.p. with a dose of 10 4 CFU of B. microti strains. Five mice per strain were sacrificed at 3, 14 and 21 d.p.i. Following mice euthanasia by CO 2 asphyxiation, spleens were aseptically collected, weighed, homogenized, serially diluted and plated onto TS agar for viable counts of Brucella. The significance of differences between strains was analyzed by the Student t-test. P values ≤0.05 were considered significant. Sequence accession number The genomic DNA sequence of BmR SM has been deposited in the SRA database (NCBI) under the accession number PRJNA545613. Table 1. Bacterial strains, plasmids, and primers used in this study. Bacterial strains Acronyms Description Reference E. coli DH5αE. coli supE44 ΔlacU169(φ80lacZΔM15)hsdR17recA1endA1 gyrA96thi-1 relA1λpir Invitrogen B. microti CCM4915 T BmS WT Wild-type reference strain, smooth phenotype [8] B. microti R SM BmR SM Spontaneous mutant of BmS WT , rough phenotype This work B. microti R SM +pBBR-wbkE BmR SM p wbkE Complemented strain of BmR SM carrying the wbkE gene in plasmid pBBR1MCS This work B. microti ΔwbkE BmR ΔwbkE Deletion mutant of BmS WT in which the wbkE gene is replaced by a kanamycin cassette This work B. microti ΔwbkE +pBBR-wbkE BmR ΔwbkE p wbkE Complemented strain of BmR ΔwbkE carrying the wbkE gene in plasmid pBBR1MCS This work B. suis 1330 BsS WT Wild-type reference strain, smooth phenotype ATCC 23444 B. suis ΔwbkE BsR ΔwbkE Deletion mutant of BsS WT in which the wbkE gene is replaced by a kanamycin cassette This work B. suis ΔwbkE +pBBR-wbkE BsR ΔwbkE p wbkE Complemented strain of BsR ΔwbkE carrying the wbkE gene in plasmid pBBR1MCS This work Plasmids pGEM®-T T/A cloning vector with ampicillin resistance marker Promega pUC4K Plasmid vector carrying a kanamycin resistance cassette (KanR) GE Healthcare pBBR1MCS E. coli/Brucella shuttle vector with chloramphenicol resistance marker [29] pGEM-T-AB pGEM-T carrying the AB PCR-fragment with sequences upand downstream of Brucella wbkE This work pGEMT-AB-Kan pGEM-T-AB carrying KanR in EcoRI site of the AB fragment This work pBBR1MCS-wbkE pBBR1MCS carrying the wbkE PCR-fragment including the native gene with 398 bp upand 600 bp downstream regions cloned into XhoI-SacI-sites This work Primers Fragment Sequence (5ʹ-3ʹ) 1 Size (base pairs) A-BMI_I539-For A GCAGTGGATCGTGGTGTATG 526 bp A-BMI_I539 EcoRI-Rev TGAGGTTTCATAGGCCCATCGAATTCCATGAATGGTTCGCTCAATG B-BMI_I539-EcoRI-For B CATTGAGCGAACCATTCATGGAATTCGATGGGCCTATGAAACCTCA 595 bp B-BMI_I539-Rev ACATTAATCGCCCGACACTC BMI_I539-XhoI-For wbkE GCGCCTCGAGAGTTGCCATCATGAGCTTGT 1928 bp BMI_I539-SacI-Rev GCGCGAGCTCTATCGGAAACAGTCGTGGTC 1 Restriction sites are underlined, and non-homologous regions are indicated by bold type. Size of the fused AB PCR-fragment obtained using both primers A-BMI_I539-For and B-BMI_I539-Rev, was 1075 bp. All PCRs were performed with Pfx DNA polymerase (Invitrogen) using B. microti genomic DNA as matrix. 870 S. OUAHRANI-BETTACHE ET AL.
Results A spontaneous rough mutant of B. microti shows increased colonization of macrophages and is avirulent in mice Following the first plating of B. microti CCM4915 T on TS agar and staining with crystal violet, a rough colony was observed. The colony was picked, subcultured three times and stained again with crystal violet: the rough phenotype remained stable for all colonies on plate. This strain was named B. microti rough spontaneous mutant and abbreviated BmR SM . It has been reported that rough mutant strains of B. suis and B. melitensis exhibit reduced intracellular survival in infected macrophages, though entry is improved [28]. BmR SM indeed entered murine J774A.1 macrophage cells approximately 100-fold better than the wild-type strain and B. suis 1330, which was used as standard reference (Figure 1). In contrast to B. suis and B. melitensis rough strains [28], BmR SM replicated 20-30-fold, at least up to 24 hours postinfection (Figure 1). To characterize the behavior of BmR SM in vivo,Balb/c mice were injected i.p. with the sublethal dose of 10 4 bacteria, as previously published by the authors for the B. microti wild-type strain [11]. The number of bacteria recovered from spleen and liver 3 days after inoculation, corresponding to the peak of infection for B. microti [11], was reduced by 3.5 and 2.2 logs (P < 0.001), respectively, compared to those previously obtained with the wild-type strain (Table 2) and also confirmed in this work (see later section on “acute murine infection”). Therefore, the rough mutant colonized these organs significantly less than the wild-type, resulting in the lack of a transient acute phase of infection. BmR SM strain is characterized by a mutation of the glycosyltransferase-encoding gene wbkE To identify the mutation(s) responsible for the rough phenotype in BmR SM , its genome was sequenced and compared with that of B. microti CCM4915 T , accessible in the NCBI database. Out of 48 variants, 28 were assigned to SNV (Single Nucleotide Variants) and 20 to InDel (Insertion/Deletion) variants. Scrutiny of the variants resulted in retaining of 3 SNV and 4 InDels, fulfilling all the following criteria: (1) located within open reading frames or in the immediate upstream vicinity, (2) causing amino acids substitutions, frameshiftor stop-mutations in the corresponding genes, (3) not located in pseudogenes, and (4) representing the most prevalent variant according to the number of sequencing reads (≥90%) with respect to the reference sequence (Supplementary Table S1). Only four mutations were intragenic and affected the following genes: BMI_I525 (2 SNVs), BMI_I539 (1 InDel) and BMI_I1103 (1 SNV), encoding a transposase (ISBm1), a glycosyltransferase (wbkE) and a queuine tRNAribosyltransferase (tgt), respectively. The mutation found in wbkE was regarded as the most plausible cause for the rough phenotype, because the homologous gene BMEI1393 of B. melitensis, located in Time post infection (hours) 1,5 7,0 24,0 48,0 Brucella/well (log10 CFU) 2 3 4 5 6 7 8 Figure 1. Intracellular replication of smooth B. microti CCM4915 T (triangle down), the spontaneous rough mutant of B. microti (BmR SM ;triangle up), and smooth B. suis 1330 (circle), in murine J774A.1 macrophage-like cells. The number of colony forming units (CFU) was determined by plating serial dilutions on TS agar plates after 2 or 3 days of incubation at 37°C for B. microti and B. suis, respectively. The experiments were performed three times in triplicate each. Data are presented as mean values ± SD of one experiment (in triplicate). VIRULENCE 871
a highly conserved cluster of the major (wbk) genetic region of LPS synthesis, participates in O-PS biosynthesis [2,27]. Protein sequences of BMI_I539 and BMEI1393 are identical for 368 out of 369 amino acids. In BmR SM , deletion of a T at position 452 of wbkE causes a frameshift and the generation of a premature stop codon at position 622. The resulting protein sequence is therefore expected to be truncated at position 207. Deletion of the B. microti wbkE gene confirms its role in smooth (S-)LPS biosynthesis and results in enhanced macrophage uptake To confirm that the absence of a functional wbkE is responsible for the rough phenotype and the reduced virulence of BmR SM , we constructed a mutant (BmR ΔwbkE ) by replacing a 608-bp internal fragment of wbkE with a Kan R cassette in the parental strain. Colony staining with crystal violet and agglutination with anti-R antiserum [32] confirmed that BmR ΔwbkE was rough as BmR SM (Table 3). In parallel, we performed a surface analysis of smooth and rough bacterial strains by atomic force microscopy (AFM). AFM has been established as a powerful imaging technique and allows characterization of the surface morphology of microbial cells at the nanoscale [33]. We used a forcecurve-based imaging mode where the AFM tip is pushed toward an area of the cell surface and retracted from it, generating a force vs. separation distance curve encoding information about height, adhesion or elasticity for each image pixel. Surface topography of B. microti wild-type and BmR ΔwbkE revealed a uniform, smooth structure for B. microti wild-type, in contrast to a jagged, irregular structure for the BmR ΔwbkE mutant, with significantly increased roughness (Figure 2(a,b); Table 3). Mapping of the adhesion forces between the tip and the bacterial surface also revealed the presence of large patches of increased adhesion at the surface of BmR ΔwbkE when compared with the surface of wild-type bacteria, suggesting important differences in the molecular structure of the BmR ΔwbkE mutant surface (Figure 2(a,c); Table 3). Both rough mutants BmR ΔwbkE and BmR SM were then complemented with an intact copy of wbkE cloned in vector pBBR1MCS, which restored the smooth phenotype, as evidenced by lack of crystal violet staining and by the agglutination with anti-M antiserum only [8](Table 3). In addition, AFM confirmed a smooth surface structure of complemented BmR ΔwbkE , with roughness and adhesion forces back to wild-type levels (Figure 2,Table 3). The BmR ΔwbkE mutant entered J774A.1 cells to an extent similar to that of the BmR SM mutant (100 times more efficient than the parental strain) and replicated 60fold over 30 hours (Figure 3(a)). In contrast, BmR ΔwbkE and BmR SM strains complemented with an intact copy of wbkE infected macrophages like the parental strain and Table 2. Balb/c mice liver and spleen colonization by B. microti S and R SM strains 3 days post-inoculation. Strains Bacteria/spleen (log10 CFU) Bacteria/liver (log10 CFU) B. microti CCM4915 T Smooth 6.52 ± 0.16 a 5.43 ± 0.21 a B. microti R SM 3.09 ± 0.59 3.27 ± 0.31 Results represent means ± SD. Differences between both strains are significant in both organs (P < 0.001). a Previously published data [11] Table 3. Phenotypes of S and R strains of B. microti and B. suis. Atomic Force Microscopy Strains Crystal violet staining a Serum agglutination b Roughness, nm ± SD Adhesion, pN ± SD B. microti CCM4915 T Smooth - M 2.2 ± 0.67 124.6 ± 26 B. microti R SM +RND c ND B. microti R SM + pBBR-wbkE - M ND ND B. microti ΔwbkE + R 7.8 ± 4.35 446 ± 120.4 B. microti ΔwbkE + pBBRwbkE - M 2.6 ± 1.57 166.1 ± 34.9 B. suis 1330 Smooth - A ND ND B. suis 1330 ΔwbkE + R ND ND B. suis 1330 ΔwbkE + pBBRwbkE - A ND ND a +, uptake; -, no uptake of crystal violet by the colonies b with monospecific A, M, or R polyclonal antisera c not determined 872 S. OUAHRANI-BETTACHE ET AL.
replicated 400and 250-fold, respectively (Figure 3(a)). An isogenic wbkE mutant of B. suis 1330 (BsR ΔwbkE )was also constructed in order to compare its behavior to that of other rough mutants described in the past [25,28]. As expected, the BsR ΔwbkE mutant retained crystal violet and agglutinated with anti-R antiserum (Table 3). It colonized the macrophages 12 times more efficiently than the wild-type, but in contrast to R-strains of B. microti, a 3-fold reduction in intracellular survival was observed within a period of 30 h, resulting in 100 times lower Figure 2. Atomic Force Microscopy (AFM) images of B. microti wild-type (Bm WT), ΔwbkE mutant (Bm RΔwbkE) and the complemented ΔwbkE mutant (Bm RΔwbkE compl). (a) Each column shows from top to bottom the vertical deflection image (height) of the whole bacteria and 0.3 × 0.3 µm 2 areas of the cell surface, representing roughness and adhesion recorded on the shown bacteria (blue square). Quantitative roughness (b) and adhesion (c) measurements of Bm WT, Bm RΔwbkE and complemented Bm RΔwbkE: 0.5 × 0.5 µm 2 images were recorded and used for measurements of 0.25 × 0.25 µm 2 areas to quantify arithmetic roughness R a and adhesion (Peak-to-Valley). n = 9 bacteria/strain. Statistical differences were analyzed by t-test and yielded P values < 0.001 when comparing Bm WT or Bm R ΔwbkE compl with Bm R ΔwbkE . Image analysis was done with Gwyddion [34]. VIRULENCE 873
viable counts when compared to the wild-type (Figure 3(b)). This was very similar to the behavior of the manB core mutant of B. suis 1330 [25]. The complemented BsR ΔwbkE strain agglutinated specifically with anti-A antiserum as the wild-type strain (Table 3) and showed wildtype levels of intracellular infection and replication, despite a stronger transitional decrease in the early phase of infection (Figure 3(b)). The B. microti wbkE gene is indispensable for acute murine infection Infection of Balb/c with 10 4 CFU of B. microti strains showed a 3-logs reduction of BmR ΔwbkE in the spleen at day 3 post-injection, as compared to the wbkE-complemented mutant and wild-type strains (Figure 4(a)), confirming the incapacity of a ΔwbkE mutant strain to Brucella/well (log10 CFU) Time post infection (hours) 1,5 7,0 24,0 30,0 Brucella/well (log10 CFU) 2 3 4 5 6 7 8 Time post infection (hours) 1,5 7,0 24,0 30,0 2 3 4 5 6 7 8 ba Figure 3. Intracellular replication of smooth and rough strains of B. microti (a) and B. suis (b) in murine J774A.1 macrophage-like cells. (a) B. microti CCM4915 T wild-type (filled triangle down), the spontaneous R-strain BmR SM (open triangle up), the complemented BmR SM mutant (filled triangle up), the constructed R-strain BmR ΔwbkE (open circle), and the complemented BmR ΔwbkE mutant (filled circle). (b) B. suis 1330 wild-type (filled triangle down), the constructed R-strain BsR ΔwbkE (open circle), and the complemented BsR ΔwbkE mutant (filled circle). The complemented strains expressed native wbkE cloned into the replicative plasmid pBBR1MCS. The experiments were performed three times in triplicate each. Data are presented as mean values ± SD of one experiment (in triplicate). Time (days) 3 d 14 d 21 d Bacteria / spleen (log10 CFU) 0 1 2 3 4 5 6 *** ab Time (days) 3 d 14 d 21 d Spleen weight (grams) 0,0 0,1 0,2 0,3 0,4 0,5 *** *** ** * Figure 4. Infection of Balb/c mice with B. microti strains: growth and survival of B. microti strains in the spleen (a) and spleen weights of infected animals (b) after i.p. inoculation of 10 4 bacteria. The number of viable B. microti CCM4915 T wild-type (black bars), BmR ΔwbkE strain (open bars), and complemented BmR ΔwbkE mutant (grey bars) was determined at days 3, 14, and 21 post-infection. The arrow indicates the infection dose of 10 4 bacteria. Five mice were sacrificed per bacterial strain and time point, and values represent means ± SD. Asterisks indicate variable significance of the differences between the R-strain and the wild-type (next to left bar) or R-strain and the complemented mutant (next to right bar), or between the R-strain and both the wild-type and the complemented mutant (above middle bar): * P < 0.05; ** P < 0.005; *** P < 0.001. 874 S. OUAHRANI-BETTACHE ET AL.
establish an acute phase of infection in the host (see also Table 2).Theacuteinfectionphaseobservedwiththewildtype and the wbkE-complemented strains was followed by an increase of the spleen weight until at least day 14, reflecting an inflammatory response (Figure 4(b)). In contrast, mice infected with BmR ΔwbkE did not gain spleen weight. A similar finding was obtained when the strain BmR SM was injected i.p. at 10 4 CFU, as spleen weights remained unchanged at day 3 and day 14 (0.09 ± 0.007 and 0.10 ± 0.015, respectively; P < 0.001), confirming a reduced immune response induction with the wbkEmutant rough strains. The wbkE gene is essential for the lethal character of B. microti infections in Balb/c mice Our previous work showed that the intra-peritoneal injection of 10 5 CFU of B. microti CCM4915 T caused the death of83%oftheBalb/cmicewithinfourdaysofinfection[11]. ToinvestigatethepossibleinvolvementofthewbkE gene in the lethal outcome of a B. microti infection, the susceptibility of Balb/c mice infected with BmR SM or BmR ΔwbkE was compared to that observed following infection with the B. microti CCM4915 T wild-typeandthecomplemented BmR ΔwbkE strains, over a monitoring period of 25 days (Table 4): 67% and 83% of the mice infected with the standard dose of 10 5 CFU of the wild-type or the complemented BmR ΔwbkE strain, respectively, died between days 2 and 6 post-inoculation. In striking contrast, all the mice infected with 10 5 CFU of BmR ΔwbkE survived without any symptoms. 100% survival was also observed for both R-mutant strains BmR SM and BmR ΔwbkE after the injection of 10 8 CFU. However, when inoculated with 10 9 CFU of either R-strain, all mice died between days 2 and 6 postinoculation. These results are even more notable if combined with our preliminary observation (not shown) that BmR SM in Balb/c mice provided protection against B. microti wild-type, B. abortus, B. melitensis and B. suis 1330. Discussion The non-canonical LPS of classical brucellae lacks endotoxicity and possesses a particular core structure helping to evade the host’s immune system [35,36]. The phenomenon of dissociation, resulting in the conversionofS-toR-phenotype,hasbeen first described for Brucella in 1933 [37]. More recently, B. abortus, B. melitensis and B. suis R-mutants devoid of O-PS have been studied in cellular and murine models of infection [25,27,28,38,39]. These studies consistently showed the relevance of O-PS for virulence. The reduced virulence of R-mutants has been attributed to (1) high sensitivity to complement-mediated lysis in mice [40,41], (2) lipid raftindependent entry into macrophages resulting in enhanced phagolysosome fusion [25], and (3) lack of intracellular replication due to macrophage activation [28]. Monoclonal antibodies specific for common O-PS epitopes of Aor M-dominant classical strains also recognize LPS of the M-dominant B. microti reference strain [14], indicating a conserved structure of O-PS. However, anti-R-LPS monoclonal antibodies do not react with B. microti LPS, suggesting structural specificities in the core-lipid A moiety of its LPS [14], which may result in enhanced endotoxic properties and possibly explain the killing ability of B. microti in the murine model of infection. Because of the lack of data available on atypical species mutants affected in O-PS biosynthesis, we investigated the virulence properties of a spontaneous R-mutant of B. microti, which was fortuitously isolated. Murine infection experiments showed a loss of lethality of this mutant, and subsequent analysis by whole-genome sequencing allowed to link this ability to the wbkE gene, encoding a glycosyltransferase located in the major O-PS biosynthesis region, as previously described for B. melitensis [27]. Complementation of R-mutants restored wild-type properties including smooth character, reduced macrophage entry and murine lethality, demonstrating that the BmR SM strain was affected in a single LPS biosynthesis gene. In contrast, spontaneous R-mutants of B. abortus and B. melitensis isolated from macrophage and murine infections were often simultaneously affected in several loci [42]. Cell surface structure analysis by AFM confirmed the smooth character of the wild-type and complemented BmR ΔwbkE strains, whereas a distinct irregular surface was recorded for BmR ΔwbkE , possibly due to exposure of outer membrane proteins and lipid A/outer core disaccharides in the absence of the O-chain [27]. This exposure may also explain the increased adhesion forces observed during the interaction of the AFM tip with the R-mutant surface. Conversely, in a recent report, AFM analysis of two B. abortus strains, a wild-type and its isogenic mutant Δgmd R lacking O-chain, shows similar degrees of roughness [43]. Structural differences in the LPS core-lipid A moieties of Table 4. Lethality of B. microti S and R strains in Balb/c mice Strains Infection dose (i.p.) % Mortality ab B. microti CCM4915 T Smooth 10 5 67 B. microti R SM 10 8 0 10 9 100 B. microti ΔwbkE10 5 0 10 8 0 10 9 100 B. microti ΔwbkE+ pBBR-wbkE10 5 83 a Each bacterial strain was inoculated to a group of six 9-weeks-old Balb/c female mice b Over a 25-days period of monitoring, murine death occurred between days 2 and 6 post-inoculation VIRULENCE 875