Lethality of Brucella microti in a murine model of infection depends on the wbkE gene involved in O-polysaccharide synthesis

Full Te ms & Condi ions o access and use can be ound a h ps://www. and online.com/ac ion/jou nalIn o ma ion?jou nalCode=k i 20 Vi ulence ISSN: 2150-5594 (P in ) 2150-5608 (Online) Jou nal homepage: h ps://www. and online.com/loi/k i 20 Le hali y o B ucella mic o i in a mu ine model o in ec ion depends on he wbkE gene in ol ed in O- polysaccha ide syn hesis Sa ia Ouah ani-Be ache, Ma ía P. Jiménez De Bagüés, Jo ge De La Ga za, Luca F eddi, Juan P. Bueso, Sébas ien Lyonnais, Sascha Al Dahouk, Daniela De Biase, S ephan Köhle & Alessand a Occhialini To ci e his a icle: Sa ia Ouah ani-Be ache, Ma ía P. Jiménez De Bagüés, Jo ge De La Ga za, Luca F eddi, Juan P. Bueso, Sébas ien Lyonnais, Sascha Al Dahouk, Daniela De Biase, S ephan Köhle & Alessand a Occhialini (2019) Le hali y o B ucella�mic o i in a mu ine model o in ec ion depends on he wbkE gene in ol ed in O-polysaccha ide syn hesis, Vi ulence, 10:1, 868-878, DOI: 10.1080/21505594.2019.1682762 To link o his a icle: h ps://doi.o g/10.1080/21505594.2019.1682762 © 2019 The Au ho (s). Published by In o ma UK Limi ed, ading as Taylo & F ancis G oup. View supplemen a y ma e ial Published online: 02 No 2019. Submi you a icle o his jou nal A icle iews: 832 View ela ed a icles View C ossma k da a Ci ing a icles: 3 View ci ing a icles RESEARCH PAPER Le hali y o B ucella mic o i in a mu ine model o in ec ion depends on he wbkE gene in ol ed in O-polysaccha ide syn hesis Sa ia Ouah ani-Be ache a , Ma ía P. Jiménez De Bagüés b , Jo ge De La Ga za a , Luca F eddi a # , Juan P. Bueso c , Sébas ien Lyonnais d , Sascha Al Dahouk e , Daniela De Biase , S ephan Köhle a *, and Alessand a Occhialini a * a IRIM, CNRS, Uni e si y Mon pellie , INSERM, Mon pellie , F ance; b Unidad de Tecnología en P oducción y Sanidad Animal, Cen o de In es igación y Tecnología Ag oalimen a ia, Ins i u o Ag oalimen a io de A agón, Uni e sidad de Za agoza, Za agoza, Spain; c Labo a o io Ag oalimen a io, Gobie no de A agón, Za agoza, Spain; d CEMIPAI, CNRS, Uni e si y Mon pellie , Mon pellie , F ance; e Depa men o Biological Sa e y, Ge man Fede al Ins i u e o Risk Assessmen , Be lin, Ge many; Depa men o Medico-Su gical Sciences and Bio echnologies, Sapienza Uni e si y o Rome, Labo a o y a ilia ed o he Is i u o Pas eu I alia –Fondazione Cenci Bologne i, La ina, I aly ABSTRACT B ucella mic o i was isola ed a decade ago om wildli e and soil in Eu ope. Compa ed o he classical B ucella species, i exhibi s a ypical i ulence p ope ies such as inc eased g ow h in human and mu ine mac ophages and le hali y in expe imen ally in ec ed mice. A spon aneous ough (R) mu an s ain, de i ed om he smoo h e e ence s ain CCM4915 T , showed inc eased mac ophage coloniza ion and was non-le hal in mu ine in ec ions. Whole-genome sequencing and cons uc ion o an isogenic mu an o B. mic o i and B ucella suis 1330 e ealed ha he R-pheno ype was due o a dele ion in a single gene, namely wbkE (BMI_I539), encoding a pu a i e glycosyl ans e ase in ol ed in lipopolysaccha ide (LPS) O-polysaccha ide biosyn hesis. Complemen a ion o he R-s ains wi h he wbkE gene es o ed he smoo h pheno ype and he abili y o B. mic o i o kill in ec ed mice. LPS wi h an in ac O-polysaccha ide is he e o e essen ial o le hal B. mic o i in ec ions in he mu ine model, demons a ing i s impo ance in pa hogenesis. ARTICLE HISTORY Recei ed 3 Sep embe 2019 Re ised 11 Oc obe 2019 Accep ed 13 Oc obe 2019 KEYWORDS B ucella; i ulence; lipopolysaccha ide (LPS); O-polysaccha ide; glycosyl ans e ase; ough pheno ype; a omic o ce mic oscopy In oduc ion B ucellae a e G am-nega i e acul a i e in acellula coc- cobacilli causing b ucellosis, a majo bac e ial zoonosis wi h 500,000 human cases globally epo ed e e y yea [1]. In he las decade, new species o B ucella,suchas B ucella mic o i, B ucella inopina a and isola es om Aus alian oden s and amphibians, ha e been desc ibed [2]. These s ains a e me abolically mo e ac i e, acid- esis an and as -g owing when compa ed o he well- known classical, human-pa hogenic B ucella species, which include B ucella abo us, B ucella meli ensis, B ucella suis and B ucella canis [2–7]. Thei isola ion om hi he o unknown wildli e hos s and he en i on- men aised he ques ion whe he B ucella may be ans- mi ed om hese ese oi s o li es ock and humans li ing in o icially b ucellosis- ee a eas o he wo ld. B. mic o i was isola ed om common ole, ed ox, wild boa , and soil in Cen al Eu ope and, mo e ecen ly, om a domes ic ma sh og a m [8,9]. Phylogene ically, his species is close o hose pa hogenic o human and li es ock han o he g oup o newly desc ibed a ypical species/s ains [2,10]. Howe e , in he absence o clinical epo s, he pa hogenic po en ial o B. mic o i emains o be e i ied. We we e he i s o desc ibe ha , unlike he classical B ucella species, B. mic o i is le hal in mice when injec ed in ape i oneally (i.p.) a a s anda d dose [11]. The le halpheno ypeinmicedependson he ypeIVsec e ion sys em Vi B [12] and is also a gene al unambiguous c i e - ion o es ablish i a speci ic B ucella gene plays a ole in i ulence o B. mic o i, as wild- ype bac e ia kill he mu ine hos a he in ec ion dose o 10 5 CFU (colony- o ming uni s); in con as , in classical species i ulence has been co ela ed o he capaci y o a s ain o es ablish o main- ain a ious deg ees o ch onic in ec ion o he spleen and/ o he li e , necessi a ing epea ed bac e ial enume a ion in hese o gans o ollow up he cou se o in ec ion. On he o he hand, a sub-le hal doses (≤10 4 CFU), B. mic o i is apidly clea ed om in ec ed mice, ne e gi es ise o ch onic in ec ion and con e s p o ec ion [11]. Le hali y in mice was la e also demons a ed o B. inopina a BO1 and CONTACT S ephan Köhle [email p o ec ed] *These au ho s con ibu ed equally o his wo k. # Cu en a ilia ion: Uni é des Zoonoses Bac é iennes, ANSES, Maisons-Al o , F ance. supplemen al da a o his a icle can be accessed he e. VIRULENCE 2019, VOL. 10, NO. 1, 868–878 h ps://doi.o g/10.1080/21505594.2019.1682762 © 2019 The Au ho (s). Published by In o ma UK Limi ed, ading as Taylo & F ancis G oup. This is an Open Access a icle dis ibu ed unde he e ms o he C ea i e Commons A ibu ion License (h p://c ea i ecommons.o g/licenses/by/4.0/), which pe mi s un es ic ed use, dis ibu ion, and ep oduc ion in any medium, p o ided he o iginal wo k is p ope ly ci ed. B ucella s ain 83–210 [13].Weando he sassumed ha he abili y o hese B ucella species o kill he mu ine hos may be due o di e ences in su ace an igens, in pa icula he s uc u e o lipopolysaccha ide (LPS) wi h a possibly highe endo oxic po en ial [13,14]. Because o i s low endo- oxici y, he LPS o classical B ucella species is conside ed as non-canonical in compa ison wi h ha o Esche ichia coli and o he pa hogenic bac e ia, enabling B ucella o es ablish ch onic in ec ions and e ade TLR4 de ec ion [15–17]. The LPS is a majo componen o he ou e memb ane and consis s o h ee key elemen s: (1) he lipid A, which p o ides he hyd ophobic LPS ancho in heou e memb ane,(2)aninne andou e co ecomposed o b anched-chain oligosaccha ides, and (3) an O-polysaccha ide (O-PS), linked o he ou e co e and p o uding in o he ex acellula en i onmen . In B ucella, he O-PS is cha ac e ized by a homopolyme ic linea chain o N- o myl-pe osamine esidues linked ia α- 1,2 and/o α-1,3 glycosidic bonds [18]. Depending on he ela i e abundance and dis ibu ion o hese bonds, he O-PS p o ides he A, M, and common (C) epi opes widely used o se o yping [19,20]. Depending on he p esence o absence o he O-PS, he colony pheno ype is ei he smoo h (S) o ough (R). All B ucella species ha in ec humans and li es ock a e na u ally S, excep o B ucella o is and B. canis [21]. Fo accina ion o li es ock agains b ucello- sis, S- and R-s ains ha e been used [22]. No ably, a speci ic in e ac ion be ween in ac LPS and he lipid a s in phagocy ic cells is esponsible o he selec i e en y o B ucella S-s ains in o he hos cells and a icking along he endocy ic pa hway [23–26]. In con as , R s ains do no en e he cell h ough he lipid a s and a e apidly elimina ed [25]. In his s udy, we cha ac e ized a spon aneous R-mu an (BmR SM ) o he B. mic o i e e ence s ain CCM4915 T . I s comple e genome sequence helped o iden i y a mu a ion inac i a ing he wbkE gene, known o be in ol ed in he syn hesis o O-PS [27]. To co e- la e his mu a ion wi h he R pheno ype and i ulence, we cons uc ed a knock-ou mu an (BmR ΔwbkE )by allelic exchange. The a e o R SM ,R ΔwbkE and hei complemen ed s ains in cellula and mu ine in ec ion models was s udied and compa ed o ha o he zoo- no ic s ain B. suis 1330. Ma e ial and me hods Bac e ial s ains, cul u e condi ions and pheno ypic cha ac e iza ion E. coli and B ucella s ains (Table 1)we eg ownunde ae obic condi ions a 37°C in Lu ia Be ani (LB, In i ogen) and T yp ic Soy (TS, Di co) media, espec i ely. When necessa y, media we e supplemen ed wi h kanamy- cin o ampicillin a 50 µg/ml, o wi h chlo amphenicol a 25 µg/ml. All expe imen s wi h iable B ucella we e pe - o med in a BSL-3 acili y. The smoo h (S) and ough (R) pheno ypes o B ucella we e assessed by c ys al iole s ain- ing [28] and by agglu ina ion es s using an i-R polyclonal an ise um and an i-A and an i-M monospeci ic se a (ANSES, F ance). Bac e ial mo phology was obse ed by a omic o ce mic oscopy (AFM). DNA analysis and mu an s ains cons uc ion Genomic DNA o B. mic o i was isola ed using he Qiagen Mini Ki . Whole-genome sho gun sequencing o he spon aneous ough s ain (BmR SM ) was pe - o med using Illumina pai ed-end sequencing wi h a lib a y inse size o 300 bp and an a e age a ge co e age o 484 x (GATC). BmR ΔwbkE o B. mic o i was ob ained by eplacing an in e nal po ion o gene BMI_I539 wi h a Kan R casse e. A ecombinan wbkE- Kan R -con aining plasmid de i ed om pGEM®-T was c ea ed as p e iously desc ibed [5,30]. B ie ly, wo DNA agmen s (A, 526 bp and B, 595 bp) each ca y- ing an EcoRI es ic ion si e in a 46-bp homology egion a he 3ʹ- and 5ʹ-end, espec i ely, we e ampli- ied by PCR. The agmen s we e used in a second PCR, o yield agmen AB (1075 bp) con aining he EcoRI si e in he middle and missing 608 ou o 1110 bp o he a ge gene BMI_I539 (i.e. om posi ions 71 o 678; Table 1). Following cloning o agmen AB in pGEM-T, he esul ing plasmid (pGEM-T-AB; Table 1) was diges ed wi h EcoRI and liga ed wi h he Kan R casse e (1282 bp) excised om plasmid pUC4K. The esul ing plasmid (pGEM-T-ABKan, 5357 bp; Table 1) was elec opo a ed in o B. mic o i. The Kan R /Amp S clones a ising om double-c osso e we e selec ed and e i ied by PCR (p ime s in Table 1). Same cons uc ions and p o ocols we e used o ob ain he ΔwbkE mu an o B. suis (BsR ΔwbkE ;Table 1). Using elec opo a ion, he h ee mu an s ains (BmR SM ,BmR ΔwbkE ,BsR ΔwbkE ) we e complemen ed wi h pBBR1MCS-wbkE ec o , con aining he wild- ype B. mic o i wbkE gene and i s up- and downs eam egions (Table 1). A omic o ce mic oscopy Bac e ia we e g own o s a iona y phase in TS, washed in PBS, ixed o 1 h in 2.5% glu a aldehyde and s o ed in PBS a 5 × 10 9 bac e ia/ml. Fluo oDish™cell cul u e dishes (Wo ld P ecision Ins umen s, UK) we e coa ed o e nigh a 4°C wi h 0.1% poly-L-lysine, washed wi h PBS, ai d ied and s o ed a 4°C. Bac e ia we e dilu ed VIRULENCE 869 20- old in PBS and added o he unc ionalized dish. Images we e eco ded wi h qp-BioAC CB2 can ile e s using he quan i a i e imaging mode a ailable on he NanoWiza d IV AFM (JPK Ins umen s –B uke ). The applied o ce was kep a 0.3 nN, and a cons an app oach/ e ac speed o 80 µm/s (z ange o 800 nm). Mac ophage in ec ion wi h B ucella s ains Mu ine J774A.1 mac ophage-like cells we e in ec ed wi h B. mic o i and B. suis s ains a a mul iplici y o in ec ion (MOI) o 20 as desc ibed p e iously [11]. All expe imen s we e pe o med in iplica e. In ec ion o Balb/c mice wi h B. mic o i s ains App o ed animal expe imen a ion guidelines we e ol- lowed in he mouse expe imen s and he wo king p o- ocol was app o ed by he CITA e hical animal expe imen commi ee. A p ocedu e o he assessmen o pain, dis ess and discom o in expe imen al ani- mals, adap ed om [31] was ollowed, assigning a sco e o each animal ega ding se e al a iables (weigh loss, appea ance, spon aneous beha io , esponses o ex e - nal s imuli and clinical signs). I he sco e ose o 15–20 poin s p io o spon aneous dea h, animals we e eu ha- nized and conside ed as ha ing succumbed o in ec ion. Bac e ia we e inocula ed i.p [11]. To es he le hali y o he bac e ial s ains, g oups o six 9-weeks-old Balb/c emale mice (Jan ie Labs) each we e in ec ed i.p. wi h 10 5 CFU o he wild- ype, BmR ΔwbkE and complemen- ed BmR ΔwbkE s ains o wi h 10 8 and 10 9 CFU o BmR SM and BmR ΔwbkE mu an s ains. Mice su i al was moni o ed o e a pe iod o 25 days pos -in ec ion (d.p.i.). To s udy he cou se o in ec ion in mice, Balb/c we e inocula ed i.p. wi h a dose o 10 4 CFU o B. mic o i s ains. Fi e mice pe s ain we e sac i iced a 3, 14 and 21 d.p.i. Following mice eu hanasia by CO 2 asphyxia- ion, spleens we e asep ically collec ed, weighed, homo- genized, se ially dilu ed and pla ed on o TS aga o iable coun s o B ucella. The signi icance o di e ences be ween s ains was analyzed by he S uden - es . P alues ≤0.05 we e conside ed signi ican . Sequence accession numbe The genomic DNA sequence o BmR SM has been depos- i ed in he SRA da abase (NCBI) unde he accession numbe PRJNA545613. Table 1. Bac e ial s ains, plasmids, and p ime s used in his s udy. Bac e ial s ains Ac onyms Desc ip ion Re e ence E. coli DH5αE. coli supE44 ΔlacU169(φ80lacZΔM15)hsdR17 ecA1endA1 gy A96 hi-1 elA1λpi In i ogen B. mic o i CCM4915 T BmS WT Wild- ype e e ence s ain, smoo h pheno ype [8] B. mic o i R SM BmR SM Spon aneous mu an o BmS WT , ough pheno ype This wo k B. mic o i R SM +pBBR-wbkE BmR SM p wbkE Complemen ed s ain o BmR SM ca ying he wbkE gene in plasmid pBBR1MCS This wo k B. mic o i ΔwbkE BmR ΔwbkE Dele ion mu an o BmS WT in which he wbkE gene is eplaced by a kanamycin casse e This wo k B. mic o i ΔwbkE +pBBR-wbkE BmR ΔwbkE p wbkE Complemen ed s ain o BmR ΔwbkE ca ying he wbkE gene in plasmid pBBR1MCS This wo k B. suis 1330 BsS WT Wild- ype e e ence s ain, smoo h pheno ype ATCC 23444 B. suis ΔwbkE BsR ΔwbkE Dele ion mu an o BsS WT in which he wbkE gene is eplaced by a kanamycin casse e This wo k B. suis ΔwbkE +pBBR-wbkE BsR ΔwbkE p wbkE Complemen ed s ain o BsR ΔwbkE ca ying he wbkE gene in plasmid pBBR1MCS This wo k Plasmids pGEM®-T T/A cloning ec o wi h ampicillin esis ance ma ke P omega pUC4K Plasmid ec o ca ying a kanamycin esis ance casse e (KanR) GE Heal hca e pBBR1MCS E. coli/B ucella shu le ec o wi h chlo amphenicol esis ance ma ke [29] pGEM-T-AB pGEM-T ca ying he AB PCR- agmen wi h sequences up- and downs eam o B ucella wbkE This wo k pGEMT-AB-Kan pGEM-T-AB ca ying KanR in EcoRI si e o he AB agmen This wo k pBBR1MCS-wbkE pBBR1MCS ca ying he wbkE PCR- agmen including he na i e gene wi h 398 bp up- and 600 bp downs eam egions cloned in o XhoI-SacI-si es This wo k P ime s F agmen Sequence (5ʹ-3ʹ) 1 Size (base pai s) A-BMI_I539-Fo A GCAGTGGATCGTGGTGTATG 526 bp A-BMI_I539 EcoRI-Re TGAGGTTTCATAGGCCCATCGAATTCCATGAATGGTTCGCTCAATG B-BMI_I539-EcoRI-Fo B CATTGAGCGAACCATTCATGGAATTCGATGGGCCTATGAAACCTCA 595 bp B-BMI_I539-Re ACATTAATCGCCCGACACTC BMI_I539-XhoI-Fo wbkE GCGCCTCGAGAGTTGCCATCATGAGCTTGT 1928 bp BMI_I539-SacI-Re GCGCGAGCTCTATCGGAAACAGTCGTGGTC 1 Res ic ion si es a e unde lined, and non-homologous egions a e indica ed by bold ype. Size o he used AB PCR- agmen ob ained using bo h p ime s A-BMI_I539-Fo and B-BMI_I539-Re , was 1075 bp. All PCRs we e pe o med wi h P x DNA polyme ase (In i ogen) using B. mic o i genomic DNA as ma ix. 870 S. OUAHRANI-BETTACHE ET AL. Resul s A spon aneous ough mu an o B. mic o i shows inc eased coloniza ion o mac ophages and is a i ulen in mice Following he i s pla ing o B. mic o i CCM4915 T on TS aga and s aining wi h c ys al iole , a ough colony was obse ed. The colony was picked, subcul u ed h ee imes and s ained again wi h c ys al iole : he ough pheno ype emained s able o all colonies on pla e. This s ain was named B. mic o i ough spon aneous mu an and abb e- ia ed BmR SM . I has been epo ed ha ough mu an s ains o B. suis and B. meli ensis exhibi educed in acellula su i al in in ec ed mac ophages, hough en y is imp o ed [28]. BmR SM indeed en e ed mu ine J774A.1 mac ophage cells app oxima ely 100- old be - e han he wild- ype s ain and B. suis 1330, which was used as s anda d e e ence (Figu e 1). In con as o B. suis and B. meli ensis ough s ains [28], BmR SM eplica ed 20-30- old, a leas up o 24 hou s pos - in ec ion (Figu e 1). To cha ac e ize he beha io o BmR SM in i o,Balb/c mice we e injec ed i.p. wi h he suble hal dose o 10 4 bac- e ia, as p e iously published by he au ho s o he B. mic o i wild- ype s ain [11]. The numbe o bac e ia eco e ed om spleen and li e 3 days a e inocula ion, co esponding o he peak o in ec ion o B. mic o i [11], was educed by 3.5 and 2.2 logs (P < 0.001), espec i ely, compa ed o hose p e iously ob ained wi h he wild- ype s ain (Table 2) and also con i med in his wo k (see la e sec ion on “acu e mu ine in ec ion”). The e o e, he ough mu an colonized hese o gans signi ican ly less han he wild- ype, esul ing in he lack o a ansien acu e phase o in ec ion. BmR SM s ain is cha ac e ized by a mu a ion o he glycosyl ans e ase-encoding gene wbkE To iden i y he mu a ion(s) esponsible o he ough pheno ype in BmR SM , i s genome was sequenced and compa ed wi h ha o B. mic o i CCM4915 T , accessible in he NCBI da abase. Ou o 48 a ian s, 28 we e assigned o SNV (Single Nucleo ide Va ian s) and 20 o InDel (Inse ion/Dele ion) a ian s. Sc u iny o he a ian s esul ed in e aining o 3 SNV and 4 InDels, ul illing all he ollowing c i e ia: (1) loca ed wi hin open eading ames o in he immedia e ups eam icini y, (2) causing amino acids subs i u ions, ame- shi - o s op-mu a ions in he co esponding genes, (3) no loca ed in pseudogenes, and (4) ep esen ing he mos p e alen a ian acco ding o he numbe o sequencing eads (≥90%) wi h espec o he e e ence sequence (Supplemen a y Table S1). Only ou mu a- ions we e in agenic and a ec ed he ollowing genes: BMI_I525 (2 SNVs), BMI_I539 (1 InDel) and BMI_I1103 (1 SNV), encoding a ansposase (ISBm1), a glycosyl ans e ase (wbkE) and a queuine RNA- ibosyl ans e ase ( g ), espec i ely. The mu a ion ound in wbkE was ega ded as he mos plausible cause o he ough pheno ype, because he homolo- gous gene BMEI1393 o B. meli ensis, loca ed in Time pos in ec ion (hou s) 1,5 7,0 24,0 48,0 B ucella/well (log10 CFU) 2 3 4 5 6 7 8 Figu e 1. In acellula eplica ion o smoo h B. mic o i CCM4915 T ( iangle down), he spon aneous ough mu an o B. mic o i (BmR SM ; iangle up), and smoo h B. suis 1330 (ci cle), in mu ine J774A.1 mac ophage-like cells. The numbe o colony o ming uni s (CFU) was de e mined by pla ing se ial dilu ions on TS aga pla es a e 2 o 3 days o incuba ion a 37°C o B. mic o i and B. suis, espec i ely. The expe imen s we e pe o med h ee imes in iplica e each. Da a a e p esen ed as mean alues ± SD o one expe imen (in iplica e). VIRULENCE 871 a highly conse ed clus e o he majo (wbk) gene ic egion o LPS syn hesis, pa icipa es in O-PS biosyn h- esis [2,27]. P o ein sequences o BMI_I539 and BMEI1393 a e iden ical o 368 ou o 369 amino acids. In BmR SM , dele ion o a T a posi ion 452 o wbkE causes a ameshi and he gene a ion o a p ema u e s op codon a posi ion 622. The esul ing p o ein sequence is he e o e expec ed o be unca ed a posi ion 207. Dele ion o he B. mic o i wbkE gene con i ms i s ole in smoo h (S-)LPS biosyn hesis and esul s in enhanced mac ophage up ake To con i m ha he absence o a unc ional wbkE is esponsible o he ough pheno ype and he educed i ulence o BmR SM , we cons uc ed a mu an (BmR ΔwbkE ) by eplacing a 608-bp in e nal agmen o wbkE wi h a Kan R casse e in he pa en al s ain. Colony s aining wi h c ys al iole and agglu ina ion wi h an i-R an ise um [32] con i med ha BmR ΔwbkE was ough as BmR SM (Table 3). In pa allel, we pe - o med a su ace analysis o smoo h and ough bac e - ial s ains by a omic o ce mic oscopy (AFM). AFM has been es ablished as a powe ul imaging echnique and allows cha ac e iza ion o he su ace mo phology o mic obial cells a he nanoscale [33]. We used a o ce- cu e-based imaging mode whe e he AFM ip is pushed owa d an a ea o he cell su ace and e ac ed om i , gene a ing a o ce s. sepa a ion dis ance cu e encoding in o ma ion abou heigh , adhesion o elas i- ci y o each image pixel. Su ace opog aphy o B. mic o i wild- ype and BmR ΔwbkE e ealed a uni o m, smoo h s uc u e o B. mic o i wild- ype, in con as o a jagged, i egula s uc u e o he BmR ΔwbkE mu an , wi h signi ican ly inc eased ough- ness (Figu e 2(a,b); Table 3). Mapping o he adhesion o ces be ween he ip and he bac e ial su ace also e ealed he p esence o la ge pa ches o inc eased adhesion a he su ace o BmR ΔwbkE when compa ed wi h he su ace o wild- ype bac e ia, sugges ing impo an di e ences in he molecula s uc u e o he BmR ΔwbkE mu an su ace (Figu e 2(a,c); Table 3). Bo h ough mu an s BmR ΔwbkE and BmR SM we e hen complemen ed wi h an in ac copy o wbkE cloned in ec o pBBR1MCS, which es o ed he smoo h phe- no ype, as e idenced by lack o c ys al iole s aining and by he agglu ina ion wi h an i-M an ise um only [8](Table 3). In addi ion, AFM con i med a smoo h su ace s uc u e o complemen ed BmR ΔwbkE , wi h oughness and adhesion o ces back o wild- ype le els (Figu e 2,Table 3). The BmR ΔwbkE mu an en e ed J774A.1 cells o an ex en simila o ha o he BmR SM mu an (100 imes mo e e icien han he pa en al s ain) and eplica ed 60- old o e 30 hou s (Figu e 3(a)). In con as , BmR ΔwbkE and BmR SM s ains complemen ed wi h an in ac copy o wbkE in ec ed mac ophages like he pa en al s ain and Table 2. Balb/c mice li e and spleen coloniza ion by B. mic o i S and R SM s ains 3 days pos -inocula ion. S ains Bac e ia/spleen (log10 CFU) Bac e ia/li e (log10 CFU) B. mic o i CCM4915 T Smoo h 6.52 ± 0.16 a 5.43 ± 0.21 a B. mic o i R SM 3.09 ± 0.59 3.27 ± 0.31 Resul s ep esen means ± SD. Di e ences be ween bo h s ains a e sig- ni ican in bo h o gans (P < 0.001). a P e iously published da a [11] Table 3. Pheno ypes o S and R s ains o B. mic o i and B. suis. A omic Fo ce Mic oscopy S ains C ys al iole s aining a Se um agglu ina ion b Roughness, nm ± SD Adhesion, pN ± SD B. mic o i CCM4915 T Smoo h - M 2.2 ± 0.67 124.6 ± 26 B. mic o i R SM +RND c ND B. mic o i R SM + pBBR-wbkE - M ND ND B. mic o i ΔwbkE + R 7.8 ± 4.35 446 ± 120.4 B. mic o i ΔwbkE + pBBR- wbkE - M 2.6 ± 1.57 166.1 ± 34.9 B. suis 1330 Smoo h - A ND ND B. suis 1330 ΔwbkE + R ND ND B. suis 1330 ΔwbkE + pBBR- wbkE - A ND ND a +, up ake; -, no up ake o c ys al iole by he colonies b wi h monospeci ic A, M, o R polyclonal an ise a c no de e mined 872 S. OUAHRANI-BETTACHE ET AL. eplica ed 400- and 250- old, espec i ely (Figu e 3(a)). An isogenic wbkE mu an o B. suis 1330 (BsR ΔwbkE )was also cons uc ed in o de o compa e i s beha io o ha o o he ough mu an s desc ibed in he pas [25,28]. As expec ed, he BsR ΔwbkE mu an e ained c ys al iole and agglu ina ed wi h an i-R an ise um (Table 3). I colo- nized he mac ophages 12 imes mo e e icien ly han he wild- ype, bu in con as o R-s ains o B. mic o i, a 3- old educ ion in in acellula su i al was obse ed wi hin a pe iod o 30 h, esul ing in 100 imes lowe Figu e 2. A omic Fo ce Mic oscopy (AFM) images o B. mic o i wild- ype (Bm WT), ΔwbkE mu an (Bm RΔwbkE) and he comple- men ed ΔwbkE mu an (Bm RΔwbkE compl). (a) Each column shows om op o bo om he e ical de lec ion image (heigh ) o he whole bac e ia and 0.3 × 0.3 µm 2 a eas o he cell su ace, ep esen ing oughness and adhesion eco ded on he shown bac e ia (blue squa e). Quan i a i e oughness (b) and adhesion (c) measu emen s o Bm WT, Bm RΔwbkE and complemen ed Bm RΔwbkE: 0.5 × 0.5 µm 2 images we e eco ded and used o measu emen s o 0.25 × 0.25 µm 2 a eas o quan i y a i hme ic oughness R a and adhesion (Peak- o-Valley). n = 9 bac e ia/s ain. S a is ical di e ences we e analyzed by - es and yielded P alues < 0.001 when compa ing Bm WT o Bm R ΔwbkE compl wi h Bm R ΔwbkE . Image analysis was done wi h Gwyddion [34]. VIRULENCE 873 iable coun s when compa ed o he wild- ype (Figu e 3(b)). This was e y simila o he beha io o he manB co e mu an o B. suis 1330 [25]. The complemen ed BsR ΔwbkE s ain agglu ina ed speci ically wi h an i-A an i- se um as he wild- ype s ain (Table 3) and showed wild- ype le els o in acellula in ec ion and eplica ion, despi e a s onge ansi ional dec ease in he ea ly phase o in ec ion (Figu e 3(b)). The B. mic o i wbkE gene is indispensable o acu e mu ine in ec ion In ec ion o Balb/c wi h 10 4 CFU o B. mic o i s ains showed a 3-logs educ ion o BmR ΔwbkE in he spleen a day 3 pos -injec ion, as compa ed o he wbkE-comple- men ed mu an and wild- ype s ains (Figu e 4(a)), con- i ming he incapaci y o a ΔwbkE mu an s ain o B ucella/well (log10 CFU) Time pos in ec ion (hou s) 1,5 7,0 24,0 30,0 B ucella/well (log10 CFU) 2 3 4 5 6 7 8 Time pos in ec ion (hou s) 1,5 7,0 24,0 30,0 2 3 4 5 6 7 8 ba Figu e 3. In acellula eplica ion o smoo h and ough s ains o B. mic o i (a) and B. suis (b) in mu ine J774A.1 mac ophage-like cells. (a) B. mic o i CCM4915 T wild- ype ( illed iangle down), he spon aneous R-s ain BmR SM (open iangle up), he complemen ed BmR SM mu an ( illed iangle up), he cons uc ed R-s ain BmR ΔwbkE (open ci cle), and he complemen ed BmR ΔwbkE mu an ( illed ci cle). (b) B. suis 1330 wild- ype ( illed iangle down), he cons uc ed R-s ain BsR ΔwbkE (open ci cle), and he complemen ed BsR ΔwbkE mu an ( illed ci cle). The complemen ed s ains exp essed na i e wbkE cloned in o he eplica i e plasmid pBBR1MCS. The expe imen s we e pe o med h ee imes in iplica e each. Da a a e p esen ed as mean alues ± SD o one expe imen (in iplica e). Time (days) 3 d 14 d 21 d Bac e ia / spleen (log10 CFU) 0 1 2 3 4 5 6 *** ab Time (days) 3 d 14 d 21 d Spleen weigh (g ams) 0,0 0,1 0,2 0,3 0,4 0,5 *** *** ** * Figu e 4. In ec ion o Balb/c mice wi h B. mic o i s ains: g ow h and su i al o B. mic o i s ains in he spleen (a) and spleen weigh s o in ec ed animals (b) a e i.p. inocula ion o 10 4 bac e ia. The numbe o iable B. mic o i CCM4915 T wild- ype (black ba s), BmR ΔwbkE s ain (open ba s), and complemen ed BmR ΔwbkE mu an (g ey ba s) was de e mined a days 3, 14, and 21 pos -in ec ion. The a ow indica es he in ec ion dose o 10 4 bac e ia. Fi e mice we e sac i iced pe bac e ial s ain and ime poin , and alues ep esen means ± SD. As e isks indica e a iable signi icance o he di e ences be ween he R-s ain and he wild- ype (nex o le ba ) o R-s ain and he complemen ed mu an (nex o igh ba ), o be ween he R-s ain and bo h he wild- ype and he complemen ed mu an (abo e middle ba ): * P < 0.05; ** P < 0.005; *** P < 0.001. 874 S. OUAHRANI-BETTACHE ET AL. es ablish an acu e phase o in ec ion in he hos (see also Table 2).Theacu ein ec ionphaseobse edwi h hewild- ype and he wbkE-complemen ed s ains was ollowed by an inc ease o he spleen weigh un il a leas day 14, e lec ing an in lamma o y esponse (Figu e 4(b)). In con- as , mice in ec ed wi h BmR ΔwbkE did no gain spleen weigh . A simila inding was ob ained when he s ain BmR SM was injec ed i.p. a 10 4 CFU, as spleen weigh s emained unchanged a day 3 and day 14 (0.09 ± 0.007 and 0.10 ± 0.015, espec i ely; P < 0.001), con i ming a educed immune esponse induc ion wi h he wbkE- mu an ough s ains. The wbkE gene is essen ial o he le hal cha ac e o B. mic o i in ec ions in Balb/c mice Ou p e ious wo k showed ha he in a-pe i oneal injec- ion o 10 5 CFU o B. mic o i CCM4915 T caused he dea h o 83%o heBalb/cmicewi hin ou dayso in ec ion[11]. Toin es iga e hepossiblein ol emen o hewbkE gene in he le hal ou come o a B. mic o i in ec ion, he suscep - ibili y o Balb/c mice in ec ed wi h BmR SM o BmR ΔwbkE was compa ed o ha obse ed ollowing in ec ion wi h he B. mic o i CCM4915 T wild- ypeand hecomplemen ed BmR ΔwbkE s ains, o e a moni o ing pe iod o 25 days (Table 4): 67% and 83% o he mice in ec ed wi h he s anda d dose o 10 5 CFU o he wild- ype o he comple- men ed BmR ΔwbkE s ain, espec i ely, died be ween days 2 and 6 pos -inocula ion. In s iking con as , all he mice in ec ed wi h 10 5 CFU o BmR ΔwbkE su i ed wi hou any symp oms. 100% su i al was also obse ed o bo h R-mu an s ains BmR SM and BmR ΔwbkE a e he injec ion o 10 8 CFU. Howe e , when inocula ed wi h 10 9 CFU o ei he R-s ain, all mice died be ween days 2 and 6 pos - inocula ion. These esul s a e e en mo e no able i com- bined wi h ou p elimina y obse a ion (no shown) ha BmR SM in Balb/c mice p o ided p o ec ion agains B. mic o i wild- ype, B. abo us, B. meli ensis and B. suis 1330. Discussion The non-canonical LPS o classical b ucellae lacks endo oxici y and possesses a pa icula co e s uc u e helping o e ade he hos ’s immune sys em [35,36]. The phenomenon o dissocia- ion, esul ing in he con e siono S- oR-pheno ype,hasbeen i s desc ibed o B ucella in 1933 [37]. Mo e ecen ly, B. abo us, B. meli ensis and B. suis R-mu an s de oid o O-PS ha e been s udied in cellula and mu ine models o in ec ion [25,27,28,38,39]. These s udies consis en ly showed he ele ance o O-PS o i ulence. The educed i ulence o R-mu an s has been a ibu ed o (1) high sensi i i y o com- plemen -media ed lysis in mice [40,41], (2) lipid a - independen en y in o mac ophages esul ing in enhanced phagolysosome usion [25], and (3) lack o in acellula eplica- ion due o mac ophage ac i a ion [28]. Monoclonal an ibodies speci ic o common O-PS epi opes o A- o M-dominan classical s ains also ecognize LPS o he M-dominan B. mic o i e e ence s ain [14], indica ing a conse ed s uc u e o O-PS. Howe e , an i-R-LPS monoclonal an ibodies do no eac wi h B. mic o i LPS, sugges ing s uc u al speci ici ies in he co e-lipid A moie y o i s LPS [14], which may esul in enhanced endo oxic p ope ies and possibly explain he killing abili y o B. mic o i in he mu ine model o in ec ion. Because o he lack o da a a ailable on a ypical species mu an s a ec ed in O-PS biosyn hesis, we in es iga ed he i ulence p ope ies o a spon aneous R-mu an o B. mic o i, which was o ui ously isola ed. Mu ine in ec- ion expe imen s showed a loss o le hali y o his mu an , and subsequen analysis by whole-genome sequencing allowed o link his abili y o he wbkE gene, encoding a glycosyl ans e ase loca ed in he majo O-PS biosyn hesis egion, as p e iously desc ibed o B. meli ensis [27]. Complemen a ion o R-mu an s es o ed wild- ype p ope - ies including smoo h cha ac e , educed mac ophage en y and mu ine le hali y, demons a ing ha he BmR SM s ain was a ec ed in a single LPS biosyn hesis gene. In con as , spon aneous R-mu an s o B. abo us and B. meli ensis iso- la ed om mac ophage and mu ine in ec ions we e o en simul aneously a ec ed in se e al loci [42]. Cell su ace s uc u e analysis by AFM con i med he smoo h cha ac e o he wild- ype and complemen ed BmR ΔwbkE s ains, whe eas a dis inc i egula su ace was eco ded o BmR ΔwbkE , possibly due o exposu e o ou e memb ane p o eins and lipid A/ou e co e disaccha ides in he absence o he O-chain [27]. This exposu e may also explain he inc eased adhesion o ces obse ed du ing he in e ac ion o he AFM ip wi h he R-mu an su ace. Con e sely, in a ecen epo , AFM analysis o wo B. abo us s ains, a wild- ype and i s isogenic mu an Δgmd R lacking O-chain, shows simila deg ees o oughness [43]. S uc u al di e ences in he LPS co e-lipid A moie ies o Table 4. Le hali y o B. mic o i S and R s ains in Balb/c mice S ains In ec ion dose (i.p.) % Mo ali y ab B. mic o i CCM4915 T Smoo h 10 5 67 B. mic o i R SM 10 8 0 10 9 100 B. mic o i ΔwbkE10 5 0 10 8 0 10 9 100 B. mic o i ΔwbkE+ pBBR-wbkE10 5 83 a Each bac e ial s ain was inocula ed o a g oup o six 9-weeks-old Balb/c emale mice b O e a 25-days pe iod o moni o ing, mu ine dea h occu ed be ween days 2 and 6 pos -inocula ion VIRULENCE 875