scieee Open visual document viewer

Exploiting genetic diversity and gene synthesis to identify superior nitrogenase NifH protein variants to engineer N2-fixation in plants

Jiang, X.; Castellanos-Rueda, R.; Coroian, D.; García-Rubio, I.; Eseverri, Á.; Payá-Tormo, L.; López-Torrejón, G.; Rubio, L.M.; Burén, S.

Abstract

Engineering nitrogen fixation in eukaryotes requires high expression of functional nitrogenase structural proteins, a goal that has not yet been achieved. Here we build a knowledge-based library containing 32 nitrogenase nifH sequences from prokaryotes of diverse ecological niches and metabolic features and combine with rapid screening in tobacco to identify superior NifH variants for plant mitochondria expression. Three NifH variants outperform in tobacco mitochondria and are further tested in yeast. Hydrogenobacter thermophilus (Aquificae) NifH is isolated in large quantities from yeast mitochondria and fulfills NifH protein requirements for efficient N2 fixation, including electron transfer for substrate reduction, P-cluster maturation, and FeMo-co biosynthesis. H. thermophilus NifH expressed in tobacco leaves shows lower nitrogenase activity than that from yeast. However, transfer of [Fe4S4] clusters from NifU to NifH in vitro increases 10-fold the activity of the tobacco-isolated NifH, revealing that plant mitochondria [Fe-S] cluster availability constitutes a bottleneck to engineer plant nitrogenases. Jiang, X.; Payá-Tormo, L.; Coroian, D.; García-Rubio, I.; Castellanos-Rueda, R.; Eseverri, Á.; López-Torrejón, G.; Burén, S.; Rubio, L.M.

Full text

ARTICLE Exploi ing gene ic di e si y and gene syn hesis o iden i y supe io ni ogenase Ni H p o ein a ian s o enginee N 2 -fixa ion in plan s Xi Jiang 1,2, Lucía Payá-To mo 1,2, Diana Co oian1, Inés Ga cía-Rubio 3, Rocío Cas ellanos-Rueda 1,4, Ál a o Ese e i 1,2, Gema López-To ejón1,2, S e an Bu én 1✉& Luis Manuel Rubio 1,2✉ Enginee ing ni ogen fixa ion in euka yo es equi es high exp ession o unc ional ni ogenase s uc u al p o eins, a goal ha has no ye been achie ed. He e we build a knowledge-based lib a y con aining 32 ni ogenase ni H sequences om p oka yo es o di e se ecological niches and me abolic ea u es and combine wi h apid sc eening in obacco o iden i y supe io Ni H a ian s o plan mi ochond ia exp ession. Th ee Ni H a ian s ou pe o m in obacco mi ochond ia and a e u he es ed in yeas . Hyd ogenobac e he mophilus (Aquifi- cae) Ni H is isola ed in la ge quan i ies om yeas mi ochond ia and ulfills Ni H p o ein equi emen s o e ficien N 2 fixa ion, including elec on ans e o subs a e educ ion, P- clus e ma u a ion, and FeMo-co biosyn hesis. H. he mophilus Ni H exp essed in obacco lea es shows lowe ni ogenase ac i i y han ha om yeas . Howe e , ans e o [Fe 4 S 4 ] clus e s om Ni U o Ni H in i o inc eases 10- old he ac i i y o he obacco-isola ed Ni H, e ealing ha plan mi ochond ia [Fe-S] clus e a ailabili y cons i u es a bo leneck o enginee plan ni ogenases. h ps://doi.o g/10.1038/s42003-020-01536-6 OPEN 1Cen o de Bio ecnología y Genómica de Plan as, Uni e sidad Poli écnica de Mad id, Ins i u o Nacional de In es igación y Tecnología Ag a ia y Alimen a ia, Pozuelo de Ala cón, 28223 Mad id, Spain. 2Depa amen o de Bio ecnología-Biología Vege al, Escuela Técnica Supe io de Ingenie ía Ag onómica, Alimen a ía y de Biosis emas, Uni e sidad Poli écnica de Mad id, 28040 Mad id, Spain. 3Cen o Uni e si a io de la De ensa, C a. de Huesca s/n, 50090 Za agoza, Spain. 4Depa men o Biosys ems Science and Enginee ing, ETH Zü ich, 4058 Basel, Swi ze land. ✉email: s e an.bu [email protected];lm. [email protected] COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio 1 1234567890():,; Ni ogen (N) e ilize s used o inc ease c op p oduc i i y in in ensi e ag icul u e p ac ices pollu e g oundwa e and elease g eenhouse gasses1. On he o he hand, sub- sis ence ag icul u e p ac ices including poo N e iliza ion p o- duce low and inconsis en yields causing malnu i ion and po e y2,3. The e is la ge in e es in enginee ing ce eal c op a ie ies capable o acqui ing hei own N4. One app oach o his ou come elies on unc ional exp ession o a ni ogenase enzyme by he ce eal plan 5. Ni ogenases a e p oka yo ic, O 2 -sensi i e, wo-componen me allop o eins ha con e ine N 2 in o bio- logically use ul NH 3 6–8. The mos e ficien and widesp ead a - ian , he molybdenum ni ogenase, is composed o an Fe p o ein (ni H-encoded) and a MoFe p o ein (encoded by ni D and ni K). The Fe p o ein (Ni H) dona es elec ons o he MoFe p o ein (Ni DK) ha in u n educes N 2 . Nascen Ni H and Ni DK polypep ides need o acqui e p ope qua e na y s uc u e and o ecei e me al clus e s, one [Fe 4 S 4 ] clus e pe Ni H homodime and wo pai s o P-clus e and FeMo-co pe Ni DK he e o- e ame , o unc ionali y. We ha e ecen ly e iewed he mechanisms and gene ic equi emen s o assemble hese co ac o s and o ma u e Ni H and Ni DK in o ac i e Mo ni ogenase9. The la ge numbe o ni ogen fixa ion (ni ) genes in ol ed, and he sensi i i y o mos o he p o ein p oduc s owa ds O 2 , makes ni ogenase enginee ing a daun ing ask wi h issues ha need o be sol ed s epwise. To da e, unc ional Ni H, Ni U, and Ni B ha e been pu ified om mi ochond ia o ae obically cul u ed Saccha omyces ce e i- siae cells10,11, while ac i e Ni U and Ni H we e isola ed om chlo oplas s o Nico iana ben hamiana a he end o he da k pe iod12. Also, he epo ed low s abili y o he Ni D p o ein13 has now been imp o ed in wo ecen s udies ha iden ified key esidues in he Ni D sequence as suscep ible o clea age upon mi ochond ia impo 14,15. No wi hs anding hese achie emen s, de ailed analysis o yeas mi ochond ia- a ge ed Azo obac e inelandii Ni H has been hampe ed by low p o ein solubili y esul ing in subop imal yields10. Accumula ion o mos ly insoluble Ni H was also epo ed when Klebsiella oxy oca Ni H was a ge ed o he obacco mi ochond ia16. The di ficul y o exp essing high le els o soluble and unc ional Ni H in yeas and obacco poses a majo p oblem o euka yo ic ni ogenase enginee ing as i is he mos abundan Ni p o ein du ing N 2 fixa ion17. The p oblem is exace ba ed because, in addi ion o se ing Ni DK wi h elec ons o subs a e educ ion, Ni H is equi ed o ma u e P-clus e s on o Ni DK and o he final s eps o FeMo-co biosyn hesis in complex wi h Ni EN9. Fo hese easons i is essen ial o iden i y a Ni H a ian ha is highly soluble and s able when exp essed a e y high le els in a plan cell, and ha can pe o m all h ee Ni H- dependen ac i i ies. One app oach o achie e his ou come would be p o ein enginee ing o well-s udied Ni H om model diazo- ophs (e.g., A. inelandii o K. oxy oca) aimed o in oduce sequences ha imp o e s abili y in he mi ochond ia18. P o ein enginee ing has been ex ensi ely employed o ob ain glyphosa e esis ance19, ano he impo an ai o c ops. Al e na i ely, mining o phylogene ically di e se ni H sou ces can be unde aken in o de o find na u al Ni H p o eins wi h supe io p ope ies, a s a egy ha was success ul o Ni B11 and o inc easing ca - o enoid le els in “Golden Rice”20. He e, 32 dis inc ni H genes we e sc eened o exp ession le el and solubili y in mi ochond ia o N. ben hamiana. The ni M, ni U, and ni S genes we e co-exp essed because hei p o ein p oduc s a e in ol ed in Ni H olding and in he biosyn hesis and deli e y o i s [Fe 4 S 4 ] clus e 9. The Hyd ogenobac e he mophilus Ni H was iden ified as as ly supe io o he A. inelandii Ni H in e ms o exp ession le els, solubili y, and unc ionali y bo h in obacco and yeas mi ochond ia. Mi ochond ia- a ge ed H. he - mophilus Ni H sa isfied all unc ional and spec oscopic equi emen s o a ni ogenase Fe p o ein when pu ified om yeas . The sc eening also pinpoin ed he plan mi ochond ia [Fe- S] clus e assembly as a bo leneck o u he enginee ing. Resul s Lib a y design and s a egy o exp ession o mi ochond ia- a ge ed Ni H in N. ben hamiana. A lib a y o 32 ni H sequences om phylogene ically di e se p oka yo es was designed con- side ing one o se e al o he ollowing c i e ia: (i)ni H genes ound in confi med diazo ophs; (ii)ni H genes om pho o ophs o plan -associa ed bac e ia; (iii)ni H genes om ae obic o gan- isms; (i ) g ow h empe a u e o he ni H hos ; ( )ni H genes om a chaeal ep esen a i es (Supplemen a y Da a 1). O ganized by phyla, he selec ion included genes om 1 Aquificae, 4 Fi micu es, 1 Ac inobac e ia, 15 P o eobac e ia, 6 Cyanobac e ia, 1 Chlo obi, 1 Chlo oflexi, and 3 Eu ya chaeo a (Fig. 1a). The wo kflow o his s udy is desc ibed in Fig. 1b. The gene sequences encoding he 32 Ni H a ian s we e cloned in o plan ec o s o Ag obac e ium ume aciens infil a ion-media ed Ni H exp ession in N. ben hamiana lea es (Supplemen a y Table 1, see Me hods sec ion o de ails). The ni H sequences we e codon- op imized o S. ce e isiae because codon-usage is simila o obacco21 and he wo kflow included downs eam exp ession o obacco-selec ed Ni H a ian s in yeas o biochemical cha ac e - iza ion. The genes we e unde con ol o he s ong and cons i u i e E35S p omo e . Amino- e minal COX4-TS ex ensions we e added o Ni H p o eins. COX4 is he 29 amino acid ansi pep ide o he S. ce e isiae mi ochond ia p o ein cy och ome c oxidase subuni IV (MLSLRQSIRFFKPATRTLCSSRYLLQQKP), whe eas TS deno es he 28 amino acid Twin-S ep-Tag pep ide (WSHPQFEKGGGSGGGSGGSAWSHPQFEK)22. COX4 a ge ed Ni H p o eins o he mi ochond ia ma ix and TS was used o enable a ian -independen immunoblo de ec ion o Ni H and o acili a e i s pu ifica ion. Impo an ly, he TS- ag has been shown o no significan ly a ec Ni H unc ionali y12. COX4-TS-Ni H a ian s a e he ea e deno ed as NbNi HXx whe e Nb s ands o he hos N. ben hamiana,Xx deno es a ian s collec i ely, and o he supe sc ip s indica e he species om which Ni H sequence was ob ained. Vec o s wi h NbNi HXx cons uc s addi ionally con ained a ansc ip ional uni o exp ession o he g een fluo escen p o ein (GFP) ha was used as indica o o success ul lea infil a ion (Supplemen a y Table 1). An auxilia y ec o was cons uc ed o co-exp ess A. inelandii ni M,ni U, and ni S and a ge hei p o ein p oduc s o mi ochond ia ia N- e minal SU9 ex ensions. Simila o COX4, he mi ochond ial p esequence o subuni 9 o he Neu ospo a c assa F 0 -ATPase23 (SU9) has been shown o deli e Ni p o eins o N. ben hamiana mi ochond ia24. Ni U and Ni S assemble [Fe- S] clus e s des ined o Ni p o eins in A. inelandii25. While no essen ial o exp ession o unc ional Ni HA in S. ce e isiae mi ochond ia10 hey we e equi ed o gene a e high amoun s o ac i e Ni B in yeas 11. As we aimed o iden i y Ni H a ian s accumula ing a highe le els han Ni HA , Ni UA and Ni SA we e included in his s udy. In A. inelandii and o he well- s udied diazo ophs Ni M is in ol ed in Ni H olding o dime iza ion p io [Fe 4 S 4 ] clus e acquisi ion9,26. Despi e ni M no being p esen in o ganisms o some selec ed ni H a ian s (Supplemen a y Da a 1), his gene was always included in infil a ion expe imen s o consis ency. Iden ifica ion o Ni H p o eins sui able o exp ession in N. ben hamiana.N. ben hamiana lea es we e co-infil a ed wi h a 1:1:1 mix u e o h ee dis inc A. ume aciens cul u es o exp ession o , espec i ely, one NbNi HXx a ian plus GFP, he auxilia y p o eins NbNi MA ,NbNi UA , and NbNi SA , and he ARTICLE COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 2COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio RNA silencing supp esso p19 o enhance he ni ansgene exp ession (Fig. 1b)27. P o ein ex ac s we e p epa ed om he N. ben hamiana lea es h ee days a e infil a ion and analyzed o accumula ion o soluble NbNi HXx using an ibodies ecognizing he TS- ag. Only wo Ni H a ian s we e consis en ly de ec ed among expe imen s (Fig. 1c, Supplemen a y Fig. 1a), namely hose o igina ing om Me hanocaldococcus in e nus (NbNi HMi) and Hyd ogenobac e he mophilus (NbNi HH ). A hi d Ni H a ian om Me hano he mobac e ma bu gensis (NbNi HMm) was de ec ed a low le els a one occasion. In con as , analysis o o al ex ac s p epa ed om he infil a ed obacco lea es showed ha , al hough accumula ion le els o he NbNi HXx p o eins a ied significan ly, 25 o he 32 a ian s could be de ec ed (Supplemen a y Fig. 1b). Only NbNi H exp ession o a ian s om B ady hizobium japonicum,Rhizobium leguminosa um b . i olii,He baspi illum se opedicae,Gloeo hece sp. KO68DGA, Rhodopseudomonas palus is,Me hano he mobac e he mau o- ophicus, and F ankia sp. (s ain FaC1) could no be demon- s a ed. Sequence alignmen s and 3D-modeling o Ni HMi, Ni HH , and Ni HMm a e shown in Supplemen a y Fig. 2. The 3D-models did no e eal any specific ea u e ha would explain hei supe io accumula ion as soluble p o ein in obacco mi o- chond ia, bu all h ee p o eins o igina e om he mophilic o ganisms (Supplemen a y Da a 1) which could possibly explain hei s abili y and solubili y. Ac i i y o Ni H a ian s isola ed om mi ochond ia o ae obically cul u ed S. ce e isiae.N. ben hamiana sc eening- iden ified a ian s and Ni HA we e exp essed in S. ce e isiae and pu ified by S ep- ag a fini y ch oma og aphy (STAC) o e alua e unc ionali y when a ge ed o mi ochond ia. Fo his, genes encoding COX4-TS-Ni H cons uc s we e ans e ed o exp es- sion ec o s oge he wi h su9-ni MA ,su9-ni UA , and su9-ni SA unde he con ol o galac ose-inducible GAL1 o GAL10 p o- mo e s (Supplemen a y Table 2, Supplemen a y Fig. 3a). These COX4-TS-Ni H a ian s exp essed in ae obic S. ce e isiae cul- u es a e he ea e deno ed ScNi HMm,ScNi HMi,ScNi HH , and ScNi HA (ScNi HXx collec i ely). While ScNi HMm,ScNi HMi, and ScNi HH we e pu ified o nea homogenei y (Fig. 2a), SDS-PAGE analysis o ScNi HA showed addi ional slowe mig a ing co-elu ing p o eins. Mass spec ome y confi med ha hese we e con aminan s (Fig. 2a). ScNi HA solubili y was low and much p o ein was los o he pelle ac ion when p epa ing he soluble cell- ee ex ac (CFE) explaining i s poo pu ifica ion yield (abou 11 mg pe kg o S. ce e isiae cells) (Supplemen a y Fig. 3b–e, Supplemen a y Table 3). The yield o ScNi HMm was also ela i ely low, in line wi h he in e io esul in he N. ben hamiana sc eening. In con as , he yields o ScNi HMi and ScNi HH we e ca. 20 imes highe . I on (Fe) quan ifica ion o pu ified samples was a iable bu indica ed ha ScNi HH was isola ed la gely as holo-p o ein con aining one [Fe 4 S 4 ] clus e pe dime (Supplemen a y Table 3). Consis en ly, immunoblo analysis showed ha ScNi HH , ScNi MA ,ScNi UA , and ScNi SA had been e ficien ly a ge ed o he mi ochond ia (Supplemen a y Fig. 4). Ac i i ies o pu ified ScNi HXx a ian s we e de e mined in i o using he ace ylene educ ion assay (ARA) and compa ed Euka ya Eu ya chaeo a (3) C ena chaeo a Nanoa chaeo a Thauma chaeo a Ko a chaeo a P o eobac e ia (15) (8) (2) (2) (3) Ac inobac e ia (1) Fi micu es (4) Bac e oides Aqui icae (1) Chlo o lexi (1) Chlo obi (1) Cyanobac e ia (6) LUCA Bac e ia (29) The mo ogae To al (32) ab 48 - 35 - Ponceau 28 - α-GFP 48 - 35 - α-Ni S 35 - α-Ni U 35 - α-Ni M 35 - kDa C l S ep-HRP (NbNi HXx) : Ni H : Ni U/Ni S/Ni M c+++++ -A Mm Mi H Ni H lib a y design (N. ben hamiana) s nai a H iN 3s nai a H iN 23 Pu i ica ion Scale up (I) (III) Lea in il a ion (A. ume aciens) Ni H pu i ica ions (S. ce e isiae)(II) Ni H + GFP (pN2XJ81-pN2XJ112) Ni U/Ni S/Ni M (pN2XJ165) p19 (GB1203) M. ma bu gensis M. in e nus H. he mophilus Solubili y sc eening (N. ben hamiana) H. he mophilus Ni H Ni H cha ac e iza ion ( H. he mophilus ) In i o complemen a ion (A DJ77) (V) 3 Ni H a ian s Ni H + Ni U/Ni S/Ni M H. he mophilus (XJ1Y) M. ma bu gensis (XJ2Y) M. in e nus (XJ3Y) Ace ylene educ ion analysis (yeas pu i ied Ni H) H. he mophilus Ni H unc ional N i H inac i e Ni H + Ni U/Ni S/Ni M + GFP + p19 (pAE382) Ac i i y analysis ( obacco pu i ied H. he mophilus Ni H) Fe e iliza ion Ex ended da k pe iod (N. ben hamiana) (VIII) N i H ac i e Ni H + Ni U/Ni S/Ni M + GFP + p19 (pAE382) H. he mophilus Ni H pu i ica ion (N. ben hamiana) (VII) (IV) [Fe 4 S 4 ] analysis (yeas Ni H) i) P-clus e ma u a ion ii) FeMo-co syn hesis iii) N 2 educ ion (yeas Ni H) (VI) Fig. 1 Ni H lib a y design and sc eening. a Phylogene ic ee indica ing he dis ibu ion and numbe o he es ed Ni H a ian s among bac e ial phyla (blue) and a chaeal lineage (magen a). bExpe imen al wo kflow o his s udy. cImmunoblo s o N. ben hamiana soluble p o ein ex ac s de eloped wi h an ibodies agains TS, GFP, Ni U, Ni S, and Ni M (s ep I o panel b). GFP de ec ion was used as con ol o no malize e ec i eness o infil a ion expe imen s. Ponceau s aining panel is shown as loading and memb ane ans e con ol. Do ed line indica es di e en exposu es o he same memb ane. Cell- ee ex ac s o A. inelandii DJ ( o Ni U and Ni S) o E. coli Rose a (DE3) o e exp essing Ni MA ( o Ni M, as Ni M exp ession le els in A. inelandii is low) we e used as size con ols. Unc opped immunoblo s a e shown in Supplemen a y Fig. 8. COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 ARTICLE COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio 3 o ha o Ni H pu ified om A. inelandii (deno ed Ni HA ). In all cases Ni DK pu ified om A. inelandii (deno ed Ni DKA ) was used as MoFe p o ein componen . ScNi HA ac i i y was 85% o Ni HA (Fig. 2b), suppo ing p e ious obse a ions ha STAC is sui able o pu ifica ion o me al-clus e con aining Ni p o eins exp essed in yeas 11,28.ScNi HH specific ac i i y was abou hal o ScNi HA , while ScNi HMm and ScNi HMi showed e y low ac i i ies (Fig. 2b). The assay did no de e mine whe he lowe ac i i ies we e due o Ni H a ian de ec s, o o incompa ibili y wi h ScNi USA in i o ( esul ing in apo-Ni H p o ein wi h low [Fe 4 S 4 ] clus e occupancy) o Ni DKA in i o ( esul ing in poo elec on dona ion). Recons i u ion o ScNi HMm [Fe 4 S 4 ] clus e s in i o by ei he mixing wi h Fe, L-cys eine, DTT, and EcNi SA (di ec econs i u ion) o by incuba ing wi h [Fe 4 S 4 ] clus e - loaded EcNi UA (Ni U-media ed econs i u ion) did no ac i a e he p o ein (Supplemen a y Fig. 5), indica ing ha his Ni H a ian is no compa ible wi h Ni DKA . In con as , ScNi HMi was ac i a ed o some ex en by Ni UA , and u he by di ec econs i u ion, indica ing ha he A. inelandii Ni US machine y is no op imal o Ni HMi (Supplemen a y Fig. 5). Howe e , ac i i ies we e e y low compa ed o he as-isola ed ScNi HH p o ein (Fig. 2b). This could be explained by Ni HH ha bo ing mo e o he conse ed amino acid esidues known o be impo an o he in e ac ion wi h Ni DKA (Supplemen a y Fig. 2). Impo an ly, soluble accumula ion o ScNi HH in mi ochon- d ia was 20- old highe han ScNi HA (Supplemen a y Table 3), which ansla es in o a leas 10- old highe in i o ac i i y and ulfills Ni H quan i y equi emen s o ni ogenase enginee ing. Thus, ScNi HH was u he cha ac e ized. ScNi HH exhibi s Ni H-cha ac e is ic spec oscopic signals and is unc ional in i o. Pu ified ScNi HH p o ein p esen ed ul a iole – isible (UV– is) abso p ion spec a ypical o O 2 - sensi i e [Fe-S] clus e -con aining p o eins (Fig. 3a). Amino- e minal sequencing e ealed ha amino acid esidues EQKP emained a e COX4 p ocessing (Fig. 3b), whe e con e sion o glu amine (Q) o glu amic acid (E) could be due o deamina ion pe o med by he mi ochond ial ma ix N- e minal amidase NTA129. Elec on pa amagne ic esonance (EPR) confi med ha ScNi HH p o ein con ained an [Fe 4 S 4 ] clus e wi h simila signal in ensi y and g- alues as Ni HA (Fig. 3c), sugges i e o success ul ma u a ion in o unc ional Fe p o ein. The Ni H a ian chosen o enginee N 2 -fixing plan s mus pe o m P-clus e ma u a ion and FeMo-co biosyn hesis in addi ion o se e as elec on dono o subs a e educ ion. We he e o e es ed whe he H. he mophilus Ni H could e e he Ni −pheno ype o A. inelandii DJ77 (Δni H s ain)30. Fo his, s-ni HH was in oduced by ans o ma ion in o DJ77 and he esul ing s ain UW481 was es ed o diazo ophic g ow h and in i o ace ylene educ ion ac i i y. UW481 showed diazo ophic g ow h bo h in solid and liquid media (Supplemen a y Fig. 6a, b), and immunoblo analysis demons a ed sus ained A Ni HH exp ession and ace ylene educing ac i i y indica i e o ac i e ni ogenase (Supplemen a y Fig. 6c, d). These da a s ongly indica e ha Ni HH can eplace he unc ions o na i e A. inelandii Ni H o some ex en , which equi es p oduc i e in e ac ions wi h a leas apo-Ni DKA , Ni DKA , and Ni ENA p o eins. ScNi HH is ac i e in subs a e educ ion, P-clus e o ma ion and FeMo-co syn hesis. Each indi idual Ni H-dependen ac i i y was hen analyzed in i o using pu e ScNi HH p epa a ions (Fig. 3d). P-clus e ma u a ion was de e mined by supplemen ing CFE o A. inelandii DJ77 (Δni H) wi h ScNi HH . The DJ77 ex ac is de oid o FeMo-co and con ains inac i e apo-Ni DKA wi h imma u e P-clus e s. The P-clus e ma u a ion assay using DJ77 CFE elies on posi i e ou comes o h ee dis inc ac i i ies pe o med in wo sequen ial eac ions (Fig. 3d). In he fi s eac ion (S ep I +II) pu e Ni H and FeMo-co a e added o DJ77 CFE esul ing in Ni H-dependen educ i e coupling o he wo [Fe 4 S 4 ] P-clus e p ecu so s o o m ma u e P-clus e s (S ep I), ollowed by FeMo-co inse ion in o P-clus e con aining apo- Ni DKA o gene a e ac i e Ni DKA (S ep II) (Fig. 3d). Te a- hiomolybda e is hen added o p e en u he FeMo-co inse - ion, sepa a ing he ma u a ion (S ep I +II) and ac i i y (S ep III) eac ions. Ac i a ion o DJ77 apo-Ni DKA by ScNi HH demons a ed i s P-clus e ma u a ion ac i i y (Fig. 3e). In i o FeMo-co syn hesis (Fig. 3d, S ep II)9was de e mined by combining pu ified p epa a ions o ScNi HH , apo-Ni DKA con aining P-clus e s bu de oid o FeMo-co31, apo-Ni ENA con aining pe manen [Fe 4 S 4 ] clus e s bu lacking FeMo-co p ecu so 32, Mo, homoci a e, and ei he he FeMo-co p ecu so ba kDa 130 - 100 - 75 - 63 - 48 - 35 - 28 - - - - - - - - - - - - - - - - - - - - - - 1 2 3 4 5 Coomassie ScNi HA ScNi HMi ScNi HMm ScNi HH A Mm Mi H -Ni H 0 500 1000 1500 2000 2500 E hylene p oduc ion (nmol C 2 H 4 ·min -1 ·mg -1 o Ni DK A ) ScNi H A Mm Mi H -Ni H 0 10 20 30 O e O e Fig. 2 Ac i i y o selec ed Ni H a ian s pu ified om mi ochond ia o ae obically cul u ed S. ce e isiae enginee ed s ains. a STAC-pu ified ScNi HA (s ain XJ4Y), ScNi HMm (s ain XJ2Y), ScNi HMi (s ain XJ3Y), and ScNi HH (s ain XJ1Y) p o eins. The low solubili y o ScNi HA p omo ed binding o con amina ing p o eins (as column was no sa u a ed wi h ScNi HA ) ha we e iden ified by pep ide mass finge p in ing as: 1) Acc1p (N1P4Q3), 2 and 3) py u a e ca boxylase (N1P377), and 4) HSP70 (D2J4C2). No iden ifica ion was possible o band numbe 5. Unc opped gels a e shown in Supplemen a y Fig. 9. bARA o STAC-pu ified ScNi HXx a ian s. Ac i i y using Ni HA and Ni DKA (posi i e con ol) was 2406 ± 53 uni s (nmol e hylene o med pe min and mg o Ni DKA ). Da a ep esen mean alues (n=2 echnical eplica es). ARTICLE COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 4COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio Ni B-co bound o he ca ie p o ein Ni XA 33 o Ni B p o ein supplemen ed wi h Fe and S34. As o he P-clus e ma u a ion assay, e a hiomolybda e was added be o e he ARA (Fig. 3d, S ep III). Figu e 3 shows ha ScNi HH suppo ed FeMo-co syn hesis in i o. Impo an ly, ScNi HH and ScNi BM (Me ha- no he mobac e he mau o ophicus Ni B isola ed om S. ce e i- siae)11 ac ed oge he in he Ni B-dependen in i o FeMo-co syn hesis assay in which Ni B-co was concomi an ly syn hesized by ScNi BM a he han added in pu ified o m. This esul p o ed compa ibili y o wo essen ial p o eins o N 2 fixa ion, ScNi HH and ScNi BM , when p oduced in yeas mi ochond ia. I also showed in e species compa ibili y wi h Ni DKA and Ni ENA , al oge he cons i u ing he conse ed biochemical co e o ni ogenase. ScNi HH ac i i y in subs a e educ ion was demons a ed by he ARA and by educ ion o N 2 in o NH 3 . ARA i a ion was ca ied ou wi h a fixed quan i y o Ni DKA and inc easing amoun s o ScNi HH . Maximum Ni DKA ac i i y was achie ed a mola ScNi HH o Ni DKA a ios la ge han 40 (Fig. 3g), simila o eac ions wi h he na u al coun e pa Ni HA 35. This esul sugges s ha he maximum ac i i y ha can be achie ed combining ScNi HH wi h Ni DKA is 1000 uni s (i.e., hal o he ac i i y wi h Ni HA ). In addi ion, ScNi HH suppo ed N 2 educ ion in o NH 3 by Ni DKA . Impo an ly, he a io o NH 3 o e hylene p oduced by Ni DKA was simila independen ly o using Ni HA o ScNi HH (Fig. 3h). As-isola ed NbNi HH was inac i e bu could be ac i a ed by [Fe 4 S 4 ] clus e econs i u ion.NbNi HH was pu ified om A. ume aciens-infil a ed lea es o N. ben hamiana. Plan s we e g own unde long-day condi ions (16 h ligh /8 h da k) and lea es we e p ocessed a he end o he da k pe iod. Genes encoding K K D D K K D D FeMo-co K K D D P-clus e [Fe 4 S 4 ] Open FeMo-co si e HH H H MoFe p o ein Fe p o ein ac S ep I P-clus e ma u a ion S ep II FeMo-co biosyn hesis N 2 C 2 H 2 HH S ep III Ni ogenase ac i i y d 300 400 500 600 700 800 0 0.2 0.4 0.6 0.8 1.0 Wa eleng h (nm) No malized abso bance As-isola ed Ai -exposed YLL EQKPSAWSH TS- ag COX4 300 400390380370360350340330320310 B (mT) EPR in ensi y (a.u.) ScNi HH Ni HA g = 2.04 g = 1.94 g = 1.84 g = 2.05 g = 1.94 g = 1.86 NH 3 C 2 H 4 hg e E hylene p oduc ion (nmol C2H4 · min-1 · assay-1) S ep I+II: S ep III: + + Ni HA ScNi HH - -+ -+ + - - + - 0 5 10 15 20 b* 0 100 200 300 E hylene p oduc ion (nmol C2H4 · min-1 · mg-1 o Ni DKA ) Ni B-co + Ni HA Ni B-co + ScNi HH Ni BA + Ni HA ScNi BM + ScNi HH ScNi BM ScNi HH 5 10 20 40 60 80 100 120 140 160 0 250 500 750 1000 1250 Ra io ScNi HH : Ni DKA E hylene p oduc ion (nmol C2H4·min -1·mg-1o Ni DKA ) Ni H A ScNi H H 0 300 600 900 1200 1500 1800 2100 0 150 300 450 600 E hylene p oduc ion (nmol C 2 H 4 ·m in -1 ·mg -1 o Ni DK A ) Ammonia p oduc ion (nmol NH 3 ·mi n -1 ·m g -1 o Ni DK A ) Fig. 3 Cha ac e iza ion o ScNi HH .aUV– is abso p ion spec a o as-isola ed and ai -exposed ScNi HH .bP ocessing si e (black a ow) o COX4 mi ochond ia a ge ing signal (blue) as de e mined by N- e minal sequencing o ScNi HH . The con e sion o Q o E (ma ked by *) could be due o deamina ion p ocesses. cEPR signal o as-isola ed ScNi HH (190 μM) compa ed o Ni HA (71.2 μM). Expe imen al da a (black lines) and simula ions (blue lines) o each p o ein a e shown oge he wi h g alues. dSchema ic ep esen a ion o Ni H-dependen ac i i ies es ed in e–h. Figu e adap ed om Bu én e al.9. Copy igh 2020 ACS unde CC BY 4.0 h p://c ea i ecommons.o g/licenses/by/4.0.eIn i o P-clus e ma u a ion o apo-Ni DKA p esen in CFE o A. inelandii DJ77 (Δni H) a e addi ion o ScNi HH o Ni HA as indica ed (±). Te a hiomolybda e was added ( ollowing s ep I +II) o inhibi u he apo-Ni DKA ac i a ion du ing he ARA (s ep III). Da a ep esen mean alues (n=2 echnical eplica es). Ni B-co and Ni B-dependen in i o FeMo-co syn hesis using ScNi HH o Ni HA . Te a hiomolybda e was added ( ollowing s ep II) o inhibi u he apo-Ni DKA ac i a ion du ing he ARA (s ep III). A 20:1 mola a io o ScNi HH o Ni DKA was used in he ARA (s ep III). Da a ep esen mean alues (n=2 echnical eplica es (Ni B-co +Ni HA ), n=3 echnical eplica es (Ni B-co +ScNi HH ), n=4 echnical eplica es (Ni BA +Ni HA ), n=5 echnical eplica es (ScNi BM +ScNi HH ), n=3 echnical eplica es (ScNi BM ), n=4 echnical eplica es (ScNi HH )). Blue and ed do s co espond o independen expe imen s. gTi a ion o Ni DKA ac i i y wi h ScNi HH . Posi i e con ol eac ions pe o med wi h Ni HA and Ni DKA a 40:1 mola a io ga e 1692 ± 4 uni s (nmol e hylene o med pe min and mg o Ni DKA ). Reac ions lacking Ni H (nega i e con ol) ga e 2.5 ± 0.8 uni s. Da a ep esen mean alues (n=2 echnical eplica es). hARA ( ed do s, le y-axis) and N 2 - educ ion assay (blue squa es, igh y-axis) using ScNi HH and Ni DKA (s ep III). Ni HA was used as con ol. Da a ep esen mean alues (n=4 echnical eplica es). COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 ARTICLE COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio 5 NbNi HH ,NbNi MA ,NbNi UA , and NbNi SA ( oge he wi h p19 and GFP) we e piled up in a single plan -exp ession ec o o co-exp ession (Me hods sec ion and Supplemen a y Table 1). Pu ified NbNi HH did no exhibi b own colo o [Fe-S] clus e s and was inac i e in he ARA when combined wi h Ni DKA (Fig. 4a). The e o e, we econs i u ed NbNi HH [Fe 4 S 4 ] clus e in i o ei he by mixing wi h Fe, L-cys eine, DTT, and EcNi SA (di ec econs i u ion), o by incuba ing wi h [Fe 4 S 4 ] clus e - loaded EcNi UA (Ni U-media ed econs i u ion). Bo h me hods ac i a ed he NbNi HH as de e mined by he ARA (Fig. 4a), demons a ing ha he p o ein was co ec ly olded bu lacked i s [Fe 4 S 4 ] clus e . This esul sugges ed ha inse ion and/o s abi- li y o NbNi HH [Fe 4 S 4 ] clus e was poo in mi ochond ia o lea es. cb kDa QQKPS AWSHPQ FEK TS- agCOX4 130 - 100 - 75 - 63 - 48 - 35 - 28 - 180 - * Coomassie d S ep -HRP (NbNi HH ) kDa 8 h 16 h Ligh Da k Ponceau LighLighLighLighLigh Da kDa kDa kDa k NbNi HH kDa 180 - α-GFP QQKPSA WSHPQ FEKGG TS- agCOX4 130 - 100 - 75 - 63 - 48 - 35 - 28 - Coomassie e 12345 a As-isola ed Di ec EcNi UA - Ni H NbNi HH pu .: NbNi UA kDa 48 - 35 - 48 - 35 - 48 - 35 - S ep-HRP (NbNi UA ) α-Ni S Ponceau Fe e iliza ion +- E hylene p oduc ion (nmol C2H4 · min-1 · mg-1 o Ni DKA ) Recons . h g 28 - 48 - 28 - 35 - 35 - 63 - 100 - 75 - 48 - 35 - 63 - 75 - E hylene p oduc ion (nmol C2H4 · min-1 · mg-1 o Ni DKA ) 0 10 20 30 Da k 0 100 200 300 400 500 ARTICLE COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 6COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio Fe e iliza ion o he soil inc eases soluble Ni U in mi o- chond ia o N. ben hamiana. One explana ion o he low [Fe 4 S 4 ] clus e con en o NbNi HH could be insu ficien Fe a ailabili y in he soil. We obse ed ha accumula ion o NbNi- UA , bu no o NbNi SA , inc eased when he wa e used o i iga e he A. ume aciens-infil a ed plan s was supplemen ed wi h Fe (Fig. 4b). Sul u was no supplemen ed in soil as he infil a ion solu ion con ained Mg 2 SO 4 . Al hough Fe e iliza ion ipled he yield o STAC-isola ed NbNi UA , he a e age Fe con en o 2 Fe a oms pe p o ein was no a ec ed (Supple- men a y Fig. 7a, b, Supplemen a y Table 4). This could be due o he loss o ansien Ni U [Fe-S] clus e s du ing pu ifica ion, and i is no a su p ising ou come as isola ion o EcNi UA con aining only he pe manen [Fe 2 S 2 ] clus e s has been p e iously obse ed36. Immunoblo s de ec ed wo di e en ly mig a ing NbNi UA species in pu ifica ions om obacco lea es (Fig. 4c). Amino- e minal sequencing showed ha bo h species we e clea ed ei he one o se en amino acids in o he TS- ag (Fig. 4d). As bo h NbNi UA species showed he same N- e mini p oces- sing, we concluded ha he as e mig a ing polypep ide was unca ed a he C- e minus. Ex ended da k pe iod combined wi h Fe e iliza ion p oduced ac i e NbNi HH in mi ochond ia o N. ben hamiana lea es. The soil o N. ben hamiana plan s exp essing NbNi HH was e ilized wi h Fe o inc ease Fe a ailabili y. In addi ion, he da k pe iod p eceding lea ha es was ex ended om 8 h o 16 h hypo hesizing ha longe da kness would lowe in acellula O 2 and s abilize NbNi HH [Fe 4 S 4 ] clus e . Da k pe iod ex ension did no inc ease NbNi HH accumula ion (Fig. 4e) bu allowed o isola ion o ac i e p o ein as shown below. Abou 6 mg o NbNi HH was consis en ly isola ed pe kg o N. ben hamiana lea es (Fig. 4 , Supplemen a y Fig. 7c, Supplemen a y Table 5). Amino- e minal sequencing showed ha mi ochond ia- a ge ed NbNi HH accumula ed as wo species (simila o NbNi UA ), one in which wo amino acid esidues om he TS- ag we e emo ed wi h he COX4 signal and ano he ha was p ocessed fi e amino acid esidues u he in o he TS- ag (Fig. 4g). Func ionali y o NbNi HH isola ed om lea es o Fe e ilized obacco plan s ollowing 16 h o da kness was de e mined using ARA. NbNi HH p epa a ions consis en ly showed ac i i ies bu hese we e low compa ed o hose o [Fe 4 S 4 ] clus e - econs i u ed NbNi HH (Fig. 4h). This esul sugges ed ha NbNi HH accumula ed as wo species in obacco mi ochond ia, whe e inac i e p o ein likely lacking [Fe 4 S 4 ] clus e was mo e abundan han unc ional and [Fe 4 S 4 ] clus e -con aining NbNi HH . Con- sis en ly, he Fe con en o pu ified NbNi HH p epa a ions we e below de ec ion limi (Supplemen a y Table 5). Al oge he he esul s indica e ha while soluble NbNi HH accumula es in good quan i y in mi ochond ia o N. ben hamiana lea es, enginee ing o addi ional p o ein componen s o biosyn he ic pa hways will be equi ed o imp o e [Fe 4 S 4 ] clus e acquisi ion o s abili y. Discussion The fi s s udy epo ing p oduc ion o ac i e Ni H in yeas p o ed ha mi ochond ia is a sui able o ganelle o hos ing O 2 - sensi i e Ni p o eins unde ae obic g ow h condi ions10. Despi e being a alid p oo -o -concep , u he de elopmen s wi h A. inelandii Ni H we e limi ed by low yields as only a small po ion was soluble in he mi ochond ial ma ix. Simila solubili y issues we e la e epo ed o K. oxy oca Ni H a ge ed o N. ben- hamiana mi ochond ia16 and a e confi med in his s udy using immunoblo sc eening and STAC. Iden i ying he bes possible Ni H p o ein o euka yo ic (plan ) exp ession was he e o e o u e mos impo ance. Ni H is he mos abundan Ni p o ein equi ed o N 2 fixa ion in A. inelandii17. Besides being he Fe p o ein componen o Mo ni ogenase, Ni H is essen ial o he assembly o bo h Ni DK co ac o s, namely he P-clus e and he FeMo-co9. Ni H p o eins o ni ogenase enginee ing in plan s should: (i) be s able and soluble a high le els in he mi ochond ial ma ix, and (ii) be compa ible wi h he Ni DK componen om a well- s udied model-diazo oph i hei own Ni DK componen s a e no a ailable in pu ified o m. Compa ibili y is impo an when e alua ing unc ion o candida e Ni H a ian s. In ou case i mean ha any selec ed Ni HXx should be compa ible wi h Ni - MA (i Ni HXx is no Ni M-independen ), Ni USA o ma u a- ion and [Fe 4 S 4 ] clus e syn hesis/inse ion, and Ni DKA o ni ogenase ac i i y measu emen s. We no e ha his equi e- men in oduces a selec ion bias and ha he sc eening could ha e o e looked Ni H a ian s ha we e supe io o ha o H. he mophilus i combined wi h di e en Ni DK. The Ni H a ian s es ed in his s udy we e selec ed om a cu a ed da ase o hund eds o Ni H sequences by a o ing ae obic o plan -associa ed o igins, o o e come he inhe en O 2 - sensi i i y o Ni H, and unc ionali y a mode a e empe a u es. We also hypo hesized ha Ni H a ian s om a chaea could unc ion be e in a euka yo ic en i onmen as his domain o li e is belie ed o be mo e closely ela ed o he Euka yo a37, and because ou p e ious wo k exp essing a chaeal Ni B a ian s in yeas had shown hem o be supe io o hose o bac e ial o igin11. We expec ed ha mos Ni H a ian s would be pa ly soluble in obacco mi ochond ia when exp essed oge he wi h he accesso y p o eins Ni UA , Ni SA , and Ni MA . Howe e , only Ni H om M. in e nus and H. he mophilus we e consis en ly de ec ed in soluble obacco ex ac s, in addi ion o M. ma bu - gensis ha was occasionally de ec ed a lowe le els. Two o hese Ni H p o eins o igina ed om a chaea and he hi d om a bac e ium. One possibili y could be ha he Ni MA p o ein was no exp essed a su ficien le els in he obacco mi ochond ia and ha only hese h ee Ni H a ian s did no equi e Ni M o ma u a ion. Howe e , low le els o Ni M exp ession appea o be enough o Ni H ma u a ion in K. oxy oca38,39. A mo e plausible explana ion can be ound in he he mophilic na u e o M. in e nus,H. he mophilus, and M. ma bu gensis. I has ecen ly Fig. 4 Cha ac e iza ion o he NbNi HH p o ein. a Ac i a ion o as-isola ed NbNi HH p o ein wi h [Fe 4 S 4 ] clus e s ei he by di ec chemical syn hesis o by EcNi UA -media ed econs i u ion. Ac i i y using Ni HA (posi i e con ol) was 1773 ± 10 uni s (nmol e hylene o med pe min and mg o Ni DKA ). Da a ep esen mean alues (n=2 echnical eplica es). bImmunoblo s showing he e ec o Fe e iliza ion on NbNi UA and NbNi SA o al p o ein exp ession. Ni S an ibody was p obed on he same memb ane a e incuba ion wi h S ep ac in-HRP. cNbNi UA p o ein pu ified om obacco plan s. The lowe band (ma ked by *) indica es a as e mig a ing NbNi UA polypep ide. dP ocessing si es (black a ows) o he COX4 mi ochond ia a ge ing signal (blue) as de e mined by N- e minal sequencing o he ull-leng h and he as e mig a ing NbNi UA .eImmunoblo s showing accumula ion o NbNi HH a he end o 8 h o 16 h nigh (da k pe iod). NbNi HH p o ein pu ified om obacco lea es. gP ocessing si es (black a ows) o COX4 signal (blue) as de e mined by N- e minal sequencing o NbNi HH .hARA o fi e independen NbNi HH STAC-pu ifica ions (1–5). Measu ed ac i i ies using Ni HA (posi i e con ols) and wi hou Ni H (nega i e con ols) we e, espec i ely, 2406 ± 53 and 4.6 ± 1.3 (pu ifica ion 1), 1773 ± 10 and 3.2 ± 2.2 (pu ifica ions 2 and 3), and 1692 ± 3.9 and 2.5 ± 0.8 (pu ifica ions 4 and 5). All ac i i ies a e in nmol e hylene o med pe min and mg o Ni DKA . Da a ep esen mean alues (n=2 echnical eplica es). Unc opped immunoblo s and gels a e shown in Supplemen a y Fig. 10. COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 ARTICLE COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio 7 been epo ed ha he empe a u e inside espi ing mi ochond ia o cul u ed human cells is a ound 50 °C40, e en when he ex e nal medium is main ained a 38 °C. Whe he he same d as ic e ec on empe a u e holds ue o mi ochond ia o a lea cell is no known o us, bu i could explain in pa he ou come o ou Ni H sc eening. None o he wo highes exp essed Ni H p o eins o igina ed om p o en diazo ophs. We a e no awa e o any s udy in es iga ing diazo ophy in he a chaeon M. in e nus. Howe e , Ni BMi cu ed he Ni −pheno ype o an A. inelandii ni B mu an s ain41 and, as Ni B has no o he known unc ion han biosyn hesis o ni ogenase ac i e-si e co ac o s, i is likely ha M. in e nus is in ac a diazo oph. On he o he hand, N 2 - fixa ion has been es ed bu no obse ed in H. he mophilus TK- 642. In e es ingly only six Ni H a ian s in ou lib a y o igina ed om o ganisms ha ing genes wi h high simila i y o A. inelandii ni M. Pe haps o he p olyl isome ases could subs i u e o Ni M in hese o ganisms. Whe he Ni M (and he Ni US machine y) is equi ed o ma u a ion o he h ee selec ed Ni H p o eins (especially Ni HH ) in mi ochond ia will be in es iga ed in u u e wo k. Mi ochond ia-exp essed ScNi HH was he only a ian ha suppo ed ele an ni ogenase ac i i y when combined wi h Ni DKA . I s ac i i y co esponded o oughly hal o ha using ScNi HA e en i he ScNi HH o Ni DKA mola a io was inc eased well abo e 40 no mally used o ARA. Eme ich and Bu is showed ha Ni H p o eins can unc ion wi h Ni DK om o he o ganisms35, bu his s udy only combined p o eins om bac e ia. An op imal g ow h empe a u e o 72 °C has been epo ed o H. he mophilus TK-643, which could explain lowe ScNi HH ac i i y in subs a e educ ion assays. Howe e , ou p edic ion om his s udy and p e ious wo k on Ni B is ha subop imal wo king empe a u e o Ni p o eins om he mo- philes is a p ice wo h paying when enginee ing ni ogenase in euka yo es, as solubili y and s abili y o hese a ian s is so much imp o ed. One obse a ion o his s udy was ha he specific ac i i y o as-isola ed NbNi HH p o ein was lowe han ScNi HH . We hink his was caused by poo [Fe 4 S 4 ] clus e a ailabili y –and hence ine ficien inco po a ion –o poo Ni H [Fe 4 S 4 ] clus e s abili y wi hin he lea cell mi ochond ia. In his con ex , i is no known how Fe e iliza ion inc eased accumula ion o soluble NbNi UA . Mo e a ailable Fe could inc ease mi ochond ia [Fe-S] clus e s biosyn hesis and [Fe 2 S 2 ] clus e occupancy in NbNi UA which, in u n, would p o ide s abili y o he p o ein. A compa ibili y issue be ween NbNi HH and NbNi UA and NbNi SA is unlikely since EcNi UA could e ec i ely ac i a e NbNi HH in i o. NbNi HH mis olding in mi ochond ia is also unlikely as i was e ficien ly ac i a ed by econs i u ion o i s [Fe 4 S 4 ] clus e . I is howe e likely ha p o ec ion by espi a o y O 2 -consump ion in lea is lowe han in yeas . NbNi HH exposu e o O 2 du ing lea p o- cessing is also a possibili y making his a pu ely echnical p o- blem. While lea es we e kep in liquid ni ogen and lysis and pu ifica ion we e pe o med inside an anae obic glo e box, i is di ficul o comple ely ule ou ha some O 2 apped wi hin he lea was eleased du ing issue dis up ion. In conclusion, his s udy shows ha gene ic di e si y can be exploi ed o iden i y, om a e y la ge pool o sequences, he mos adequa e Ni p o ein componen s o enginee a euka yo ic ni ogenase. Modula cloning echniques, gene syn hesis wi h codon op imiza ion, and o he syn he ic biology ools pe mi building mul i-p o ein pa hways wi h componen s o e y di e se o igin. In his case he Ni H p o ein om H. he mophilus was iden ified as soluble in mi ochond ia o bo h S. ce e isiae and N. ben hamiana accumula ing a much highe le els han he A. inelandii homologue. This example is ele an no only because he iden ified a ian pe o med all h ee Ni H-essen ial eac ions, namely P-clus e ma u a ion, FeMo-co biosyn hesis, and Ni D- KA educ ion, bu also because Ni HH o med unc ional in e species in e ac ions wi h Ni B, Ni EN, and Ni DK p o eins, al oge he ep esen ing he ou p o eins cons i u ing he co e o diazo ophy. Me hods Design, assembly, and cloning o he ni H lib a y. A cu a ed da ase o diazo- ophs41 was used o collec ni H candida es and design he lib a y. Genes encoding ni H a ian s we e codon op imized o exp ession in S. ce e isiae and he sequence encoding pE35S::cox4- wins ep was codon op imized o exp ession in obacco (Supplemen a y Da a 1). All gene ic pa s we e op imized using he GeneOp imize ool (The moFishe ) and syn hesized by The moFishe ia he Enginee ing Ni ogen Symbiosis o A ica (ENSA) p ojec . The ni H genes we e syn hesized and cloned in o pMA cloning ec o wi h BamHI and Bs EII es ic ion si es flanking each gene. The pE35S::cox4- wins ep sequence was flanked by HindIII and BglII es ic ion si es. pGFPGUSplus (plasmid #64401, Addgene) and he pMA ec o con aining pE35S::cox4- wins ep we e diges ed wi h HindIII and BglII and used o gene a e he pa en al ec o pN2SB41, con aining a pE35S::cox4- wins ep-gus- NOS ansc ip ional uni in which gus was flanked by BamHI and Bs EII es ic ion si es. The pa en al ec o pN2SB41 and all pMA ec o s con aining ni H a ian s we e diges ed wi h BamHI and Bs EII and used o gene a e ec o s pN2XJ81-pN2XJ112 (Supplemen a y Table 1). pGFPGUSplus was used o gene a e ec o pN2XJ165 con aining ansc ip ional uni s o mi ochond ia- a ge ed accesso y Ni p o eins (A. inelandii Ni U, Ni S, and Ni M). The su9-ni UA (AAAAGGATCCAATGGCCTCCACTCGTGTCCT CG, AAAAAAGGTCACCTTAGACTTCCATTTGGGCGTGTGCG) and su9- ni SA (AAACTAGTATGGCCTCCACTCGTGTCCTCG, AAAAGAGCTCTTAAC CATAGACAGGAGCAAAGGCTTTACC) genes we e amplified by PCR om he yeas ec o pN2GLT410. Amplifica ion eac ions added flanking BamHI and Bs EII ( o su9-ni U)o SpeI and SacI ( o su9-ni SA ) si es. The DNA agmen con aining he su9-ni MA sequence was c ea ed by o e lapping PCR using p ime s in oducing sequences homologous o hose flanking he XhoI si e o pGFPGUSplus (ATTATG GAGAAACTCGAGTTAACCATGTGCTAAGTTTTCC, TACAAATCTATCTCT CTCGAGATGGCCTCCACTCGTG, CTTTCTGAGGCCATGGAAGAGTAGGCG CGCTTCTGG, CGCGCCTACTCTTCCATGGCCTCAGAAAGATTAGCTGA TG). pGFPGUSplus was fi s diges ed wi h BglII and Bs EII o inse su9-ni UA , hen wi h XbaI and SacI o inse su9-ni SA , and finally diges ed wi h XhoI o inse su9-ni MA by homologous ecombina ion44. All DNA diges ions we e pe o med using enzymes om New England Biolabs. Liga ed p oduc s (T4 ligase, P omega) we e in oduced in o E. coli DH5α chemically compe en cells and selec ed on LB (Lysogenic b o h) supplemen ed wi h app op ia e an ibio ics. Plasmid ex ac ion was pe o med using Qiap ep Spin Minip ep ki (QIAGEN) and co ec cloning was confi med by Sange sequencing (Mac ogen). G ow h o S. ce e isiae, mi ochond ia isola ions, and ScNi H pu ifica ions.S. ce e isiae o galac ose-induced exp ession o ScNi HMm,ScNi HMi,ScNi HH , and ScNi HA oge he wi h SU9-Ni UA , SU9-Ni SA , and SU9-Ni MA (XJ1Y-XJ4Y, Supplemen a y Table 3) we e cul u ed in 4-l e men e s unde ae obic condi ions (0.625 l o ai pe minu e and l o cul u e, 250 pm s i ing) and used o mi o- chond ia isola ions o Ni H pu ifica ions as p e iously desc ibed11. P epa a ion o CFE and STAC pu ifica ions we e pe o med a O 2 -le els below 1 ppm in anae- obic chambe s (Coy sys ems o MB aun). Typically, cells we e esuspended in lysis bu e (100 mM T is-HCl (pH 8.6), 200 mM NaCl, 10% glyce ol, 2 mM sodium di hioni e (DTH), 1 mM PMSF, 1 μg/ml leupep in, 5 μg/ml DNAse I) a a a io o 1:2 (w/ ). To al ex ac s (TE) we e p epa ed by lysis o he cell suspensions unde anae obic a mosphe e using an EmulsiFlex-C5 homogenize (A es in Inc.) ope a ing a 20,000 psi. The TE was ans e ed o cen i uge ubes equipped wi h sealing closu es (Beckman Coul e ) and cen i uged a 50,000 g o 1 h a 4 °C (A an i J-26 XP). The supe na an was fil e ed using fil e ing cups wi h a po e size o 0.2 μm, ende ing cell- ee ex ac (CFE) o soluble p o eins ha was loaded a 2.5 ml/min in o a 5 ml S ep-Tac in XP column (IBA Li eSciences) a ached o an ÄKTA FPLC (GE Hea hca e). The column was washed using 75 ml washing bu e (100 mM T is-HCl pH 8.0, 200 mM NaCl, 10% glyce ol, 2 mM DTH). S ep-Tac in XP column-bound p o eins we e elu ed wi h 15 ml washing bu e supplemen ed wi h 50 mM bio in (IBA Li eSciences). The elu ion ac ion was concen a ed, and bio in emo ed, by passing he p o ein h ough PD-10 desal ing columns (GE Heal hca e). Desal ed elua e was u he concen a ed using cen i ugal fil e s (Amicon, Millipo e) wi h 30 kDa cu o . Finally, he concen a ed p o ein was snap- ozen in c yo ials (Nalgene) and s o ed in liquid N 2 . Soil Fe e iliza ion, p epa a ion o anae obic N. ben hamiana lea cell- ee ex ac s, and pu ifica ion o NbNi HH and NbNi UA .N. ben hamiana plan s we e g own unde long day condi ions (16 h ligh /8 h da k) wi h suppo ing ligh om 17:00 o 00:00 o 4 weeks. Fo Fe e iliza ion expe imen s, plan s we e i iga ed (2l pe week) wi h ap wa e supplemen ed wi h 1 g/l Seques ene G100 ARTICLE COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 8COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio (Syngen a). Lea es ha es ed a e ex ended da k pe iod (16 h) we e kep in da kness om 17:00 (p e ious day) un il sample collec ion (09:00 ollowing mo ning). Pu ifica ions o NbNi HH and NbNi UA we e pe o med a O 2 -le els below 1 ppm inside anae obic chambe s (Coy sys ema o MB aun). Typically, 200 g o lea ma e ial was ha es ed and ozen in liquid N 2 . Lea ma e ial was ans e ed in o an anae obic chambe in ozen condi ion and dis up ed in equal amoun (w/ ) o lysis bu e (100 mM T is-HCl pH 8.6, 200 mM NaCl, 10% glyce ol, 2 mM DTH, 1 mM PMSF, 1 μg/ml leupep in, 5 μg/ml DNAseI) using a blende (Os e Classic 4655) ope a ing a maximum powe and main ained a 4 °C using a ci cula ing wa e ba h. TE was fil e ed h ough cheese clo h o emo e la ge deb is. P epa a ion CFE by cen i uga ion, S ep-Tac in a fini y ch oma og aphy, p o ein elu ion, concen a ion, and s o age was iden ical as o yeas -exp essed ScNi H p o eins. The pu ifica ion p ocedu e o NbNi UA only di e ed in ha no DTH was p esen in he bu e s. P o ein me hods, an ibodies, UV– is abso p ion spec um, and elec on pa amagne ic esonance. P o ein concen a ions we e measu ed using he BCA p o ein assay (PIERCE) in combina ion wi h iodoace amide o elimina e he in e e ing e ec o DTH45. Colo ime ic Fe de e mina ion was pe o med as epo ed46, and he N- e minal amino acid sequences we e de e mined by Edman deg ada ion (P o eome Fac o y AG). An ibodies used in his s udy and hei dilu ions o immunoblo ing we e as ollows: polyclonal an ibodies de ec ing Ni UA (used a 1:2,000 in 5% BSA), Ni SA (used a 1:1,000 in 5% BSA), Ni HA (used a 1:5,000 in 5% BSA), Ni MA (used a 1:2,000 in 5% BSA) we e aised agains pu ified p epa a ions o he co esponding A. inelandii p o eins (gene a ed in house). S ep- ag II (“S ep-MAB”, 2-1507-001, IBA Li esciences, 1:2,000 in 5% BSA), S ep-Tac in conju aged o HRP (“S ep- HRP”, 2-1502-001, IBA Li esciences, 1:50,000 in TBS- T), GFP (sc-9996, San a C uz Bio echnology, 1:2,000 in 5% BSA), HSP60 (LK-2, ab59458, Abcam, 1:1,000 in 5% BSA), and Tubulin (3H3087, sc-69971, San a C uz Bio echnology, 1:500 in 5% BSA) specific an ibodies a e comme cially a ailable. The UV– is abso p ion spec a we e eco ded a e emo al o he DTH om he p o ein samples using PD-10 desal ing columns (GE Heal hca e) equilib a ed wi h he co esponding p o ein bu e wih ou DTH. DTH- ee p o ein samples we e hen dilu ed in he same bu e s and ans e ed o a Q6 spec oscopy cu e es wi h sealing closu es. Abso p ion (280 nm o 800 nm) was eco ded using a UV- 2600 spec opho ome e (Shimadzu). EPR measu emen s we e pe o med in a B uke E500 spec ome e equipped wi h a esona o ope a ing in he TE 102 mode a 9.47 GHz. Tempe a u e was se and s abilized o 10 K by an Ox o d empe a u e con olle egula ing a gas-flow c yos a e ige a ed wi h helium. Fo measu emen s, a mic owa e powe o 2.5 mW and a magne ic field modula ion ampli ude o 1 mT was used. Expe imen al condi ions we e ca e ully moni o ed o a oid o e -modula ion o sa u a ion e ec s. Simula ions o he EPR spec a we e pe o med using he Ma lab oolbox Easyspin47. In i o Ni H ac i i y. Ni H ac i i y was de e mined as desc ibed by Shah e al. wi h sligh modifica ions48. Reac ions we e p epa ed inside anae obic chambe s. Pu ified Ni H p o eins we e analyzed by ARA a e addi ion o Ni DKA and ATP- egene a ing mix u e (1.23 mM ATP, 18 mM phosphoc ea ine, 2.2 mM MgCl 2 , 3 mM DTH and 46 μg/ml o c ea ine phosphokinase, 22 mM T is-HCl pH 7.5) in a final olume o 600 μl inside 9 ml se um ials unde A a mosphe e con aining 500 μl o ace ylene (1 a m). The a io o Ni H o Ni DK in he assays was 40:1 unless o he wise indica ed. The ARA we e pe o med a 30 °C in a shaking wa e ba h o 15 min. Reac ions we e s opped by adding 100 μl o 8 M NaOH. Posi i e con ol eac ions o ace ylene educ ion we e ca ied ou wi h Ni HA . E hylene o med was measu ed in 50 μl gas phase samples using a Po apak N 80/100 column in a gas ch oma og aph (Shimadzu). Reduc ion o N 2 o NH 3 was de e mined in eac ion mix u es p epa ed as o he ARA bu con aining 100 mM 3-(N-mo pholino)p opanesul onic acid (MOPS), pH 7.8, as bu e . Mix u es we e p epa ed in olumes o 750 μl, om which 100 μl was emo ed a assay s a o se e as backg ound ( o ) o NH 3 measu emen s. A e exchanging ial a mosphe e o N 2 , mix u es we e incuba ed a 30 °C o 30 min, and eac ions we e s opped by addi ion o 100 μl 5 M EDTA. Twen y-fi e μl o he blank ( o ) and he eac ion ( 30 ) we e added in duplica es o 200 μlo- ph haldialdehyde eagen solu ion (The moFishe Scien ific) in 96-well mic opla e o fluo escence-based assays (Nunc). Fluo escence (Ex 390 nm, Em 472 nm) was measu ed using a Va ioskan LUX pla e eade (The moFishe Scien ific). NH 3 p oduc ion was de e mined om he inc ease in fluo escence ( 30 - o ) agains s anda ds p epa ed wi h NH 4 Cl and eco ded in he same pla e. In i o P-clus e ma u a ion. P-clus e ma u a ion assays we e pe o med inside anae obic chambe s. The in i o assay combined isola ed Ni H o be es ed (50 μg) wi h A. inelandii DJ77 (Δni H) CFE (4.34 mg o al p o ein) and an excess o pu e FeMo-co (0.85 μM) in 500 μl ATP- egene a ing mix u e as desc ibed abo e. Reac ions we e incuba ed a 30 °C o 30 min. Fo y μl o 1 mM (NH 4 ) 2 MoS 4 ( e a hiomolybda e) we e hen added and mix u es we e incuba ed o 10 min a oom empe a u e o p e en u he FeMo-co inco po a ion in o Ni DKA du ing he ARA. Apo-Ni DKA ac i a ion a e P-clus e ma u a ion and FeMo-co inse ion was analyzed by ARA a e addi ion o an excess o he same Ni H species (100 μg) and ATP- egene a ing mix u e in a final eac ion olume o 1 ml. ARA was ca ied ou in 9 ml se um ials con aining A and 500 μl o ace ylene (1 a m) in he headspace o 15 min a 30 °C. Posi i e con ol eac ions o in i o P-clus e ma u a ion and ARA con ained pu ified Ni HA . E hylene o med was measu ed in 50 μl gas phase samples using a Po apak N 80/100 column in a gas ch oma og aph (Shimadzu). In i o FeMo-co syn hesis and apo-Ni DKA econs i u ion. Ni B-co-dependen FeMo-co syn hesis assays we e pe o med inside anae obic chambe s as desc ibed by Cu a i e al., wi h sligh modifica ions34. One hund ed μl eac ions con ained 3.0 μM Ni H, GST-Ni X-Ni B-co (20.4 μM Fe), 1.5 μM apo-Ni ENA , 0.6 μM apo- Ni DKA , 17.5 μMNa 2 MoO 4 , 175 μMR-homoci a e, 1 mg/ml BSA, and ATP- egene a ing mix u e (1.23 mM ATP, 18 mM phosphoc ea ine disodium sal , 2.2 mM MgCl 2 , 3 mM DTH, 46 μg/ml c ea ine phosphokinase, final concen a ions in 22 mM T is-HCl (pH 7.5) bu e a 30 °C o 60 min. Ni B-dependen FeMo-co syn hesis assays we e pe o med as he abo e desc ibed Ni B-co-dependen assay eplacing GST-Ni X-Ni B-co by 10.0 μM Ni B monome , 125 μM FeSO 4 , 125 μMNa 2 S, and 125 μM SAM. Following in i o syn hesis o FeMo-co, 17.5 μM (NH 4 ) 2 MoS 4 was added o p e en u he FeMo-co inco po a ion in o apo-Ni DKA , and incuba ed o 10 min a 25 °C. Ac i a ion o apo-Ni DKA was analyzed by addi ion o 500 μl ATP- egene a ing mix u e and ScNi HH (2.0 μMfinal concen a ion) in 9 ml ials con aining A and 500 μl ace ylene. The ARA we e pe o med a 30 °C o 20 min. Posi i e con ol eac ions o ARA con ained Ni DKA and Ni HA . E hylene o med was measu ed in 50 μl gas phase samples using a Po apak N 80/100 column in a gas ch oma og aph (Shimadzu). In i o [Fe-S] clus e econs i u ion and Ni H ac i i y. In i o [Fe-S] clus e econs i u ions o Ni H and Ni UA pu ified om E. coli (EcNi UA )10 we e pe - o med in anae obic chambe s as desc ibed by Zheng and Dean49 wi h sligh modifica ions. Ni H o Ni U (20 μM) was added o 22 mM T is-HCl (pH 7.5) bu e supplemen ed wi h 8 mM 1,4-di hio h ei ol (DTT) in a final olume o 100 μl and incuba ed a 37 °C o 30 min. Then, eac ions we e supplemen ed wi h 1 mM L-cys eine, 1 mM DTT, 400 μM (NH 4 ) 2 Fe(SO 4 ) 2 , and 225 nM Ni SA pu ified om E. coli (EcNi SA )10, and incuba ed a 37 °C o e nigh . Finally, he p o eins we e dilu ed 1000- old in 22 mM T is-HCl (pH 7.5) bu e , and hen concen a ed using cen i ugal fil e s (Amicon, Millipo e) wi h 30 kDa cu o o emo e excess eagen s. Fo “di ec econs i u ion”ac i i y assays, he ac i i y o [Fe 4 S 4 ] clus e econs i u ed Ni H p o ein was de e mined using ARA. Fo “Ni U-media ed econs i u ion”, as-isola ed Ni H p o ein was mixed wi h [Fe-S] clus e econs i u ed EcNi UA , and hen immedia ely used o ARA. S a is ics and ep oducibili y. Dis inc samples we e used o in i o ac i i y measu emen s and sample sizes a e indica ed by n, whe e each dis inc sample was measu ed a leas wo imes. Mean o measu ed ac i i ies a e shown. The da a p esen ed in he figu e g aphs a e lis ed in Supplemen a y Da a 2. Da a a ailabili y The au ho s decla e ha he da a suppo ing he findings o his s udy a e a ailable wi hin he a icle, i s supplemen a y in o ma ion and da a, and upon eques . Recei ed: 15 June 2020; Accep ed: 25 No embe 2020; Re e ences 1. E isman, J. W. e al. Ni ogen: Too much o a i al esou ce. (Science B ie . WWF Ne he lands, Zeis , The Ne he lands, 2015). 2. Bo laug, N. E. Feeding a wo ld o 10 billion people: he mi acle ahead. In Vi o Cell De . Biol. 38, 221–228 (2002). 3. Sibha u, K. T. & Qaim, M. Ru al ood secu i y, subsis ence ag icul u e, and seasonali y. PLoS One 12, e0186406 (2017). 4. Bloch, S. E., Ryu, M. H., Ozaydin, B. & B oglie, R. Ha nessing a mosphe ic ni ogen o ce eal c op p oduc ion. Cu . Opin. Bio echnol. 62, 181–188 (2020). 5. Bu én, S. & Rubio, L. M. S a e o he a in euka yo ic ni ogenase enginee ing. FEMS Mic obiol. Le . 365, nx274– nx274 (2018). 6. Bulen, W. A. & LeCom e, J. R. The ni ogenase sys em om Azo obac e : wo- enzyme equi emen o N2 educ ion, ATP-dependen H2 e olu ion, and ATP hyd olysis. P oc. Na l Acad. Sci. USA 56, 979–986 (1966). COMMUNICATIONS BIOLOGY | h ps://doi.o g/10.1038/s42003-020-01536-6 ARTICLE COMMUNICATIONS BIOLOGY | (2021)4:4 | h ps://doi.o g/10.1038/s42003-020-01536-6 | www.na u e.com/commsbio 9