Repositorio Institucional de Documentos

2013 75 María Cristina Villellas Arilla A role of efflux pumps in intrinsic drug resistance and virulence of Mycobacterium tuberculosis Director/es Departamento Bioquímica y Biología Molecular y Celular Aínsa Claver, José Antonio Director/es Tesis Doctoral Autor Repositorio de la Universidad de Zaragoza – Zaguan http://zaguan.unizar.es UNIVERSIDAD DE ZARAGOZA Departamento Director/es María Cristina Villellas Arilla A ROLE OF EFFLUX PUMPS IN INTRINSIC DRUG RESISTANCE AND VIRULENCE OF MYCOBACTERIUM TUBERCULOSIS Director/es UNIVERSIDAD DE ZARAGOZA Bioquímica y Biología Molecular y Celular Aínsa Claver, José Antonio Tesis Doctoral Autor 2013 Repositorio de la Universidad de Zaragoza – Zaguan http://zaguan.unizar.es Departamento Director/es Director/es Tesis Doctoral Autor Repositorio de la Universidad de Zaragoza – Zaguan http://zaguan.unizar.es UNIVERSIDAD DE ZARAGOZA FACULTAD DE MEDICINA DEPARTAMENTO DE MICROBIOLOGÍA, MEDICINA PREVENTIVA Y SALUD PÚBLICA A role of efflux pumps in intrinsic drug resistance and virulence of Mycobacterium tuberculosis . Memoria presentada por María Cristina Villellas Arilla Licenciada en Bioquímica Para optar al grado de Doctor por la Universidad de Zaragoza Director: José A. Aínsa Claver Dr. José A. Aínsa Grupo de Genética de Micobacterias http://genmico.unizar.es/ CIBERes – CIBER Enfermedades Respiratorias http://www.ciberes.org/ Departamento de Microbiología, Medicina Preventiva y Salud Pública Tel : +34-976-761694 Facultad de Medicina, Universidad de Zaragoza Fax: +34-976-762420 C/Domingo Miral s/n, 50009-Zaragoza, Spain [email protected] JOSÉ ANTONIO AÍNSA CLAVER, Profesor Titular de Microbiología del Departamento de Microbiología, Medicina Preventiva y Salud Pública de la Facultad de Medicina, como director de la Tesis Doctoral de MARÍA CRISTINA VILLELLAS ARILLA, titulada: A role of efflux pumps in intrinsic drug resistance and virulence of Mycobacterium tuberculosis. (Implicación de las bombas de eflujo en la resistencia intrínseca a fármacos y virulencia de Mycobacterium tuberculosis) EXPONE: Que esta Tesis Doctoral corresponde con el proyecto de tesis presentado y aprobado en su momento, no habiéndose producido ninguna variación. Que dicha Tesis doctoral reúne los requisitos necesarios para optar al título de Doctor y a la mención de Doctorado Europeo. Por lo anterior, emito el presente INFORME FAVORABLE. Zaragoza, 10 de Diciembre de 2012. Fdo: José A. Aínsa 1 INDEX OF CONTENTS Tabla de contenido RESUMEN'............................................................................................................................................'7' SUMMARY'...........................................................................................................................................'9' Introduction' History'of'Tuberculosis'..............................................................................................................'13' Mycobacteria'and'the'tubercle'bacillus'................................................................................'14' Mycobacterial'cell'envelope'...............................................................................................................'16! Mycobacterium'tuberculosis'complex'and'phylogeny'of'M.#tuberculosis'...........................'18! Infection'by'M.#tuberculosis'.................................................................................................................'19! Genomics'of'M.#tuberculosis'......................................................................................................'21' Fighting'against'tuberculosis'...................................................................................................'22' Vaccination'...............................................................................................................................................'22! Treatment'.................................................................................................................................................'23! Drug'resistance'and'tolerance'of'M.#tuberculosis'..............................................................'24' Intrinsic'resistance'................................................................................................................................'24! Acquired'resistance'...............................................................................................................................'25! Tolerance'...................................................................................................................................................'26! Antibiotics'against'tuberculosis'........................................................................................................'26! The!Global!Problem!of!TB!Drug!Resistance!and!the!Need!of!New!Antibiotics!.............................!32! Transport'across'the'cell'envelope'of'Bacteria'..................................................................'33' Passive'transport:'Porins'.....................................................................................................................'34! Active'transport:'Transporters'..........................................................................................................'34! Families!of!Transporters!.....................................................................................................................................!35! References'......................................................................................................................................'38' ' 2 CHAPTER'1' Role!of!MFS!proteins!in!Drug!Resistance!and!Virulence!of!M.# tuberculosis! ! Introduction'...................................................................................................................................'45' Efflux'pumps'in'mycobacteria'have'important'roles'.................................................................'45! DrugEresistance!........................................................................................................................................................!45! Virulence!.....................................................................................................................................................................!45! Efflux'pumps'object'of'study'...............................................................................................................'45! Rv1258c!(Tap)!..........................................................................................................................................................!45! Rv1410c!(P55)!..........................................................................................................................................................!46! Rv2333c!(Stp)!...........................................................................................................................................................!47! Genetic'tools'for'generating'knockWout'strains'in'M.#tuberculosis'.........................................'48! OBJECTIVES'....................................................................................................................................'49' Material'and'Methods'.................................................................................................................'50' Bacterial'strains,'media'and'growth'conditions'..........................................................................'50! General'techniques'of'nucleic'acids'.................................................................................................'51! DNA!extraction!.........................................................................................................................................................!51! Construction!of!plasmids!.....................................................................................................................................!53! Oligonucleotides!......................................................................................................................................................!57! Southern!Blot!............................................................................................................................................................!58! Generation'of'competent'cells'&'electroporation'.......................................................................'58! E.#coli!.............................................................................................................................................................................!58! M.#tuberculosis!..........................................................................................................................................................!59! Construction'of'knockWout'strains'of'M.#tuberculosis'.................................................................'59! Phenotypical'characterization'of'M.#tuberculosis'........................................................................'61! Growth!in!liquid!medium!.....................................................................................................................................!61! Neutral!Red!Stain!....................................................................................................................................................!61! Analysis'of'lipids'of'M.#tuberculosis'cell'wall'.................................................................................'62! Extraction!of!free!lipids!and!mycolic!acids!from!M.#tuberculosis!cell!wall!......................................!62! Thin!Layer!Chromatography!..............................................................................................................................!62! Susceptibility'assays:'Minimum'Inhibitory'Concentration'......................................................'63! The!resazurin!assay!................................................................................................................................................!63! Infection'assays'.......................................................................................................................................'64! 9 SUMMARY Efflux pumps are membrane proteins that transport different substrates to the outside of bacteria. It has been reported that they can have a role both in intrinsic and acquired resistance to several drugs, and can be implicated in colonization and persistence of pathogenic bacteria in the host. In adittion, other physiological processes are also affected by these membrane proteins, depending on their natural substrates. Nowadays, the drug-resistant Mycobacterium tuberculosis strains have become a huge health problem. Not only Multiand eXtensively-Drug Resistant strains, but also M. tuberculosis virtually resistant to all antituberculous drugs have been reported. Therefore, a global effort has to be made in order to control this emergency situation. Several strategies are in progress: the development of new anti-TB drugs and Directly Observed Treatment Short courses (DOTS) are among them. A better understanding of the mechanisms of drug-resistance would provide useful tools to improve therapy. The MFS efflux pumps Rv1258c (Tap), Rv2333 (Stp) and Rv1410c (P55) from M. tuberculosis have been previously studied in the heterologous host M. bovis BCG, the vaccine strain. A clear role in intrinsic resistance was observed for several drugs. Although this a good approximation, since the high percentaje of identity between M. tuberculosis and M. bovis BCG, the little differences in the genetic background could affect the results. For this, our main objective was to study these three efflux pumps in their own microorganism, M. tuberculosis. Knock-out and complemented strains, along with overexpression strains were generated for Tap, Stp and P55, derived from the virulent M. tuberculosis reference strain H37Rv. Susceptibility assays confirmed most, but not all, of the results obtained in M. bovis BCG. Infection assays were performed in cell and mouse model, to test if the deletion of the efflux pump gene affected pathogenicity. According to cell model, the three efflux pumps seemed to be necessary for complete virulence of M. tuberculosis; nontheless, in immunocompetent mouse model, only P55-knock out proved to be attenuated. In search for another strategy to detect substrates of efflux pumps from M. tuberculosis, we decided to try to express them in Escherichia coli. In addition to Minimun Inhibitory Concentration assays, a experiment in which the accumulation and efflux of molecules can be observed in real time was optimised. If successful, the technique would allow to easily and quickly test a range of potential substrates of the target efflux pump. Unfortunately, no significant results were obtained and further experiments would be required to confirm 10 the expression of the mycobacterial efflux pumps in E. coli. In parallel, two M. tuberculosis knock out mutants for the efflux pumps MmpL7 and MmpL10 were phenotypically characterised. Interestingly, the strain which had mmpL7 disrupted showed an apparent increase in the growth rate, as well as less aggregates than the wild type strain when it was grown in liquid medium. Finally, an analysis of streptomycin-resistant clinical isolates was done. The genes already related to streptomycin resistance (rpsL, rrs and gidB) were sequenced and analysed in search of mutations. A fourth gene was included in this experiment: Rv1258c, encoding Tap efflux pump. Since this transporter is implicated in streptomycin resistance, our hypothesis was that a possible mutation in the promoter or in the gene could be conferring resistance. Although we didn’t find any mutations in tap gene fulfilling this criteria, we did notice a mutation that several clinical isolates had in common. Further research revealed that this Single Nucleotide Polymorphism (SNP), called Tap580, was specific of Beijing lineage of strains. A quick PCR-RFLP method to easily detect this mutation was designed, and checked with a lot of 220 DNA extractions of clinical isolates belonging to different lineages of M. tuberculosis. 11 Introduction 13 History of Tuberculosis The disease is caused by Mycobacterium tuberculosis, a bacillus whose history is closely related to that of mankind, as it has infected humans for thousands of years. Pathological evidence of TB has been found in Egyptian mummies dating back five millennia, and a specific DNA sequence unique to M. tuberculosis has been identified in Egyptian and Peruvian mummies dating back to 500-1500 Before Christ (BC). By the first millennium BC, tuberculosis was endemic all around the world, and named phtisis, the Greek term for consumption. At that time (460 BC), phtisis was the most widespread disease in Ancient Greece. It was not until XVII and XVIII centuries After Christ (AC) that there was an advance in the understanding of the disease. The 17th century German physician Franciscus Sylvius firstly described the “tubercles” as characteristic lesions in the lung of people suffering from phtisis, and almost 200 years later, this discovery will further name the disease as “tuberculosis”. Some studies performed between 1600 and 1800 AC, had suggested that the main infective agent was the sputum of ill patients, and it was even proposed that tuberculosis was caused by some animacula, or wonderfully minute living creatures. This hypothesis, published in 1719 by Benjamin Marten, was considered ridiculous. From second half of the XVIII century until the end of the XIX, TB was a prevalent disease in Europe and North America, and was called white plague for the extreme paleness of people suffering from this disease. But XIX century is also the century of scientific advances and a marked decrease in deaths caused by tuberculosis was about to happen. It was in 1882 when Robert Koch first observed M. tuberculosis (that was also named “Koch bacillus” in his honor) under the microscope, and published a demonstration that it was the etiological agent of tuberculosis. He had previously presented the Koch’s Postulates, describing how an infectious microorganism isolated from a lesion of a person or animal suffering the disease, can reinfect a healthy animal; those postulates are currently the basis of medical microbiology. Since then, great advances in fight against TB have happened incessantly. In 1921 Albert Calmette and Camille Guerin obtained the current vaccine against TB, named BCG (Bacille de Calmette et Guerin). In 1944 Schatz and Waksman discovered streptomycin, an antibiotic with antimycobacterial activity. This fact, followed by the discovery of isoniazid in 1952 and rifampicin in 1967, marks a new period for tuberculosis. It turned into a 14 curable disease and new cases decreased considerably until the ‘80s. Appearance of HIV in addition to other factors, such as migrations, caused then the reemergence of tuberculosis and other diseases, and in 1993 it was declared an emerging global health problem by the WHO (Fig. 1.). Nowadays, the emergence of strains that are resistant to the current therapy complicates the aim of TB eradication. However, we count currently on great scientific advances, including the knowledge of the complete genome of M. tuberculosis (27) that will allow us to better understand the biology and molecular mechanisms of the bacillus, to efficiently win this fight. Mycobacteria and the tubercle bacillus Mycobacteria are acid-fast bacilli belonging to the genus Mycobacterium, family Mycobacteriaceae, included into the suborder Corynebacteriaceae, order Actinomycetales (94). Philogenetically they belong to the gram-positive group of bacteria, however, due to their highly hydrophobic cell wall, different from those of both gram positive and gram negative bacteria, they are only weakly stained by gram staining. Fig. 1. Timeline in TB research. It shows the most relevant highlights in the fight against the disease. Adapted from (51). 15 The genus Mycobacterium comprises more than 120 species (98). They include nonpathogens, e.g. Mycobacterium smegmatis, as well as highly successful pathogens e.g. Mycobacterium tuberculosis, Mycobacterium leprae and Mycobacterium ulcerans, the etiologic agents of tuberculosis, leprosy and Buruli ulcer, respectively. Attending to the rate of replication, mycobacterial species can be divided in two groups: slow-growing mycobacteria, with a doubling time higher than 13 hours, like M. tuberculosis, and rapidgrowing mycobacteria, with a generation time between 2 and 5h, like M. smegmatis. Colony morphology is variable among species, from rough to smooth and pigmented to nonpigmented. Mycobacteria inhabit various environmental reservoirs, like ground and tap water, soil, animals and humans. They can grow in fluid environments, usually forming clumps because of their high hydrophobic cell envelope; some mycobacteria are invasive, since they are able to multiply inside macrophages, such us M. tuberculosis. Classically, the genus Mycobacterium has been organised in a phylogenetic tree attending the homology level of 16S RNA gene (Fig. 2.) (38); in adittion, other genes have been analysed as well in order to reach a more robust phylogeny (99). M. tuberculosis is an aerobic bacillus, catalase and nitrate reductase positive, non-motile and non-sporulated, of 2-5µm in length and 0.2-0.5µm in width. Its doubling time (~24h) classifies it as a slow-grower, which needs 4 weeks to form a colony on solid medium. Until recently, it was believed that mycobacterial species don’t sporulate, but a study by Ghosh et al.(39) revealed that M. marinum and most likely M. bovis BCG, actually can form spores. 16 Mycobacterial cell envelope The basic architecture of the mycobacterial cell envelope differs from the ones of gram positive and gram negative bacteria. The Mycobacterium tuberculosis envelope, from the inside to the outside, consists of a plasma membrane, similar to other plasma membranes (28); a cell wall composed of three covalently linked macromolecules (peptidoglycan, arabinogalactan and mycolic acids) and noncovalently linked lipids and proteins; and a capsule consisting of polysaccharides, proteins and lipids (Fig. 3.) (72). The Fig 2. Phylogenetic tree of the genus Mycobacterium based on 16S RNA homology. Rapid and slow growers are separated with a dotted line, virulent strains are underlined. Adapted from (38). 17 lipopolysacharides lipomannan (LM) and lipoarabinomannan (LAM) are not covalently attached to the mycobacterial envelope, and their localization remains unclear (40). The non-covalent associaton of mycolic acids and complex free lipids conforms an atypical outer membrane (45). In M. tuberculosis, these free lipids include the phthiocerol dimycocerosates (PDIM) and the closely related phenolic glycolipids (PGL), the trehalose ester families that include sulfolipids (SL), diacyltrehaloses (DAT) and polyacyltrehaloses (PAT), and the family of mannosyl-β-1-phosphomycoketides (46). The trehalose dimycolate (TDM) or “cord factor”, named so before discovering its chemical structure, is also a free lipid implicated in cording, and constituted the first virulence factor of M. tuberculosis (41). Important functions are related with the mycobacterial envelope, such us defining the shape of the cell and providing mechanical and osmotic protection. Other important function is the transport of molecules, including nutrients, ions, antibiotics and toxic metabolites. Its unually high hidrophobicity makes it an efficient barrier for antibiotics, thus contributing to intrinsic drug resistance. Regarding M. tuberculosis, when infecting macrophages, the cell wall is the primary interface between the bacterium and the host, constituting the first line of defense against host attacks. In adittion, some complex free lipids, such us PDIM, are known to be virulence factors, and others contribute to modulate the immune response from the host (9). Such a lipid-rich coat explains the tendency of mycobacteria to form aggregates when grown in liquid medium, as well as the property of acid fastness. The characteristic cell wall of mycobacteria retains the dye carbol-fuchsin after a wash with an alcoholic solution in acid medium (Ziehl-Neelsen stain), whereas the rest of bacteria are quickly decolorized. It was recently suggested that this is a consequence of the density of mycolic acids (111). In addition, the fixation of the dye neutral red is used as a marker of virulence, since this dye indicates important alterations in the cell envelope of M. tuberculosis. Specifically, neutral red is unable to fix to the cell envelope when bacteria are deficient in more than one type of methyl-branched lipids, which are related to virulence, such us PDIM (26). 18 Mycobacterium tuberculosis complex and phylogeny of M. tuberculosis The Mycobacterium tuberculosis complex (MTBC) is composed by all the etiologic agents of tuberculosis, and currently includes nine species. Species Host M. tuberculosis Human M. africanum Human M. canettii Human M. bovis Cattle M. caprae Goat M. microti Vole M. pinipedii Seal and sea lion M. mungi Mongoose M. orygis Oryx Table 1. Species belonging to MTBC (5, 103) Fig. 3. Schematic representation of cell envelope of M. tuberculosis. Adapted from (72) 25 In addition to efflux pumps, mycobacteria produce some drug-modifying enzymes, such as β-lactamases, responsible for the intrinsic resistance to β-lactams drugs in M. tuberculosis (73). The gene erm37 (or ermMT) encodes a 23S rRNA methyltransferase, which is responsible for intrinsic resistance to macrolides (9, 23) not only in M. tuberculosis but also in other mycobacteria (97-99). Aminoglycoside modifying enzymes are also present in the chromosome of M. tuberculosis and other mycobacteria but their role in resistance is unclear, as two of those genes, aac(2’)-Ic from M. tuberculosis and aac(2’)-Id from M. smegmatis, were studied in M. smegmatis and only aac(2’)-Id was correlated with aminoglycoside resistance (6, 90). It has been reported that whiB7, a transcriptional activator, was responsible for intrinsic resistance to several antibiotics of different structures, like erythromycin, chloramphenicol, clarithromycin, spectinomycin, streptomycin or tetracycline (94). It has been shown that whiB7 is a regulator that may be involved in the induction of some previously described genes, including the gene encoding for the efflux pump tap, or the gene erm37. There are 7 whiB genes in M. tuberculosis (whiB1-whiB7) induced by different stress conditions and antibiotics (52, 134), and some homologous ones which have already been found in M. smegmatis (114). Acquired resistance Bacteria can become resistant to antibiotics by several strategies: i) target modification, ii) target overexpression, iii) barrier mechanisms (reduce uptake or increased efflux), iv) drug-inactivating enzymes, v) inactivation of drug-activating enzymes. Genes conferring resistance can be located in plasmids or transposons, and therefore can be transferred horizontally from one strain to another (50) . M. tuberculosis is able to acquire resistance by mutation in its chromosomal genes; this will be further detailed in the mechanism of resistance of each antituberculous antibiotic. No horizontal transfer of resistance genes had been reported for M. tuberculosis (50). 26 Tolerance Tolerance is defined as the phenotypic resistance or non-susceptibility to a drug mediated by changes in a cells’s physiological state, which is often associated with non-replicating state as in persisters (50). It has been reported that, upon macrophage infection, bacterial efflux pumps confer tolerance (Fig. 6) (1); however, the mechanisms underlying this transient resistance are not fully understood. Antibiotics against tuberculosis In this section, mechanism of action and drug resistance are explained for each anti tuberculosis drug. First-line antibiotics Isoniazid) Isoniazid (isonicotinic acid hydrazide, INH) is one of the most-widely used first-line TB antibiotics, utilized both in standard chemotherapy as well as in chemoprophylaxis (166). It is highly active against growing tubercle bacilli but has little activity against resting bacilli in stationary phase or under anaerobic conditions (93). Isoniazid is a prodrug that becomes active thanks to the action of the catalase peroxidase encoded by the gene katG (167). The current mode of action proposes that, when activated, INH binds to NAD forming an INH-NAD adduct. This adduct binds and inhibits InhA (an enoyl-acyl carrier protein reductase involved in mycolic acid biosynthesis), Fig. 6. Antibiotic Tolerance in Replicating Mycobacteria Mediated by Macrophage-Induced Drug Efflux (A) Extracellular mycobacteria are killed and eliminated by antibiotics. (B) Mycobacteria that enter macrophages may retain susceptibility to drugs and be killed, or they may induce expression of efflux pumps, which makes them drug tolerant and able to replicate and persist in the face of otherwise lethal concentrations of antibiotics. (1, 76) 27 consequently inhibiting mycolic acid biosynthesis and inducing cell death (154) (Fig. 4). InhA is accepted to be the target of INH. Loss of KatG activity implies a failure in activating INH (155), hence mutations in the katG gene are cause of resistance. Indeed, between 20 and 86% of INH resistant strains (depending on the geographical region) contain a mutation in the katG gene, being the mutation S315T the most common. Fifteen to forty-six percent of the resistant mutants present a mutation on the promoter region of the inhA gene. Those mutations have led to an increased expression of this gene, and cause low level of INH resistance (170) and co-resistance with ethionamide, as both drugs act on the same target InhA (154). Although most INH resistant strains have mutations in katG and inhA, other genes have been postulated to have some implication in INH resistance, like ndh-II, ahpC or kasA. Some efflux pumps, including mmpL7 or the pump component iniA have been reported to be involved in INH resistance (67). Rifampicin) Rifampicin (RIF) is a semisynthetic firstline antibiotic for the treatment of TB but is also a broad spectrum antibiotic active against a wide range of bacteria. RIF is active against growing M. tuberculosis and stationary phase bacilli with low metabolic activity. RIF inhibits RNA synthesis by binding to the bacterial RNA polymerase (25). Resistance to RIF in M. tuberculosis, as in many other bacteria, is caused by mutations in the rpoB gene that encodes the β-subunit of the RNA polymerase. Those mutations are found in about 96 % of RIF-resistant TB isolates (146). In addition, it has been found that the deletion of the Rv1410c gene encoding the P55 efflux pump made M. bovis BCG more susceptible to a range of toxic compounds including rifampicin (117). 28 Ethambutol) Ethambutol (EMB) is a mycobacteria-specific drug with no apparent activity against other bacteria. It has a bacteriostatic activity only against actively growing bacilli, having no effect on non-replicating bacilli (164). The proposed target of EMB is the arabinosyl transferase, an enzyme involved in synthesis of arabinogalactan - the major polysaccharide of the mycobacterial cell wall (91). EMB then inhibits the synthesis of arabinogalactan, interfering with the polymerization of cell wall arabinan (144). The enzyme arabinosyl transferase is encoded by the gene embB, which is part of an operon containing the genes embC-embA-embB in M. tuberculosis. Up to 68% of the EMBresistant clinical isolates presents mutations in the embCAB operon (147,140). Other genes including Rv0340, rmlD or rmlA2, have been found to be associated with EMB resistance (115), though they are not significant. Around 25% of EMB-resistant M. tuberculosis strains do not have mutations in any of the genes described, suggesting that there may be other mechanisms involved in EMB resistance. Pyrazinamid) Pyrazinamide (PZA) is a first-line antibiotic used in the initial phase of treatment that is very active against M. tuberculosis, while other bacteria, including other mycobacteria, are not susceptible. PZA is only active at acid pH (86), showing activity in vivo but not in vitro. Uncommonly, it kills non-growing bacilli with low metabolic activity more efficiently than actively growing bacilli (171). The proposed mode of action of PZA (Fig. 6) suggests that it enters the bacilli and is converted into pyrazinoic acid (POA) by the action of pyrazinamidase/nicotinamidase enzyme, encoded by the pncA gene. POA gets out of the cell by passive diffusion and weak efflux (in M. tuberculosis it seems to be rather defective), and in an acidic extracellular environment, a portion of POA becomes protonated to HPOA, the uncharged form that permeates through the membrane inside the cell. HPOA brings protons into the cell, what could cause cytoplasmatic acidification and de-energization of the membrane by collapse of the proton motive force further affecting membrane transport (168). 29 Thus most PZA-resistant M. tuberculosis strains (72 – 97 %) present mutations in the pncA gene, losing the pyrazinamidase/nicotinamidase activity and failing in the activation of the prodrug (131, 132). However, while M. tuberculosis is uniquely susceptible to this drug, other mycobacteria are intrinsically resistant. In the case of M. bovis, this resistance is due to a SNP in the pncA gene with respect to M. tuberculosis, which causes lack in PZase activity (130). In M. smegmatis and other mycobacteria, the resistance is suggested to be due to an active efflux of POA (169). There are still some resistant TB strains whose mechanism of resistance to PZA still has to be determined. Streptomycin) Streptomycin (SM) is an aminoglycoside antibiotic discovered in 1944 (1) that was the first effective TB drug. Aminoglycosides are broad-spectrum antibiotics with a bactericidal activity against a variety of bacterial species including M. tuberculosis. SM kills actively growing bacilli, while it has no effect on non-growing or intracellular tubercle bacilli (92). Due to the severe adverse effects that can cause and also because it is an injectable drug, it has been relegated as a second-line TB drug. SM inhibits protein synthesis by binding to the 30S subunit of the bacterial ribosome, specifically to the ribosomal protein S12 and the 16S rRNA (51). It can also cause damage to the cell membrane. SM resistance in M. tuberculosis is due to mutations in the genes rpsL and rrs which encode respectively the S12 protein and the 16S rRNA of the ribosome, that is the SM target (47). Approximately 70% of the SM-resistant clinical isolates have a mutation in one of those two genes, resulting in intermediate or high level of resistance. There are still 20-30% of the resistant strains presenting low level resistance with no mutation found (164), which suggests that there are other mechanisms of resistance. For example, Tap efflux pump has been shown to confer low level resistance to SM when overexpressed (3). In addition, it has recently been found that mutations within the gene gidB (encoding a 7-methylguanosine (m(7)G) methyltransferase specific for the 16S rRNA) confer low-level streptomycin resistance by loss of a conserved m(7)G modification in 16S rRNA (102). Despite the existence of aminoglycoside modifying enzymes, their role in clinically relevant resistance still remains unclear since none appears to have SM as a substrate. 30 Second-line antibiotics Fluoroquinolones) Fluoroquinolones are drugs with a broad-spectrum bactericidal activity against a wide range of bacteria, including mycobacteria. They are known to inhibit DNA gyrase complex, as well as DNA topoisomerase IV. Mutations in gyrA and gyrB (genes encoding the two subunits of DNA gyrase) cause resistance to quinolones in M. tuberculosis, which does not have topoisomerase IV. However, there are some mutants in which DNA gyrase is not involved, and the mechanism of their resistance is not clear (41). A new mechanism of quinolone resistance was recently identified. MfpA is a protein that binds to DNA gyrase and inhibits its activity, also giving FQ resistance (59). Aminoglycosides) Other aminoglycosides besides SM, such as kanamycin, gentamicin, amikacin, or capreomycin – which is a peptide antibiotic but commonly grouped with the aminoglycosides - that are not first-line drugs for TB treatment, play an important role in the treatment of MDR strains or infections with mycobacteria other than M. tuberculosis. Since they are aminoglycosides, and they bind to ribosomal structures at the 16S rRNA, mutations in rrs gene are also cause of resistance (7, 66) even though they do not cause cross resistance with SM. Recently, it has been described that tlyA, a gene encoding an rRNA 2’-Omethyltransferase, is involved in capreomycin and viomycin resistance (84). In mycobacteria there are some chromosomally encoded aminoglycoside modifying enzymes that only confer resistance to some agents in the case of M. smegmatis (5, 6, 90). Cycloserine) Cycloserine is a bacteriostatic antibiotic used as a second-line agent often in combination with other second-line drugs to treat MDR TB. It inhibits the synthesis of peptidoglycan by 31 blocking the action of D-alanine racemase and D-alanine:alanine synthase but the genetic bases of CS resistance are unclear (164) PAS) PAS (Para-Amino Salicilic acid) is a bacteriostatic antibiotic active against TB and other mycobacteria but not against non-mycobacterial species. It is used as a second-line drug in combination with others to treat MDR-TB. The mechanism of action of PAS is not well understood, though two possible mechanisms have been proposed: interference with folic acid biosynthesis (120) and inhibition of iron uptake (118). The gene thyA, encoding a thymidilate synthase has been reported recently to be involved in PAS resistance in some clinical isolates (120). Ethionamide) Ethionamide (ETH) is a derivative of isonicotinic acid, and is a second-line anti TB drug. It shares a common target with INH, the enoyl-acyl carrier protein reductase (InhA) involved in mycolic acid biosynthesis. Therefore it inhibits mycolic acid biosynthesis and causes cell death. ETH is a prodrug that needs to be activated. This activation is done by oxidation, thanks to an enzyme codified by the gene etaA, also called ethA. Consequently, mutations in ethA cause resistance to ETH (164). Mutations on the promoter region of the inhA gene leading to increased expression, cause low level of ETH resistance and co-resistance with INH, as both drugs act on the same target InhA (154). The mechanism of action and target are the same for ETH and INH, so the resistance mechanisms described for INH are valid for ETH and if common, they cause coresistance. The different step is the activation of the prodrug, carried out by KatG in case of INH, and EthA in case of ETH. 32 The Global Problem of TB Drug Resistance and the Need of New Antibiotics MDR-, XDRand TDR-TB strains Multi Drug-Resistant Tuberculosis (MDR-TB), is the disease caused by bacilli resistant to at least isoniazid and rifampicin, the two most powerful anti-TB drugs. It can take up to two years to treat with drugs that are more toxic, more expensive, and less effective than the first-line ones. If the drugs to treat MDR-TB are mismanaged, further resistance can occur. In 2006 a new type of resistant TB was described - XDR-TB (eXtensively Drug-Resistant TB) – which is more dangerous, and threatens all the TB control efforts (156). XDR is defined as: “resistant to at least rifampicin and isoniazid, in addition to any fluoroquinolone, and at least one of the three following injectable drugs used in anti-TB treatment: capreomycin, kanamycin and amikacin” (157). Unfortunately, XDR-TB strains with adittional second-line drug resistance had also been found. Some of these strains are resistant to all the tested antituberculosis antibiotics (63, 101, 107). New terms like “extremely drug resistant” (“XXDR-TB”), “super XDR-TB” and “totally drug-resistant TB” (“TDR-TB”) were used to define such resistance patterns New drugs for tuberculosis Tuberculosis mismanagement has led to the increasing prevalence of multidrug-resistant and even extensively resistant forms of TB. There is now a worldwide recognition that new drugs for TB are urgently required, especially with the aims of shortening the treatment, and treating MDR-TB and latent infections. A great effort is being done in this direction by academic laboratories, non-profit organizations and pharmaceutical companies. Thanks to research in drug development, a few novel compounds are being generated. WHO data show several compounds in early and late clinical trials, including TB Oxazolidinone PNU-100480 (Pfizer) and TBK-613-Quinolone (TB Alliance) in advanced preclinical trials; Diamine SQ-109 (Sequella Inc.), Linezolid (CDC TBTC, Pfizer, various Universities), Pyrrole LL-3858 (Lupin Pharmaceutical Inc.), Diarylquinoline TMC207 (Tibotec), Nitro-dihydro-imidazooxazole OPC-67683 (Otsuka Pharmaceutical Co.), Nitroimidazole-oxazine PA-824 (TB Alliance), Rifapentine (CDC TBTC, sanofi-aventis) in clinical phase I and II; and Gatifloxacin (OFLOTUB Consortium, European Commission, Lupin, WHO TDR) and Moxifloxacin (TB Alliance, Bayer, CDC TBTC, Johns Hopkins Univ, BMRC, UCL) in clinical phase III (158). 33 However, there is still a need to increase the number of drug candidates. A perservering research activity in search for new targets and new compounds is being carried out. New drugs should target new pathways or enzymes to avoid crossresistance to existing drugs. The targets have to be “druggable” proteins, with ability of inhibition by a small drug-like molecule. It is also important that the crystal structure is known or at least that it is homologue to other known proteins. In addition, the biochemical activity and biological function of the protein has to be understood, as well as what is the metabolic pathway that is going to be interfered. Transport across the cell envelope of Bacteria Non-polar compounds can diffuse through phospholipid bilayers, being the permeability of a particular membrane directly related with its fluidity. Regarding mycobacteria, differential scanning calorimetry showed that the lipids in mycobacterial cell walls have very high phase transition temperatures, in the range of 6070ºC, thus indicating the extremely low fluidity of the lipid bilayer, mainly determined by mycolic acids (59). In consequence, due to the high impermeability of the lipid bilayer of the mycobacterial membranes even for hydrophobic molecules, it is necessary the presence of channels and transporters that make possible the uptake of nutrients and efflux of toxic compounds to the outside of bacteria. Fig 7. The development pipeline for new drugs (2011). (110) 34 Passive transport: Porins These proteins are located in the outer membrane of Gram negative bacteria and the outer layer of mycobacteria (35). They are water-filled pores through which hydrophilic molecules can enter the bacteria down the concentration gradient. The first porin was discovered in E. coli. In mycobacteria, M. smegmatis is known to have several porins, from which MspA represents a 70% of all pores (29). M. tuberculosis has also a pore-forming protein, OmpATb; however, its role as a porin is unclear (68). Porins consist of transmembrane antiparallel ß-strands with alternating hydrophobic amino acids (facing outwards) and hydrophilic amino acids (facing inwards) assembled into ßbarrels. Connecting these ß-strands there are short periplasmic turns and longer extracellular loops. The electrostatic field resulting from hydrophilic amino acids in the ßstrands and some extracellular loops, along with the size of the pore, will determine the selectivity of the transported molecules (35). These channels are known to have diverse functions, such as acting as receptors for bacteriocins, bacteriophages and elements of the immune system, but the main function of porins is to allow the diffusion of hydrophilic molecules into the cell. Many antibiotic molecules have low rates of diffusion through porins due to the fact that their sizes are similar to the exclusion limit; thus, limiting the uptake of antibiotics, porins contribute to intrinsic resistance (35). Active transport: Transporters Transporters are integral membrane proteins that transport molecules across the lipid bilayer against the electrochemical gradient. On the basis of bioenergetic and structural criteria, transporters can be classified in different groups. Attending to the source of energy, these proteins are classified in primary or secondary transporters. Primary transporters utilize ATP-hydrolysis whereas secondary transporters use transmembrane electrochemical gradient of protons or sodium ions (79). Depending on the similarities in primary and secondary structure, transporters can be divided into five families, detailed in the following section. 41 49. Yamada, H., A. Bhatt, R. Danev, N. Fujiwara, S. Maeda, S. Mitarai, K. Chikamatsu, A. Aono, K. Nitta, W. R. Jacobs, Jr., and K. Nagayama. 2012. Nonacid-fastness in Mycobacterium tuberculosis DeltakasB mutant correlates with the cell envelope electron density. Tuberculosis (Edinb) 92:351-357. 43 Chapter 1 Role of MFS proteins in Drug Resistance and Virulence of M. tuberculosis 44 45 Introduction Efflux pumps in mycobacteria have important roles Drug-resistance To prevent the intracellular accumulation of toxic compounds, bacteria have evolved energy-dependent systems to pump such molecules out of the cell. In mycobacteria, most of the drug resistant isolates have arisen through the acquisition of chromosomal mutations in genes encoding either drug targets or the drug activating enzymes (86), which usually confer high-levels of resistance. There are also a significant number of low-level drug resistant strains in which no mutation can be found. In these strains, the resistance phenotype can be explained in several ways: there could be mutations in other not yet discovered drug targets, alteration in the permeability of the cell envelope, or the resistance phenotype could be a consequence of the involvement of drug transporters, as it has been widely described for other bacterial genera (74). Virulence Transporters play an essential role in the expression of the virulence phenotype in bacteria. For example, AcrAB-TolC from Salmonella enterica serovar Typhimurium (22); regarding M. tuberculosis, the RND efflux pumps MmpL4, MmpL7, MmpL8 and MmpL10 are known to contribute to virulence (32, 37), as well as the ABC efflux pump DrrABC (23, 37). Efflux pumps object of study Rv1258c (Tap) This efflux pump from M. tuberculosis, belonging to MFS, has 12 TMS (Fig 8). Rv1258c orthologue was first described in Mycobacterium fortuitum, a fast-growing mycobacteria causing diverse infections in humans as an efflux pump mediating low-level resistance to tetracycline, streptomycin, gentamicin and other aminoglycosides (3). The M. tuberculosis Rv1258c was characterised in heterologous hosts (M. bovis BCG and M. smegmatis mc2155), showing a rather similar behaviour (3, 30, 82) . It was also observed that disruption of the Rv1258c-orthologue in the vaccine strain M. bovis BCG resulted in alterations in the growth kinetics (82). Other groups have revealed that this gene could be overexpressed in multidrug resistant clinical isolates of M. tuberculosis and that its expression depends on the 46 transcription factor whiB7 (65). Besides, Rv1258c has been reported to be conferring rifampicin tolerance upon macrophage infection (1). Rv1410c (P55) This efflux pump, a MFS protein with 12 TMS (Fig. 9) was first identified as the product of a gene downstream of that encoding the antigenic lipoprotein P27 from pathogenic M. bovis isolates in a two-gene operon (15, 16). Rv1410c efflux pump from M. tuberculosis was primarily characterised in the heterologous hosts M. smegmatis mc2155 (90) and M. bovis BCG (81) and identified some of their drug-substrates, among which the antituberculous drug rifampicin seems to increase the expression of this gene in M. bovis BCG (following our results using lacZ as a reporter gene); in the latter microorganism, its inactivation also produced alterations in colony and bacillus morphology (82). A recent study clearly indicated that P27 (Rv1411c) and Rv1410c are functionally connected in processes that involve the preservation of the cell wall and the transport of toxic compounds away from the cells (11). Almost simultaneously, two groups described that insertional inactivation of the upstream P27 gene resulted in strong attenuation of M. tuberculosis (17, 87); the first group also found a similar phenotype for the insertional inactivation of Rv1410c. Fig .8. Prediction of TMS of Rv1258c efflux pump, using Hidden Markov Models (http://www.cbs.dtu.dk/services/TMHMM/) 47 Rv2333c (Stp) It has been previously described the contribution of the Rv2333c efflux pump to intrinsic tetracycline and spectinomycin resistance of M. bovis BCG (80) where the inactivation of the gene resulted also in a slower growth rate in liquid media. Other group identified that the M. tuberculosis Rv2333c gene increased it expression by more than 10 times upon infection of human macrophages (25). Rv2333c protein belongs to the MFS Superfamily, and it has 14 TMS (Fig 10). Fig .9. Prediction of TMS of Rv1410c efflux pump, using Hidden Markov Models (http://www.cbs.dtu.dk/services/TMHMM/) Fig. 10. Prediction of TMS of Rv1410c efflux pump, using Hidden Markov Models (http://www.cbs.dtu.dk/services/TMHMM/) 48 Genetic tools for generating knock-out strains in M. tuberculosis The RecA protein was the first recombination enzyme to be identified in M. tuberculosis. As in E. coli, expression of M. tuberculosis RecA is associated with the SOS response that is triggered by DNA damage. Allelic exchange, or gene knockout, is an essential tool to investigate gene function in bacteria. It is usually achieved through the operation of homologous recombination systems to replace the target copy of the gene in the chromosome with an inactive copy of the gene located on a vector (88). Initial attempts to achieve allele replacement in M. tuberculosis were frustrated by the high levels of illegitimate recombination in the pathogen (48). Numerous strategies have been devised to obtain efficient allele replacement in M. tuberculosis. Most experiments have utilized a plasmid delivery system, although phage systems have also been employed (73, 92). Most recently, a “recombineering” method was developed; it’s based on the inducible expression of mycobacteriophage recombinases that enhance the frequency of recombination so that a linear fragment of DNA can recombinate in a single step (104). 49 OBJECTIVES - To construct a knock-out, a complemented and an overexpression strain, derived from H37Rv virulent strain, for each of the efflux pump genes Rv1258c, Rv1410c and Rv2333c. - To find if these efflux pump genes are implicated in intrinsic drug resistance of M. tuberculosis. - To perform infection assays with these strains with the aim of finding a possible role of M. tuberculosis in virulence. 50 Material and Methods Bacterial strains, media and growth conditions In this work, we have used M. tuberculosis H37Rv and E. coli XL1, and E. coli DH5α. E. coli strains were cultured in Luria-Bertani (LB) broth or on LB agar plates at 37ºC. Antibiotics were added when necessary, at final concentrations listed in Table 3. Liquid cultures were grown in glass tubes in a shaker. Cultures and all manipulations of M. tuberculosis were done in a Biosafety Level 3 Laboratory (BSL3). M. tuberculosis was cultured in Middlebrook 7H9 liquid medium supplemented with 10% ADC (0.5% bovine serum albumin, 0.2% dextrose, 0.085% NaCl, 0.0003% beef catalase) (Difco) (7H9/ADC from now). In order to keep the culture clump-free, Tween 80 was added to a final concentration of 0,05%, except for the media used in susceptibility assays and cultures for lipid extraction, which were supplemented with glycerol 0.5%. Solid medium was Middlebrook 7H10 agar supplemented either with 10% ADC (7H10/ADC from now) or 10% OADC (0.05% oleic acid, 0.5% bovine serum albumin, 0.2% dextrose, 0.085% NaCl, 0.0003% beef catalase) (Difco) (7H10/OADC from now). M. tuberculosis H37Rv and derivatives were grown at 37ºc; liquid cultures were done in cell culture flasks, without shaking. Antibiotics, X-Gal (5-bromo-4-chloro-indolyl-β-D-galactopyranoside) and sucrose were added when necessary at final concentrations listed in table 3. X-Gal was used to visualize the expression of the reporter gene lacZ, whereas sucrose was used for the counterselection of bacteria containing vectors carrying sacB gene. Storage of strains was done at -80ºC in presence of 15% glycerol. 57 Oligonucleotides All the oligonucleotides are listed in Table 5. Artificial endonuclease restriction sites were added when required and are shown underlined. Oligonucleotide Sequence 5’->3’ Description 2333-1F GACGGCCTGCAGTGGGTG Sequencing pCRS2 2333-1R CATGGCGACGGTCGTGATC Sequencing pCRS2 2333-B CCAGTGGAATTCGACGAAAC To verify stp knock-out mutants.Sequencing. 2333-med TCTGACCCTGTTCCGCG To verify stp knock-out mutants.Sequencing. cp55-1 TTGCTCACATGTTCTTTCCTG Sequencing P55 gene cp55-2 CGACGGCAAACACGTACTG Sequencing P55 gene cspt1 GGTGAGCACCGCGATTG Sequencing pCRS2 cspt2 GTTCCTGCAGAACGTGCG Sequencing pCRS2 ctap5 GTCGACTACTTCGGGCGTC To verify tap knock-out mutants.Sequencing. ctap6 GACCATCGATGCCAAACC To verify tap knock-out mutants.Sequencing. ctap7 GTCCAACGACCAGCCTGC Sequencing tap gene. ctap8 CGCTGTATCTGCCGATGG Sequencing tap gene. Hyg-out TGATCCGGTGGATGACC To verify knock-out mutants Km903-A CTCGTGAAGAAGGTGTTGCT To confirm presence of KmR Tn903derived gene Km903-B CCGACCATCAAGCATTTTAT To confirm presence of KmR Tn903derived gene M13Fw GTAAAACGACGGCCAGT To sequence pSUM36 and derivatives M13Rv AGCGGATAACAATTTCACAC To sequence pSUM36 and derivatives P55 trans-in ACGCCCTGGCCGAACAGC To verify P55 knock-out mutants.Sequencing. P55-C1 TTTTAGATCTTTCACCGGTGGCGTCC To clone P55 gene in pSUM36. BglII site underlined. P55-C2 TTTTAAGCTTCTTGGTCGGCACCGGC To clone P55 gene in pSUM36 and pMVD361. HindIII site underlined. P55-C4 TTTTGAATTCTTTCACCGGTGGCGTCC To clone P55 gene in pMVD361 EcoRI site underlined. p55-out1 GGATGACCGGCATGTTGATC To confirm presence of pCRS3 pks3-Fw CGCTGACGTCGGTGAAAAC To sequence position 1467 of pks3 gene pks3-Rv CTGCACCCGGTCAATACC To sequence position 1467 of pks3 gene pMV361-A CAGGAGCATTGCCGTTCC Sequencing pMV361 and derivatives pMV361-B CCTCGAGCAAGACGTTTCC Sequencing pMV361 and derivatives RP-180 ATGCAGCTGGCACGACAGGT To verify replicative plasmids derived from pSUM36. Spt-C2 CCAACAACGTTTTGGCGTTTCC To clone stp gene in pMV361. AclI site underlined. Spt-C3 CTGCAGCCAAGCTTGCATGCC To clone stp gene in pMV361. HindIII site underlined. spt-out1 CCAGTGGCGATGAGCGTGAG To confirm presence of pSAN17and pCRS2 Tap-C2 TTTTAACGTTGCCCGGGGGCGCAC To clone tap gene in pMV361 AclI site underlined. Tap-C3 TTTTAAGCTTGTACAGGCCGGGCTGGC To clone tap gene in pMV361 HindIII site underlined. tap-out1 CAGCGTTGCGAACAGGATCAG To confirm presence of pPAZ11 and pCRS4 TN5-A CGCTTGGGTGGAGAGGCTATTC To confirm presence of KmR Tn5derived gene TN5-B CCGCTCAGAAGAACTCGTCAAG To confirm presence of KmR Tn5derived gene vec19-up AGCAGGACGTCGAGTCGCG To verify P55 knock-out mutants.Sequencing. Table 5. Oligonucleotides used in this study. 58 Southern Blot Approximately 3 µg of extracted genomic DNA were digested with PvuII or PstI (see table x). The fragments were separated by electrophoresis through 0.8% agarose gels in TrisBorate-EDTA (TBE) buffer for 18h at 36V. After migration, a standard treatment of the gel was performed. DNA was fixed by UV light for 5min and subjected to a depurination treatment (0.25M HCl for 10min), washing, denaturalization (0.5M NaOH, 1.5M NaCl for 20min) and neutralization (1.5M NaCl, 1M Tris, pH=8.0 for 20min). Hereafter, DNA was vacuum blotted (45-60mbar for 1h 30min) onto a Hybond-N+ nylon membrane (Amersham) using 10x SSC buffer (1.5M NaCl, 150mM sodium citrate). Blotted DNA was fixed by UV light for 4 min and hybridized with a specific probe. This probe was made by PCR with Taq Gold polymerase (Applied Biosystems) using specific oligonucleotides (Table 6). This PCR product was then purified using GFXTM PCR kit and adjusted to 10 ng/µl. After labeling the probe, hybridization patterns were visualized using ECLTM Direct Nucleic Acid Labelling and Detection System (Amersham). Generation of competent cells & electroporation E. coli To prepare electrocompetent cells, 300 ml of a bacterial culture were grown to an OD600nm of 0.4 - 0.6. Then the growth was stopped for 30 min on ice, and bacteria were washed twice in chilled-cold water, and once in chilled-cold 10% glycerol. Cells are finally resuspended in 1 ml chilled-cold 10% glycerol. Aliquots of 40 µl can be storaged at -80ºC for further use. Aliquots of 40 µl were electroporated with ~100 ng purified plasmid DNA in 0.2 cm gap cuvettes (Bio-Rad) with a single pulse (2.5kV, 25µF, 200Ω) in a GenePulser XcellTM (BioRad). Cells were resuspended in LB to a final volume of 1 ml and incubated for 1h at 37ºC M. tuberculosis H37Rv deleted gene DNA digested with Probe PCR with oligonucleotides Size Rv1258c PstI ctap5 vs ctap6 0,7 Kb Rv2333c PvuII 2333-med vs 2333-B 1,1 Kb Rv1410c PvuII p55-trans-in vs vec19-up 0,9 Kb Table 6. Restriction enzymes used for digesting genomic DNA and construction of specific probes for Southern Blot. 59 before plating several dilutions on plates containing the needed antiobiotic. Colonies appeared after incubation overnight. M. tuberculosis M. tuberculosis competent cells were prepared as described by Wards et al. (108). 200 ml of bacterial culture were grown to an OD600nm of 0.6-0.8. 24 h before preparing the competent cells, glycine was added to the cells to a final concentration of 0,2 M and incubated at 37ºC. All the process was performed at room temperature. Bacterial pellet was washed twice with 0.05% Tween80 and once with 10% glycerol-0.05% Tween-80, and finally resuspended in 2ml of 10% glycerol-0.05% Tween-80. Aliquots of 200-400 µl of competent cells can be storaged at -80ºC for further use. Aliquots of 200-400µl were electroporated with 100-200 ng of replicative or integrative plasmid DNA (previously purified), using 0.2 cm gap cuvettes (Bio-Rad) with a single pulse (2.5kV, 25µF, 1000Ω) in a GenePulser XcellTM (Bio-Rad). Cells were recovered with 1ml of 7H9-ADC-0.05% Tween-80 and incubated for 24h at 37ºC, to express the antibiotic resistance genes, before plating serial decimal dilutions on plates containing the relevant antibiotic. Colonies typically appeared in 3-4 weeks. Suicide plasmids Electrocompetent cells were prepared the same way, but resuspending in a final volume of 1,5 ml 10% glycerol-0.05% Tween-80 in order to obtain a denser cell suspension. Fresh 400 µl aliquots were transformed with 15-20 µg of purified plasmid DNA, which had been previously irradiated with UV light (λ=360nm) for 2-10 s. All the transformation mix was plated, dividing it in three agar plates. Colonies typically appeared in 4-5 weeks. Construction of knock-out strains of M. tuberculosis Knock-out mutants of M. tuberculosis H37Rv were constructed following the method described by Parish et al. (73). A suicide plasmid fulfilling several characteristics is needed (Fig 13). 60 This plasmid has the target gene disrupted by a Hyg resistance marker, in addition to a Km resistance marker and a cassette containing the genes lacZ and sacB under control of the strong promoters PAg85 and Phsp60 respectively. Since it lacks an origin of replication for mycobacteria, it is a suicide plasmid.!! ! A suicide plasmid derived from pNIL and pGOAL series had been previously constructed in our group for each target gene Rv1258c (pVZ17), Rv2333c (pILI9) and Rv1410c (pILI12) (see plasmids). When this plasmid was electroporated in M. tuberculosis (see Generation of competent cells and electroporation, M. tuberculosis, suicide plasmids), a first event of simple recombination can take place between the disrupted gene of the plasmid and the wildtype gene in the genomic DNA resulting in a recombinant strain, named Single Cross Over (SXO) mutant. SXO strain has the suicide plasmid integrated in its genomic DNA, so mutants are resistant to Hyg and Km, and have a lactose positive phenotype; for this reason they were selected in 7H10/ADC supplemented with Hyg, Km and X-Gal. Blue colonies (lac+) were candidates for being SXO. Thus, they were inoculated in 7H9/ADC with Hyg and Km, and incubated for 10-15 days at 37ºC. Several PCRs were performed to verify this first recombination. In order to induce the second recombination event, several decimal dilutions (10-1, 10-2 and 10-3) of SXO strain liquid culture were plated on 7H10/ADC supplemented with Hyg, X-Gal and sucrose. The marker gene cassette has the counter-selection marker sacB, which is lethal for bacteria in the presence of sucrose (75). Thus, SXO mutant wasn’t able to grow in the selection medium, except the case when the wild-type and the disrupted genes recombinated, removing the plasmid from the genome. This second recombination event yielded the Double Cross Over (DXO) mutant, which was the final knock-out strain, with a phenotype Hyg and sucrose resistant, Km sensitive and lactose negative. White colonies (lac-) were candidates for being DXO strains, so they were inoculated in 7H9/ADC/Hyg and cultured for 10-15 days, then checked by PCR and Southern Blot P Ag85 -lacZ, P hsp60 -sacB Suicide plasmid Fig. 13. Scheme of suicide plasmids for generating knock-out mutants. 61 Phenotypical characterization of M. tuberculosis Growth in liquid medium In order to characterize growth in liquid medium, 100 ml of 7H9/Tween/ADC were inoculating with 105 cfu/ml, using a culture in logarithmic phase. OD600nm was measured for 1 month. When OD600 reached 1, the culture was diluted ½ and ¼ and OD corrected depending on the dilution. Neutral Red Stain This method was adapted from Soto et al. (93). Mycobacterial strains were grown on 7H10/ADC medium for 3-4 weeks. Cells were placed and gently disgregated in Falcon 15ml tubes containing 4ml of 50% methanol, and then incubated for 1h at 37ºC. Cells were pelleted by centrifugation (4000 rpm, 5 min), and methanol removed. Then, 4ml barbital buffer were added and the pellet mixed by inversion. Subsequently, 150µl of a solution of neutral red were added. Results were evaluated after 1h incubation at 37ºC. A. Medium with sucrose B. Medium without sucrose Fig. 14. Comparison of growth of M. tuberculosis carrying sacB gene in medium with and without sucrose. Dilution of the SXO liquid culture is indicated. White colonies (lac-) are candidates for DXO mutants, whereas SXO are spontaneous mutants resistant to sucrose. 62 Reagents & Solutions 50% methanol : 50% methanol, 50% distilled water Barbital buffer : 1% sodium barbital in 5% NaCl, pH=9.8 Neutral red: 0,05% neutral red disolved in distilled water. Analysis of lipids of M. tuberculosis cell wall Extraction of free lipids and mycolic acids from M. tuberculosis cell wall Strains were inoculated in 200 ml 7H9/ADC/0,5% glycerol, it is important not to add Tween 80 because the free lipids can be partially lost. After approximately one month of incubation at 37ºC, cultures were centrifuged (4000 rmp, 20 min) and PBS 1x added to wash the cells. Subsequently, cells were pelleted (4000 rpm, 1h) and PBS removed by decanting. Pellets can be frozen and storaged at -80ºC or used immediately. First extraction was performed with chloroform:methanol 1:1. Bacterial pellets were let to dry as much as possible before resuspending them in 4 ml methanol. The suspension was then transferred to a glass tube with PTFE cap and 4 ml chloroform were added. This mix was incubated for 2 days at room temperature, gently shaking occasionally. The organic phase containing free lipids was then transferred to a fresh glass tube. A second extraction was made using 4 ml chloroform:methanol 2:1. The two extracted fractions were joined in the same glass tube, and further evaporation of the organic phase with a stream of nitrogen gas resulted in dried pellet of lipids. The remaining bacterial residues were kept to extract mycolic acids. First, 8 ml of MeOH:toluene:H2SO4 (30:15:1) were added to the glass tube containing the bacterial residues, and heated at 80ºC overnight, vortexing occasionally. In this process the esther bond was broken and mycolic acids released as methylic esthers. Two consecutive extractions with 8 ml hexane were made, and hexane further evaporated with a stream of nitrogen gas. Thin Layer Chromatography Crude extracts and mycolic acids were resuspended in 100 µl and 200 µl chloroform, respectively. 10 µl of each extract were deposed on silica gel G60 plates (20x20cm; Merck) 63 and analyzed by thin layer chromatography (TLC). As controls, 10 µl of purified fractions of M. tuberculosis cell wall free lipids (2mg/ml) were included. Different solvents were used depending on the polarity of the lipids we want to separate (Table 7). To visualize lipids, several reagents can be used: anthrone for glycolipids, Dittmer (molybdenum blue) for phospholipids and molybdophosphoric acid (MPA) for general lipids. Plates were sprayed with the chosen reagent and then heated a 110ºC-120ºC until coloured spots appeared. Lipids Eluent (v:v) Reagent PAT, DAT, CF, SL-I CHCl3:MeOH 85:15 Anthrone PIMs CHCl3:MeOH:H2O 60:35:8 Anthrone Phospholipids CHCl3:MeOH:H2O 60:35:8 Dittmer PDIM, TG Petroleum ether:diethylether 90:10 PMA PGLs CHCl3:MeOH 95:5 Anthrone Mycolic acids Hexane: diethylether 85:15 PMA Reagents & Solutions Anthrone : 1% anthrone in H2SO4 Molybdophosphoric acid : molybdophosphoric acid 10% in ethanol Susceptibility assays: Minimum Inhibitory Concentration The resazurin assay Serial two-fold dilutions of antibiotics were performed in 7H9/glycerol 0,5%/ADC medium, in 96-well microtiter plates, with a final volume of 100µl per well. Liquid cultures of M. tuberculosis in logarithmic phase were adjusted to 105 cfu/ml in 7H9/glicerol 0,5%/ADC. 100µl of this suspension were added to each well and plates were incubated 6 days at 37ºC. 30 µl of resazurin solution were then added to each well, and results were observed after 48h of incubation at 37ºC. Resazurin (blue) is an indicator of bacterial growth, since metabolic activity of bacteria reduces it to resofurin (pink). Table 7. Eluents and Reagents used in TLC for each group of lipids. 64 Minimum Inhibitory Concentration (MIC) is the concentration of antibiotic of the first well that doesn’t change color from blue to pink. Reagents & Solutions Resazurin : 0,1 mg/ml resazurin in distilled water Infection assays Intracellular replication in J774 mouse macrophages Intracellular replication of M. tuberculosis was tested in J774 mouse macrophage-like cells. J774 cells were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 4mM L-glutamine (“complete DMEM” from now). Infections were performed at a multiplicity of infection (MOI) of 0.5-1 bacteria per macrophage, with a variable number of cells per well depending on the experiment. After 4 h, infection was stopped by removing bacterial suspension and cells were washed three times with 1 ml PBS, and finally cultured in 2ml complete DMEM per well to allow intracellular replication. Medium was replaced when needed (typically every 1-2 days) by removing 1,5 ml of overlaying DMEM and adding the same volume of fresh complete DMEM. In order to know the number of intracellular bacteria at the end of time of infection (4h) and days 3, 5 and 7 post-infection, DMEM medium was removed, and 300 µl 0.1% triton X100 were added to each well in order to lyse the cells. 700 µl of PBS were added per well and the solution carefully mixed. Several dilutions of this lysate were plated on 7H10/ADC plates and viable bacteria counted after 2-4 weeks. Apoptosis induction in J774 mouse macrophages Apoptosis induction of M. tuberculosis was tested in J774 mouse macrophage-like cells. J774 cells were seeded in wells, in complete DMEM. Infections were performed at a multiplicity of infection (MOI) of 30-50 bacteria per macrophage, with 105 cells per well. After 4 h, infection was stopped by removing bacterial suspension and cells were washed three times with 1 ml PBS, and finally cultured in 2ml complete DMEM per well to allow intracellular replication. At day 3 or 4 post-infection, both supernatant and trypsinized cells were collected together in 15 ml screw-cup tubes. Phosphatidylserine exposure and membrane integrity were analyzed by using Annexin-V and 7-actinomycinD (BD Biosciences) and flow cytometry according to manufacturer instructions. Briefly, cells were washed with PBS and incubated 65 with Annexin-V and 7AAD in Annexin-binding buffer for 15 min. After that, cells were washed twice with PBS, fixed with 4% paraformaldehyde (PFA) during 30 min and washed again with PBS. Both PBS and PFA solutions contained CaCl2 2.5 mM. Replication in lungs in mouse model Intratracheal infection in C57BL/6 mice was performed with 150-300 CFU of bacteria in 50µl of PBS 1x per mouse and 5 mice were used per strain. To deliver bacterial suspension, isoflurane anesthetized mice were orally intubated with a lachrymal olive luer-lock (UNIMED), 30mm in length and 0.6mm in diameter. Serial dilutions of the bacterial suspension were plated to corroborate the number of viable bacteria. Three weeks postinfection, lungs from each animal were harvested and placed in PBS for bacterial burden evaluation. To analyze bacterial replication, lungs were homogenized using GentleMacs homogeneizer (Miltenyi Biotec) and CFU counted by plating serial dilutions on 7H11/ADC solid medium supplemented with polymyxin 50U/ml, trimethopim 20mg/l and amphotericin B 10mg/l. The protocol for animal handling was previously approved by University of Zaragoza Animal Ethics Committee. 66 Results and Discussion Generation of M. tuberculosis knock out mutants We have used the method described by Parish et al. (73) to generate three knock-out mutants, H37Rv KOTAP, H37Rv KOSTP and H37Rv KOP55, with Rv1258c, Rv2333c and Rv1410c genes deleted respectively. The correspondent suicide plasmid (Table 8) was electroporated in M. tuberculosis H37Rv competent cells, and the colonies grown on 7H10/ADC/Hyg/X-Gal that presented lactose positive (blue) phenotype, selected as potential SXO candidates. These colonies were grown in liquid medium, and subsequently verified by PCR (Table 9). The second event of recombination, which will yield the knock-out mutant, was induced by inoculating the SXO strains on 7H10/ADC/Hyg/suc plates. After 4 weeks, the colonies with Hyg resistant and lactose negative (white) phenotype were inoculated in liquid medium, as they were candidates for DXO mutants. Most of the colonies were lactose positive; they were spontaneous mutants to sucrose. Several PCRs were performed to confirm the DXO candidates (Table 9). The whole process of knock-out generation took about 6 months. Suicide plasmid Targeted gene Knock-out strain pVZ17 Rv1258c H37Rv KOTAP pILI9 Rv2333c H37Rv KOSTP pILI12 Rv1410c H37Rv KOP55 Table 8. Suicide plasmids used to generate H37Rv efflux pumps knock-out mutants. 73 As it is observed in Fig. 20, no significant differences were noted between the wild type and the knock-out strains. However, a possible difference could be masked by the nutrient-rich media; if these efflux pumps are transporting any molecule important for the fitness of bacteria, maybe it can only be visualized in a minimum medium. The P55 knock-out mutant and overexpressing strains have limited growth ability on solid media Both knock-out and overexpression strains formed smaller colonies than the wild-type after two weeks of incubation. However, the colony of overexpression strain was rougher than the one of knock out mutant. 0,100 1,000 10,000 0 5 10 15 20 25 30 35 40 45 O.D. 600nm t (days) H37Rv KOTAP KOSTP KOP55 Fig. 20. Growth curves of H37Rv, H37Rv KOTAP, H37Rv KOSTP and H37Rv KOP55. KO P55 H37Rv H37Rv H37Rv pCVZ1 Fig 21. Comparison between morphologies of wild type (H37Rv) and P55 knock-out (KO P55) colonies. Fig 22. Comparison between morphologies of wild type (H37Rv) and P55 overexpression (pCVZ1) colonies. 74 Deletion of P55 efflux pump results in a flat colony, and the rough texture is restored in the complemented strain. Susceptibility assays Minimum Inhibitory Concentrations were calculated by the resazurin method. Results of susceptibility assays are showed in Tables 13-15. Differences in susceptibility are shaded. Increased susceptibility to spectinomycin (16-fold), gentamicin (2-fold) and streptomycin (2-fold) was found for Rv1258c knockout mutant. Deletion of Rv1410c caused a decrease in MICs of vancomycin and rifampicin (8-fold). Accordingly, the complemented knockout mutants showed wild type susceptibility levels. Rv2333c knockout mutant showed increased susceptibility to vancomycin, but wild type susceptibility levels are not reached in the complemented strain. Rv1258c( Compound( MIC((mg/l)( H37Rv( KOTAP( KOTAPc( Spectinomycin( 128$64' 8$4' 64$32' Streptomycin( 0,4' 0,2' 0,4' Ethambutol( 2' 2' 2' Gentamicin( 4' 2' 4' Isoniazid( 0,4' 0,4' 0,4' Tetracyclin( 4' 4' 4' Triclosan( 32' 32' 32' Chloramphenicol( 4$2' 4$2' 4$2' Acriflavine( 2' 2' 2' KOP55 KOP55c Fig 23 Morphology of P55 knock-out mutant (KOP55) and complemented strain (KOP55c) colonies after two months of growth. Table 13. MICs of Rv1258c knock out and complemented strains. 75 Rv1410c( Compound( MIC((mg/l)( H37Rv( KOP55( KOP55c( Isoniazid( 0,4' 0,4' 0,4' Gentamicin( 4' 4' 4' Triclosan( 32' 32' 32' Vancomycin( 4$2' 0,5$0,25' 2$1' Rifampicin( 0,0128$0,0064' 0,0016' 0,0064' Tetracyclin( 4' 4' 4' Chloramphenicol( 4$2' 4$2' 4$2' Acriflavine( 4' 2' 2' Rv2333c( Compound( MIC((mg/l)( H37Rv( KOSTP( KOSTPc( Rifampicin( 0,0064' 0,0064$0,0032' 0,064$0,0032' Chloramphenicol( 4' 4' 4' Triclosan( 32' 32' 32' vancomycin( 4$2' 1' 1' Isoniazid( 0,4' 0,4' 0,4' Infection assays Intracellular replication in J774 Intracellular replication of knock-out, complemented and the wild type strains was tested in J774 mouse macrophage-like cells. The multiplicity of infection (MOI) was 0.5-1 bacteria per macrophage. At 4 h and 1, 3, 5 and 7 days post-infection, intracellular bacteria were counted. (Fig 23, 24, 25). Infection assays in mouse macrophages showed that Rv1258c, Rv2333c and Rv1410c efflux pumps could be implicated in virulence, as they have less intracellular replication than the wild type. Table 14. MICs of Rv1410c knock out and complemented strains. Table 15. MICs of Rv1410c knock out and complemented strains 76 Fig. 23. Replication of efflux pump mutants referred to 4h post-infection in J774 mouse macrophagelike cells. N: number of viable intracellular bacteria on the respective day postinfection. N0: number of viable intracellular bacteria on 4h postinfection. A. Rv1258c mutants. B. Rv2333c mutants. C. Rv1410c mutants. 0! 5! 10! 15! 20! 25! 0! 3! 5! 7! N/N0' day'postWinfection' H37Rv! KOTAP! KOTAP!c! 0! 5! 10! 15! 20! 25! 30! 35! 40! 45! 50! 0' 3' 5' 7' N/N0' days'postWinfection' H37Rv! KOP55! KOP55!c! 0! 5! 10! 15! 20! 25! 30! 35! 40! 45! 0! 3! 5! 7! N/N0' days'postWinfection' H37Rv! KOSTP! KOSTPc! 77 Apoptosis induction in cells J774 Level of apoptosis induced by wild-type and knock-out mutants was determined in J774 mouse macrophage cells. J774 cells were infected with H37Rv, KOTAP and KOP55 and marked with annexin-V and 7-AAD. By analysis of J774 infected cells by flow citometry, the proportion of cells in an apoptotic state can be found. The apoptotic cells show annexin fluorescence, but don’t show 7-AAD fluorescence. No differences in the proportion of apoptotic cells infected with wild-type and knock-out mutants were found (Fig 24). P55 shows an attenuated phenotype in mouse model infection The wild type strain and the three knock-out mutants were tested in immunocompetent mice C57BL/6. Infection was carried out inoculating 150-300 CFUs via intratracheal injection. After three weeks of infection, mice were sacrified and viable counts were performed on serial dilutions of the homogenized lungs. Table x shows the Replication of efflux pumps mutants in mouse lung. Fig.24. Analysis of annexin-V and 7-AAD fluorescence of J774 cells by flow citometry. 78 Among the three knock out mutants, the only one that showed an attenuated phenotype in immunocompetent mice was KOP55. However, these experiments are going to be done in immunodeficient mice, in which we can see more clearly if there is a contribution to virulence. Fig. 25. Replication of efflux pumps mutants in mouse lung. Average Log CFU of the inoculum suspension and at week 3 post-infection. 0! 1! 2! 3! 4! 5! 6! 7! 0' 0,5' 1' 1,5' 2' 2,5' 3' 3,5' Log'CFU' t'(weeks)' H37Rv! KOTAP! KOSTP! KOP55! 79 Conclusions • The efflux pump Rv1258c (Tap) of M. tuberculosis is implicated in intrinsic resistance to streptomycin, gentamicin and spectinomycin. The knock out mutant of tap didn’t show a difference in susceptibility to tetraclycine compared to the wild type H37Rv strain, as it did with M. bovis BCG model. Infection assays in mouse macrophage cell model revealed that Tap could have a role in virulence. However, the knock-out mutant of Rv1258c had the same phenotype as H37Rv in infection assays in immunocompetent mouse model. • Rv1410c (P55) efflux pump of M. tuberculosis is contributing to intrinsic resistance to rifampicin, one of the two main antibiotics in antituberculous treatment, and vancomycin. H37Rv knock-out mutant of Rv1410c has altered growth in solid media: it grew more slowly than the wild-type and showed a flatter and smoother morphology of colony. Mouse macrophage cell infection assays and in vivo infection (immunocompetente mice) showed that P55 has a role in virulence of M. tuberculosis. • H37Rv knock-out mutant of Rv2333c (Stp) didn’t show increased susceptibility to tetracycline and spectinomycin, as it did M. bovis BCG Rv2333c knock-out mutant. Infection assays in mouse macrophage cell model revealed that Stp could have a role in virulence. However, infection assays of immunocompetent mice showed no difference between the replication in lungs of the knock-out mutant of Rv2333c and that of H37Rv wild-type strain. • Rv1258c, Rv2333c and Rv1410c don’t seem to be implicated in apoptosis induction of mouse macrophage cells. 80 References 1. Adams, K. N., K. Takaki, L. E. Connolly, H. Wiedenhoft, K. Winglee, O. Humbert, P. H. Edelstein, C. L. Cosma, and L. Ramakrishnan. 2011. Drug tolerance in replicating mycobacteria mediated by a macrophage-induced efflux mechanism. Cell 145:39-53. 2. Ainsa, J. A., M. C. Blokpoel, I. Otal, D. B. Young, K. A. De Smet, and C. Martin. 1998. Molecular cloning and characterization of Tap, a putative multidrug efflux pump present in Mycobacterium fortuitum and Mycobacterium tuberculosis. Journal of bacteriology 180:5836-5843. 3. Ainsa, J. A., C. Martin, M. Cabeza, F. De la Cruz, and M. V. Mendiola. 1996. Construction of a family of Mycobacterium/Escherichia coli shuttle vectors derived from pAL5000 and pACYC184: their use for cloning an antibiotic-resistance gene from Mycobacterium fortuitum. Gene 176:23-26. 4. Bianco, M. V., F. C. Blanco, B. Imperiale, M. A. Forrellad, R. V. Rocha, L. I. Klepp, A. A. Cataldi, N. Morcillo, and F. Bigi. 2011. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds. BMC infectious diseases 11:195. 5. Bigi, F., A. Alito, M. I. Romano, M. Zumarraga, K. Caimi, and A. Cataldi. 2000. The gene encoding P27 lipoprotein and a putative antibiotic-resistance gene form an operon in Mycobacterium tuberculosis and Mycobacterium bovis. Microbiology 146 ( Pt 4):1011-1018. 6. Bigi, F., C. Espitia, A. Alito, M. Zumarraga, M. I. Romano, S. Cravero, and A. Cataldi. 1997. A novel 27 kDa lipoprotein antigen from Mycobacterium bovis. Microbiology 143 ( Pt 11):3599-3605. 7. Bigi, F., A. Gioffre, L. Klepp, M. P. Santangelo, A. Alito, K. Caimi, V. Meikle, M. Zumarraga, O. Taboga, M. I. Romano, and A. Cataldi. 2004. The knockout of the lprG-Rv1410 operon produces strong attenuation of Mycobacterium tuberculosis. Microbes and infection / Institut Pasteur 6:182-187. 8. Buckley, A. M., M. A. Webber, S. Cooles, L. P. Randall, R. M. La Ragione, M. J. Woodward, and L. J. Piddock. 2006. The AcrAB-TolC efflux system of Salmonella enterica serovar Typhimurium plays a role in pathogenesis. Cellular microbiology 8:847-856. 9. Camacho, L. R., P. Constant, C. Raynaud, M. A. Laneelle, J. A. Triccas, B. Gicquel, M. Daffe, and C. Guilhot. 2001. Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. The Journal of biological chemistry 276:19845-19854. 10. Cappelli, G., E. Volpe, M. Grassi, B. Liseo, V. Colizzi, and F. Mariani. 2006. Profiling of Mycobacterium tuberculosis gene expression during human macrophage infection: upregulation of the alternative sigma factor G, a group of transcriptional regulators, and proteins with unknown function. Research in microbiology 157:445455. 11. Cardona, P. J., C. Y. Soto, C. Martin, B. Giquel, G. Agusti, N. Andreu, E. Guirado, T. Sirakova, P. Kolattukudy, E. Julian, and M. Luquin. 2006. Neutral-red reaction is related to virulence and cell wall methyl-branched lipids in Mycobacterium tuberculosis. Microbes and infection / Institut Pasteur 8:183-190. 12. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry, 3rd, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of 81 Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537544. 13. De Rossi, E., P. Arrigo, M. Bellinzoni, P. A. Silva, C. Martin, J. A. Ainsa, P. Guglierame, and G. Riccardi. 2002. The multidrug transporters belonging to major facilitator superfamily in Mycobacterium tuberculosis. Mol Med 8:714-724. 14. Domenech, P., M. B. Reed, and C. E. Barry, 3rd. 2005. Contribution of the Mycobacterium tuberculosis MmpL protein family to virulence and drug resistance. Infection and immunity 73:3492-3501. 15. Forrellad, M. A., L. I. Klepp, A. Gioffre, Y. G. J. Sabio, H. R. Morbidoni, M. D. Santangelo, A. A. Cataldi, and F. Bigi. 2012. Virulence factors of the Mycobacterium tuberculosis complex. Virulence 4. 16. Kalpana, G. V., B. R. Bloom, and W. R. Jacobs, Jr. 1991. Insertional mutagenesis and illegitimate recombination in mycobacteria. Proceedings of the National Academy of Sciences of the United States of America 88:5433-5437. 17. Morris, R. P., L. Nguyen, J. Gatfield, K. Visconti, K. Nguyen, D. Schnappinger, S. Ehrt, Y. Liu, L. Heifets, J. Pieters, G. Schoolnik, and C. J. Thompson. 2005. Ancestral antibiotic resistance in Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 102:12200-12205. 18. Parish, T., and N. G. Stoker. 2000. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology 146 ( Pt 8):1969-1975. 19. Paulsen, I. T., and K. Lewis (ed.). 2002. Microbial Multidrug Efflux. Horizon Scientific Press. 20. Pelicic, V., J. M. Reyrat, and B. Gicquel. 1996. Generation of unmarked directed mutations in mycobacteria, using sucrose counter-selectable suicide vectors. Molecular microbiology 20:919-925. 21. Ramon-Garcia, S., C. Martin, E. De Rossi, and J. A. Ainsa. 2007. Contribution of the Rv2333c efflux pump (the Stp protein) from Mycobacterium tuberculosis to intrinsic antibiotic resistance in Mycobacterium bovis BCG. The Journal of antimicrobial chemotherapy 59:544-547. 22. Ramon-Garcia, S., C. Martin, C. J. Thompson, and J. A. Ainsa. 2009. Role of the Mycobacterium tuberculosis P55 efflux pump in intrinsic drug resistance, oxidative stress responses, and growth. Antimicrobial agents and chemotherapy 53:36753682. 23. Ramon-Garcia, S., V. Mick, E. Dainese, C. Martin, C. J. Thompson, E. De Rossi, R. Manganelli, and J. A. Ainsa. 2012. Functional and genetic characterization of the tap efflux pump in Mycobacterium bovis BCG. Antimicrobial agents and chemotherapy 56:2074-2083. 24. Sander, P., and E. C. Bottger. 1999. Mycobacteria: genetics of resistance and implications for treatment. Chemotherapy 45:95-108. 25. Sassetti, C. M., and E. J. Rubin. 2003. Genetic requirements for mycobacterial survival during infection. Proceedings of the National Academy of Sciences of the United States of America 100:12989-12994. 26. Saunders, G. a. M., J. . 2003. Molecular Biology of M. tuberculosis. In Mycobacteria and TB. Kaufmann SHE, Hahn H (eds):. 27. Silva, P. E., F. Bigi, M. P. Santangelo, M. I. Romano, C. Martin, A. Cataldi, and J. A. Ainsa. 2001. Characterization of P55, a multidrug efflux pump in Mycobacterium bovis and Mycobacterium tuberculosis. Antimicrobial agents and chemotherapy 45:800-804. 28. Simeone, R., M. Leger, P. Constant, W. Malaga, H. Marrakchi, M. Daffe, C. Guilhot, and C. Chalut. 2010. Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis. The FEBS journal 277:2715-2725. 82 29. Sirakova, T. D., A. K. Thirumala, V. S. Dubey, H. Sprecher, and P. E. Kolattukudy. 2001. The Mycobacterium tuberculosis pks2 gene encodes the synthase for the heptaand octamethyl-branched fatty acids required for sulfolipid synthesis. The Journal of biological chemistry 276:16833-16839. 30. Soto, C. Y., N. Andreu, I. Gibert, and M. Luquin. 2002. Simple and rapid differentiation of Mycobacterium tuberculosis H37Ra from M. tuberculosis clinical isolates through two cytochemical tests using neutral red and nile blue stains. Journal of clinical microbiology 40:3021-3024. 31. Stover, C. K., V. F. de la Cruz, T. R. Fuerst, J. E. Burlein, L. A. Benson, L. T. Bennett, G. P. Bansal, J. F. Young, M. H. Lee, G. F. Hatfull, and et al. 1991. New use of BCG for recombinant vaccines. Nature 351:456-460. 32. van Kessel, J. C., and G. F. Hatfull. 2007. Recombineering in Mycobacterium tuberculosis. Nature methods 4:147-152. 33. van Soolingen, D., P. E. de Haas, P. W. Hermans, and J. D. van Embden. 1994. DNA fingerprinting of Mycobacterium tuberculosis. Methods in enzymology 235:196205. 34. Wards, B. J., and D. M. Collins. 1996. Electroporation at elevated temperatures substantially improves transformation efficiency of slow-growing mycobacteria. FEMS microbiology letters 145:101-105. 89 nucleotide polymorphism (SNP) in the Rv2629 gene by using real-time PCR followed by high-resolution melting has also been described (4). In this work, we present the analysis of target mutations in clinical isolates of M. tuberculosis resistant to STR. In addition, we investigated the nucleotide sequence of Rv1258c gene encoding the drug efflux pump Tap from M. tuberculosis, which transports STR and other antibiotics, as we have previously described (2), (8), (19), as a potential STR resistance determinant. We identified a nucleotide insertion in the coding sequence of the Rv1258c gene, which does not seem to be associated with resistance to this drug. Interestingly, this insertion is exclusive of the Beijing family of M. tuberculosis isolates and has led to the development of a method for screening M. tuberculosis strains (either purified DNA or directly on respiratory samples) and reliably identifying those belonging to the Beijing family of strains. 90 MATERIALS & METHODS M. tuberculosis DNA samples First, DNA samples of 18 M. tuberculosis clinical isolates resistant to STR and some additional drugs (including several MDR isolates), of the Universidad de Zaragoza culture collection, along with the control strain H37Rv (fully drug susceptible) were used as template to amplify and sequence the target genes (rpsL, rrs, gidB and Rv1258c). This group included 4 strains that had a spoligotyping consistent with being of the Beijing family. Next, we analysed 220 DNA samples from M. tuberculosis complex clinical isolates collected from Hospitals in Huesca, Zaragoza, Madrid and Barcelona (Spain). These isolates included samples from a Spanish national survey on MDR M. tuberculosis done between 1998 and 2009. This set included 49 DNA samples having a spoligotyping consistent with those of the Beijing family, 158 were representative of other M. tuberculosis distinct lineages (LAM, T, X, S, Haarlem, CAS, EAI and others, including 5 isolates of the MTZ strain, a highly transmissible M. tuberculosis strain that has caused major outbreaks in Zaragoza (13) and 13 were M. africanum (Table 3). Overall, we got isolates representative of most of M. tuberculosis genetic lineages described (9). In these samples, we investigated the presence of the novel nucleotide insertion in Rv1258c gene described in this work. We selected 30 DNA samples (18 from Hospital Germans Trías i Pujol, Badalona and 12 from Hospital Gregorio Marañón, Madrid), those originated from STR resistant isolates (five of them belonged to the Beijing family), and the Rv1258c gene was completely sequenced in order to verify the presence of the nucleotide insertion in Rv1258c gene described in this work, and to identify other potential mutations. PCR amplification and sequencing 91 The primers used for amplifying and sequencing genes related with STR resistance, the annealing temperature used in the PCR reaction, and the size of the product are listed in Table 1. PCR reactions were performed in a final volume of 50 µl using 200 µM of each dNTP, 5 µl of Buffer (10x PCR Buffer, Applied Biosystems), 1.25 U of Taq Gold polymerase (Applied Biosystems), 0.25 µM of each primer, 5 µl of dimethyl sulphoxide and 2 µl of DNA (20-100 ng/µl). Amplifications consisted of an initial step at 94 ºC for 10 min, followed by 40 cycles of 1 minute at 94 ºC, annealing for 2 minutes (see Table 1) and 2 minutes at 72 ºC, with a final extension step of 10 min at 72 ºC. All genes were amplified in one single product, except Rv1258c gene that was amplified in two overlapping products, one containing the promoter and the first half of the coding sequence, and the second containing the rest of the gene. PCR products were purified using ExoSAP-IT (Affymetrix) and sequenced using the same primers used for the amplification. Sequences were then analysed by comparison with that of the reference H37Rv strain (Cole et al. (6); TubercuList, http://tuberculist.epfl.ch/). Screening of nucleotide insertion in Rv1258c gene Firstly, an internal fragment of Rv1258c gene containing the location of the cytosine nucleotide insertion between positions 580 and 581 of the coding sequence of the Rv1258c gene (denominated Tap580) was amplified using primers ctap9 and ctap10 (Table 1). DNA samples were processed 9 minutes at 94 ºC, followed by 35 cycles of 30 seconds at 94 ºC, annealing for 30 seconds at 65 ºC, extension at 72 ºC for 1.5 minutes, and final extension at 72 ºC for 10 minutes. We obtained a product of 1052 bp, which was digested for 1 hour at 37 ºC with XhoI restriction enzyme, followed by electrophoresis in 0.8% agarose gel in TBE buffer. As a control of endonuclease digestion, PCR products were digested for 1 hour at 37 ºC with PvuII restriction enzyme, which produces two fragments of 610 and 442 nucleotides for both Beijing and non-Beijing isolates. 92 Bioinformatic analysis Databases of bacterial genomes were analysed using the program Blast at NCBI (National Center for Biotechnology Information, http://blast.ncbi.nlm.nih.gov/) in search for Tap580 insertion in Rv1258c gene among sequenced genomes of the M. tuberculosis complex. Last access was on July 26th 2012. Screening of Tap580 insertion in Rv1258c gene directly in respiratory samples Seven respiratory samples from patients diagnosed with tuberculosis were obtained from Servicio de Microbiología (Hospital Universitario Lozano Blesa, Zaragoza, Spain). All samples were smear positive (their bacillary load ranged from 2 to >100 bacilli/field) and culture positive. Samples were decontaminated by N-acetyl-Lcysteine/NaOH, and a fraction was incubated 20 minutes at 80 ºC for killing the live bacilli and extracting DNA using the kit GenoLyse® (Hain Lifescience). 93 RESULTS & DISCUSSION Mutations in rpsL, rrs and gidB genes In order to find the mutations responsible for STR resistance in 18 M. tuberculosis clinical strains, we sequenced first the genes rpsL, rrs and gidB that are known to carry mutations related with resistance to STR and compared them with the sequence of STR-susceptible H37Rv laboratory strain available in the TubercuList database (http://tuberculist.epfl.ch/). All strains analysed in our study, including the reference H37Rv strain, had mutations A363G in rpsL and C299T in gidB, which have been reported as sequencing errors in the sequence of H37Rv included in both TubercuList database and GenBank entry AL123456.2 Ioerger, et al. (11), (31). Significant mutations found in the strains analysed in our study are summarised in Table 2. Eight of the strains tested (44.4%) carried mutations in rpsL gene, being the mutation A128G found in six of them. The four Beijing strains included in this group carried this mutation, which is the most frequent mutation found in STR resistant M. tuberculosis Beijing strains (17, 23). Two other strains (11.1%) had the mutation A263G. Four strains (22.2%) harboured mutations in the rrs gene. Three strains carried mutations C340T, A324G and A736G, respectively; to our knowledge this is the first report on mutations in this region. The latter strain also carried mutation C462T according to Tuberculist numbering, mutation that has been already documented as C461T (5). Finally, one strain carried mutation C492T close to the 530 loop of the secondary structure of M. tuberculosis 16S rRNA; this strain is further discussed below. The role of GidB protein in conferring high-level STR resistance in M. tuberculosis has been fully characterised (29), although the contribution of certain point mutations to 94 STR resistance is still controversial; it has been speculated that some mutations in gidB gene would promote the acquisitions of mutations in either rpsL or rrs (18). A large number of mutations (including many silent mutations) were found in the gidB gene, in fact, only four strains had a gidB gene identical to that of H37Rv. Many missense mutations have been described in STR susceptible strains, such as the mutation T47G (the most frequent mutation found in our study) that has been reported as specific of the Latin-American-Mediterranean (LAM) family strains (21)); in fact, the 6 strains carrying this mutation belonged to the LAM family of strains (data not shown). The four Beijing strains carried two mutations: A276C (E92D) that has been described as a SNP specific of this family (21), and A615G; both mutations can be found in STR susceptible strains (29). In the Beijing strains, these gidB mutations occur simultaneously to mutation A128G in rpsL gene as mentioned above. Among the non-Beijing strains, gidB C413T mutation has been found both in STR resistant and susceptible M. tuberculosis isolates (18, 26, 29). In one STR resistant isolate, we found mutation G248C, likely indicating that it could lead to resistance to this drug; however, other mutations in this position (G248T) have been found in STR susceptible strains (18). Finally, the only gidB mutation potentially related with resistance to STR could be the missense mutation G490C, since this one was detected in a strain lacking mutations in rpsL and rrs genes. We found mutations in all three genes in one strain; these were rpsL A128G, rrs C492T and gidB T47G. In this strain STR resistance will be due to the mutation rpsL A128G, since the two other mutations have been found in both STR resistant and susceptible isolates. Mutation rrs C492T, also reported elsewhere as C491T, has been associated to LAM3 genetic lineage of M. tuberculosis (25, 27). This very same genetic lineage of M. tuberculosis also carries mutation T47G as mentioned above (21). 95 Finally, one of the STR resistant strains lacked mutations in any of these three genes. In three others, only mutations in gidB were found, although these were either silent or have been described also in STR susceptible strains, hence making unlikely that they may have a major contribution to resistance to this drug. This confirms that other mechanisms must contribute to STR resistance in M. tuberculosis. Mutations in Rv1258c gene We hypothesize that since STR is a substrate of Rv1258c efflux pump (19), mutations affecting expression levels of Rv1258c gene or changing kinetic properties of the efflux pump could contribute to STR resistance. To further investigate this, we amplified and sequenced the Rv1258c gene in the 18 samples of M. tuberculosis STR resistant clinical strains in which we had sequenced rpsL, rrs and gidB genes. We found two different mutations in Rv1258c gene. One strain has a deletion of the adenine nucleotide in position 13 (Table 2) producing a frameshift; as a result, a TGA stop codon will end translation of a peptide of only 10 amino acids. Four strains have an insertion of a cytosine nucleotide between positions 580 and 581 (Table 2); this insertion, which in this work we will refer to as Tap580, causes a frame-shift mutation from codon 194 onwards, resulting in a shorter protein (231 amino acids). This protein probably would not constitute a functional membrane transporter, since it contains only 6 transmembrane segments (TMS) in comparison with the 12 TMS of the full-length protein (419 amino acids) (Figure 1). Bacterial drug efflux pumps of the Major Facilitator Superfamily have 12 or 14 TMS, which are required for transport activity. These five strains carrying mutations in Rv1258c gene also carried mutations A263G (K88R) or A128G (K43R) in rpsL gene, which probably will be responsible for the highlevel STR resistance making difficult to analyse the contribution of Rv1258c mutations in resistance to this drug. 96 Remarkably, we noticed that the four strains carrying Tap580 insertion had been typed as belonging to the Beijing lineage by either RFLP and/or spoligotyping (data not shown). We hypothesized that this could represent a novel polymorphism specific of the Beijing family. To test this, we inspected the presence of Tap580 insertion in thirteen genomes of M. tuberculosis available in public databases (NCBI, last access was on July 26th 2012), including clinical isolates, laboratory strains such as H37Rv and H37Ra, and two strains of the Beijing family. Interestingly, only CCDC5079 and CCDC5081 that belong to Beijing family (30) had the Tap580 insertion (Table 4), further supporting that Tap580 is a specific insertion of the Beijing family isolates. Other species of the M. tuberculosis complex, such as four substrains of M. bovis BCG and M. bovis AF2122/97 did not show Tap580 polymorphism and had complete identity with Rv1258c gene of H37Rv (Table 4). The Tap580 insertion is present in clinical strains of the Beijing family of isolates We further investigated the presence of Tap580 insertion in different subtypes of the Beijing family of isolates, and in isolates of other genetic families. For this, we first developed a quick and simple method for detecting Tap580 insertion. Between positions 577 and 582 of the Rv1258c gene, the sequence CTCGAG is the target for XhoI endonuclease; insertion of a cytosine nucleotide in Beijing strains results in CTCGCAG that is not recognized by this endonuclease (Figure 2). We designed two primers for amplifying a fragment of 1052 bp of the Rv1258c gene, from nucleotides 165 to 1216, which includes the position of the Tap580 insertion. Digestion of PCR products with XhoI endonuclease resulted in two DNA fragments of 413 and 639 bp in the case of non-Beijing strains, whereas PCR products from Beijing strains remained unaffected (Figure 2). We proceeded then to screen a collection of 220 clinical isolates of M. tuberculosis complex, which included 49 isolates having spoligotyping consistent with that of the 97 Beijing family. DNA samples were given random numbers and were blind tested using our PCR-RFLP method described above. We found that Tap580 insertion was present in all Beijing strains and absent in all strains belonging to other lineages of M. tuberculosis; Tap580 insertion was also absent from M. africanum isolates (Table 3). We included two controls in our assays. First, in each experiment we included samples of DNA from the laboratory strain M. tuberculosis H37Rv (which does not belong to the Beijing family of isolates), and from the M. tuberculosis GC1237 strain (a Beijing isolate recently characterised (3)). The PCR product from M. tuberculosis H37Rv was cut by XhoI, whereas that of M. tuberculosis GC1237 strain was not cut, confirming that all steps in the identification process were carried out satisfactorily. Second, all PCR products were digested with PvuII restriction enzyme, which cuts the amplification products of Rv1258c gene obtained from both Beijing and non-Beijing samples, demonstrating that the amplification step has been specific of Rv1258c gene and ruling out the possibility of unspecific amplifications. Finally, out of the 220 samples, we sequenced Rv1258c gene in the 30 M. tuberculosis STR resistant clinical isolates from Hospital Gregorio Marañón (Madrid, Spain) and Hospital Germans Trias i Pujol (Badalona, Spain). We found consistently that Tap580 insertion was present in the 5 Beijing and absent in all the non-Beijing strains, hence validating the method for screening Tap580 insertion developed in this work. In addition, we found a deletion of 4 nucleotides spanning positions 835 and 838 of the Rv1258c gene in one of the Beijing samples, which is located downstream of the in-frame stop codon in position 694-696 produced by Tap580 insertion. Detection of the Rv1258c nucleotide insertion in clinical samples In order to assess the usefulness of this technique for detecting Beijing strains directly in clinical samples, we analysed seven respiratory samples with diverse bacillary load and positive for culture of M. tuberculosis. After isolating the DNA 98 from sputum samples, we successfully amplified the 1052 bp PCR product from all samples, including those having a low bacillary load, and digested with XhoI endonuclease. All seven M. tuberculosis strains present in sputum samples were identified as non-Beijing, in agreement with spoligotyping. The precise effect of this nucleotide insertion in the physiology of M. tuberculosis Beijing isolates remains to be fully elucidated. Recently, the role of Rv1258c efflux pump in drug tolerance in M. tuberculosis has been reported (1). Since the identified single nucleotide insertion in Rv1258c gene in Beijing isolates results in a truncated, and most probably inactive protein, this would suggest that isolates carrying this nucleotide insertion could have a disadvantage in terms of drug resistance and drug tolerance in comparison with others carrying a fully functional Rv1258c transporter. However, since Beijing isolates are frequently associated with a higher propensity to acquire drug resistance, it is conceivable that other mutations are actually compensating the loss of Rv1258c in this family of M. tuberculosis isolates. Examples of compensatory mutations occurring following the acquisition of drug resistance associated mutations have been described for M. tuberculosis (7). In summary, we have found a new genetic polymorphism of M. tuberculosis Beijing strains, which has been used to develop a simple and reliable technique for identifying isolates of this family. Given the higher transmissibility rate of this family of strains, which in addition are more prone to develop drug resistance, methods for rapid identification constitute a very important tool for the control of outbreaks caused by isolates of the Beijing family of strains. This technique is fast since it can be performed directly on clinical specimens and there is no need for culturing strains, making it an ideal method for being implemented in those settings where routine culture of clinical samples cannot be done. In addition, this technique is easy to carry out and does not require sophisticated equipment since only a thermocycler and DNA electrophoresis system are needed. In addition, samples can be processed 105 . 106 TABLE 1. Primers used for amplification in this study. Target PCR product (bp) Tac (ºC) Primer Sequence 5’->3’ Reference For amplifying and sequencing rpsL 501 52 S13 GGCCGACAAACAGAACGT (15) S16 GTTCACCAACTGGGTGAC (15) rrs 1037 58 264 TGCACACAGGCCACAAGGGA (22) 285 GAGAGTTTGATCCTGGCTCAG (22) gidB 977 56 gidB3 GAACGGAAGATCGTCCAC This work gidB4 CGATAGTTGAAGCCTGGC This work Rv1258ca 830 58 ctap1 CAATGTGGATTACCGCGAC This work ctap2 GTCTTGCCGGTAGCCGTC This work Rv1258cb 902 58 ctap3 CGCAGGTTCCAGACGAAG This work ctap4 GATCAGCGCGTTGAGTTC This work For detection of nucleotide insertion Rv1258c 1052 65 ctap9 GGCCGACAAACAGAACGT This work ctap10 GTTCACCAACTGGGTGAC This work a 3’ region of Rv1258c gene. b Promoter and 5’ region of Rv1258c gene. c Ta= annealing temperature 107 TABLE 2. Mutations found in rpsL, rrs, gidB and Rv1258c genes in strains of the Universidad de Zaragoza culture collection. M. tuberculosis SM-resistant Mutation found in: Strain rpsL rrs gidB Rv1258c DNA Protein DNA DNA Protein DNA Protein Z-07044 C340T Z-07047a A128G K43R A276Cb E92D InsC 580-581 194 frameshift A615Gb silent HMS-1838 C413Tb A138V HCU-2879 A263G K88R HCU-2934 A128G K43R T47Gb L16R HCU-2830a A128G K43R A276Cb E92D InsC 580-581 194 frameshift A615Gb silent HMS-1695 A128G K43R C492T T47Gb L16R HMS-1691 A263G K88R A13del 5 frameshift HMS-1781 G490C G164R VEN-4145a A128G K43R A276Cb E92D InsC 580-581 194 frameshift A615Gb silent VEN-1714 T47Gb L16R C409Gb R137G 108 VEN-5292 A324G T47Gb L16R T149C L50P VEN-2457 T47Gb L16R VEN-1667 T47Gb L16R G248C R83P VEN-2543 VEN-314 C159T silent VEN-4237 C462T C159T silent A736G VEN-3748a A128G K43R A276Cb E92D InsC 580-581 194 frameshift A615Gb silent a Strains belonging to Beijing family. b Mutations found in susceptible strains (18, 26, 29) 109 TABLE 3. Number of strains belonging to different lineages used in Tap580 screening. Lineage / species No. of strains Beijing 49 T 27 LAMa 25 HAARLEM 18 U 16 CASb 12 EAIc 9 S 2 X 1 Not assigned 48 M. africanum 13 TOTAL 220 a LAM: Latin American and Mediterranean lineage b CAS: Central-Asian lineage c EAI: East African-Indian lineage 110 TABLE 4. Search for Tap580 insertion by bioinformatics analysis of M. tuberculosis complex sequenced genomes. Strains Beijing lineage Tap 580 Mycobacterium tuberculosis H37Ra No No H37Rv No No CCDC5079 Yes Yes CCDC5180 Yes Yes CDC1551 No No CTRI-2 No No F11 No No KZN 1435 No No KZN 4207 No No RGTB327 No No RGTB423 No No str. Erdman = ATCC 35801 DNA. No No UT205 No No Mycobacterium bovis BCG Pasteur 1173P2. No BCG Mexico. No BCG. Moreau RDJ No BCG. Tokyo 172 DNA. No AF2122/97 No 111 112 Comments The Beijing family The M. tuberculosis Beijing genotype family constitutes a homogeneous group of strains sharing a closely related IS6110 RFLP patterns containing a high number of bands, identical spoligotyping (deletion of spacers 1 to 34 in the Direct Repeat region) (106), an insertion of IS6110 between dnaA-dnaN genes (54) and one or two IS6110 copies in a DNA region called NTF locus (53, 54) Different studies have indicated that one-third of global TB cases is caused by Beijing family strains assigning this lineage to one of the most successful mycobacterial families in terms of morbidity and mortality (12). In some areas, such as Vietnam, Cuba, and Estonia, Beijing strains were found to be strongly associated with drug resistance (8, 14, 31, 52). M. tuberculosis GC1237, which belongs to the Beijing family, has been responsible for different epidemic outbreaks in the Gran Canary Island since 1991, representing the 25% of the cases of tuberculosis in the year 2007-2008 (24, 64). GC1237 is the strain used for Beijing control in the PCR-RFLP method. A number of selective advantages have been associated with its success including a lower efficacy of BCG for Beijing strains (60, 106) higher virulence (60, 62), ability to induce a differential immune response (33, 61), higher transmissibility (12) and enhanced capacity to grow in human macrophages and monocytes (57, 112) and an enhanced capacity to acquire drug resistance (2, 13, 14) The PCR-RFLP method described in the manuscript, constitutes a fast, easy and inexpensive method of detecting Beijing strains, even at early stages of infection. This tool can be helpful to detect this highly virulent and transmissible strains, allowing a better control of outbreaks. 113 References 1. Agerton, T. B., S. E. Valway, R. J. Blinkhorn, K. L. Shilkret, R. Reves, W. W. Schluter, B. Gore, C. J. Pozsik, B. B. Plikaytis, C. Woodley, and I. M. Onorato. 1999. Spread of strain W, a highly drug-resistant strain of Mycobacterium tuberculosis, across the United States. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 29:85-92; discussion 9385. 2. Anh, D. D., M. W. Borgdorff, L. N. Van, N. T. Lan, T. van Gorkom, K. Kremer, and D. van Soolingen. 2000. Mycobacterium tuberculosis Beijing genotype emerging in Vietnam. Emerging infectious diseases 6:302-305. 3. Bifani, P. J., B. Mathema, N. E. Kurepina, and B. N. Kreiswirth. 2002. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends in microbiology 10:45-52. 4. Bifani, P. J., B. Mathema, Z. Liu, S. L. Moghazeh, B. Shopsin, B. Tempalski, J. Driscol, R. Frothingham, J. M. Musser, P. Alcabes, and B. N. Kreiswirth. 1999. Identification of a W variant outbreak of Mycobacterium tuberculosis via population-based molecular epidemiology. JAMA : the journal of the American Medical Association 282:2321-2327. 5. Bifani, P. J., B. B. Plikaytis, V. Kapur, K. Stockbauer, X. Pan, M. L. Lutfey, S. L. Moghazeh, W. Eisner, T. M. Daniel, M. H. Kaplan, J. T. Crawford, J. M. Musser, and B. N. Kreiswirth. 1996. Origin and interstate spread of a New York City multidrug-resistant Mycobacterium tuberculosis clone family. JAMA : the journal of the American Medical Association 275:452-457. 6. Caminero, J. A., M. J. Pena, M. I. Campos-Herrero, J. C. Rodriguez, I. Garcia, P. Cabrera, C. Lafoz, S. Samper, H. Takiff, O. Afonso, J. M. Pavon, M. J. Torres, D. van Soolingen, D. A. Enarson, and C. Martin. 2001. Epidemiological evidence of the spread of a Mycobacterium tuberculosis strain of the Beijing genotype on Gran Canaria Island. American journal of respiratory and critical care medicine 164:1165-1170. 7. Diaz, R., K. Kremer, P. E. de Haas, R. I. Gomez, A. Marrero, J. A. Valdivia, J. D. van Embden, and D. van Soolingen. 1998. Molecular epidemiology of tuberculosis in Cuba outside of Havana, July 1994-June 1995: utility of spoligotyping versus IS6110 restriction fragment length polymorphism. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 2:743-750. 8. Dormans, J., M. Burger, D. Aguilar, R. Hernandez-Pando, K. Kremer, P. Roholl, S. M. Arend, and D. van Soolingen. 2004. Correlation of virulence, lung pathology, bacterial load and delayed type hypersensitivity responses after infection with different Mycobacterium tuberculosis genotypes in a BALB/c mouse model. Clinical and experimental immunology 137:460-468. 9. Kruuner, A., S. E. Hoffner, H. Sillastu, M. Danilovits, K. Levina, S. B. Svenson, S. Ghebremichael, T. Koivula, and G. Kallenius. 2001. Spread of drug-resistant pulmonary tuberculosis in Estonia. Journal of clinical microbiology 39:3339-3345. 10. Kurepina, N., E. Likhoshvay, E. Shashkina, B. Mathema, K. Kremer, D. van Soolingen, P. Bifani, and B. N. Kreiswirth. 2005. Targeted hybridization of IS6110 fingerprints identifies the W-Beijing Mycobacterium tuberculosis strains among clinical isolates. Journal of clinical microbiology 43:2148-2154. 114 11. Kurepina, N. E., S. Sreevatsan, B. B. Plikaytis, P. J. Bifani, N. D. Connell, R. J. Donnelly, D. van Sooligen, J. M. Musser, and B. N. Kreiswirth. 1998. Characterization of the phylogenetic distribution and chromosomal insertion sites of five IS6110 elements in Mycobacterium tuberculosis: non-random integration in the dnaA-dnaN region. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 79:31-42. 12. Li, Q., C. C. Whalen, J. M. Albert, R. Larkin, L. Zukowski, M. D. Cave, and R. F. Silver. 2002. Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infection and immunity 70:6489-6493. 13. Lopez, B., D. Aguilar, H. Orozco, M. Burger, C. Espitia, V. Ritacco, L. Barrera, K. Kremer, R. Hernandez-Pando, K. Huygen, and D. van Soolingen. 2003. A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clinical and experimental immunology 133:30-37. 14. Manca, C., M. B. Reed, S. Freeman, B. Mathema, B. Kreiswirth, C. E. Barry, 3rd, and G. Kaplan. 2004. Differential monocyte activation underlies strain-specific Mycobacterium tuberculosis pathogenesis. Infection and immunity 72:5511-5514. 15. Manca, C., L. Tsenova, A. Bergtold, S. Freeman, M. Tovey, J. M. Musser, C. E. Barry, 3rd, V. H. Freedman, and G. Kaplan. 2001. Virulence of a Mycobacterium tuberculosis clinical isolate in mice is determined by failure to induce Th1 type immunity and is associated with induction of IFN-alpha /beta. Proceedings of the National Academy of Sciences of the United States of America 98:5752-5757. 16. Millan-Lou, M. I., H. Alonso, P. Gavin, M. Hernandez-Febles, M. I. CamposHerrero, R. Copado, F. Canas, K. Kremer, J. A. Caminero, C. Martin, and S. Samper. 2012. Rapid test for identification of a highly transmissible Mycobacterium tuberculosis Beijing strain of sub-Saharan origin. Journal of clinical microbiology 50:516-518. 17. van Soolingen, D., L. Qian, P. E. de Haas, J. T. Douglas, H. Traore, F. Portaels, H. Z. Qing, D. Enkhsaikan, P. Nymadawa, and J. D. van Embden. 1995. Predominance of a single genotype of Mycobacterium tuberculosis in countries of east Asia. Journal of clinical microbiology 33:3234-3238. 18. Zhang, M., J. Gong, Z. Yang, B. Samten, M. D. Cave, and P. F. Barnes. 1999. Enhanced capacity of a widespread strain of Mycobacterium tuberculosis to grow in human macrophages. The Journal of infectious diseases 179:1213-1217. 121 General techniques of nucleic acids Oligonucleotides All the oligonucleotides are listed in Tables 17 and 18. Artificial endonuclease restriction sites were added when required and are shown underlined. Oligonucleotides with cloning purposes Oligonucleotide Sequence 5’->3’ Description pET30-ORF6-Fw GAAGGAGATATACATATGAAAATCGAAG Sequencing pET6Ap derivatives MmpL7-Rv CAGCGTCCAAGAAAATACCG Sequencing pCVF7 ctap3 CGCAGGTTCCAGACGAAG Sequencing pCVF1 pET30-ORF6-Rv GCTTCCTTTCGGGCTTTG Sequencing pET6Ap derivatives p55-Fw GCGTTCTTCGGTTGGGAAC Sequencing pCVF2 MmpL7-Fw1 GATCGTGCTGCTGACCGC Sequencing pCVF7 MmpL7-Fw2 ATCGACACAGACAATGAGCG Sequencing pCVF7 MmpL7-Rv2 CGTCCTGGATGGTTGTTTC Sequencing pCVF7 P55trans-in ACGCCCTGGCCGAACAGC Sequencing pCVF2 MmpL7-30aORF6-F ATGCCTAGTCCGGCTGGC To clone mmpL7 gene in pET6Ap. Tap-pT7-7-F TTTTCATATGCGCAACAGCAACCGCGGCCCGG CATTC To clone tap gene in pT7-7. NdeI site underlined. P55-pT7-7-F TTTTCATATGCGCGCGGGCCGCCGCGTGGCGA TTAGCGCGGGCAGCCTG To clone P55 gene in pT7-7. NdeI site underlined. Tap-pT7-7-R TTTTAAGCTTATTCACTGAGCCGATCCT To clone tap gene in pT7-7. EcoRI site underlined P55-pT7-7-R TTTTAAGCTTGGTGGCTCGTTAGAGCGGCTCC To clone P55 gene in pT7-7. EcoRI site underlined pT7-7-Fw CATGTTTGACAGCTTATCATCGATG Sequencing pT7-7 derivatives pT7-7-Rv GGGAGACCACAACGGTTTC Sequencing pT7-7 derivatives MmpL7-30aORF6-R GTCTCGAACAGGCGGTCAAC To clone mmpL7 gene in pET6Ap. Compound E. coli M. tuberculosis Kanamycin (Km) 20 µg/ml 20 µg/ml Ampicilin (Ap) 100 µg/ml - Tetracyclin (Tet) 3 µg/ml - Streptomycin (Sm) 50 µg/lm - IPTG 1mM - Table 16. Antibiotics and compounds used in this work. Table 17. Oligonucleotides used in construction and verification of plasmids. 122 Oligonucleotides used for allelic exchange purposes Oligonucleotide Sequence 5’->3’ Description uppOlmmpL7 TGCTCAGCCTGAACAGTCCAAGTCTTAACTT AAACAGGAGCCGTTAAGACatgcctagtccg gctggccgtcta To generate CVF13 strain. Used to amplify mmpL7 gene with homology arms (shown in capital letters), which are homologous to the 50 pb regions flanking acrB gene. lowOlmmpL7 GTTATGCATAAAAAAGGCCGCTTACGCGGCC TTAGTGATTACACGTTGTAtcaacgccgccc tggcgtggtcgg repOlacrB61528mmpl GAACAACGTTGAGTCGGTGTTCGCCGTTAAC GGCgccggggcaaggcaagcacagcaatacc tcgatcccatgcTCGTTTCCTTGAAGGACTG GGCCGATCGTCCGGGCG To generate CVF19 strain. Capital letters indicate the homology arms that hybridize within acrB gene. The region belonging to mmpL7 gene is shown underlined. acrB S 5-f CCTTCTTGCCAGATGAGGAC To confirm the replacement of the rpsLneo cassette by repOlacrB615-28mmpl oligonucleotide. Used to verify CVF19 strain by sequencing. acrB S 5-r GCAGTACCCAGTTCCACGAT Plasmid DNA extraction (minipreparation) Plasmid DNA extractions were done with QIAprep Spin Miniprep Kit (Qiagen), following manufacter’s instructions. E. coli strains were cultured overnight either in LB liquid medium on LB agar plates; for extraction 1.5 ml liquid culture or culture from plate were used. Plasmidic DNA was kept at -20ºC. Construction of plasmids We used two expression vectors for E. coli: pT7-7 (70) and pET30a-ORF6 (43). Construction of vectors for expressing Rv1258c and Rv1410c efflux pumps from M. tuberculosis. The PCR amplifications for cloning were performed with a high fidelity DNA Polymerase (TripleMaster® PCR System (Eppendorf)). The oligonucleotides used in this PCRs were designed with the proper restriction sites. Table 18. Oligonucleotides used in allelic exchange techniques. 123 Since the codon usage in E. coli is different from the one of M. tuberculosis (7), we changed the first codons of Rv1258c and Rv1410c genes in order to optimise the expression of these mycobacterial efflux pumps in E. coli. With that aim, we designed primers with nucleotide substitutions so that they were adapted to the E. coli codon usage, and led to no change in the codified aminoacid (Fig 26). A 1279 pb fragment containing Rv1258c (tap) gene of H37Rv was amplified from pCRS4 plasmid as a template (see Chapter 1), using oligonucleotides Tap-pT7-7-F and Tap-pT7-7R. PCR product was digested with enzymes NdeI and HindIII and ligated with the vector pT7-7 previously linearized with NdeI and HindIII, yielding the plasmid pCVF1. The plasmid was sequenced with the oligonucleotides pT7-7-Fw, pT7-7-Rv and ctap3 (Table 17) to confirm the insert. In order to generate pCVF2, a 1583 bp fragment containing Rv1410c (P55) gene from M. tuberculosis H37Rv was amplified by PCR from pCVZ1 (see chapter 1) with oligonucleotides P55-pT7-7-F and P55-pT7-7-R. This PCR fragment was digested with the restriction enzymes NdeI and HindIII and inserted into pT7-7 vector digested with NdeI and HindIII. The resulting plasmid was sequenced with oligonucleotides pT7-7-Fw, pT7-7-Rv, P55-Fw and P55-trans-in to verify the insert (Table 17). A. Rv1258c B. Rv1410c Fig. 26. Forward primers for amplification of Rv1258c and Rv1410c genes adapted to codon usage of E. coli. Nucleotide substitutions are highlighted in yellow. The recognition site for NdeI restriction enzyme is written in blue and underlined. 124 Construction of vectors for expressing MmpL7 efflux pump from M. tuberculosis We generated a bicistronic plasmid that didn’t carry a kmR gene, so it could be used for expression of mycobacterial genes in Km-resistant E. coli strains. First, the Ω-Ap cassette, was released from plasmid pKT254Ω-Ap (34) by digestion with SmaI restriction enzyme, and subsequently inserted in the SmaI site of the KmR gene in pET30a-ORF6 (43). The resulting plasmid, pET6Ap, was checked by restriction analysis with SmaI. The orientation of the Ω-Ap cassette was not investigated. In order to construct pCVF7, a 7841 bp fragment containing mmpL7 gene from H37Rv was amplified using oligonucleotides MmpL7-30aORF6-F and MmpL7-30aORF6-R, with Phusion High-Fidelity DNA Polymerase (New England Biolabs), which leaves the product with blunt ends. As a template, BAC-Rv30 (which contains from 3281413-3356541 nucleotides from H37Rv genome) was used. The plasmid pET6Ap was linearized with EcoRV, yielding a bluntended fragment, and subsequently ligated with the insert. To select the correct orientation of the insert in the resulting plasmid, two PCRs were performed: i) pET30Fig. 27. pT7-7 vector and derived plasmids pCVF1 and pCVF2 125 ORF6-Fw and MmpL7-Rv , ii) pET30-ORF6-Rv vs MmpL7-Fw2 (Table 17). The plasmid was then sequenced with pET30-ORF6-Fw, pET30-ORF6-Rv, MmpL7-Fw1, MmpL7-Fw2, MmpL7Rv and MmpL7-Rv2 (Table 17), to confirm the absence of mutations in the insert. Plasmids Plasmid Marker genes Description Ref. pT7-7 Ap Vector for expressing genes under control of T7promoter in E. coli. (70) pCVF1 Ap pT7-7 derived plasmid with Rv1258c (tap) gene, under control of T7 promoter. This work pCVF2 Ap pT7-7 derived plasmid with Rv1410c (P55) gene under control of T7 promoter. This work pET30aORF6 Km (Tn903derived) Vector for expressing genes under control of T7promoter in E. coli, upon induction with IPTG. (43) pET6Ap Ap Derived from pET30a-ORF6, with KmR inactivated by insertion of Ω-ApR cassette. This work pCVF7 Ap pET6Ap derived plasmid with mmpL7 gene under control of T7 promoter, upon induction with IPTG. This work Fig 28. A. pET6Ap, derived from pET30a-ORF6, the KmR gene is inactivated by the Ω-ApR cassette (orientation is not known). B. pCVF7 plasmid, for expression of mmpL7. Table 19. Plasmids used in this study 126 Generation of E. coli competent cells & electroporation To prepare electrocompetent cells, 150 ml of a bacterial culture were grown to an OD600nm of 0.4. Then the growth was stopped for 30 min on ice, and bacteria were washed twice in chilled-cold water, and once in chilled-cold 10% glycerol. Cells were finally resuspended in 1 ml chilled-cold 10% glycerol. Aliquots of 40 µl can be storaged at -80ºC for further use. Alternatively, if cells are to be electroporated inmediately, a simplified protocol can be used. Independent aliquots of 1.4 ml LB, pre-warmed at 37ºC, were inoculated with 30 µl fresh E. coli culture, and incubated at 37ºC 1000 rpm until they reached an OD~0.4. Growth was then stopped by placing the cells on ice for 2 minutes. Subsequently, bacteria were pelleted (11000 rpm, 30s, 2ºC) and two washes with 1ml chilled-cold water were performed. Finally, the pellet was resuspended in 30-40 µl chilled-cold water and immediately electroporated. Electroporation Aliquots of 40 µl were electroporated with 1 µl purified plasmid (~100 ng) DNA in 0.1 cm gap cuvettes (Bio-Rad) with a single pulse (1,8 kV) in a E. coli PulserTM (Bio-Rad). Cells were resuspended in LB to a final volume of 1 ml and incubated for 1h at 37ºC 1000 rpm before plating several dilutions on plates containing the needed antiobiotic. Colonies appeared after incubation overnight. Construction of mutants by Allelic Exchange in E. coli These method is based in the enhanced recombination frequency by external recombinase enzymes, belonging to λ-phage. We used the Counter Selection BAC Modification Kit (Gene Bridges). This kit contains the plasmid pRedET, which carries the λ-phage red γβα operon expressed under the control of the arabinose-inducible pBAD promoter, it has a thermosensitive origin of replication and confers tetracycline resistance. The homologous recombination event will take place between a targeted gene of the bacterial chromosome (acrB gene in this case) and a linear DNA fragment flanked by two homology arms. Each homology arm is 50 bp long, and they will determine the region where the homologous recombination will occur. In a first step of recombination, a rpsLneo cassette, conferring resistance to Km and susceptibility to Sm, flanked by these homology arms, is inserted. The final construction is obtained by recombination of a DNA linear fragment that replace the rpsL-neo cassette. 127 This fragment was obtained by PCR, using a high fidelity DNA Polymerase (TripleMaster® PCR System (Eppendorf)) and oligonucleotides designed with the correspondent homology arms (Table 18). Subsequently, this PCR product was precipitated with 3 volumes of EtOH and 0,1 volumes of NaAc 3M, incubated at -80ºC for 5 min and then pelleted and resuspended to a final concentration 0,5-1 µg/ml. The rpsL-neo cassette had been previously introduced into the acrB gene of strain 3AG100 (20). First, pRedET was transformed in the selected E. coli strain. All the incubations must be done at 30ºC in order to keep this themosensitive plasmid. The next step was the electroporation of the linear DNA fragment. For this, 30 µl of culture grown at 30ºC overnight were used to inoculate an aliquot of 1.4 ml LB/Tet broth. When this culture reached OD600nm=0.2-0.3, 50 µl Larabinose 10% were added, and further grown at 37ºC in order to induce the expression of recombinases, until OD600nm=0.4. Growth was then stopped by placing the cells on ice for 2 minutes. Subsequently, bacteria were pelleted (11000 rpm, 30s, 2ºC) and two washes with 1ml chilled-cold water were performed. Finally, the pellet was resuspended in 30-40 µl chilled-cold water and immediately electroporated with 1 µl purified plasmid (0,5-1 µg DNA) in 0.1 cm gap cuvettes (Bio-Rad) with a single pulse (1,8 kV) in a E. coli PulserTM (Bio-Rad). Cells were resuspended in LB to a final volume of 1 ml and incubated for 1h at 37ºC 1000 rpm. The strains resulting from the homologous recombination have lost the rpsL-neo cassette, thus they are Km susceptible and Sm resistant; because of this the transformation mix was plated on LB Sm and incubated at 37ºC overnight. The thermosensitive plasmid pRedET was eliminated by incubating at 37ºC. Several PCRs were performed in order to verify the generated strains. Reagents & solutions NaAc : NaAc 3M pH 5,3 Fig.29. Schematic representation of the allelic exchange replacement for generating mutants of E. coli. 128 Susceptibility assays E. coli Serial two-fold dilutions of antibiotics were performed in LB medium in 96-well microtiter plates, with a final volumen of 50µl per well. Cultures grown overnight on agar LB plates were used to prepare a cell suspension in NaCl 0,9%, and turbidity was adjusted to 0.5 McFarland standard. This suspension was diluted 1/50 and use to inoculate the antibiotic plate, with a volumen of 50 µl per well. Results were observed after 15-18h of incubation at 37ºC. Minimal Inhibitory Concentration (MIC) was the one of the first well with no visible bacterial growth. M. tuberculosis Serial two-fold dilutions of antibiotics were performed in 7H9/glycerol 0.5%/OADC medium, in 96-well microtiter plates, with a final volumen of 100µl per well. Liquid cultures in logarithmic phase were adjusted to OD600nm ~ 0.25 and diluted 1/100 in 7H9/glycerol 0.5%/OADC. 100µl of this suspension were added to each well and plates were incubated 6 days at 37ºC. 30 µl of a resazurin solution 0,1 mg/ml were added to each well, and results were observed after 48h of incubation at 37ºC. Resazurin (blue) is an indicator of bacterial growth, because metabolic activity of bacteria reduces it to resofurin (pink). Minimun Inhibitory Concentration (MIC) is the concentration of antibiotic of the first well that doesn’t change color from blue to pink. Solutions & Reagents Resazurin : 0,1 mg/ml resazurin in distilled water Accumulation assays We performed acummulation assays with ethidium bromide (EtBr) (18, 71), phenylarginine-ß-naphthylamide (PAßN) (19) and pyronin Y (Pyr) (89), in presence and absence of efflux inhibitors, such as carbonyl cyanide m-chlorophenylhydrazone (CCCP), PAßN and 1-(1-naphthylmethyl)-piperazine (NMP). The intracellular accumulation of these compounds was estimated by measuring fluorescence intensity. Each compound tested has different characteristics that make them suitable for this assay: EtBr increases its fluorescence when its intercalated in the DNA; PAßN is cleaved by intracellular esterases to yield the highly fluorescent metabolite ßnaphthylamine; and fluorescence of Pyr is quenched after binding to RNA. 129 An overnight culture on agar LB plate was used to make a suspension in buffer (PBS 1x + 0,4% glucose). O.D. 600nm was adjusted to 1 and 200 µl of this suspension transferred to each well of a opaque black 96-well plate. The substrate of accumulation was then added to the cell suspension to the corresponding final concentration (EtBr 25µM, PAßN 200µM, Pyr 2,5µM) and, if necessary, the efflux inhibitor to a final concentration of 200µM. Wild-type and ∆acrB strains were included as controls. Relative fluorescence intensity was measured over time in a Safire (Tecan, Crailsheim, Germany) fluorescence plate-reader. Selected wavelengths for measuring each compound are listed in Table 20. Real-time accumulation and efflux assays First, we prepared a bacterial suspension to perform these assays. For this, a 20 ml LB medium was inoculated directly from cryovials of from an overnight culture on agar LB plates. This culture was incubated overnight (18-20h) at 37ºC and shaking (200 rpm), thus it will reach stationary phase and starvation of nutrients. 10 ml of this stationary culture were transferred to a 50ml tube and washed with 20 ml PPB buffer (20mM K3PO4, 1 mM MgCl2, pH7). Then, it was centrifuged (5 min at 4000rpm), supernatant removed and pellet resuspended in 30ml of PPB buffer. With the same buffer it was adjusted to an OD600= 0.25. This cell suspension was used to perform two different experiments: a) Real time efflux assay b) Real time accumulation & efflux assay These assays must be performed with AcrAB-TolC substrates fulfilling a very important characteristic: they must be strongly fluorescent in a non-polar environment, and its fluorescence decreased drastically in a polar environment. Because of this, we are able to distinguish the compound inside the bacteria from the one outside. In our study, we used Compound λ. Excitation Max. (nm) λ Emission Max (nm) EtBr 518 605 PAßN 320 460 Pyr 545 570 Table 20. Wavelength settings for compounds used in accumulation assays. 130 1,2-Dinaphthylamine (1,2-DNA) (21) and BM-27; both are highly lipophilic and consequently they adhere to plastic, because of this all the tubes must be made of glass. Real time efflux assay 2 ml of bacterial suspension previously prepared were transferred to a glass tube, CCCP added to a final concentration of 5-20 µM (depending on the E. coli strain) and incubated for 15 minutes to de-energize the cells. 1,2’-DNA was added to a final concentration of 16 µM; it enters the cell by passive difussion, but the bacterium is not able to export it by active efflux, thus resulting in the accumulation inside the cell. The glass tube was sealed with film and incubated 2-3 h at room temperature. As a result, bacteria were loaded with 1,2’-DNA. When the incubation time was over, CCCP and 1,2’-DNA that didn’t enter into bacteria were removed by washing the pelleted bacteria with 2 ml of PPB. This suspension was transferred to a quarzt cuvette and placed into a spectrofluorometer (Perkin Elmer LS55). By measuring the fluorescence we were informed of the efflux of the substrate in real time. At second 100 of experiment, pre-loaded bacteria were stimulated with glucose at a final concentration of 50 mM. Glucose energizes the cells, which are now able to actively export the substrate through their transporters. This phenomenon was translated into a decrease of fluorescence. Real-time accumulation and efflux assay 2 ml of the cell suspension were transferred to a quartz cuvette and inmediately placed in the spectrofluorimeter to start measurement. After 50 s, CCCP was added to a final concentration of 10 µM; due to quenching effect, fluorescence signal was reduced. At 500 s from the start of the experiment, BM-27 was added to a final concentration of 10 µM and as a consequence of accumulation inside the bacteria, fluorescence started to raise. At second 1000, glucose was added to a final concentration of 50 mM in order to energize the cells; in response a fluorescence decrease was observed, as a consequence of the active efflux of BM-27. 137 Characterization of mutants MmpL7KO and MmpL10KO of M. tuberculosis MmpL7KO has less growth rate and forms less aggregates in liquid medium MmpL7KO mutant showed phenotypical differences when compared to wild-type strain CDC1551. Firstly, MmpL7KO has an increased rate of growth in liquid medium, regarding both to OD measurement and counts of viable bacteria. At day 8 of growth, OD of the cultures of wild-type and MmpL7KO started to diverge, and from day 15 differences became more obvious. On the other hand, MmpLKO grew at similar rate as the wild-type, but slightly faster. Differences between them are clearer in the count of viable bacteria (Fig 34) Fig. 32. Real time efflux of 1,2’-DNA of 3AG100 wild type and 3AG100 acrB::mmpL7 in the presence and absence of the inhibitor NMP. Fig. 33. Real time accumulation and efflux of 1,2’-DNA of 3AG100 wild type and 3AG100 acrB::mmpL7.. 138 In addition, liquid culture of MmpL7KO forms less aggregates than the one of the wild-type strain, like it is showed in Fig. 35. 0 0,5 1 1,5 2 2,5 3 0 10 20 30 40 O.D.600nm days CDC1551 MmpL10KO MmpL7KO 0 2 4 6 8 0 5 10 15 20 cfu/ml (x108) days CDC1551 MmpL10KO MmpL7KO Fig.34. Characterisation of growth rates in liquid medium of CDC1551, MmpL7KO and MmpL10KO, by OD measurements and cfu count. Fig 35. A. Liquid cultures of CDC1551, MmpL7KO and MmpL10KO. MmpL7KO forms less aggregates than the wild type strain. B. Sediment of liquid cultures of CDC1551 (n.1), MmpL7KO (n.3) and MmpL10KO (n.2). after resuspending and let them stand for about five minutes. A B 139 Zielh-Neelsen Staining Microscope visualization of stainings did not reveal significant differences in the morphology of wild-type and mutants bacilli (Fig. 36). Antibiotic susceptibility of MmpL7KO and MmpL10KO With the aim of studying the posible contribution of MmpL7 and MmpL10 efflux pumps to intrinsic resistance of M. tuberculosis, we determined the MIC of MmpL7KO, MmpL10KO and CDC1551 to several compounds, including first and second line antituberculosis antibiotics. Both mutants seemed to be more susceptible (two-fold) to tetracycline and spectinomycin, when compared to the wild-type strain. In addition, MmpL7KO showed more susceptibility to rifampicin and MmpL10KO could contribute to resistance to minoclycin. (Table 26) CDC1551 MmpL7KO MmpL10KO 140 Compound CDC1551 MmpL10KO MmpL7KO Isoniazid 0,05-0,1 0,05-0,1 0,05-0,1 Rifampicin 0,125-0,250 0,125-0,250 0,0625 Rifaximin <0,0625 <0,0625 <0,0625 Ethambutol 1 1 1-2 Streptomycin 0,125-0,25 0,25 0,125-0,25 Spectinomycin 64-128 32-64 32-64 Gentamicin 2 2 2 Tetracycline 8 4 4 Minocycline 2-4 1-2 2 Tigecycline 2-4 2-4 2-4 Levofloxacin 0,25 0,25 0,25 Moxifloxacin 0,125 0,125 0,0625-0,125 Ciprofloxacin 0,25-0,5 0,25 0,25-0,5 Clarithromycin 2 2 2 Erythromycin 256 256 256 Clindamycin 32-64 32-64 32-64 Chloramphenicol 2-4 4 2-4 Linezolid 0,25 0,25 0,25 Novobiocin 32 32 32 Acriflavine 2 2 2 141 CONCLUSIONS • Plasmids for expressing Rv1258c and Rv1410c (MFS) efflux pumps and MmpL7 (RND) from M. tuberculosis have been constructed. • E. coli strains containing either the whole mmpL7 gene from M. tuberculosis or a hybrid gene acrB:mmpL7 have been generated. • No clear evidence of expression of mycobacterial efflux pumps in E. coli was found. • MmpL7 knock-out mutant of M. tuberculosis efflux pump has an apparently increased growth rate in liquid medium, and displayed altered colony morphology. • Knock-out mutants of mmpL7 and mmpL10 seemed to be more susceptible to tetracycline and spectinomycin, when compared to the wild-type strain. MmpL7KO showed more susceptibility to rifampicin and MmpL10KO could contribute to resistance to minoclycin. 142 References 1. Adams, K. N., K. Takaki, L. E. Connolly, H. Wiedenhoft, K. Winglee, O. Humbert, P. H. Edelstein, C. L. Cosma, and L. Ramakrishnan. 2011. Drug tolerance in replicating mycobacteria mediated by a macrophage-induced efflux mechanism. Cell 145:39-53. 2. Agerton, T. B., S. E. Valway, R. J. Blinkhorn, K. L. Shilkret, R. Reves, W. W. Schluter, B. Gore, C. J. Pozsik, B. B. Plikaytis, C. Woodley, and I. M. Onorato. 1999. Spread of strain W, a highly drug-resistant strain of Mycobacterium tuberculosis, across the United States. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 29:85-92; discussion 9385. 3. Ainsa, J. A., M. C. Blokpoel, I. Otal, D. B. Young, K. A. De Smet, and C. Martin. 1998. Molecular cloning and characterization of Tap, a putative multidrug efflux pump present in Mycobacterium fortuitum and Mycobacterium tuberculosis. Journal of bacteriology 180:5836-5843. 4. Ainsa, J. A., C. Martin, M. Cabeza, F. De la Cruz, and M. V. Mendiola. 1996. Construction of a family of Mycobacterium/Escherichia coli shuttle vectors derived from pAL5000 and pACYC184: their use for cloning an antibiotic-resistance gene from Mycobacterium fortuitum. Gene 176:23-26. 5. Alexander, K. A., P. N. Laver, A. L. Michel, M. Williams, P. D. van Helden, R. M. Warren, and N. C. Gey van Pittius. 2010. Novel Mycobacterium tuberculosis complex pathogen, M. mungi. Emerging infectious diseases 16:1296-1299. 6. Allen, J. L. 1992. A modified Ziehl-Neelsen stain for mycobacteria. Medical laboratory sciences 49:99-102. 7. Andersson, G. E., and P. M. Sharp. 1996. Codon usage in the Mycobacterium tuberculosis complex. Microbiology 142 ( Pt 4):915-925. 8. Anh, D. D., M. W. Borgdorff, L. N. Van, N. T. Lan, T. van Gorkom, K. Kremer, and D. van Soolingen. 2000. Mycobacterium tuberculosis Beijing genotype emerging in Vietnam. Emerging infectious diseases 6:302-305. 9. Barrera, L. 2007. The basics of clinical bacteriology. In J. C. Palomino, S. CardosoLeao, and V. Ritacco (ed.), Tuberculosis. From basic science to patient care. 10. Bay, D. C., K. L. Rommens, and R. J. Turner. 2008. Small multidrug resistance proteins: a multidrug transporter family that continues to grow. Biochimica et biophysica acta 1778:1814-1838. 11. Bianco, M. V., F. C. Blanco, B. Imperiale, M. A. Forrellad, R. V. Rocha, L. I. Klepp, A. A. Cataldi, N. Morcillo, and F. Bigi. 2011. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds. BMC infectious diseases 11:195. 12. Bifani, P. J., B. Mathema, N. E. Kurepina, and B. N. Kreiswirth. 2002. Global dissemination of the Mycobacterium tuberculosis W-Beijing family strains. Trends in microbiology 10:45-52. 13. Bifani, P. J., B. Mathema, Z. Liu, S. L. Moghazeh, B. Shopsin, B. Tempalski, J. Driscol, R. Frothingham, J. M. Musser, P. Alcabes, and B. N. Kreiswirth. 1999. Identification of a W variant outbreak of Mycobacterium tuberculosis via population-based molecular epidemiology. JAMA : the journal of the American Medical Association 282:2321-2327. 14. Bifani, P. J., B. B. Plikaytis, V. Kapur, K. Stockbauer, X. Pan, M. L. Lutfey, S. L. Moghazeh, W. Eisner, T. M. Daniel, M. H. Kaplan, J. T. Crawford, J. M. Musser, and B. N. Kreiswirth. 1996. Origin and interstate spread of a New York City multidrug-resistant Mycobacterium tuberculosis clone family. JAMA : the journal of the American Medical Association 275:452-457. 143 15. Bigi, F., A. Alito, M. I. Romano, M. Zumarraga, K. Caimi, and A. Cataldi. 2000. The gene encoding P27 lipoprotein and a putative antibiotic-resistance gene form an operon in Mycobacterium tuberculosis and Mycobacterium bovis. Microbiology 146 ( Pt 4):1011-1018. 16. Bigi, F., C. Espitia, A. Alito, M. Zumarraga, M. I. Romano, S. Cravero, and A. Cataldi. 1997. A novel 27 kDa lipoprotein antigen from Mycobacterium bovis. Microbiology 143 ( Pt 11):3599-3605. 17. Bigi, F., A. Gioffre, L. Klepp, M. P. Santangelo, A. Alito, K. Caimi, V. Meikle, M. Zumarraga, O. Taboga, M. I. Romano, and A. Cataldi. 2004. The knockout of the lprG-Rv1410 operon produces strong attenuation of Mycobacterium tuberculosis. Microbes and infection / Institut Pasteur 6:182-187. 18. Bohnert, J. A., and W. V. Kern. 2005. Selected arylpiperazines are capable of reversing multidrug resistance in Escherichia coli overexpressing RND efflux pumps. Antimicrobial agents and chemotherapy 49:849-852. 19. Bohnert, J. A., S. Schuster, E. Fahnrich, R. Trittler, and W. V. Kern. 2007. Altered spectrum of multidrug resistance associated with a single point mutation in the Escherichia coli RND-type MDR efflux pump YhiV (MdtF). The Journal of antimicrobial chemotherapy 59:1216-1222. 20. Bohnert, J. A., S. Schuster, M. A. Seeger, E. Fahnrich, K. M. Pos, and W. V. Kern. 2008. Site-directed mutagenesis reveals putative substrate binding residues in the Escherichia coli RND efflux pump AcrB. Journal of bacteriology 190:82258229. 21. Bohnert, J. A., S. Schuster, M. Szymaniak-Vits, and W. V. Kern. 2011. Determination of real-time efflux phenotypes in Escherichia coli AcrB binding pocket phenylalanine mutants using a 1,2'-dinaphthylamine efflux assay. PloS one 6:e21196. 22. Buckley, A. M., M. A. Webber, S. Cooles, L. P. Randall, R. M. La Ragione, M. J. Woodward, and L. J. Piddock. 2006. The AcrAB-TolC efflux system of Salmonella enterica serovar Typhimurium plays a role in pathogenesis. Cellular microbiology 8:847-856. 23. Camacho, L. R., P. Constant, C. Raynaud, M. A. Laneelle, J. A. Triccas, B. Gicquel, M. Daffe, and C. Guilhot. 2001. Analysis of the phthiocerol dimycocerosate locus of Mycobacterium tuberculosis. Evidence that this lipid is involved in the cell wall permeability barrier. The Journal of biological chemistry 276:19845-19854. 24. Caminero, J. A., M. J. Pena, M. I. Campos-Herrero, J. C. Rodriguez, I. Garcia, P. Cabrera, C. Lafoz, S. Samper, H. Takiff, O. Afonso, J. M. Pavon, M. J. Torres, D. van Soolingen, D. A. Enarson, and C. Martin. 2001. Epidemiological evidence of the spread of a Mycobacterium tuberculosis strain of the Beijing genotype on Gran Canaria Island. American journal of respiratory and critical care medicine 164:1165-1170. 25. Cappelli, G., E. Volpe, M. Grassi, B. Liseo, V. Colizzi, and F. Mariani. 2006. Profiling of Mycobacterium tuberculosis gene expression during human macrophage infection: upregulation of the alternative sigma factor G, a group of transcriptional regulators, and proteins with unknown function. Research in microbiology 157:445455. 26. Cardona, P. J., C. Y. Soto, C. Martin, B. Giquel, G. Agusti, N. Andreu, E. Guirado, T. Sirakova, P. Kolattukudy, E. Julian, and M. Luquin. 2006. Neutral-red reaction is related to virulence and cell wall methyl-branched lipids in Mycobacterium tuberculosis. Microbes and infection / Institut Pasteur 8:183-190. 27. Cole, S. T., R. Brosch, J. Parkhill, T. Garnier, C. Churcher, D. Harris, S. V. Gordon, K. Eiglmeier, S. Gas, C. E. Barry, 3rd, F. Tekaia, K. Badcock, D. Basham, D. Brown, T. Chillingworth, R. Connor, R. Davies, K. Devlin, T. Feltwell, S. Gentles, N. Hamlin, S. Holroyd, T. Hornsby, K. Jagels, A. Krogh, J. McLean, S. 144 Moule, L. Murphy, K. Oliver, J. Osborne, M. A. Quail, M. A. Rajandream, J. Rogers, S. Rutter, K. Seeger, J. Skelton, R. Squares, S. Squares, J. E. Sulston, K. Taylor, S. Whitehead, and B. G. Barrell. 1998. Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature 393:537544. 28. Daffé, M. 2008. The global architecture of the mycobacterial cell envelope. In M. Daffé and J.M. Reyrat (ed.), The Mycobacterial Cell Envelope. 29. Danilchanka, O., M. Pavlenok, and M. Niederweis. 2008. Role of porins for uptake of antibiotics by Mycobacterium smegmatis. Antimicrobial agents and chemotherapy 52:3127-3134. 30. De Rossi, E., P. Arrigo, M. Bellinzoni, P. A. Silva, C. Martin, J. A. Ainsa, P. Guglierame, and G. Riccardi. 2002. The multidrug transporters belonging to major facilitator superfamily in Mycobacterium tuberculosis. Mol Med 8:714-724. 31. Diaz, R., K. Kremer, P. E. de Haas, R. I. Gomez, A. Marrero, J. A. Valdivia, J. D. van Embden, and D. van Soolingen. 1998. Molecular epidemiology of tuberculosis in Cuba outside of Havana, July 1994-June 1995: utility of spoligotyping versus IS6110 restriction fragment length polymorphism. The international journal of tuberculosis and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 2:743-750. 32. Domenech, P., M. B. Reed, and C. E. Barry, 3rd. 2005. Contribution of the Mycobacterium tuberculosis MmpL protein family to virulence and drug resistance. Infection and immunity 73:3492-3501. 33. Dormans, J., M. Burger, D. Aguilar, R. Hernandez-Pando, K. Kremer, P. Roholl, S. M. Arend, and D. van Soolingen. 2004. Correlation of virulence, lung pathology, bacterial load and delayed type hypersensitivity responses after infection with different Mycobacterium tuberculosis genotypes in a BALB/c mouse model. Clinical and experimental immunology 137:460-468. 34. Fellay, R., J. Frey, and H. Krisch. 1987. Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene 52:147-154. 35. Fernandez, L., and R. E. Hancock. 2012. Adaptive and mutational resistance: role of porins and efflux pumps in drug resistance. Clinical microbiology reviews 25:661681. 36. Filliol, I., A. S. Motiwala, M. Cavatore, W. Qi, M. H. Hazbon, M. Bobadilla del Valle, J. Fyfe, L. Garcia-Garcia, N. Rastogi, C. Sola, T. Zozio, M. I. Guerrero, C. I. Leon, J. Crabtree, S. Angiuoli, K. D. Eisenach, R. Durmaz, M. L. Joloba, A. Rendon, J. Sifuentes-Osornio, A. Ponce de Leon, M. D. Cave, R. Fleischmann, T. S. Whittam, and D. Alland. 2006. Global phylogeny of Mycobacterium tuberculosis based on single nucleotide polymorphism (SNP) analysis: insights into tuberculosis evolution, phylogenetic accuracy of other DNA fingerprinting systems, and recommendations for a minimal standard SNP set. Journal of bacteriology 188:759772. 37. Forrellad, M. A., L. I. Klepp, A. Gioffre, Y. G. J. Sabio, H. R. Morbidoni, M. D. Santangelo, A. A. Cataldi, and F. Bigi. 2012. Virulence factors of the Mycobacterium tuberculosis complex. Virulence 4. 38. Gey van Pittius, N. C., S. L. Sampson, H. Lee, Y. Kim, P. D. van Helden, and R. M. Warren. 2006. Evolution and expansion of the Mycobacterium tuberculosis PE and PPE multigene families and their association with the duplication of the ESAT-6 (esx) gene cluster regions. BMC evolutionary biology 6:95. 39. Ghosh, J., P. Larsson, B. Singh, B. M. Pettersson, N. M. Islam, S. N. Sarkar, S. Dasgupta, and L. A. Kirsebom. 2009. Sporulation in mycobacteria. Proceedings of the National Academy of Sciences of the United States of America 106:1078110786. 145 40. Gilleron, M. 2008. Structure, Biosynthesis, and activities of the phosphatidyl-myoinositol-based lipoglycans. In M. Daffé and J.M. Reyrat (ed.), The Mycobacterial Cell Envelope. 41. Glickman, M. 2008. Cording, Cord Factors, and Trehalose Dimycolate. In M. Daffé and J.M. Reyrat (ed.), The Mycobacterial Cell Envelope. 42. Groenen, P. M., A. E. Bunschoten, D. van Soolingen, and J. D. van Embden. 1993. Nature of DNA polymorphism in the direct repeat cluster of Mycobacterium tuberculosis; application for strain differentiation by a novel typing method. Molecular microbiology 10:1057-1065. 43. Guo, Y., S. S. Wallace, and V. Bandaru. 2009. A novel bicistronic vector for overexpressing Mycobacterium tuberculosis proteins in Escherichia coli. Protein expression and purification 65:230-237. 44. Gutacker, M. M., B. Mathema, H. Soini, E. Shashkina, B. N. Kreiswirth, E. A. Graviss, and J. M. Musser. 2006. Single-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites. The Journal of infectious diseases 193:121-128. 45. Hoffmann, C., A. Leis, M. Niederweis, J. M. Plitzko, and H. Engelhardt. 2008. Disclosure of the mycobacterial outer membrane: cryo-electron tomography and vitreous sections reveal the lipid bilayer structure. Proceedings of the National Academy of Sciences of the United States of America 105:3963-3967. 46. Jackson, M., G. Stadthagen, and B. Gicquel. 2007. Long-chain multiple methylbranched fatty acid-containing lipids of Mycobacterium tuberculosis: biosynthesis, transport, regulation and biological activities. Tuberculosis (Edinb) 87:78-86. 47. Jellen-Ritter, A. S., and W. V. Kern. 2001. Enhanced expression of the multidrug efflux pumps AcrAB and AcrEF associated with insertion element transposition in Escherichia coli mutants Selected with a fluoroquinolone. Antimicrobial agents and chemotherapy 45:1467-1472. 48. Kalpana, G. V., B. R. Bloom, and W. R. Jacobs, Jr. 1991. Insertional mutagenesis and illegitimate recombination in mycobacteria. Proceedings of the National Academy of Sciences of the United States of America 88:5433-5437. 49. Kamerbeek, J., L. Schouls, A. Kolk, M. van Agterveld, D. van Soolingen, S. Kuijper, A. Bunschoten, H. Molhuizen, R. Shaw, M. Goyal, and J. van Embden. 1997. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology. Journal of clinical microbiology 35:907-914. 50. Kaufmann, S. a. P. v. H. e. 2008. Handbook of tuberculosis. 51. Kaufmann, S. H. 2005. Robert Koch, the Nobel Prize, and the ongoing threat of tuberculosis. The New England journal of medicine 353:2423-2426. 52. Kruuner, A., S. E. Hoffner, H. Sillastu, M. Danilovits, K. Levina, S. B. Svenson, S. Ghebremichael, T. Koivula, and G. Kallenius. 2001. Spread of drug-resistant pulmonary tuberculosis in Estonia. Journal of clinical microbiology 39:3339-3345. 53. Kurepina, N., E. Likhoshvay, E. Shashkina, B. Mathema, K. Kremer, D. van Soolingen, P. Bifani, and B. N. Kreiswirth. 2005. Targeted hybridization of IS6110 fingerprints identifies the W-Beijing Mycobacterium tuberculosis strains among clinical isolates. Journal of clinical microbiology 43:2148-2154. 54. Kurepina, N. E., S. Sreevatsan, B. B. Plikaytis, P. J. Bifani, N. D. Connell, R. J. Donnelly, D. van Sooligen, J. M. Musser, and B. N. Kreiswirth. 1998. Characterization of the phylogenetic distribution and chromosomal insertion sites of five IS6110 elements in Mycobacterium tuberculosis: non-random integration in the dnaA-dnaN region. Tubercle and lung disease : the official journal of the International Union against Tuberculosis and Lung Disease 79:31-42. 55. Kuroda, T., and T. Tsuchiya. 2009. Multidrug efflux transporters in the MATE family. Biochimica et biophysica acta 1794:763-768. 146 56. Law, C. J., P. C. Maloney, and D. N. Wang. 2008. Ins and outs of major facilitator superfamily antiporters. Annual review of microbiology 62:289-305. 57. Li, Q., C. C. Whalen, J. M. Albert, R. Larkin, L. Zukowski, M. D. Cave, and R. F. Silver. 2002. Differences in rate and variability of intracellular growth of a panel of Mycobacterium tuberculosis clinical isolates within a human monocyte model. Infection and immunity 70:6489-6493. 58. Li, X. Z., and H. Nikaido. 2009. Efflux-mediated drug resistance in bacteria: an update. Drugs 69:1555-1623. 59. Liu, J., C. E. Barry, 3rd, G. S. Besra, and H. Nikaido. 1996. Mycolic acid structure determines the fluidity of the mycobacterial cell wall. The Journal of biological chemistry 271:29545-29551. 60. Lopez, B., D. Aguilar, H. Orozco, M. Burger, C. Espitia, V. Ritacco, L. Barrera, K. Kremer, R. Hernandez-Pando, K. Huygen, and D. van Soolingen. 2003. A marked difference in pathogenesis and immune response induced by different Mycobacterium tuberculosis genotypes. Clinical and experimental immunology 133:30-37. 61. Manca, C., M. B. Reed, S. Freeman, B. Mathema, B. Kreiswirth, C. E. Barry, 3rd, and G. Kaplan. 2004. Differential monocyte activation underlies strain-specific Mycobacterium tuberculosis pathogenesis. Infection and immunity 72:5511-5514. 62. Manca, C., L. Tsenova, A. Bergtold, S. Freeman, M. Tovey, J. M. Musser, C. E. Barry, 3rd, V. H. Freedman, and G. Kaplan. 2001. Virulence of a Mycobacterium tuberculosis clinical isolate in mice is determined by failure to induce Th1 type immunity and is associated with induction of IFN-alpha /beta. Proceedings of the National Academy of Sciences of the United States of America 98:5752-5757. 63. Migliori, G. B., G. De Iaco, G. Besozzi, R. Centis, and D. M. Cirillo. 2007. First tuberculosis cases in Italy resistant to all tested drugs. Euro surveillance : bulletin europeen sur les maladies transmissibles = European communicable disease bulletin 12:E070517 070511. 64. Millan-Lou, M. I., H. Alonso, P. Gavin, M. Hernandez-Febles, M. I. CamposHerrero, R. Copado, F. Canas, K. Kremer, J. A. Caminero, C. Martin, and S. Samper. 2012. Rapid test for identification of a highly transmissible Mycobacterium tuberculosis Beijing strain of sub-Saharan origin. Journal of clinical microbiology 50:516-518. 65. Morris, R. P., L. Nguyen, J. Gatfield, K. Visconti, K. Nguyen, D. Schnappinger, S. Ehrt, Y. Liu, L. Heifets, J. Pieters, G. Schoolnik, and C. J. Thompson. 2005. Ancestral antibiotic resistance in Mycobacterium tuberculosis. Proceedings of the National Academy of Sciences of the United States of America 102:12200-12205. 66. Mostowy, S., and M. A. Behr. 2002. Comparative genomics in the fight against tuberculosis: diagnostics, epidemiology, and BCG vaccination. American journal of pharmacogenomics : genomics-related research in drug development and clinical practice 2:189-196. 67. Moussatova, A., C. Kandt, M. L. O'Mara, and D. P. Tieleman. 2008. ATP-binding cassette transporters in Escherichia coli. Biochimica et biophysica acta 1778:17571771. 68. Niederweis, M. 2003. Mycobacterial porins--new channel proteins in unique outer membranes. Molecular microbiology 49:1167-1177. 69. Nikaido, H., and Y. Takatsuka. 2009. Mechanisms of RND multidrug efflux pumps. Biochimica et biophysica acta 1794:769-781. 70. Ninio, S., D. Rotem, and S. Schuldiner. 2001. Functional analysis of novel multidrug transporters from human pathogens. The Journal of biological chemistry 276:48250-48256. 71. Ocaktan, A., H. Yoneyama, and T. Nakae. 1997. Use of fluorescence probes to monitor function of the subunit proteins of the MexA-MexB-oprM drug extrusion