Exon-Intron Structure and Evolution of the Lipocalin Gene Family

Exon-In on S uc u e and E olu ion o he Lipocalin Gene Family Diego Sa´nchez,* 1 Ma ı´a D. Gan o nina,* 1 Gab iel Gu ie´ ez,and An onio Ma ı´n *Depa amen o de Bioquı´mica y Fisiologı´a y Gene´ ica Molecula -IBGM, Uni e sidad de Valladolid-CSIC, Valladolid, Spain; and Depa amen o de Gene´ ica, Uni e sidad de Se illa, Se illa, Spain The Lipocalins a e an ancien p o ein amily whose exp ession is cu en ly con i med in bac e ia, p o oc is s, plan s, a h opods, and cho da es. The e olu ion o his p o ein amily has been assessed p e iously using amino acid sequence phylogenies. In his epo we use an independen se o cha ac e s de i ed om he gene s uc u e (exon-in on a angemen ) o in e a new lipocalin phylogeny. We also p esen he no el gene s uc u e o h ee insec lipocalins. The posi ion and phase o in ons a e well p ese ed among lipocalin clades when mapped on o a p o ein sequence alignmen , sugges ing he homologous na u e o hese in ons. Because o his homology, we use he in on posi ion and phase o 23 lipocalin genes o econs uc a phylogeny by maximum pa simony and dis ance me hods. These phylogenies a e e y simila o he phylogenies de i ed om p o ein sequence. This esul is con i med by cong uence analysis, and a consensus ee shows he commonali ies be ween he wo sou ce ees. In e es ingly, he in on a angemen phylogeny shows ha me azoan lipocalins ha e mo e in ons han o he euka yo ic lipocalins, and ha in on gains ha e occu ed in he C- e mini o cho da e lipocalins. We also analyze he ela ionship o in on a angemen and p o ein e ia y s uc u e, as well as he ela ionship o lipocalins wi h membe s o he p oposed s uc u al supe amily o calycins. Ou cong uence analysis alida es he gene s uc u e da a as a sou ce o phylogene ic in o ma ion and helps o u he e ine ou hypo hesis on he e olu iona y his o y o lipocalins. In oduc ion E e since he ise o G am-nega i e bac e ia he lipocalins ha e been unc ioning and e ol ing in hese o ganisms and in hei euka yo ic symbion s, which possibly acqui ed he p imo dial lipocalin gene h ough a ho izon al ansmission e en (Bishop 2000). A p o ein amily de eloped h ough he s anda d e olu iona y mechanisms o gene duplica ion and di e gence (Ohno 1999), gi ing ise o a leas 10 di e en genes ha a e cu en ly ecognized in he mos ecen ly e ol ed o ganismal axa. P e ious s udies o h ee-dimensional and sequence simila i y g ouped lipocalins in ke nel o ou lie sub amilies based on he p esence o h ee s uc u ally conse ed p o ein egions (SCRs) (Flowe , No h, and A wood 1993) in he bba el-based s uc u al old o lipocalins ( ig. 1A). Se e al phylogene ic econs uc ions ha e been buil upon he alignmen o amino acid esidues o lipocalin sequences (e.g., Iga ashi e al. 1992; Toh e al. 1996). We ha e pe o med comp ehensi e phylogene ic analyses o he lipocalin amily using p o ein sequence alignmen s wi h guidance based on p o ein s uc u e da a, and ee-building me hods based on maximum likelihood (ML) (Gan o nina e al. 2000; Gu ie´ ez, Gan o nina, and Sa´nchez 2000). These s udies g oup lipocalins in well-suppo ed clades. When oo ed wi h he bac e ial lipocalins, he opology o he ee and he o ganismal dis ibu ion o lipocalins sugges ha hese p o eins end o inc ease he a e o sequence di e gence and o gene duplica ion du ing e o- lu ion. Also, hei in e nal pocke appea s o ha e e ol ed owa d binding smalle hyd ophobic ligands wi h mo e e iciency. An ex ensi e li e a u e suppo s he conse a ion o exon-in on s uc u e in clades o o hologous genes (COGs) (Rokas, Ka hi i hamby, and Holland 1999; Wada e al. 2002), as well as in amilies o pa alogous genes (K em and Di Ce a 2001) and p o ein supe amilies (Be s e al. 2001). These indings suppo he use o gene ea u es as sou ces o phylogene ic in e ence (Rokas and Holland 2000; K em and Di Ce a 2001). In a p e ious epo Salie (2000) p oposed a scena io o he e olu ion o he lipocalin gene amily by s udying he gene s uc u e and ch omosomal loca ion o 15 lipocalins. Howe e , his iew o lipocalin e olu ion is e y dependen on he con- cep s o ke nel e sus ou lie sub amilies, and i con lic s wi h ou p oposed e olu iona y his o y o lipocalins (Gu ie´ ez, Gan o nina, and Sa´nchez 2000). To eassess ou hypo hesis o lipocalin e olu ion, we ha e used gene s uc u e ea u es as cha ac e s o build phylogene ic ees h ough di e en ee- econs uc ion me hods. In his epo we p esen he gene s uc u e da a o h ee insec lipocalins ha we ha e been s udying o hei ole in ne ous sys em de elopmen (Gan o nina, Sa´nchez, and Bas iani 1995; Sa´nchez, Gan o nina, and Bas iani 1995; Sa´nchez e al. 2000b). The posi ion and phase o in ons in a numbe o lipocalins a e used o econs uc a phylogeny by maximum pa simony me hods and by a dis ance ma ix buil wi h a measu e o gene s uc u e simila i y (Be s e al. 2001). We also analyze he a iabili y in in ons p esen in he C- e mini o lipocalins belonging o di e en COGs, and compa e lipocalin in on a angemen wi h e ia y s uc- u e. We es he conse a ion o in on a angemen wi hin he calycins, a p oposed s uc u al supe amily ( e iewed by Flowe , No h, and Sansom 2000). Finally, we analyze he cong uence o phylogenies based on p o ein sequence and gene s uc u e, and build a consensus ee o e ine ou hypo hesis on lipocalin e olu ion. Ma e ials and Me hods Genomic PCR Ampli ica ion o he Laza illo Gene Genomic DNA was pu i ied om g asshoppe s (Schis oce ca ame icana). B ain issue was lysed in 25 mM EDTA, 0.5% SDS, and 0.1 mg/ml p o einase K. The 1 Con ibu ed equally o his wo k. Key wo ds: lipocalin, calycin, molecula e olu ion, gene phylo- geny, exon-in on, in on e olu ion. E-mail: [email p o ec ed]. Mol. Biol. E ol. 20(5):775–783. 2003 DOI: 10.1093/molbe /msg079 Ó2003 by he Socie y o Molecula Biology and E olu ion. ISSN: 0737-4038 775 DNA was ex ac ed wi h phenol and RNAse A– ea ed. We used he Expand Long Templa e PCR Sys em (Roche Biochemicals) ollowing manu ac u e ’s speci ica ions o pe o m polyme ase chain eac ion (PCR) ampli ica ions in a he mal cycle (GeneAmp 9700 Pe kin Elme ) using hin-walled plas ic ubes (PE Biosys ems). P ime s we e designed om he Laza illo cDNA sequence (GenBank Accession Numbe U15656) wi h he p ime 3 p og am (www-genome.wi.mi .edu/cgi-bin/p ime /p ime 3_ WWW.cgi), and syn hesized by Ame sham Pha macia Bio ech. P ime sequences we e: A59(GTGCTGC- TGTCTGTAAGCTG) and A39(TGGAGTTGACG- ACTGTGATG) o ampli ica ion o in on A; B59 (ACGGCAGAGTACTCCATGTCG) and B39 (AGCTCGCTCGCGAACTCTGC) o es ing he p es- ence o in on B; D59(CGACAACTACTCCATTGT- GTGG) and D39(GCTGCAGATTCTTCAGCTCATC) o ampli ica ion o in on D; and p ime s EF59(TCCTA- TTACGATCACGGAAC) and EF39(TCATGACTCGCT- GACCATAC) o es ing he p esence o in ons E/F. Polyme ase chain eac ion p oduc s we e sequenced wi h an ABI P ism 377 au oma ed DNA sequence using Taq FS DNA Polyme ase. Sequence Sea ches and Alignmen s We sea ched o lipocalin genes whose in on-exon s uc u e has been con i med by he knowledge o hei mRNA sequence. No deduced in on-exon a angemen was included in he analysis o a oid ‘‘noise’’ p oduced by poo ly p edic ed splice si es, and o disca d pseudogenes. Using he same seeding p ocess and selec ion c i e ia p e iously desc ibed (Gan o nina e al., 2000; Gu ie´ ez, Gan o nina, and Sa´nchez 2000), a sea ch o lipocalin cDNA and EST sequences was pe o med using he Blas p og am (Al schul e al. 1990) in he GenBank da abase a ailable Decembe 13, 2001. Thi y-se en o he se- quences e ie ed con ained he comple e CDS o he lipocalins and had he co esponding genomic sequence a ailable on he da abases. These genes a e shown in able 1. We e alua ed he p esence, loca ion, and phase o in ons o hese genes, and made a selec ion (as e isks in able 1) based on wo c i e ia: (1) being he ep esen a i e o a lipocalin COG ( o a oid sampling bias), and (2) showing an in on pa e n unique in he amily. Thus we a e accoun ing o he o e all gene s uc u e a ia ion p esen in he lipocalin amily. P o ein sequences we e aligned wi h Clus alX (1.8) (Thompson e al. 1997) using a Gonne se ies sco ing ma ix and a gap penal y mask based on he aligned se- conda y s uc u es o he lipocalins wi h known e ia y s uc u e. Based on ou knowledge o lipocalin s uc u e and unc ion, we made mino manual co ec ions o he alignmen . In on posi ions and phases we e hen mapped on o he p o ein sequence alignmen . In on phase was named 0 when he in on spli s wo consecu i e codons; I i an in on loca es be ween he i s and second codon nucleo ides; and II i an in on loca es be ween he second and hi d codon nucleo ides. We used only he in ons in e ening he ORF o lipocalin genes, as hose loca ed in he 59-and39-UTR can no be mapped on o he p o ein sequence alignmen . Phylogene ic Analyses Phylogene ic analyses based on p o ein sequences we e ca ied ou using he maximum likelihood me hod wi h he MOLPHY 2.3 so wa e ( Adachi and Hasegawa 1996) as p e iously epo ed (Gan o nina e al. 2000). Boo s ap suppo o ee b anches was es ima ed using he esampling log likelihood me hod (Hasegawa and Kishino 1994) o calcula e local boo s ap p opo ions (LBP). We ha e used in on posi ions o 23 ep esen a i e lipocalins as phylogene ic cha ac e s. We buil h ee inpu ma ices based on h ee in on cha ac e s a es: (1) he p esence/absence o a gi en in on, (2) he in on phase, and (3) he in on posi ion in he alignmen . Two p ocedu es we e ca ied ou : The i s was a maximum pa simony analysis using he in on p esence ma ix as inpu . Cha ac e s we e conside ed as uno de ed. We made heu is ic ee sea ches by he TBR me hod o PAUP* (Swo o d 1998). A majo i y ule consensus ee was cons uc ed om he mos pa simonious ees ound in he analysis. The second p ocedu e s a ed wi h he cons uc- ion o a dis ance ma ix based on a measu e o gene s uc u e simila i y (Be s e al. 2001) ha uses he p esence, loca ion, and phase o in on ma ices desc ibed abo e o es ima e he exon-in on simila i y be ween wo o he aligned p o eins. SGða;bÞ¼ 1 2Nmax X Nequi i¼1 1 1þecðdidÞþuðai;biÞ  FIG. 1.—A, Schema ic diag am o he opology o he lipocalin s uc u al old. bs ands a e ep esen ed by whi e a ows, le e ed A–H. a helices a e shown as ba eled cylinde s. The boxes ou line he h ee s uc u ally conse ed egions (SCRs). B, Schema ic ep esen a ion o he posi ion o in ons in ep esen a i es o lipocalin clades. Whi e boxes co espond o he gene CDS, and g ay boxes ep esen he un ansla ed egions. Size (in nucleo ides) is shown abo e each exon. Lines ep esen in on inse ions (no d awn o scale), and he phase o each in on is indica ed abo e he line. 776 Sa´nchez e al. S G is he simila i y measu e o he wo p o eins (aand b); N max is he la ges numbe o in ons ound in ei he p o ein; N equi is he numbe o equi alen (homologous) in ons; a i and b i a e he i h equi alen in on posi ions in he wo p o eins; d i is he di e ence in posi ion o he in ons wi hin he wo p o eins (in amino acids); u(a i ,b i )is 1 i he in on phases a e he same and 0 i hey a e di e en ; cand da e cons an s (0.2 and 30) op imized such ha he sigmoid unc ion is insensi i e o small changes in in on posi ions (610 esidues) (Be s e al. 2001). A ma ix o dis ances calcula ed by his me hod was used o econs uc a ee by he Neighbo -Joining me hod (Sai ou and Nei 1987) implemen ed in PHYLIP (Felsens ein 1993). The gene a ion o consensus ees and he analysis o cong uence we e pe o med wi h he RadCon p og am (Tho ley and Page 2000). The p o ein sequence alignmen s and gene s uc u e da a ma ices used o he phylogene ic s udies a e a ailable om he au ho s upon eques . Resul s and Discussion Gene S uc u e in he Lipocalin Family Lipocalin genes ha e been ound o con ain ou o eigh exons (Salie 2000). A schema ic ep esen a ion o he posi ion o in ons is shown in igu e 1B o ep esen a i e lipocalins. Mos in ons in e up he ORF, and only a ew appea o be loca ed in he 59- and 39-UTR o lipocalins. The posi ion and phase o in ons in e ening he lipocalins ORF appea ed o be ai ly conse ed. These simila i ies in exon-in on o ganiza ion p o ide s ong suppo o a common o igin o he lipocalin genes and he e o e make gene-s uc u e in o ma ion sui able o phylogene ic in e ence. Table 1 Lis o Expe imen ally De e mined Lipocalin Gene S uc u es P o ein Species Abb e ia ion Clade Taxon a Accession Numbe Lipocalin Dic yos elium discoideum Ddis.Lip* I P JC1b154 03 Lipocalin ly neu al-Laza illo A abidopsis aliana A ha.OML* I Pl NC_003076 D osophila melanogas e Dmel.Nlaz* II A L81559 Lipocalin ly glial-Laza illo D osophila melanogas e Dmel.Glaz* II A DS01087 Lipocalin Ka l D osophila melanogas e Dmel.Ka l* II A AE003487 Insec icyanin A Manduca sex a Msex.IcyA* II A X64714 Insec icyanin B ’’ Msex.IcyB II A X64715 Laza illo Schis oce ca ame icana Same.Laz* II A In p ocess Apolipop o ein D Homo sapiens Hsap.ApoD* II PM M16648–9 M16695–6 ’’ Mus musculus Mmus.ApoD II PM NW_000107 Re inol binding p o ein Homo sapiens Hsap.RBP III PM NT_030084 ’’ Ra us no egicus Rno .RBP* III PM M10610 K03045–6 Be a-lac oglobulin B Bos au us B au.BLB* IV PM Z48305 ’’ Cap a hi cus Chi .BLB IV PM Z33881 Be a-lac oglobulin Mac opus eugenii Meug.BL* IV MM L14954–60 Be a-lac oglobulin B O is a ies Oa i.BLB IV PM X12817 Be a-lac oglobulin A ’’ Oa i.BLA IV PM M32232–37 Glycodelin Homo sapiens Hsap.Glyc* IV PM M34046 P os aglandin D syn hase Homo sapiens Hsap.PGDS V PM M98537–39 ’’ Ra us no egicus Rno .PGDS* V PM M94134 ’’ Mus musculus Mmus.PGDS V PM Y10138 Neu ophil gela inase lipocalin Homo sapiens Hsap.NGAL* V PM X99133 ’’ Mus musculus Mmus.NGAL V PM X81627 Quiescence p o ein-21 ’’ Ggal.QS-21* V B AF121346 Alpha-1 mic oglobulin Homo sapiens Hsap.A1mg VI PM M88165 M88243–47 M88249 ’’ Mus musculus Mmus.A1mg* VI PM AF034692 Complemen C8csubuni Homo sapiens Hsap.C8GC* VII PM U08198 Majo u ina y p o ein 1 Mus musculus Mmus.MUP1* VIII PM X03208 Aph odisin Mus musculus Mmus.Aph X PM NW_042625 Aph odisin Mesoc ice us au a us Mau .Aph * X PM AJ225170 Alpha-1 acid glycop o ein 2 ’’ Hsap.a1G2* XII PM AH007409 on Ebne ’s gland p o ein Homo sapiens Hsap.VEG XIII PM L14927 ’’ Sus sc o a Ssc .VEG* XIII PM V96150 on Ebne ’s gland p o ein 1 Ra us no egicus Rno .VEG1 XIII PM X74805 on Ebne ’s gland p o ein 2 ’’ Rno .VEG2 XIII PM X74807 Epididymal RA-binding p o . Ra us no egicus Rno .ERBP* XIV PM X59831 Epididymal RA-binding p o . Mus musculus Mmus.ERBP XIV PM U68381 Odo an binding p o ein Mus musculus Mmus.OBP1 X PM NW_042625 Odo an binding p o ein IIa Homo sapiens Hsap.OBP2a* X PM AJ251029 Odo an binding p o ein IIb Homo sapiens Hsap.OBP2b X PM AJ251025 a Abb e ia ions: A, a h opod; Am, amphibian; Bi, bi d; F, ish; MM, ma supial mammal; PM, placen al mammal; P, p o oc is ; Pl. plan ; R, ep ile. * Lipocalins chosen o gene s uc u e phylogene ic analysis (see c i e ia in Ma e ials and Me hods). Lipocalin Gene S uc u e and E olu ion 777 Be o e he p esen analysis, sampling o me azoan lipocalin genes was s ongly biased owa d he cho da e phylum. Only one gene om a h opods was epo ed (Li and Riddi o d 1992). The e o e, we se ou o s udy he gene s uc u e o o he known a h opodan lipocalins. Exon-In on A angemen o he Laza illo Genes in Schis oce ca and D osophila The gene s uc u e o Laza illo, a lipocalin ound in he g asshoppe Schis oce ca ame icana ( e iewed by Sa´nchez, Gan o nina, and Bas iani 2000a), would be o g ea alue in p o iding insigh in o lipocalin e olu ion because o he ances al posi ion o o hop e oids wi hin he a h opod lineage (Ca e ino, Cho, and Spe ling 2000). The ORF o lipocalin genes is in e up ed by 6 in ons a he mos . These in ons (named A–F) a e ep esen ed in a model lipocalin depic ed in igu e 2A. The p edic ed loca ion o he six in ons in he g asshoppe Laza illo gene was deduced by loca ing in on posi ions in a mul iple p o ein sequence alignmen o Laza illo wi h o he lip- ocalins o known gene s uc u e. We hen designed Laza illo p ime s ha would PCR ampli y speci ic in ons om genomic DNA. The p ime se s a e shown numbe ed unde he lipocalin model in igu e 2A.ThePCR ampli ica ions using g asshoppe DNA appea in he e hidium b omide gel shown in igu e 2B. Each numbe ed lane e e s o he se o p ime s used. These ampli ica ions e ealed he p esence o h ee in ons in he CDS o he Laza illo gene ( ig. 2C) ha co esponded o in ons A, C, and D o he model lipocalin gene. In on size was es ima ed by band size o in ons A and C, and by comple e sequencing o he sho in on D. Sequencing he PCR p oduc s de ined he exac loca ion and phase o he Laza illo in ons (see able 2). These in onic sequences a e deposi ed in GenBank (Accession Numbe s: AY197702, AY197703, AY197704, and AY197705). The a ailabili y o he D osophila genome sequence has made possible o loca e he in ons p esen in NLaz and GLaz, he wo ui ly lipocalins homologous o Laza illo (Sa´nchez e al. 2000b). The in on loca ion and size a e ep esen ed schema ically in igu e 2D–E, and hei se- quence bounda ies a e shown in able 2. Th ee and ou in ons a e p esen espec i ely in he GLaz and NLaz genes ha a e common o o he lipocalins (see below). A unique in on loca ed in he signal pep ide (poin ed wi h an as e isk in ig. 2E) is p esen in he N- e minal egion o NLaz. Phylogene ic Analysis o Lipocalins Based on Gene S uc u e In addi ion o he al eady cha ac e ized lipocalin genes (Salie 2000) and he a h opodan Laza illo genes epo ed abo e, we sea ched o o he lipocalin genes whose in on-exon s uc u e was con i med by he knowledge o hei mRNA sequence. All he lipocalin genes ound a e lis ed in able 1, wi h genes selec ed o he analysis ma ked wi h as e isks (23 ep esen a i es; see Ma e ials and Me hods). We ound a p o oc is gene ( om Dic yos elium discoideum, EST #C24642), a plan gene ( om A abi- dopsis haliana, mRNA Acc. Numbe AY062789), and ano he D osophila gene (Ka l, EST # NM_132520). The Dic yos elium and A abidopsis genes a e o singula alue o ou e olu iona y analysis because hey a e he only ep esen a i es o lipocalins om unicellula euka yo es and plan s. Alignmen o Lipocalin Gene S uc u es The in onic a chi ec u e o he selec ed lipocalin genes was mapped on o a mul iple p o ein sequence alignmen in he con ex o he o e all seconda y s uc u e o an a che ypal lipocalin ( ig. 3). No ewo hy, he e is a s ong conse a ion o he loca ion and phase o in ons, a inding also epo ed in o he gene s uc u e analyses (Iga ashi e al. 1992; Holz eind and Redl 1994; Toh e al. 1996; Lindq is e al. 1999; Salie 2000). This conse a- ion is e iden among COG membe s, bu also among pa alogous lipocalins. Some in on posi ions and phases a e e y well conse ed (e.g., in on A), while o he s show sligh a ia ions (e.g., B and C). Some in ons a e p esen in mos lipocalins (e.g., in ons A and C) while o he s a e p esen only in a subse o hem (e.g., in ons D, E, and F). An impo an assump ion o ou analysis is he homology o each in on (A–F) ound in he ORF o lipocalins. We accep ha some a ia ion in in on posi ion could be due o ambigui ies in he alignmen o pa alogous genes, whe e nea by inse ion/dele ions can cause appa en displacemen o in on posi ions (S ol z us e al. 1997). A sys ema ic examina ion o o hologous sequences would be needed o e alua e he p esence and ele ance o FIG. 2.—Exon-in on a angemen o he insec Laza illo genes. A, Diag am o he gene s uc u e o a model lipocalin. In ons in he ORF egion a e named A–F. A ows and numbe s below hem show he p ime se s designed o ampli y speci ic in ons om he genomic DNA. B, Pho og aph o an e hidium b omide gel showing he esul s o PCR ampli ica ions om g asshoppe genomic DNA wi h he p ime se s shown in A. C–E, Diag am o he Laza illo genes in g asshoppe and D osophila. In ons size a e shown by numbe s in C, and scaled in Dand Eas ep esen ed by he scale ba s. The as e isk in Eshows a unique in on in he 59 egion o he DNLaz ORF. 778 Sa´nchez e al. in on-sliding as an addi ional sou ce o a ia ion. Ou selec ion o genes, mos o hem pa alogous o each o he , p ecludes us om answe ing his ques ion. Ne e heless, independen ly o i s sou ce, he in on posi ion a ia ion is inco po a ed in ou dis ance measu e (see Ma e ials and Me hods) and is used o assess he e olu iona y his o y o lipocalins. Taking in o accoun he p esence, posi ion and phase o in ons, we pe o med bo h maximum pa simony and dis ance-based phylogene ic econs uc ions. The esul ing ees ( ig. 4) a e oo ed wi h he Dic yos elium lipocalin o i s p esence in an ancien o ganismal lineage (whose o igin p eda es he a i al o me azoans), and because o he ances al cha ac e o his p o ein sequence as judged by i s simila i y o bac e ial lipocalins. Maximum Pa simony Analysis This analysis eco e ed six equally pa simonious ees (minimum s ep numbe 8). The majo i y ule consensus ee is shown in igu e 4A. This ee ( ha compu es he p esence o absence o in ons A–F as disc e e cha ac e s a es) esol es i e gene s uc u e- ela ed g oups: (1) he Dic yos elium and plan lipocalins, (2) wo a h opodan lipocalins (Laz and IcyA), (3) wo D osophila lipocalins plus ApoD and RBP, (4) a nume ous g oup o lipocalins ha belong o he clades IV-XIII (de ined in ou p o ein phylogeny, Gu ie´ ez, Gan o nina, and Sa´nchez, 2000; see able 1 o de ails), and (5) he h ee lipocalins bea ing six in ons (C8GC, a1mg and ERBP). The ui ly Nlaz gene se s apa , al hough g ouped wi h he emainde a h opodan lipocalins, due o i s unusual se o in ons. Dis ances Phylogeny A dis ance-based phylogene ic econs uc ion was ca ied ou by compu ing a dis ance ma ix wi h gene s uc u e da a (in on p esence, loca ion, and phase). These da a we e combined o p oduce a quan i a i e measu e o gene s uc u e simila i y (Be s e al., 2001; see Ma e ials and Me hods). The Neighbo -Joining (NJ) ee (Sai ou and Nei 1987) oo ed wi h he Dic yos elium lipocalin is shown in igu e 4B. Simila o he pa simony ee, he NJ ee ela es monophyle ically mos a h opodan lipocalins wi h ApoD, and seg ega es he D osophila NLaz and RBP as genes wi h unique exon-in on s uc u es. The A abi- dopsis and Dic yos elium lipocalins emain a he base o he ee, and he se o lipocalins belonging o clades IV- XIII a e o ming a monophyle ic g oup, also ela ed o he 6-in on C8GC, a1mg and ERBP. Despi e displaying sho b anch leng hs, his ee also es ablishes ela ionships among di e en lipocalin COGs, as can be seen in he cladog am shown in igu e 4B. Gene S uc u e e sus P o ein Sequence Phylogenies The gene s uc u e-in e ed iew o lipocalin e olu- ion sha es basic opological ea u es wi h he p o ein sequence-based phylogeny (see Gu ie´ ez, Gan o nina, and Sa´nchez 2000). Al hough in p inciple he e a e no easons o expec cong uence be ween hese wo ees, i is clea ha in bo h phylogene ic econs uc ions he a h opodan lipocalins a e ela ed o ApoDs, and hey appea ela ed o p o oc is and plan lipocalins; RBPs o m a sepa a e g oup, ela ed o some insec lipocalins; and he es o lipocalins o m a well suppo ed monophyle ic g oup. To u he es his, we buil a ML ee using he p o ein sequence alignmen om which he gene s uc u e ma ices we e de i ed, and oo ed his ee wi h he Dic yos elium lipocalin ( ig. 5A). We used he p og am RadCon (Tho ley and Page 2000) o e alua e he cong uence o he p o ein sequence ML and he gene s uc u e NJ ees. Bo h sou ce ees a e well esol ed: Table 2 Exon-In on Bounda ies P esen in he CDS o D osophila and Schis oce ca Lipocalin Genes Lipocalin Gene In on Splice Dono Splice Accep o Codon Phase Dmel.DNLaz aCAC TCG AG g aagcgcca a ccccacag T TCG CAC 2 His Se Se Se His A GCG GAA GCG g gag c g aa ac cag TAT ATG GGC 0 Ala Glu Ala Ty Me Gly B AAT CGA TT g gag a ca ga gaaaaag C ACC GGA 2 Asn A g Le u Th Gln C CCG ACG C g gag aa g aca ag AG CCA TTG 1 P o Th G ln P o Leu D AAT TTC A g gag aa aa gcag AA ATT GTT 1 Asn Phe L ys Ile Val Dmel.DGLaz A ATG AGT CGG g aag ag a c g ag GTC CTT GGA 0 Me Se A g Val Leu Gly B AAT CGC AT g a ga aa cc ag A ACT GGT 2 Asn A g Il e Th Gly C GAT TTT AAG g a c acaa cc ag TTT ACC ACC 0 Asp Phe Lys Phe Th Th Same.Laz A GCC ACG CTG Unsequenced ga cg ag TAC ATG GGG 0 Ala Th Leu Ty Me Gly C AGT GTT G g gag ac aa g gcag GT AAC TAC 1 Se Val G Ly Asn Ty D TCT ACA G g cag cag c c g gcag AA ATC TCA 1 Se Th G lu Ile Se Lipocalin Gene S uc u e and E olu ion 779 hei cladis ic in o ma ion con en , a no malized measu e o how much a ee educes unce ain y ega ding phylogene ic ela ionships (Tho ley, Wilkinson, and Cha les on 1998), is 0.98 o he gene s uc u e NJ ee, and 1.00 o he p o ein sequence ML ee. We also analyzed he posi ional cong uence o each lipocalin COG in he wo sou ce ees. The no malized cong uence measu e, called ‘‘explici ly ag ee’’ (EA) simila i y (Es ab ook 1992), is shown in igu e 5A o each lipocalin, and he a e age EA simila i y ( he EA simila i y o he ees) is 0.789. This measu e e lec s he high cong uence o he opology o bo h ees, and sugges s ha bo h phylogene ic econs uc ions a e good es ima es o he e olu iona y his o y expe ienced by lipocalins. Following he s ic nes ing me hod (Adams 1972), we buil a consensus ee ( ig. 5B) ha shows he commonali ies be ween he wo sou ce ees. The consensus ee u he co obo a es he o hology o ApoDs o he a h opodan lipocalins, and he mono- phyle ic ela ionship o o he cho da e lipocalins. Thus, wo se s o independen cha ac e s ha e p oduced he same phylogene ic ela ionships be ween ex an lipocalins. Phylogene ic Dis ibu ion o In on Numbe s Wi hin he Lipocalin Family Ano he inding e ealed by he in on a angemen phylogeny is ha lipocalins ha ha e o igina ed mo e ecen ly con ain mo e in ons in hei CDS. In igu e 5C we mapped he numbe o exons on o an upda ed e sion o he ML-based lipocalin p o ein phylogeny (see Gu ie´ ez, Gan o nina, and Sa´nchez [2000] o clade asc ip ion). The ancien unicellula euka yo ic and plan lipocalins a e encoded by 2 exons; he a h opodan lipocalins by 4–5 exons; and he cho da e lipocalins by 4–7 exons. In ons E and F a e absen in noncho da e lipocalins, whe eas in ons A–D show much wide phylogene ic dis ibu ions. FIG. 3.—Alignmen o he ma u e p o eins o lipocalin ep esen a i es wi h known gene s uc u e. The posi ion and phase o he in ons a e mapped on o he alignmen in he con ex o he o e all seconda y s uc u e o an a che ypal lipocalin (bs ands a e ep esen ed by whi e a ows, and a helices by cylinde s). In on phase 0 is shown as a line be ween he spli codons; phase 1 o 2 in ons as open o shaded boxes a ound he amino acids p esen ing he spli codon. 780 Sa´nchez e al. A i s look a hese da a migh sugges an e olu iona y end o gain in ons. In his hypo hesis, he o igin o in ons A and D could be placed ea ly in euka yo ic e olu ion, in ons B and C o igina ed a he base o he me azoan lineage, and in ons E and F ap- pea ed la e du ing ea ly cho da e adia ion. The acqui- si ion o in ons was accompanied by di e se in on losses in di e en b anches, gi ing ise o he pa e n obse ed oday. Howe e , we ha e o be c i ical when in e p e ing hese obse a ions in he con ex o lipocalin in ons o igin and e olu ion. Fi s , he cu en insu icien sampling o lipocalins ou side he me azoan kingdom gene a es un- ce ain y abou he e y assump ion o homology o in ons A and D in Dic yos elium and A abidopsis, espec i ely. Second, he se o me azoan lipocalins a ail- able encompasses only wo phyla wi hin he kingdom; any p oposal abou which se o in ons was p esen in he common ances o o all me azoans awai s con i ma- ion coming om o he phyla. A scena io wi h a se o ou ancien in ons and subsequen losses in di e en lineages (Fedo o e al. 2001; Roy e al. 2002) would be as p obable as a scena io wi h ewe o no ancien in ons and a p e alence o in on gain a p e e ed ‘‘ho spo s’’ (o p o o-splice si es; Dibb and Newman 1989; Logsdon 1998). Ne e heless, he ex ensi e sampling o lipocalins in he cho da e phylum allows us o make a s onge case o he acquisi ion o in ons E and F du ing ea ly cho da e adia ion. Bo h in ons a e absen in all a h opod lipocalins and in ApoD, he lipocalin COG ha b anches o a he base o he cho da e lipocalin sub ee in ou wo independen phylogene ic econs uc ions ( igs. 4Band 5C). The e o e, in on gain wi hin he cho da e lineage is he mos pa simonious explana ion o he cu en dis ibu ion o in ons E and F. In summa y, al hough many ques ions abou he o igin o lipocalin in ons and hei subsequen e olu ion emain unanswe ed, a combina ion o ancien and ecen in ons is he mos plausible scena io. Ou esul s show ha , independen o hei o igin, he a ia ions in gene s uc u e can be used o econs uc he his o y o descen o lipocalin genes. N- e mini Conse a ion e sus C-Te mini Va iabili y? I is ema kable ha he in ons speci ic o cho da e lipocalins a e loca ed in he C- e mini o he p o eins, whe eas in ons in hei N- e minal egion a e he mos conse ed in he amily (see ig. 3). This pola i y, also no- iced by o he esea che s (Salie 2000), is ela ed nei he o a pa icula dis ibu ion o lipocalins leng h no o a C- e minal–speci ic p o ein sequence a iabili y. Ra he , we p opose i migh be ela ed o a p opensi y o in on gain/loss in his gene egion. The analysis o he 39 egion FIG.5.—A–B, Compa isons o gene s uc u e e sus p o ein sequence phylogenies. A, Phylogene ic ML ee buil upon he p o ein sequence alignmen used o de i e he gene s uc u e ma ices (see ig. 3), and oo ed wi h he dic yos elid lipocalin. Explici ly ag eed simila i y alues a e shown o each lipocalin, acco ding o he RadCon p og am (see Ma e ials and Me hods). B, Consensus ee ob ained by a s ic nes ing me hod (Adams 1972), ep esen ing he commonali y be ween he gene s uc u e and he p o ein sequence ees. C, Upda ed (Ma ch 2002) maximum-likelihood ee based on he p o ein sequence o 148 lipocalins (see Gan o nina e al. [2000] o de ails on ee building) showing he numbe o in ons p esen in he ORF o each lipocalin clade. LBP alues a e indica ed in each node (see Ma e ials and Me hods). The ee was oo ed wi h bac e ial lipocalins. The scale ba s ep esen b anch leng h (numbe o amino acid subs i u ions/100 esidues). FIG. 4.—Phylogene ic ees de i ed om lipocalin gene s uc u e in o ma ion. A, Maximum pa simony analysis based on he p esence- absenceo in onsin hegeneORF.B, Neighbo -Joining (NJ) phylogene ic econs uc ion based on a dis ance ma ix wi h gene s uc u e da a (in on p esence, loca ion, and phase) combined in a measu e o gene s uc u e simila i y (see Ma e ials and Me hods). The NJ ee is shown bo h as a phylog am (le ) and as a cladog am ( igh ). All ees a e oo ed wi h he Dic yos elium lipocalin. The scale ba in he phylog am ep esen s b anch leng h (numbe o amino acid subs i u ions/si e). Lipocalin Gene S uc u e and E olu ion 781 o lipocalins bea ing 5–6 in ons e eals ha se e al lipocalins o pa icula cho da e lineages (e.g., PGDS, VEG, NGAL; da a no shown) show in ons in he 39-UTR ha a e loca ed 0–7 nucleo ides away om he s op codon. These in ons would be equi alen o in on F i hey happened o be in he CDS. Any o m o in on sliding (S ol z us e al. 1997), o any ameshi ing mu a ion ha mo es he s op codon in he 39di ec ion, could include/ exclude a gi en in on in he gene CDS, gene a ing an appa en in on gain/loss. Mo eo e , a puzzling case o C- e minus a iabili y comes om he compa ison o mouse and a ERBP ( ig. 6A). In on F o mouse ERBP loca es 9 nucleo ides away om he s op codon. The a ERBP gene has an inse ion ha accommoda es a sho exon and ano he in on (al e na i ely, he mouse ERBP could ha e expe ienced an equi alen dele ion). We e i no o he exis ence o an in- ame s op codon in he sho exon p esen in he a ERBP gene, we would ha e a unique lipocalin wi h 7 in ons. In summa y, he C- e mini o cho da e lipocalins show genomic plas ici y, accommoda ing in ons and mu a ions ha modi y he p o ein leng h. I is no known whe he his genomic plas ici y is causally ela ed o a highe p obabili y o in on gain, loss, o sliding in he 39end o lipocalins, bu his possibili y is wo h in es iga ing. Gene S uc u e and he Th ee-Dimensional S uc u e o Lipocalins and Calycins We mapped he loca ion o exon bounda ies in he e ia y s uc u e o lipocalins ha belong o di e en phylogene ic clades (IcyA, RBP, BLB, NGAL, MUP, and ERBP). Mos lipocalin in ons a e loca ed in he bounda ies o bs ands (see ig. 3). In spi e o a ce ain a iabili y in numbe and posi ion, in ons A–D seem o dema ca e he lipocalin bba el, whe eas in ons E and F a e p esen in he C- e minal lexible egion. A way o es ing a ela ionship be ween lipocalin in on-exon bounda ies and e ia y s uc u e would be o analyze he gene s uc u e o p o eins wi h a e ia y s uc u e like ha o lipocalins. A simila s uc u e and a ma ginal sequence simila i y ha e been used o p opose a s uc u al supe amily, he calycins, ha ela es lipocalins o p o eins such as FABP, CRBP, a idin, and a g oup o p o ease inhibi o s (Flowe , No h, and Sansom 2000). We ind no gene s uc u e simila i y a e aligning ep esen a- i es o hese p o eins wi h he lipocalins and compa ing in on posi ions ( ig. 6B). This inding sugges s ha (1) we do no ha e compelling e idence o a ela ionship be ween in on-exon a angemen and he e ia y s uc u e o hese bba el–based p o eins; (2) he e olu iona y ela ionship o lipocalins wi h he o he p oposed calycins, al eady ques ioned a e analyzing hei p o ein sequence (Gan o nina e al. 2000), emains o be demons a ed; and (3) he homology o in ons A–F in lipocalins, he ounda ion o he phylogene ic in e ences ha we p esen in his wo k, is a easonable assump ion: he pa e n and p ope ies o in on-exon bounda ies a e good ma ke s o he lipocalins his o y o descen . Concluding Rema ks: E olu iona y Hypo hesis o he Lipocalin Gene Family In conclusion, gene s uc u e is well p ese ed among lipocalins, and ou esul s alida e i s use o he econs uc ion o lipocalin e olu ion. The cong uence o phylogene ic ees buil om wo independen se s o da a (p o ein sequence and gene s uc u e) inc eases he e isimili ude o bo h econs uc ions o he lipocalins his o y. Fu he mo e, in he u u e we can use gene s uc u e da a o assay he lipocalin na u e o no el p o eins whose amino acid sequence and/o p o ein s uc u e show simila i y o lipocalins. Ou esul s gi e suppo o he ollowing hypo hesis abou he e olu iona y his o y o lipocalins: Bac e ial lipocalins we e inhe i ed by unicellula euka yo es and passed on o bo h plan s and me azoans. The p imi i e me azoans sp ead a low numbe o ancien lipocalins in o some o hei successo s, he a h opods and cho da es, al hough hese p o eins migh ha e been unexploi ed and subsequen ly los in o he phyla. The p imo dial a h opod and cho da e lipocalins we e likely simila o he Laza illo and ApoD lipocalins now p esen in hese phyla. Alongside he cho da e adia ion, he ApoD-like ances al lipocalin su e ed duplica ions. On he one hand, i ga e ise o he ances o o RBPs, and on he o he hand, o one o mo e ances o s o all o he pa alogous g oups o lipocalins ha di e ged in o he cu en di e se ca alog o cho da e lipocalins. Acknowledgmen s We hank C. Gonza´lez o allowing us o use his lab esou ces o collec he Laza illo gene s uc u e da a needed o his wo k, and M. Bas iani o he g asshoppe genomic DNA. We hank J. P. Salie o help ul discussion and commen s on he manusc ip . This wo k was suppo ed by FIG. 6.—A, Alignmen o he nucleo ide sequences coding o he C- e minal egion o he ERBP genes om mouse (Mmus.ERBP) and a (Rno .ERBP). S op codons a e ma ked by g ay boxes. In on inse ions a e shown by e ical lines. A conse ed TGA codon is p esen (unde lined) in he 39-UTR o he a gene. B, Alignmen o he p o ein sequences o wo ep esen a i e FABP and CRBP p o eins wi h he lipocalin alignmen o igu e 3. In on inse ions o FABP and CRBP (in on phase shown as in ig. 3) a e shown in he con ex o lipocalin in ons and seconda y s uc u e. Fo he sake o simplici y, he lipocalins a e ep esen ed by a whi e box and he in on posi ions (no conside ing hei phase) a e highligh ed wi h a hick black line. 782 Sa´nchez e al. a g an (DGICYT BIO-1999-065-C02-02) o A. M., and a isi ing p o esso g an o D.S. We a e g a e ul o R. Escalan e o ale ing us o he sequence o he Dic yo- s elium gene, and o B. Ake s om o ale ing us o he D osophila gene Ka l. We hank C. San iago a he Cen o de In es igaciones Biolo´gicas sequencing acili y. Li e a u e Ci ed Adachi, J., and M. Hasegawa. 1996. MOLPHY e sion 2.3: p og ams in molecula phylogene ics based on maximum likelihood. The Ins i u e o S a is ical Ma hema ics, Tokyo. Adams, E. N. 1972. Consensus echniques and he compa ison o axonomic ees. Sys . Zool. 21:390–397. Al schul, S. F., W. Gish, W. Mille , E. W. Mye s, and D. J. Lipman. 1990. Basic local alignmen sea ch ool. J. Mol. Biol. 215:403–410. Be s, M. J., R. Guigo, P. Aga wal, and R. B. Russell. 2001. Exon s uc u e conse a ion despi e low sequence simila i y: a elic o d ama ic e en s in e olu ion? EMBO J. 20:5354–5360. Bishop, R. E. 2000. The bac e ial lipocalins. Biochim. Biophys. Ac a 1482:73–83. Ca e ino, M. S., S. Cho, and F. A. Spe ling. 2000. The cu en s a e o insec molecula sys ema ics: a h i ing owe o Babel. Annu. Re . En omol. 45:1–54. Dibb N. J., and A. J. Newman. 1989. E idence ha in ons a ose a p o o-splice si es. EMBO J. 8:2015–2021. Es ab ook, G. F. 1992. E alua ing undi ec ed posi ional cong u- ence o indi idual axa be ween wo es ima es o he phylogene ic ee o a g oup o axa. Sys . Biol. 41:172–177. Fedo o , A., X. Cao, S. Saxono , S. J. de Souza, S. W. Roy, and W. Gilbe . 2001. In on dis ibu ion di e ence o 276 ancien and 131 mode n genes sugges s he exis ence o ancien in ons. 98:13177–13182. Felsens ein, J. 1993. PHYLIP (phylogeny in e ence package). Ve sion 3.5c. Dis ibu ed by he au ho , Depa men o Gene ics, Uni e si y o Washing on, Sea le. Flowe , D. R., A. C. T. No h, and T. K. A wood. 1993. S uc u e and sequence ela ionships in he lipocalins and ela ed p o eins. P o ein Sci. 2:753–761. Flowe D. R., A. C. No h, and C. E. Sansom. 2000. The lipocalin p o ein amily: s uc u al and sequence o e iew. Biochim. Biophys. Ac a 1482:9–24. Gan o nina, M. D., G. Gu ie´ ez, M. J. Bas iani, and D. Sa´nchez. 2000. A phylogene ic analysis o he lipocalin p o ein amily. Mol. Biol. E ol. 17:114–126. Gan o nina, M. D., D. Sa´nchez, and M. J. Bas iani. 1995. Laza illo, a new GPI-linked su ace lipocalin, is es ic ed o a subse o neu ons in he g asshoppe emb yo. De elopmen 121:123–134. Gu ie´ ez, G., M. D. Gan o nina, and D. Sa´nchez. 2000. E olu ion o he lipocalin amily as in e ed om a p o ein sequence phylogeny. Biochim. Biophys. Ac a 1482:35–45. Hasegawa, M., and H. Kishino. 1994. Accu acies o he simple me hods o es ima ing he boo s ap p obabili y o a maxi- mum likelihood ee. Mol. Biol. E ol. 11:142–145. Holz eind, P., and B. Redl. 1994. S uc u al o ganiza ion o he gene encoding he human lipocalin ea p ealbumin and syn hesis o he ecombinan p o ein in Esche ichia coli. Gene 139:177–183. Iga ashi, M., A. Naga a, H. Toh, Y. U ade, and O. Hayaishi. 1992. S uc u al o ganiza ion o he gene o p os aglandin D syn hase in he a b ain. P oc. Na l. Acad. Sci. USA 89:5376–5380. K em, M. M., and E. Di Ce a. 2001. Molecula ma ke s o se ine p o ease e olu ion. EMBO J. 20:3036–3045. Li, W., and L. M. Riddi o d. 1992. Two dis inc genes encode wo majo isoelec ic o ms o insec icyanin in he obacco ho nwo m, Manduca sex a. Eu . J. Biochem. 205:491–499. Lindq is , A., P. Roue , J.-P. Salie , and B. Ake s om. 1999. The alpha1-mic oglobulin/bikunin gene: cha ac e iza ion in mouse and e olu ion. Gene 234:329–336. Logsdon, J. M. J . 1998. The ecen o igins o spliceosomal in ons e isi ed. Cu . Opin. Gene . De . 8:637–648. Ohno, S. 1999. Gene duplica ion and he uniqueness o e eb a e genomes ci ca 1970–1999. Semin. Cell De . Biol. 10:517– 522. Rokas, A., and P. W. Holland. 2000. Ra e genomic changes as a ool o phylogene ics. T ends Ecol. E ol. 15:454–459. Rokas, A., J. Ka hi i hamby, and P. W. Holland. 1999. In on inse ion as a phylogene ic cha ac e : he eng ailed homeobox o S epsip e a does no indica e a ini y wi h Dip e a. Insec Mol. Biol. 8:527–530. Roy, S. W., A. Fedo o , and W. Gilbe . 2002. The signal o ancien in ons is obscu ed by in on densi y and homolog numbe . P oc. Na l. Acad. Sci. USA 99:15513–15517 Sai ou, N., and M. Nei. 1987. The neighbo -joining me hod: a new me hod o econs uc ing phylogene ic ees. Mol. Biol. E ol. 4:406–425. Salie , J.-P. 2000. Ch omosomal loca ion, exon/in on o ganiza- ion and e olu ion o lipocalin genes. Biochim. Biophys. Ac a 1482:25–34. Sa´nchez, D., M. D. Gan o nina, and M. J. Bas iani. 1995. De elopmen al exp ession o he lipocalin Laza illo and i s ole in axonal pa h inding in he g asshoppe emb yo. De elopmen 121:135–147. ———. 2000a. Laza illo, a neu onal lipocalin in g asshoppe s wi h a ole in axon guidance. Biochim. Biophys. Ac a 1482:102–109. Sa´nchez, D., M. D. Gan o nina, S. To es-Schumann, S. D. Speese, J. M. Lo a, and M. J. Bas iani. 2000b. Cha ac e iza- ion o wo no el lipocalins exp essed in he D osophila emb yonic ne ous sys em. In . J. De . Biol. 44:349–359. S ol z us, A., J. M. Logsdon, J ., J. D. Palme , and W. F. Dooli le. 1997. In on ‘‘sliding’’ and he di e si y o in on posi ions. P oc. Na l. Acad. Sci. USA 94:10739–10744. Swo o d, D. L. 1998. PAUP*: phylogene ic analysis using pa simony (*and o he me hods). Ve sion 4. Sinaue Asso- cia es, Sude land, Mass. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The Clus alX Windows in e ace: lexible s a egies o mul iple sequence alignmen aided by quali y analysis ool. Nucleic Acids Res. 24:4876–4882. Tho ley J. L., and R. D. M. Page. 2000. RadCon: phylogene ic ee compa ison and consensus. Bioin o ma ics 16:486–487. Tho ley, J. L., M. Wilkinson, and M. A. Cha les on. 1998. The in o ma ion con en o consensus ees. Pp. 91–98 in A. Rizzi, M. Vichi, and H.-H. Bock, eds. Ad ances in da a science and classi ica ion. Sp inge -Ve lag, Be lin. Toh, H., H. Kubode a, N. Nakajima, T. Sekiya, N. Eguchi, T. Tanaka, Y. U ade, and O. Hayaishi. 1996. Glu a hione- independen p os aglandin D syn hase as a lead molecule o designing new unc ional p o eins. P o ein Eng. 9:1067–1082. Wada, H., M. Kobayashi, R. Sa o, N. Sa oh, H. Miyasaka, and Y. Shi ayama. 2002. Dynamic inse ion-dele ion o in ons in deu e os ome EF-1 alpha genes. J. Mol. E ol. 54:118–128. Pee Bo k, Associa e Edi o Accep ed Decembe 23, 2002 Lipocalin Gene S uc u e and E olu ion 783