Recombinase polymerase and enzyme-linked immunosorbent assay as a DNA amplification-detection strategy for food analysis

Documen downloaded om: This pape mus be ci ed as: The inal publica ion is a ailable a Copy igh Addi ional In o ma ion h ps://dx.doi.o g/10.1016/j.aca.2013.12.017 h p://hdl.handle.ne /10251/65319 Else ie San iago Felipe, S.; To ajada-Gena o, LA.; Puchades, R.; Maquiei a Ca ala, Á. (2014). Recombinase polyme ase and enzyme-linked immunoso ben assay as a DNA ampli ica ion-de ec ion s a egy o ood analysis. Analy ica Chimica Ac a. 811:81-87. doi:10.1016/j.aca.2013.12.017. 1 RECOMBINASE POLYMERASE AND ENZYME-LINKED 1 IMMUNOSORBENT ASSAY AS A DNA AMPLIFICATION-DETECTION 2 STRATEGY FOR FOOD ANALYSIS 3 4 S. San iago-Felipe, L.A. To ajada-Gena o, R. Puchades, A. Maquiei a 5 Cen o de Reconocimien o Molecula y Desa ollo Tecnológico (IDM) - Depa amen o de 6 Química, Uni e si a Poli ècnica de València, Camino de Ve a s/n, 46022 Valencia, Spain. 7 email: amaquiei [email p o ec ed] .es 8 9 10 ABSTRACT 11 Polyme ase chain eac ion in conjunc ion wi h enzyme-linked immunoso ben assay 12 (PCR-ELISA) is a well-es ablished echnique ha p o ides a sui able apid, sensi i e, 13 and selec i e me hod o a b oad ange o applica ions. Howe e , he need o p ecise 14 apid empe a u e cycling o PCR is an impo an d awback ha can be o e come by 15 employing iso he mal ampli ica ion eac ions such as ecombinase polyme ase 16 ampli ica ion (RPA). The RPA–ELISA combina ion is p oposed o ampli ica ion a a 17 low, cons an empe a u e (40 ºC) in a sho ime (40 min), o he hyb idisa ion o 18 labelled p oduc s o speci ic 5’-bio inyla ed p obes/s ep a idin in coa ed mic o i e 19 pla es a oom empe a u e, and o de ec ion by colo ime ic immunoassay. RPA- 20 ELISA was applied o sc een common sa e y h ea s in oods u s, such as alle gens 21 (hazelnu , peanu , soybean, oma o, and maize), gene ically modi ied o ganisms (P35S 22 and TNOS), pa hogenic bac e ia (Salmonella spp. and C onobac e spp.), and ungi 23 (Fusa ium spp.). Sa is ac o y sensi i i y and ep oducibili y esul s we e achie ed o 24 all he a ge s. The RPA-ELISA echnique does away wi h he mocycling and p o ides 25 a sui able sensi i e, speci ic, and cos -e ec i e me hod o ou ine applica ions, and 26 p o es pa icula ly use ul o esou ce-limi ed se ings. 27 28 Keywo ds: iso he mal ampli ica ion; ELISA; alle gen; GMO; pa hogen; ood 29 sa e y 30 31 2 1. In oduc ion 32 Analy ical me hods o as , eliable, sensi i e and cos -e ec i e de ec ion a e 33 highly demanded in many a eas, including ood sa e y. Me hods based on he de ec ion 34 o nucleic acids o e in e es ing bene i s because DNA molecules show cons an 35 concen a ions, s abili y, and be e ex ac ion yields (e en om p ocessed and hea - 36 ea ed samples) han p o eins [1-2]. Fu he mo e, he ampli ica ion by polyme ase 37 chain eac ion (PCR) ensu es he equi ed sensi i i y le els. Consequen ly in ecen 38 yea s, he PCR-based me hods, e.g. RT-PCR, digi al PCR o mic oa ay, a e he gold 39 s anda d o he analysis o nucleic acids [2-4]. 40 The demand o sequence-speci ic app oaches ha do no equi e labo ious o 41 expensi e de ec ion echnologies has led o he hyphena ion o PCR wi h enzyme-linked 42 immunoso ben assay (PCR-ELISA) [5-7]. This combines he high selec i i y o DNA- 43 based me hods wi h ELISA sensi i i y. This in eg a ion in ol es he hyb idisa ion o 44 labelled ampli ica ion p oduc s o speci ic cap u ed p obes in each mic o i e well, as 45 well as hei immunode ec ion. Al hough sensi i i y can be imp o ed using luo ome ic 46 o chemiluminiscen subs a es, PCR-ELISA me hods no mally employ colo ime ic 47 de ec ion because be e ep oducibili y, cos -by-assay, and s abili y a e achie ed [6-8]. 48 The e o e, colo ime ic PCR-ELISA is a me hod ha is capable o p ocessing up o 96 49 o 384 assays simul aneously, i is po en ially au oma able, and only equi es he basic 50 ins umen s p esen in any diagnos ic labo a o y. 51 The he mal PCR echnique has i s limi a ions, such as equi ing p ecise 52 empe a u e con ol and apid he mocycling s eps among he empe a u es o 53 dissocia ion (95 ºC), annealing (55-65 ºC) and elonga ion (70 ºC) [6]. Ye he use o 54 o he enzymes (o a combina ion o enzymes) o mimic DNA eplica ion in i o has 55 eme ged as a solu ion o con en ional PCR polyme ases [9-10]. A he momen , wo 56 iso he mal ampli ica ion eac ions in combina ion wi h ELISA ha e been desc ibed: 57 loop-media ed iso he mal ampli ica ion (LAMP-ELISA) [11] and helicase-dependen 58 ampli ica ion (HDA-ELISA) [12]. They do no equi e expensi e ampli ica ion 59 equipmen and ha e been seen o be e y lexible and capable o simul aneously 60 p ocessing up o se e al hund eds o samples in a ew hou s. Howe e , hese eac ions 61 a e pe o med a om oom empe a u e (60 – 65 ºC), equi e an ini ial dena u a ion 62 s ep a 95 ºC (HDA) o need complex p ime s design (LAMP). 63 An inno a i e iso he mal ampli ica ion called ecombinase polyme ase 64 ampli ica ion (RPA) o e s in e es ing ad an ages [13-14]. This echnique acili a es he 65 3 binding o oligonucleo ide p ime s o empla e DNA. P ime s a e elonga ed by a s and- 66 displacing DNA polyme ase, called Bsu polyme ase, while single-s anded DNA- 67 binding p o eins s abilise ampli ica ion eac ion in e media es. Compa ed o o he 68 ampli ica ion enzymes, Bsu polyme ase main ains simila ac i i y in inhibi ing 69 en i onmen s, equi es a sho e incuba ion ime, ope a es a lowe empe a u es, is easy 70 o use and he ampli ied p oduc s do no need pos -ampli ica ion ea men . The 71 in eg a ion o DNA ampli ica ion and he de ec ion s ep en ails adjus ing se e al c i ical 72 a iables. Fo ins ance, RPA bu e con ains Ca bowax 20M, a high-molecula -weigh 73 polye hylene glycol, as a c owding agen o in luence he ecombinase kine ics. 74 Howe e , i is known ha hese molecules may a ec he solubili y, mel ing 75 empe a u e o iscosi y o he eac ion mix, and hence he ampli ied p oduc [15]. 76 In his s udy, he hyphena ion o he RPA and ELISA me hodologies (RPA- 77 ELISA) is de eloped o ood sa e y applica ions. The echnical implemen a ion o 78 in eg a ed sc eening me hods in ood indus y can as ly help o simpli y he p ocess 79 and o educe cos s, hus making analy ical p ocedu es iendlie [1]. He e he 80 simul aneous de ec ion o di e en common ood h ea s is p oposed. Hazelnu , peanu 81 and soybean ha e been selec ed as ep esen a i e examples o he alle gens included in 82 p io i y lis s [16]. Toma o and maize ha e also been included because he e is g owing 83 conce n abou hei alle genici y associa ed wi h hei cu en widesp ead use [17-18]. 84 P omo e 35S and e mina o NOS a e widely used o sc eening gene ically modi ied 85 o ganisms (GMOs) since se en y- wo pe cen o GMOs con ains a leas one o hese 86 sequences [19-20]. Salmonella spp., C onobac e spp. a e equen ly de ec ed as being 87 esponsible o ood con amina ion. Acco ding o he Food and Ag icul u e 88 O ganiza ion o he Uni ed Na ions and he Wo ld Heal h O ganiza ion, hey a e 89 conside ed o be included among he mos ele an pa hogens and hei absence is 90 equi ed in ood sa e y analysis [21-22]. Finally, Fusa ium spp. is one o mos equen 91 ungi ound in ood and eed de i a es, and i p oduces myco oxins ha cause se ious 92 heal h p oblems in bo h humans and li es ock [23-24]. 93 94 4 2. Expe imen al 95 2.1 Ta ge genes 96 The selec ed genes o hazelnu , peanu , soybean, oma o, maize, GMO p omo e - 97 P35S, GMO e mina o -TNOS, Salmonella spp., C onobac e spp., and Fusa ium spp. 98 a e shown in Table 1. All he p ime s and p obes we e success ully checked o ele an 99 homologies by a BLASTN sea ch (h p://blas .ncbi.nlm.nih.go /). 100 101 2.2 Bac e ial and ungal s ains, oods u and DNA ex ac ion 102 Salmonella yphimu ium g oup B (CECT 443) and C onobac e sakazakii (ATCC 103 BBA-894) we e used as e e ence s ains. They we e isola ed and p o ided by he 104 GAIKER Technology Cen e (Bizkaia, Spain). Viable samples we e ob ained by 105 o e nigh cul u e on nu ien aga pla es (0.5% Pep one, 0.3% bee ex ac , 1.5% aga , 106 0.5% NaCl, pH 7) a 37 ºC. Bac e ial inocula ion assays we e p epa ed by adding 10- 107 old se ial dilu ions o an 18-hou cul u e o each pa hogen in s e ile saline solu ion 108 (0.8% NaCl), co e ing a ange om 0 o 4104 CFU mL-1. Fusa ium monili o me 109 (CECT 2982) was used as he e e ence ungal s ain. I was isola ed and p o ided by 110 he Ins i u o Ag o o es al Medi e áneo (IAM), Uni e si a Poli ècnica de València 111 (UPV). Viable samples we e ob ained by cul u ing 4 days on nu ien aga pla es a 112 25ºC. Fungi inocula ion assays we e p epa ed by adding ungal mycelium (103-105 µg 113 o mycelium pe g o ood) om a 4-day cul u e. The ce i ied e e ence ma e ials 114 (CRM) con aining 0.05% o ansgenic B 11 maize (ERM-BF412 ) and 0.01% o 115 ansgenic RRS soybean (ERM-BF410gk) we e pu chased om he Ins i u e o 116 Re e ence Ma e ial and Measu emen s (Geel, Belgium). Food p oduc s we e bough in 117 local s o es. Genomic DNA was ex ac ed om bac e ial cul u es, ungal mycelium, and 118 ood samples using he DNeasy Blood & Tissue Ki (Qiagen, Inc., CA). 119 Inocula ion assays we e assessed a e aking in o accoun hei common 120 concen a ion in con amina ed oods (e.g., Salmonella spp. >102 CFU/mL) [28]. 121 122 2.3 RPA-ELISA 123 RPA assays we e ca ied ou in a o al olume o 25 μL using he Twis Amp 124 Basic ki (Twis DX, Camb idge, UK). Reac ions con ained 480 nM o each 5’- 125 digoxigenin labelled p ime (Table 1), 15 ng o genomic DNA, 14 mM o Mg ace a e, 126 and 1× ehyd a ion bu e . Fi s ly, all he eagen s excep o he DNA empla e and Mg 127 5 ace a e we e p epa ed in a mas e mix, which was dis ibu ed in o each 0.2 mL eac ion 128 ube con aining he enzyme and he nucleo ides in a d ied pelle . Then, DNA was added 129 in o he ubes, and Mg ace a e was dispensed las ly. Since he RPA eac ion s a s as 130 soon as magnesium is added, he ubes we e immedia ely placed in o a hea ing o en 131 (Memme , model UF30, Ge many) a 40 ºC o 40 min. 132 Ampli ica ion p oduc s we e analysed in 96-well mic o i e ELISA pla es 133 (Co ning, USA). Fo his pu pose, 100 µL o s ep a idin (0.2 mg L-1) and bio inyla ed 134 p obes (20 nM), dilu ed in coa ing bu e (50 mM ca bona e bu e , pH 9.6) and we e 135 incuba ed o e nigh a 4 ºC. Double labelled oligonucleo ide (5’-bio in and 3’- 136 digoxigenin) was used as he posi i e con ol and non- a ge bio inyla ed 137 oligonucleo ide was he nega i e con ol (no complemen a y o any a ge ). Mic o i e 138 pla es we e washed 3 imes wi h PBS-T (phospha e-bu e ed saline con aining 0.05% 139 ( / ) ween 20, pH 7.4) plus deionised wa e , and we e s o ed a 4 ºC o become s able 140 a less 1 mon h. Ampli ied p oduc s (1 L) we e mixed wi h 99 L o 5 hyb idisa ion 141 bu e (SSC, 1 saline sodium ci a e: NaCl 150 mM, sodium ci a e 15 mM, pH 7) and 142 hea ed a 95 ºC o 5 min o dena u e in o single s ains. Then dena u ed p oduc s (100 143 µL) we e dispensed in o each well and incuba ed a 37 ºC o 45 min. A e washing he 144 pla e 3 imes wi h PBS-T and deionised wa e , 100 µL pe well o an i-digoxigenin 145 an ibody labelled wi h ho se adish pe oxidase (an i-Dig-HRP) solu ion in PBS-T 146 (1:2000) we e dispensed and incuba ed a oom empe a u e o 25 min. A e a washing 147 s ep wi h PBS-T and deionised wa e , 100 µL o TMB solu ion (0.25 g L-1 o 3, 3’, 5, 148 5’- e ame hylbenzidine and 0.002 M o hyd ogen pe oxide in ci a e bu e , pH 5.5) 149 we e dispensed and incuba ed a oom empe a u e o 10 min. Finally, he eac ion was 150 s opped wi h 50 µL o 2.5 M sulphu ic acid and abso bance was measu ed a 450 nm 151 ( e e ence wa eleng h: 650 nm) wi h a mic o i e pla e eade (Wallac, model Vic o 152 1420 mul ilabel coun e , Finland). A sample was conside ed posi i e when he op ical 153 esponse was highe han he cu -o alue. 154 155 2.4 PCR-ELISA 156 PCR mix u es (25 μL) con ained 15 ng o ex ac ed genomic DNA, 1× T is-KCl 157 bu e (100 mM T is-HCl, 500 mM KCl, pH 8.3), 2 mM MgCl2, 200 µM dNTPs, 1.25 158 uni s o Taq DNA polyme ase (Roche, Ge many) and 400 nM o each 5’-digoxigenin 159 labelled p ime (Table 1). Reac ions we e ca ied ou in a TC-400 he mocycle (Bibby 160 Scien i ic, S a o dshi e, UK) and applying he he mal p og amme: dena u a ion (95 161 6 ºC, 5 min) ollowed by 40 cycles o dena u a ion (95 ºC, 30 s), annealing (62 ºC, 30 s) 162 and elonga ion (72 ºC, 30 s), wi h a inal elonga ion s ep (72 ºC, 5 min). The 163 immunoassay was pe o med as is desc ibed abo e. 164 165 2.5 Compa ison wi h o he de ec ion echniques 166 Ampli ica ion p oduc s we e checked by elec opho esis on a 3% (w/ ) aga ose 167 gel a 110 V and oom empe a u e. Gels we e s ained o 30 min wi h 0.5× TBE bu e 168 (T is/Bo a e/EDTA) con aining luo opho e Real-Sa e (Real Labo a o ies, Spain) a 169 0.01% ( / ), and bands we e isualised wi h a UV ansillumina o . P oduc size was 170 de e mined by compa ison wi h a 50 bp ladde (Fe men as, Li huania). Ampli ica ion 171 yields we e calcula ed om he luo escence measu emen s wi h SYBR-Sa e a 0.01% 172 ( / ) in a mic o i e pla e eade . 173 174 2.6 Compa ison o de eloping s a egies 175 O he de eloping immunoassay s eps we e also es ed independen ly. o- 176 Phenylenediamine dihyd ochlo ide (OPD) was used as an al e na i e colo ime ic 177 subs a e o TMB. The addi ion o digoxigenin-dUTPs (35 µM) in he RPA mix u es 178 was an al e na i e o ob ain labelled ampli ied p oduc s. Th ee an igen-an ibody 179 ecogni ion assays we e also compa ed. The i s app oach was based on digoxigenin- 180 labelled p ime s, an an i-digoxigenin an ibody p oduced in sheep (an i-Dig) as a 181 p ima y an ibody a he 1/20,000 dilu ion, and an i-sheep conjuga ed wi h ho se adish 182 pe oxidase (an i-sheep-HRP) as a seconda y an ibody a he 1/4,000 dilu ion. The 183 second app oach used Cy5-labelled p ime s, an an i-Cy5 an ibody p oduced in mouse 184 (an i-Cy5) a he 1/2,000 dilu ion, and an an i-mouse conjuga ed wi h ho se adish 185 pe oxidase (an i-mouse-HRP) a he 1/500 dilu ion. The hi d app oach was based on 186 Dig-labelled p ime s, sheep an i-Dig an ibody as a p ima y an ibody a he 1/5,000 187 dilu ion, and an i-sheep conjuga ed wi h alkaline phospha ase (an i-sheep-AP) as a 188 seconda y an ibody dilu ed a 1/250, using he ni o-blue e azolium/5-b omo-4-chlo o- 189 3'-indolyphospha e solu ion (BCIP/NBT) as he colo ime ic subs a e. Da a analysis 190 was pe o med wi h he s a is ical package SPSS o Windows, . 16.0 191 192 7 3. Resul s and discussion 193 3.1 Adap a ion o he RPA p o ocol 194 The eac ion condi ions (p ime concen a ions, empe a u e and ime) we e s udied o 195 achie e he same ampli ica ion condi ions o en analy es: hazelnu , peanu , soybean, 196 and maize seeds, oma o ui , P35S and TNOS om he CRM, and pu e cul u es o 197 Salmonella spp., C onobac e spp., and Fusa ium spp. The op imal RPA condi ions 198 we e 480 nM o he o wa d and e e se p ime s, and incuba ion a 40 ºC o 40 min. A 199 single p o ocol was achie ed o he pa allel ampli ica ion o all es ed analy es, which 200 conside ably cu he o al analysis ime. Ampli ied p oduc s we e cha ac e ised by 201 aga ose gel elec opho esis o p oduc size de e mina ion. RPA eac ions gene a ed he 202 p edic ed p oduc leng h, acco ding o he p oposed p ime s, hese being: 109 bp o 203 hazelnu , 82 bp o peanu , 81 bp o soybean, 92 bp o oma o, 136 bp o maize, 123 204 bp o P35S, 118 o TNOS, 152 bp o Salmonella spp., 190 bp o C onobac e spp., 205 and 180 bp o Fusa ium spp. 206 207 3.2 Hyb idisa ion assays. In eg a ion o RPA and ELISA 208 Se e al ac o s in luence hyb idisa ion e iciency o he speci ic p obe 209 immobilised on he mic opla e, and la e he de ec ion esponse. Fo his pu pose, mul i- 210 a iable expe imen al designs we e made o op imise he main pa ame e s du ing he 211 assays. 212 The hyb idisa ion p ocess on solid suppo s, including polys y ene used in 213 mic opla e wells, depends on p obe co e age densi y. An indi ec immobilisa ion 214 eac ion (s ep a idin/bio in-labelled p obe) was chosen. To ha end, coa ing condi ions 215 we e op imised by a ying he s ep a idin concen a ion om 0.002 o 2 mg L-1, and 216 he p obe concen a ion om 0.2 o 200 nM, and 0.2 mg L-1 o s ep a idin and he 20 217 nM p obe we e selec ed (Figu e 1A). A s ep a idin concen a ion abo e 0.2 mg L-1 218 inc eased he signal, bu d as ically educed assay ep oducibili y. P obe co e age was 219 calcula ed using double labelled oligonucleo ides (5’-bio in and 3’-Cy5) and a 220 homemade su ace luo escence eade . P obe densi y was 0.08 mol mm-2. 221 Addi ionally, he hyb idisa ion yield changed acco ding o empe a u e. Hyb idisa ion 222 ime was es ed e e y 10 min o 1 h, and he empe a u e ange was 25-50 ºC. The 223 maximum signal was achie ed a e 45 min a 37 ºC (Figu e 1B and 1C). 224 8 The e ec o he eac ion olume (12.5-200 µL/well) and p oduc dilu ion (1/50 o 225 1/5,000) was also e alua ed (Figu e 1D). The bes esul s we e ob ained a he 1/100 226 dilu ion o ampli ica ion p oduc and using 100 µL as he eac ion olume. Highe 227 concen a ions o ampli ica ion p oduc educed he signal. This e ec can be explained 228 by he p esence o Ca bowax 20M (5%) in he RPA bu e . No o he e ec s o 229 ampli ica ion eagen s o he washing p o ocol we e obse ed, so i was unnecessa y o 230 pe o m u he ea men s wi h he RPA p oduc s in he p oposed me hod. A e es ing 231 some solu ions (wa e , SSC, PBS-T, and PBS) and cycles (1-5), h ee cycles wi h PBS- 232 T and one cycle wi h deionised wa e we e chosen as he app op ia e washing p o ocol. 233 234 3.3 Op imisa ion o he de ec ion s ep 235 The ELISA assays based on he ecogni ion digoxigenin-labelled RPA p oduc s 236 by an an i-Dig-HRP an ibody we e op imised by analysing he DNA ex ac ed om 237 hazelnu , soybean seeds and ansgenic maize. The highes signal was achie ed a he 238 1/2,000 dilu ion, and no signi ican signal imp o emen was accomplished a highe 239 concen a ions (Figu e 1E). The an ibody incuba ion ime was op imised, wi h he bes 240 esul s ob ained a 25 min (Figu e 1F). Th ee PBS-T washing s eps and u he 241 deionised wa e ising we e su iced o elimina e any excess eagen s. 242 Fo he immunoenzyma ic de ec ion o he hyb idisa ion complex, a colo ime ic 243 eac ion ( = 450 nm, backg ound = 650 nm) was employed by compa ing wo common 244 HRP subs a es, 3,3’,5,5’- e ame hylbenzidine (TMB) and o-phenylenediamine 245 dihyd ochlo ide (OPD), a di e en concen a ions up o 2 g L-1. As no ema kable 246 di e ences we e obse ed du ing he achie ed analy ical pe o mances be ween bo h 247 subs a es, he use o TMB a 0.25 g L-1 was selec ed because i o e s ad an ages, such 248 as low cos , easy manipula ion, g ea e s abili y and lowe oxici y [8]. 249 Al e na i e s a egies o he digoxigenin-labelled p ime s/an i-Dig-HRP/TMB 250 sys em we e adop ed and compa ed o con en ional me hods: elec opho esis and in- 251 well- luo escence by he SYBR-Sa e DNA s ain (Figu e 2). Fi s ly, digoxigenin-dUTPs 252 in he PCR mix u es we e es ed as an example o nucleo ide labelling. This op ion, 253 ei he combined o no wi h digoxigenin-labelled p ime s, inc eases assay sensi i i y, 254 bu a a sligh ly highe cos -by- eac ion [8]. Secondly, he immunoassay can be 255 pe o med using di e en combina ions o p ima y and seconda y an ibodies. Two 256 app oaches we e es ed: digoxigenin-labelled p ime s/sheep an i-Dig/an i-sheep-HRP 257 and Cy5-labelled p ime s/mouse an i-Cy5/an i-mouse-HRP. By keeping digoxigenin as 258 15 [20] Commission Regula ion (EU) No 619/2011 o 24 June 2011 laying down he 402 me hods o sampling and analysis o he o icial con ol o eed as ega ds p esence o 403 gene ically modi ied ma e ial o which an au ho isa ion p ocedu e is pending o he 404 au ho isa ion o which has expi ed. O J Eu Union L 268:24–28. 405 [21] Commission Regula ion (EC) No 2073/2005 o 15 No embe 2005 on 406 mic obiological c i e ia o oods u s. O J Eu Union L 338:1–26. 407 [22] T. A nandis-Cho e , S. Mo ais, L.A. To ajada-Gena o, R. Puchades, A. 408 Maquiei a, J. Be ganza, G. Olaba ia, Talan a, 101 (2012) 405-412. 409 [23] C. G imm, R. Geisen, Le . Appl. Mic obiol. 26 (1998) 456-462. 410 [24] Commission Regula ion (EC) No 1881/2006 o 19 Decembe 2006 se ing 411 maximum le els o ce ain con aminan s in oods u s. O J Eu Union L 364:5–24. 412 [25] L. Yang, A. Pan, J. Jia, J. Ding, J. Chen, H. Chen, C. Zhang, D. Zhang, J. Ag ic. 413 Food Chem. 53 (2005) 183-190. 414 [26] In e na ional O ganiza ion o S anda diza ion. 21570:2005 Foods u s–Me hods 415 o analysis o he de ec ion o gene ically modi ied o ganisms and de i ed p oduc s– 416 quali a i e nucleic acid based me hods. Gene a, Swi ze land: In e na ional O ganiza ion 417 o S anda diza ion, 2005. 418 [27] In e na ional O ganiza ion o S anda diza ion. 21569:2005 Foods u s–Me hods 419 o analysis o he de ec ion o gene ically modi ied o ganisms and de i ed p oduc s– 420 quali a i e nucleic acid based me hods. Gene a, Swi ze land: In e na ional O ganiza ion 421 o S anda diza ion, 2005. 422 [28] Wo ld Heal h O ganiza ion. 2004. In e na ional Cou se: Epidemiology o 423 oodbo ne diseases. Au onomous Uni e si y o Yuca an, Me ida, Mexico. pp. 25-36. 424 [29] R. Köppel, F. an Velsen-Zimme li, T. Buche , Eu . Food Res. Technol. 235 425 (2012) 843-853. 426 [30] P.P. Zhou, J.Z. Zhang, Y.H. You, Y.N. Wu, Biomed. En i on. Sci. 21 (2008) 53- 427 62. 428 [31] Regula ion (EC) No 1830/2003 o he Eu opean Pa liamen and o he Council o 429 22 Sep embe 2003 conce ning he aceabili y o ood and eed p oduc s p oduced om 430 gene ically modi ied o ganisms and amending Di ec i e 2001/18/EC. O J Eu Union L 431 166:9–15. 432 433 434 16 FIGURE CAPTIONS 435 Figu e 1. RPA-ELISA op imiza ion: e ec o di e en expe imen al a iables on op ical in ensi y 436 (A) Coa ing condi ions (s ep a idin and p obe concen a ions); (B) Hyb idisa ion ime; (C) Hyb idisa ion 437 empe a u e; (D) Hyb idisa ion solu ion (dilu ion RPA solu ion and o al olume); (E) De eloping agen 438 dilu ion (dilu ion o an i-Dig-HRP an ibody); (F) De eloping ime (an ibody incuba ion). Signal 439 co esponds o 1.5 ng o a ge genomic DNA. 440 441 Figu e 2. Compa ison o de ec ion s a egies o RPA p oduc s. B -p obe: bio inila ed p obe; an i- 442 Dig: an i-digoxigenin an ibody p oduced in sheep; an i-sheep: an i-sheep an ibody; an i-Cy5: an i-Cy5 443 an ibody p oduced in mouse; an i-mouse: an i-mouse an ibody; HRP ho se adish pe oxidase; AP: alkaline 444 phospha ase. Signal co esponds o he sensi i i y o each o ma (calcula ed in CFU/mL), de e mined by 445 analysing se ially dilu ed DNA ex ac s om Salmonella spp. 446 447 Figu e 3. Naked-eye esul s o comme cial ood samples in mic opla es. Each sample ( ow) is 448 es ed o each analy e (columns): (1) hazelnu ; (2) peanu ; (3) soybean; (4) oma o; (5) maize; (6) P35S; 449 (7) TNOS; (8) Samonella spp.; (9) C onobac e spp.; (10) Fusa ium spp. Highligh ed ec angles indica e 450 posi i e samples (abso bance > cu -o alue). 451 452 TABLE CAPTIONS 453 Table 1. The p ime s, p obes, and con ol sequences used o ampli ica ion p ocedu es 454 455 Table 2. Compa ison o limi s o de ec ion and ep oducibili y ob ained by RPA-ELISA and PCR- 456 ELISA 457 458 Table 3. Sc eening esul s o he analy es in comme cial ood samples analysed by RPA-ELISA 459 460 17 GRAPHICAL ABSTRACT 461 462 S ep a idin Conjuga ed an ibody P obe Ta ge DNA ISOTHERMAL AMPLIFICATION RPA-ELISA 18 Figu e 1. 463 464 0 0.002 0.02 0.2 2 0 0.2 2 20 200 S ep a idin (mg L-1) P obe (nM) A 0.8-1.0 0.6-0.8 0.4-0.6 0.2-0.4 0.0-0.2 Abs 450/650 nm B 0.0 0.2 0.4 0.6 0.8 1.0 010 20 30 40 50 60 Time (min) Abs 450/650 nm C 0.0 0.2 0.4 0.6 0.8 1.0 25 30 35 40 45 50 Tempe a u e (ºC) Abs 450/650 nm 0 12.5 25 50 100 150 200 1/5000 1/2500 1/1000 1/500 1/100 1/50 Volume (µL) RPA p oduc dilu ion D 0.8-1.0 0.6-0.8 0.4-0.6 0.2-0.4 0.0-0.2 Abs 450/650 nm E 0.0 0.2 0.4 0.6 0.8 1.0 1/20000 1/10000 1/8000 1/6000 1/4000 1/2000 1/1000 an i-Dig-HRP dilu ion Abs 450/650 nm F 0.0 0.2 0.4 0.6 0.8 1.0 0 5 10 15 20 25 30 De eloping ime (min) Abs 450/650 nm 465 466 19 Figu e 2 467 468 20 Figu e 3 469 1 2 3 4 5 6 7 8 9 10 Muesli cookies Ke chup Soup Powde ed in an o mula Nega i e con ol Posi i e con ol 1 2 3 4 5 6 7 8 9 10 Muesli cookies Ke chup Soup Powde ed in an o mula Nega i e con ol Posi i e con ol 470 471 21 Table 1. 472 Ta ge Sequence 5’-3’ Tm (ºC) Amplicon size (bp) Re e ence Hazelnu FP Dig-ACTACATAAAGCAAAAGGTTGAAG 53.5 109 [4] Co a1 gene RP TCGTAATTGATTTTCTCCAGTTTG 55.2 P obe B nTg-TTTTTCGGACAAAGCATCGCCTTCAATCA 67.1 Peanu FP Dig-CTAGTAGCCCTCGCCCTTTT 59.9 82 [4] A a h2 gene RP GGCATCTTCTGTCTCCTTGG 59.8 P obe B nTg-TTTTTAGTTCCCACTGCTGCCTC 62.6 Soybean FP Dig-TCCACCCCCATCCACATTT 59.2 81 [4] Le gene RP GGCATAGAAGGTGAAGTTGAAGGA 58.8 P obe B nTg-TTTTTTTTTTCGAAGCTGGCAACGCTACCGGTT 74.1 Toma o FP Dig-AGACCACGAGAACGATATTTGC 66.8 92 [25] La 52 gene RP TTCTTGCCTTTTCATATCCAGACA 58.4 P obe B nTg-TTTTTACTCTCTTTGCAGTCCTCCCTTGGG 57.6 Maize FP Dig-CGTCGTTTCCCATCTCTTCCTCC 64.2 136 [26] adh 1 gene RP CCACTCCGAGACCCTCAGTC 63.5 P obe B nTg-TTTTTCCTCACCAGTTACGAAACCAATCGATCCAA 67.1 GMO p omo e FP Dig-CCACGTCTTCAAAGCAAGTGG 59.8 132 [27] 35S gene RP TCCTCTCCAAATGAAATGAACTTCC 59.7 P obe B nTg-TTTTTTTATATAGAGGAAGGGTCTTGCGAAGGATA 64.8 GMO e mina o FP Dig-GCATGACGTTATTTATGAGATGGG 59.3 118 [27] NOS gene RP GACACCGCGCGCGATAATTTATCC 64.4 P obe B nTg-TTTTTTTTGCGCGCTATATTTTGTTTTCTATCGCG 64.8 Salmonella spp. FP Dig-TACCAAAGCTAAACGCGCAGCT 62.1 152 [8] hns gene RP TGATCAGGAAATCTTCCAGTTGC 61.1 P obe B nTg-TTTTTTTTTTTTTGATTACAGCCGGTGTACGACCCT 75.9 C onobac e spp. FP Dig-GTTGGATCACCTCCTTACCTGC 64.2 190 [8] 16S-23S DNA gene RP AGTTAAACCTCTTCAACTCCTG 58.4 P obe TGTGAGCACGCGAGGTTGTATCTTGCA-TTTTTTTTTT-B nTg 64.0 Fusa ium spp. FP Dig-CCGAGTTTACAACTCCCAAA 62.7 180 [5] ITS 1 gene RP ACAGAGTTTAGGGGTCCTCT 58.4 P obe B nTg-TTTTTTTTTTTTACCGGGAGCGGGCTGAT 67.4 Posi i e con ol P obe Dig-TTTTTTTTTTTTTTTGTCATGGGCCTCGTGTCGGAAAACC-B nTg 81.0 Nega i e con ol P obe B nTg-ACCGTCGCGCACTATCTGATTTCAAA 73.3 FP: o wa d p ime , RP: e e se p ime , Dig: digoxigenin-labelled, B n-Tg: bio in labelled 473 474 22 Table 2. 475 RPA-ELISA PCR-ELISA Hazelnu (µg g-1)* 1.29 5.80 Peanu (µg g-1) 11.21 13.27 Soybean (µg g-1) 2.01 1.47 Toma o (µg g-1) 9.45 6.63 Maize (µg g-1) 14.36 2.00 Limi o de ec ion P35S (µg g-1) 8.36 1.24 TNOS (µg g-1) 19.74 6.69 Salmonella spp. (CFU mL-1) 6.00 5.00 C onobac e spp. (CFU mL-1) 13.00 12.00 Fusa ium spp. (µg g-1) 5.93 31.96 Mean Rep oducibili y** (%) In a-day 1.4 - 6.6 3.4 - 7.2 In e -day 7.9 - 11.3 8.5 - 14.5 * µg g-1 e e s o µg o analy e pe g o ood 476 ** Rep oducibili y was calcula ed om he samples con aining 0.1 % o analy e (n=3) 477 478 23 Table 3. 479 Decla ed analy ea / De ec ed analy ec Spiked analy eb / De ec ed analy ec Food Hazelnu Peanu Soybean Toma o Maize P35S TNOS S. spp C. spp F. spp Muesli cookies + / ++ - / nd + / + - / nd ± / + <0.9% / + <0.9% / + - / nd - / nd 10% / +++ Chocola e wa e ± / + + / + ± / + - / nd - / nd <0.9% / nd <0.9% / nd 4·101 / + - / nd - / nd Ke chup - / nd - / nd - / nd + / ++ + / ++ <0.9% / nd <0.9% / nd 4·103 / ++ - / nd 0.1% / + Feed - / nd - / nd - / nd - / nd + / + + / ++ + / + 4·104 / +++ - / nd 1% / ++ Toma o - / nd - / nd - / nd + / +++ - / nd + / ++ + / ++ 4·103 / ++ 4·102 / ++ - / nd Baby ood - / nd - / nd - / nd - / nd + / +++ <0.9% / nd <0.9% / nd 4·104 / +++ - / nd 10% / +++ Soup - / nd - / nd ± / + - / nd - / nd <0.9% / nd <0.9% / nd 4·102 / ++ 4·102 / ++ - / nd Skimmed powde ed milk - / nd - / nd - / nd - / nd - / nd <0.9% / nd <0.9% / nd 4·102 / ++ 4·104 / +++ - / nd Powde ed in an o mula - / nd - / nd - / nd - / nd - / nd <0.9% / nd <0.9% / nd 4·104 / +++ 4·103 / +++ - / nd CRM (RRS 5%) - / nd - / nd + / +++ - / nd - / nd + / ++ + / + - / nd - / nd - / nd CRM (B 11 Maize 5%) - / nd - / nd - / nd - / nd + / +++ + / ++ + / + - / nd - / nd - / nd Swee co n - / nd - / nd - / nd - / nd + / +++ <0.9% / nd <0.9% / nd - / nd - / nd 1% / ++ a Decla ed: + analy e lis ed; - analy e no lis ed; ± may con ain ace le els; <0.9% labelling no equi ed (GMO-EU egula ion). 480 b Spiked analy e co espond o Salmonella spp. (S. spp), C onobac e spp. (C. spp), and Fusa ium spp. (F. spp). 481 c Used code: +, de ec ed a low le el; ++, de ec ed a medium le el; +++, de ec ed a high le el; nd, non de ec ed. 482 483