scieee AI-readable full text Open interactive document viewer

Targeted gene modification in Fragaria vesca mediated by CRISPR/Cas9 system

Martín-Pizarro, Carmen,Posé-Padilla, David

Abstract

Genome editing is becoming an important biotechnological tool for gene function analysis and crop improvement, being the CRISPR-Cas9 (Clustered Regularly Interspaced Short Palindromic Repeat-CRISPR associated protein 9) system the most widely used. The natural CRISPR/Cas9 system has been reduced to two components: a single-guide RNA (sgRNA) for target recognition via RNA-DNA base pairing, which is commonly expressed using a promoter for small-RNAs (U6 promoter), and the Cas9 endonuclease for DNA cleavage (1). To validate the CRISPR/Cas9 system in strawberry plants, we designed two sgRNAs directed against the floral homeotic gene APETALA3 (sgRNA-AP3#1 and sgRNA-AP3#2). This gene was selected because ap3 mutations induce clear developmental phenotypes in which petals and stamens are missing or partially converted to sepals and carpels respectively (2). In this work, we used two different U6 promoters to drive the sgRNA-AP3s expression: AtU6-26 from Arabidopsis (4), and a U6 promoter from Fragaria vesca (FvU6) (this work). We also tested two different coding sequences of Cas9: a human- (hSpCas9) (3) and a plant-codon optimized (pSpCas9) (this work). Transient expression experiments using both CRISPR/Cas9 systems (AtU6-26:sgRNA-AP3#1_35S:hSpCas9_AtU6-26:sgRNA-AP3#2 and FvU6:sgRNA-AP3#1_35S:pSpCas9_FvU6:sgRNA-AP3#2) were performed infiltrating Agrobacterium tumefaciens into F. vesca fruits. PCR amplification and sequencing analyses across the target sites showed a deletion of 188-189 bp corresponding to the region comprised between the two cutting sites of Cas9, confirming that the CRISPR/Cas9 system is functional in F. vesca. Remarkably, the two systems showed different mutagenic efficiency that could be related to differences in expression of the U6 promoters as well as differences in the Cas9 transcripts stability and translation. Stable transformants for both F. vesca (2n) and Fragaria X anannassa (8n) are currently being established to test whether is possible to obtain heritable homozygous mutants derived from CRISPR/Cas9 strategies in strawberry. Thus, our work offers a promising tool for genome editing and gene functional analysis in strawberry. This tool might represent a more efficient alternative to the sometimes inefficient RNAi silencing methods commonly used in this species.

Full text

Introduction Results Targeted gene modification in Fragaria vesca mediated by the CRISPR/Cas9 system Carmen Martín-Pizarro1, David Posé1 1. Ins&tuto*de*Hortofru&cultura*Subtropical*y*Mediterránea,*Universidad*de*Málaga–Consejo*Superior*de*Inves&gaciones*CienAficas,* Departamento*de*Biología*Molecular*y*Bioquímica,*Facultad*de*Ciencias,*Universidad*de*Málaga,*29071*Málaga,*Spain.! Genome! edi)ng! is! becoming! an! important! biotechnological! tool! for! gene! func)on! analysis! and! crop! improvement,! with! the! CRISPR/Cas9! (Clustered! Regularly! Interspaced! Short! Palindromic! RepeatBCRISPR! associated! protein! 9)! system! being! the! most! widely! used! mechanism.! The! natural! CRISPR/Cas9! system! has! been! reduced!to!two!components:!a!singleBguide!RNA!(sgRNA)!for!target!recogni)on!via!RNABDNA!base!pairing,!which!is!commonly!expressed!using!a!promoter!for!smallB RNAs!(U6!promoter),!and!the!Cas9!endonuclease!for!DNA!cleavage!(1).!! To!op)mize!the!CRISPR/Cas9!system!for!strawberry!plants,!we!generated!constructs!using!a!U6!promoter!from!the!woodland!strawberry!(Fragaria*vesca).!We!also! engineered! the! coding! sequence! for! the! Streptococcus* pyogenes!Cas9* endonuclease! (SpCas9)! by! modifying! it! to! match! the! plant! codon! usage! frequencies.! To! validate! the! CRISPR/Cas9! system! in! F.* vesca,! we! designed! sgRNAs! directed! against! the! floral! homeo)c! gene! APETALA3.! This! gene! was! selected! because! ap3! muta)ons!induce!clear!developmental!phenotypes!in!which!petals!and!stamens!are!missing!or!par)ally!converted!to!sepals!and!carpels,!respec)vely!(2)!.!!! ! Fwd! Rvse! PAM! PAM! Cut! sgRNA#1! sgRNA#2! 189!bp!Cut! Exon!1! Exon!2! Exon!3! Wt!amplicon!! (512!bp)! Mut.!amplicon!! (323!bp)! 51,8%! (N:!27/14)! 26,9%! (N:!26/7)! 512!bp! 323!bp! ··AATCCACGAGTATATTAGCCCTACCA····················TCTATGGAGCTCGCACTACGAGGTGA·· 0 (WT) ··AATCCACGA------------------------------------------------------ACGAGGTGA·· -189 ··AATCCACGAG-----------------------------------------------------ACGAGGTGA·· -188 ··AATCCACGA-----------------------------------------------------TACGAGGTGA·· -188 189!pb! Target!#1! Target!#2! Del!size! 2.#Target#selec-on,#construct#design#and#transient# expression.### Fig.! 1.! (A)! Alignment! of! the! commonly! used! U6T26! promoter! from* Arabidopsis* thaliana* (AtU6B26)! (3)! with! the! orthologous! U6! promoters! from! Fragaria* vesca.* Yellow!and!red!boxes:!conserved!promoter!domains.!Grey!box:!U6!sRNA!sequence.! The!FvU6TIII!promoter!was!selected!for!our!construct.! (B)!Comparison!of!the!codon!usage!frequency!for!the!op)mized!human!hSpCas9! endonuclease!(4)!with!the!pSpCas9!endonuclease!for!plants!that!we!engineered!for! this!study.! (A)!(B)! 1.#Selec-on#of#the#U6#promoter#from#Fragaria&vesca& and#plant#codon#usage#op-miza-on#of#Streptococcus& pyogenes#Cas9&endonuclease#(SpCas9).# (C)! (D)! Fig.!2!(A).!Arabidopsis!ABCE!model.!The!floral!homeo)c!gene!APETALA3*was! selected! as! the! target! for! mutagenesis.! (B)! Gene! structure! of! FvAP3! (gene14896)!and!posi)ons!of!the!two!sgRNAs!designed!for!this!work.!Grey! boxes:!exons,!black!lines:!introns.!(C)! !Vectors!used!in!this!work.!The!first! one! (AtU6B26/hspCas9)! expresses! the! two! sgRNAs! under! the! AtU6T26! promoter! and! uses! the! human! hSpCas9.! The! second! vector! (FvU6BIII/ pSpCas9)! expresses! the! sgRNAs! under! the! FvU6BIII! promoter! and! includes! the! engineered! pSpCas9.! (D)! To! induce! transient! expression,! the! vectors! were! transformed! into! Agrobacterium* tumefaciens* and*infiltrated! into! F.* vesca!fruits!using!a!syringe.! 3.#Mutagenesis#(dele-on)#efficiency#analyses#by# PCR#and#sequencing.!!! (A)! (B)! (C)! Fig.! 3.! (A)! Diagram! of! the! FvAP3! gene.! Orange! arrows! indicate! the! two! targets! (sgRNAs);! blue! square:! PAM! sequence.! Cas9! endonuclease! cuts! 3! nts!upstream!of!the!PAM!sequence.!Cut!sites!are!displayed.!Purple!arrows:! primers! used! to! amplify! the! region! expected! to! be! deleted.! Expected! amplicon!sizes!for!the!WT!and!the!mutant!are!shown.! (B)! Gel! electrophoresis! of! PCR! in! independent! fruits! using! the! flanking! primers!shown!in!(A)!for!the!two!vectors!and!a!nega)ve!control!(CB;!agroB infiltrated!fruits!with!a!vector!harbouring!35S:Cas9!but!without!the!sgRNA! cassede).!512!bp!band:!wt!allele;!323!bp!band:!mutant!allele.!This!result! shows! that! the! CRISPR/Cas9! dele)on! system! works! during! transient! expression! in! F.* vesca! fruits,! but! there! is! limited! transforma)on! and/or! mutagenesis! efficiency,! as! evidenced! by! the! strong! presence! of! the! wt! band.!Percentage!of!fruits!with!each!specific!amplifica)on!padern!and!total! number!of!fruits!are!shown!at!the!bodom.!A!lower!percentage!of!dele)on! was!obtained!with!FvU6TIII/pSpCas9!vector.! (C)! Sequences! of! the! mutant! amplicons!from!AtU6T26/hSpCas9! fruits.! Three! different! types! of! dele)on! were! found.! Cas9! cut! either! 3! or! 4! nts! upstream!of!the!PAM!sequences!(blue!box).! 4.#Transcript#and#protein#levels#for#Cas9#variants.### 5.#Expression#analysis#for#U6#promoters# (A)! (B)! Fig.!4.!(A)!(Top)!Detec)on!of!the!Cas9!variant!proteins!by!WesternBblot!analysis!of! the!infiltrated!fruits!that!showed!a!dele)on!in!FvAP3.!The!hSpCas9!protein!was! detected,!but!the!pSpCas9!protein!was!not.!(BoYom)!Loading!control!for!nuclear! protein!extrac)on.!(B)!(Top)!Cas9!expression!analysis!by!semiquan)ta)ve!RTBPCR.! The!hSpCas9!mRNA!was!detected,!pSpCas9!showed!only!weak!expression!in!one! sample.!This!result!explains!the!absence!of!pSpCas9!protein.!(BoYom)!FaCHP1*is! shown!as!a!loading!control.! Fig.!5.!RTBqPCR!analysis!of!the!expression!of!sgRNAs!under!the!AtU6T26*and! FvU6TIII* promoters.! 15! independent! fruits! infiltrated! with! each! construct! and! a! nega)ve! control! were! analysed.! Stronger! expression! and! a! greater! percentage!of!fruits!expressing!the!sgRNAs!were!achieved!using!the!FvU6TIII* promoter.!FaCHP1*was!used!as!housekeeping!gene.! References 1.Jinek!M,!et!al!(2012)!A!programmable!dualBRNABguided!DNA!endonuclease!in!adap)ve!bacterial!immunity.!Science.!337(6096):!816B821.!!! 2.Yang!Y,!et!al!(2003)!pis)llataB5,!an!Arabidopsis!B!class!mutant!with!strong!defects!in!petal!but!not!in!stamen!development.!Plant!J.!33(1):177B188.! !! 3.Cong!L,!et!al!(2013)!Mul)plex!genome!engineering!using!CRISPR/Cas!systems.!Science.!339(6121):819B823.!! 4.Feng!Z,!et!al!(2013)!Efficient!genome!edi)ng!in!plants!using!a!CRISPR/Cas!system.!Cell.!Res.!23(19):1229B1232.!! APETALA3& PISTILLATA* APETALA1* APETALA2* SEPALLATA1T4* AGAMOUS* SEPALS! PETALS! STAMENS! CARPELS! (A)! sgRNA#1! sgRNA#2! Exon!1! 2! 3! 4! 5! FvAP3:!gene14896! (B)! AtU6T26/hSpCas9* FvU6TIII/pSpCas9* Wt!amplicon! Mut.!amplicon! Rela)ve!expression! Conclusions and perspectives Our! results! show! that! the! CRISPR/Cas9! mutagenesis!system!is!func)onal!in!F.*vesca.*The! mutagenic! efficiency! was! higher! for! AtU6T26/ hSpCas9!than!FvU6TIII/pSpCas9,* which! we! adribute!to!impaired!pSpCas9!transcript!stability.! Nonetheless,! the! FvU6TIII! promoter! showed! a! higher! expression! level! than! AtU6T26,! which! will! allow!us!to!further!op)mize!the!system.!We!are! currently!establishing!stable!transgenic!lines!using! both!the!AtU6T26!and!FvU6TIII!promoters!to!drive! expression!of!the!sgRNAs!using!only!the!hSpCas9* endonuclease.! Our! work! offers! a! promising! tool! for! genome! edi)ng! and! the! func)onal! analysis! of! genes! in! strawberry.! This! tool! might! represent! a! more! efficient! alterna)ve! to! the! some)mes! inefficient! RNAi! silencing! methods! commonly! used! in! this! species.!! AtU6B26! sgRNA#1! 35S! 3xFLAG! NLS! hSpCas9! NLS! AtU6B26! Nos!ter!! sgRNA#2! FvU6BIII! sgRNA#1! 35S! 3xFLAG! NLS! pSpCas9! NLS! FvU6BIII! Nos!ter!! sgRNA#2! 164!kDa! FLAGBCas9! !!!!!!!1!!!!!!!!!2!!!!!!!!3!!!!!!!!4! !!!!!!!1!!!!!!!!!!2!!!!!!!!!!3!!!!!!!!!4! AtU6T26/hSpCas9* FvU6TIII/pSpCas9* Loading! control! FaCHP1* Cas9* 114/133!bp! 91!bp! 0! 2000! 4000! 6000! 8000! 10000! 12000! Nega)ve!control! 1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 13! 14! 15! 1! 2! 3! 4! 5! 6! 7! 8! 9! 10! 11! 12! 13! 14! 15! AtU6B26:sgRNA#1_35S:hSpCas9_AtU6B26:sgRNA#2! FvU6BIII:sgRNA#1_35S:pSpCas9_FvU6BIII:sgRNA#2! sgRNA!#1! sgRNA!#2! FvU6TIII/pSpCas9*AtU6T26/hSpCas9* Aminoacid! Codon! Frequency! hSpCas9! Frequency! pSpCas9! ALA! GCT! 2,9! 25,0! GCA! 2,1! 15,0! GCC! 50,7! 8,6! GCG! 0,7! 7,9! CYS! TGT! 0,0! 0,7! TGC! 1,4! 0,7! ASP! GAT! 13,6! 47,8! GAC! 57,1! 22,8! GLU! GAA! 26,4! 40,0! GAG! 50,7! 37,1! PHE! TTT! 8,6! 22,8! TTC! 36,4! 22,1! GLY! GGA! 8,6! 19,3! GGT! 0,7! 17,1! GGG! 2,1! 7,9! GGC! 40,0! 7,1! HIS! CAT! 0,7! 14,3! CAC! 22,8! 9,3! ILE! ATT! 7,1! 27,1! ATC! 60,0! 23,6! ATA! 0,0! 16,4! LYS! AAG! 87,8! 60,0! AAA! 27,1! 55,0! LEU! CTT! 0,0! 35,0! TTG! 0,0! 29,3! CTC! 2,1! 18,6! TTA! 0,0! 0,0! CTG! 103,5! 11,4! CTA! 0,0! 11,4! MET! ATG! 15,7! 15,7! ASN! AAT! 9,3! 25,7! AAC! 40,7! 24,3! PRO! CCT! 5,7! 10,0! CCA! 2,1! 9,3! CCG! 0,7! 5,0! CCC! 18,6! 2,9! GLN! CAA! 1,4! 21,4! CAG! 36,4! 16,4! ARG! AGA! 20,7! 12,8! AGG! 3,6! 16,4! CGT! 0,0! 11,4! CGA! 0,0! 0,0! CGG! 30,0! 0,0! CGC! 2,1! 15,7! SER! TCT! 5,0! 15,0! TCA! 0,0! 10,7! AGT! 0,7! 8,6! AGC! 33,5! 7,1! TCC! 15,0! 7,1! TCG! 0,0! 5,7! THR! ACT! 0,7! 16,4! ACA! 6,4! 14,3! ACC! 39,3! 9,3! ACG! 0,7! 7,1! VAL! GTT! 0,0! 22,1! GTG! 50,7! 13,6! GTC! 2,9! 10,0! GTA! 0,0! 7,9! TRP! TGG! 5,0! 5,0! TYR! TAT! 5,0! 20,0! TAC! 34,3! 19,3! END! TGA! 0,0! 0,7! TAA! 0,7! 0,0! TAG! 0,0! 0,0!