A mechanism of RGS14(414)-mediated recovery of an episodic memory loss: implication of GluR2 subunit of AMPA receptor
Full text
Cover
AUTOR: Mariam Al-Masmudi Martín https://orcid.org/0000-0001-5005-9199 EDITA: Publicaciones y Divulgación Científica. Universidad de Málaga Esta obra está bajo una licencia de Creative Commons Reconocimiento-NoComercialSinObraDerivada 4.0 Internacional: Cualquier parte de esta obra se puede reproducir sin autorización pero con el reconocimiento y atribución de los autores. No se puede hacer uso comercial de la obra y no se puede alterar, transformar o hacer obras derivadas. http://creativecommons.org/licenses/by-nc-nd/4.0/legalcode Esta Tesis Doctoral está depositada en el Repositorio Institucional de la Universidad de Málaga (RIUMA): riuma.uma.es
FACULTAD DE MEDICINA Ph.D. Thesis Programa de Doctorado: Neurociencia y sus Aplicaciones Clínicas A mechanism of RGS14414-mediated recovery of an episodic memory loss: implication of GluR2 subunit of AMPA receptor Mariam Al-Masmudi Martín Lab. Neurobiología, CIMES, UMA Thesis supervisor: Dr. Zafaruddin Khan Málaga, 2015
Supervisor certificate Dr. Zafaruddin Khan, Director del laboratorio de Neurobiología de Centro de Investigaciones Médico Sanitarias y Profesor del departamento de Medicina y Dermatología de la facultad de Medicina de la Universidad de Málaga, INFORMA Que Doña Mariam Al-Masmudi Martín, Licenciada en Biología por la Universidad de Málaga, ha realizado bajo su dirección el trabajo experimental que ha llevado a la redacción de la presente memoria de Tesis Doctoral, titul ada “A mechanism of RGS14414-mediated recovery of an episodic memory loss: implication of GluR2 subunit of AMPA receptor”. Considerando que constituye trabajo de Tesis Doctoral, se autoriza su presentación para optar al Grado de Doctor. Y para que así conste y surta los efectos oportunos, se firma el presente documento en Málaga, a 30 de septiembre de 2015. Fdo.: Zafaruddin Khan
Agradecimientos Acknowledgements Después de más de 5 años de trabajo y dedicación a la realización de esta tesis doctoral, llega el momento de echar la mirada hacia atrás para recordar y agradecer a cada una de las personas a las que he tenido la suerte de conocer durante estos años y que han hecho posible, de una manera u otra, haber logrado culminar esta importante etapa de mi vida. Por ello he de dar las gracias… A mi director de tesis el Dr. Zafaruddin Khan por haberme dado la oportunidad de formar parte de su grupo de investigación, por depositar en mí su confianza así como por el apoyo y ayuda brindados a la hora del desarrollo de este trabajo de tesis. A los distintos grupos de investigación con los que hemos tenido la oportunidad de colaborar. Al grupo del Dr. Zafar Bashir, del departamento de fisiología y farmacología de la Universidad de Bristol, en especial a los Doctores Paul y Francesco por poner a mi disposición todo aquello que necesité para mi formación durante mi estancia de 7 meses en Reino Unido, por su amabilidad y por estar siempre dispuestos a ayudar. Gracias a vosotros pude sumergirme en el mundo de la electrofisiología y obtener parte de los resultados presentados en este trabajo de tesis. Al Dr. David Fernández de Sevilla, del departamento de Anatomía, Histología y Neurociencia de la Facultad de Medicina de la Universidad Autónoma de Madrid, por todo el conocimiento aportado en cuanto a técnicas de electrofisiología e imagen de calcio que han sido de gran ayuda a la hora de interpretar algunos de los datos que aparecen en esta tesis, en especial a los componentes de su grupo, José y Laura por haberme acogido en su laboratorio con los brazos abiertos y haberme hecho sentir como una más del grupo durante mi estancia en Madrid. Al grupo del Dr. Robert Nisticó por cederme parte de los datos de electrofisiología referentes a los experimentos de despotenciación, los cuales forman parte de este manuscrito. A los distintos grupos de investigación con los que he tenido la oportunidad de aprender y enriquecerme profesionalmente. A la Dra. Antonia Gutiérrez y a su grupo; Eli, Laura, Raquel, Mercedes y Vanesa entre otros, por haberme aportado parte de los conocimientos que he adquirido en las técnicas de histología y por estar siempre dispuestas a ayudar en todo momento. Al la Dra. Alicia Rivera y a su grupo; por cedernos parte del material de estereotaxia, en especial a Alejandra por todos los consejos aportados sobre la técnica de Western Blot. Al grupo del Dr. Javier Márquez, en especial a Carolina Cardona por su tiempo dedicado a enseñarme el revelado con ECL. Al grupo del Laboratorios de lípidos, a José Rioja y María José por haber estado siempre dispuestos a cedernos amablemente sus equipos. A Irene, Juan y Gloria, “Mi chupipandi”. A Irene, mi “irenilla”, porque sin tu apoyo no hubiese conseguido llegar hasta aquí, porque siempre he podido contar contigo desde el primer momento que empezamos juntas esta aventura, porque has estado siempre dispuesta ayudarme y enseñarme sin esperar nada a cambio, aunque eso significara quedarte hasta muy tarde en el laboratorio o incluso venir un fin de semana o un festivo desde Álora. Sólo por haber tenido la oportunidad de conocerte ha merecido la pena haber iniciado este proyecto, porque en ti no solo encontré a la mejor de las compañeras y maestras sino también a mi mejor amiga. Espero seguir disfrutando de tu compañía y la de Pedro por mucho tiempo. A Juan, mi “pareja artística” por haber sido un pilar muy importante en esta etapa, porque gran parte de lo que sé lo aprendí gracias a ti (Cultivos celulares, Inmunohistoquímica, Biología molecular…), porque
siempre has estado dispuesto a ayudarme y a guiarme en este largo camino incluso desde la distancia. Gracias a ti he podido crecer como investigadora y potenciar en mí ese instinto curioso que te caracteriza. Te debo mucho Juan, te estaré eternamente agradecida. A Gloria, nuestra “mami” en el laboratorio, por haber estado pendiente siempre tanto de Irene como de mí, porque con tu llegada al laboratorio llego un aire de frescura y ternura. Gracias por todos los consejos y los ánimos brindados. A mis antiguos compañeros de laboratorio. A Manuel, por haberme ayudado en los inicios de mi carrera investigadora, haberme aportado parte de mis conocimientos en las técnicas de comportamiento y haber participado en los estudios de envejecimiento. A Sinforiano por su tiempo dedicado a enseñarme la técnica de qRT-PCR. A Eduardo por sus enseñanzas y consejos en el ámbito de la neuropsicobiología, todavía recuerdo aquellas largas horas realizando los experimentos conductuales de tacto y ese humor sarcástico tan particular en ti. A Elisa por ayudarme, guiarme y aconsejarme en todo momento a la hora de redactar la presente memoria de tesis doctoral y preparar la presentación con esa rigurosidad que te caracteriza. A las nuevas incorporaciones del laboratorio; Inma, Maria Elena, Lucía, María, Marta, Carlos y José, porque han hecho que esta última fase de escritura de la tesis haya sido mucho más llevadera y menos tediosa. Gracias por los buenos momentos y por todo vuestro apoyo. A Maria Jesús, “el miembro no oficial del grupo”, porque sin ti las largas horas en el estabulario no hubiesen sido lo mismo. Gracias por tu amistad. Espero poder seguir formando parte de tu vida y tú de la mía por mucho tiempo. Al personal del Estabulario, a Ricardo por siempre estar dispuesto ayudar y aportarme todos sus conocimientos en lo que se refiere al cuidado y manejo de animales de experimentación, a Ana, Eva, Conchi, Marivi, Vanesa, Isa, Sole y en especial a mi Soraya por su amabilidad, su colaboración y sus ánimos. Al personal del servicio de Biología celular y cultivos celulares del SCAI, en especial a Reme y Casimiro por toda la ayuda prestada a la hora de desarrollar mis experimentos. A Zouhir, por haber estado allí en todo momento, en los buenos y en los malos, apoyándome y animándome a seguir adelante, a no tirar nunca la toalla y recordándome siempre que era capaz de conseguir mis metas y sueños. Sin ti no hubiese podido llegar hasta aquí. Gracias por ser como eres y que sepas que parte de esta tesis va dedicada a ti. A todo el personal del CIMES, mi segunda casa, a Miguel, María Jesús, Raquel, Antonio, Jaime, José, Cárdenas, Guerra, Ricardo, Ana, Gema…por haber hecho más amena tantas horas de trabajo y haberme hecho sentir, valga la redundancia, “como en casa”, en especial a Gema por estar siempre pendiente y preocuparse tanto de Irene como de mí y por tantas tardes de risas. Y finalmente y no por ello menos importante, a mi familia, a mis padres y mis hermanitos porque aunque nunca llegaron a comprender del todo mi trabajo y mi dedicación a la investigación con sus correspondientes largas jornadas de trabajo sacrificando muchos fines de semana y días de vacaciones, siempre estuvieron allí apoyándome en todo momento desde la distancia y alegrándose de cada meta lograda por pequeña que fuera en este largo camino. Espero haber estado a la altura y haberos hecho sentir orgullosos. Esta tesis va dedicada a vosotros.
Dedication A mis padres y a mis hermanos
Abbreviations ACSF: artificial cerebrospinal fluid. AD: Alzheimer´s disease. AMPAR: α-amino-3-hydroxy-5-methyl-4isoxazolepropionic acid receptor. ANOVA: Analysis of variance. AP: anteroposterior. BSA: bovine serum albumin. CamKII: Ca2+ / calmodulin - dependent protein kinase II. CCh: carbachol. cDNA: complementary DNA. CFU: colony-forming unit. CNQX: 6-cyano-7-nitroquinolaxaline-2,3dione. CREB: cAMP response element-binding protein. Ct: threshold cycle. DABCO: 1,4-Diazabicyclo[2.2.2] octane. DI: discrimination index. DL-AP5: DL - 2 - Amino - 5 - phosphonopentanoic acid. DNA: deoxyribonucleic acid. DV: dorsoventral. ERK: extracellular signal-regulated kinase. fEPSP: field excitatory postsynaptic potential. Fr: frontal cortex. GAP: GTPase-activating protein. GDP: guanosine diphosphate. GluR1-4: ionotropic glutamate receptors (AMPA). GPCR: G protein-coupled receptor. GPR domain: G protein regulatory domain. GTP: guanosine triphosphate. HFS: high-frequency stimulation. JNK: c-Jun N-terminal kinase. KN62: 4-[(2S)-2- [(5-isoquinolinylsulfonyl) methylamino ]-3-oxo-3-(4phenyl-1-piperazinyl) propyl] phenyl isoquinolinesulfonic acid ester. LFS: low-frequency stimulation. LTD: long-term depression. LTP: long-term potentiation. LY367385: (S)-(+)-α-Amino-4-carboxy-2methylbenzeneacetic acid. mAChR: muscarinic cholinergic receptor. mACSF: modified artificial cerebrospinal fluid. MAPKK (MKK): mitogen-activated protein kinase kinase. MCS: multiple-cloning site. mGluR: metabotropic glutamate receptor. ML: mediolateral. mRNA: messenger RNA. MTL: medial temporal lobe.
NMDAR: N-methyl-D-aspartate receptor. OD: optical density. ORM: object recognition memory. PARP-1: poly[ADP]-ribose polymerase 1. PBS: phosphate buffered saline. PCR: polymerase chain reaction. PKA: cAMP-dependent protein kinase. PKC: calcium-dependent protein kinase. PKMζ: protein kinase Mζ. PLP: Periodate-lysine-paraformaldehyde. PRh: perirhinal cortex. qRT-PCR: quantitative reverse transcription PCR. RBD domain: Ras binding domain. RGS: regulator of G protein signaling. RNA: ribonucleic acid. Rpl19: ribosomal protein L19. TIQ-A: thieno[2,3-c]isoquinolin-5(4H)-one. U0126:1,4-diamino-2,3-dicyano-1,4-bis(o-aminophenylmercapto) butadiene. VDCC: voltage-dependent calcium channel. ZIP: z-Pseudosubstrate inhibitory peptide.
Table of contents I. INTRODUCTION .......................................................................................................... 9 1 Regulator of G protein signaling 14 (RGS14).............................................................. 11 2 RGS14414, a spliced variant of RGS14 .......................................................................... 13 2.1 Object recognition memory and RGS14414 ............................................................... 14 2.1.1 Object recognition memory (ORM) ................................................................... 14 2.1.2 Role of RGS14414 in the ORM ........................................................................... 14 3 Implication of perirhinal Hebbian synaptic plasticity in recognition memory ........ 15 3.1 The perirhinal projections ......................................................................................... 15 3.2 Hebbian synaptic plasticity in perirhinal cortex ....................................................... 15 3.3 LTP/LTD in recognition memory ............................................................................. 16 4 Memory loss in Alzheimer´s disease and aging ........................................................... 16 4.1 Aging ......................................................................................................................... 17 4.2 Alzheimer´s disease .................................................................................................. 17 5 Mechanism of memory enhancement ........................................................................... 18 II. OBJECTIVES............................................................................................................... 23 III. MATERIALS AND METHODS................................................................................. 27 1 First block of experiments: Explore the effect of RGS14414 gene treatment in recovery of an episodic memory loss ............................................................................ 29 1.1 Experimental design .................................................................................................. 29 1.1.1 Effect of RGS14 in aging ................................................................................... 29 1.1.2 Effect of RGS14 in transgenic mice with Alzheimer´s disease ......................... 30 1.2 Methods ..................................................................................................................... 30 1.2.1 Preparation of lentivirus ..................................................................................... 30 1.2.2 Animal housing conditions and stereotaxic surgery .......................................... 43 1.2.3 Confirmation of RGS14414 protein expression by immunohistochemistry ........ 45 1.2.4 ORM test ............................................................................................................ 46 2 Second block of experiments: Identify pathways implicated in RGS14414-mediated memory enhancement .................................................................................................... 48 2.1 Experimental design .................................................................................................. 48 2.2 Methods ..................................................................................................................... 51 2.2.1 Cannula implantation and lentivirus injection ................................................... 51 3 Third block of experiments: Determine relationship between memory enhancer effect of RGS14414 and AMPA receptors ..................................................................... 52 3.1 Experimental design .................................................................................................. 52 3.1.1 AMPA receptors mRNA quantification ............................................................. 53
3.1.2 GluR2 protein quantification ............................................................................. 53 3.2 Methods ..................................................................................................................... 53 3.2.1 Dissection of area V2 of visual cortex from rat brain ........................................ 53 3.2.2 qRT-PCR ............................................................................................................ 53 3.2.3 Western Blot ...................................................................................................... 59 4 Fourth block of experiments: Examine the effect of RGS14414 treatment on Hebbian synaptic plasticity in perirhinal cortex ......................................................................... 61 4.1 Experimental design .................................................................................................. 61 4.1.1 Effect of RGS14414 gene treatment in perirhinal cortex on ORM ..................... 62 4.1.2 Evaluation of RGS14-mediated effect on synaptic plasticity ............................ 62 4.2 Methods ..................................................................................................................... 63 4.2.1 Slice preparation and electrophysiology ............................................................ 63 5 Fifth block of experiments: Analyze brain areas implicated in RGS14-mediated memory enhancement .................................................................................................... 67 5.1 Experimental design .................................................................................................. 67 5.1.1 RGS14-mediated enhancement in ORM after treatment in either areas V2, perirhinal cortex or frontal cortex ...................................................................... 68 5.1.2 Study of dependence of brain areas implicated in RGS14-mediated ORM processing .......................................................................................................... 69 5.2 Methods ..................................................................................................................... 70 5.2.1 Cresyl violet staining ......................................................................................... 70 IV. RESULTS ...................................................................................................................... 71 1 Recovery of ORM loss by RGS14414 gene treatment in area V2 ................................ 73 1.1 Study in aging ........................................................................................................... 73 1.2 Study in Alzheimer´s disease .................................................................................... 74 2 Mechanism of memory enhancer activity of RGS14414 .............................................. 75 2.1 Implication of AMPA/Kainate receptors .................................................................. 76 2.2 A dynamic expression of AMPA receptors in RGS-animals .................................... 77 2.2.1 An increase in GluR2 and GluR4 gene expression ............................................ 77 2.2.2 Expression pattern of GluR2 protein during ORM processing .......................... 78 2.3 The relationship between ORM and synaptic plasticity in perirhinal cortex ............ 79 2.3.1 RGS14414-mediated ORM enhancement in perirhinal cortex ............................ 79 2.3.2 Study of synaptic plasticity ................................................................................ 80 3 Independent brain areas implicated in ORM processing ........................................... 86 3.1 RGS14 enhancer effect on ORM in area V2, perirhinal and frontal cortices ........... 86 3.2 Independent brain domains in ORM-processing ...................................................... 88 3.2.1 Independence of Area V2 in ORM .................................................................... 88 3.2.2 Independence of perirhinal cortex in ORM ....................................................... 90 3.2.3 Independence of frontal cortex in ORM ............................................................ 91 V. DISCUSSION ............................................................................................................... 93 1 Recovery of an episodic memory loss in aging and AD .............................................. 95
2 Effect of RGS14 is mediated through GluR2 .............................................................. 96 3 RGS14 does not facilitate the Hebbian synaptic plasticity ......................................... 98 4 Independent brain areas can promote RGS-mediated recovery of ORM loss ......... 99 5 Mechanism of RGS-mediated memory enhancement and recovery of ORM loss…100 VI. CONCLUSIONS......................................................................................................... 103 VII. REFERENCES ........................................................................................................... 107 VIII. APPENDICES ............................................................................................................ 121
I. Introduction
I. Introduction 11 1 Regulator of G protein signaling 14 (RGS14) Classically defined G protein signaling begins with a heterotrimeric G protein (Gαβγ) (Albert & Robillard 2002; Neves et al 2002) bound to a G protein-coupled receptor (GPCR). GPCR activation promotes guanosine diphosphate (GDP) release and subsequent guanosin e triphosphate (GTP) binding to activate Gα. Activation of Gα leads to dissociation/rearrangement of the heterotrimeric complex and allows Gα and Gβγ to interact with downstream effectors. As a GTPase, the α-subunit then rapidly initiates its own inactivation through GTP-hydrolysis and returns to its basal state (Gα-GDP), where it can bind Gβγ once more and reassociate with a GPCR (Gilman 1987; Hamm 1998; Hepler & Gilman 1992). This GTPase cycle of G protein activation and deactivation is subject to regulation by members of the regulators of G protein signaling (RGS) family. RGS proteins contain a canonical RGS domain of ≈ 120 amino acids, which binds activated G proteins and acts as a GTPase-activating protein (GAP) to catalyze GTP hydrolysis and accelerate the G protein cycle (De Vries et al 2000; Hollinger & Hepler 2002; Ross & Wilkie 2000; Woodard et al 2015) (figure 1). PM β γ GDP GPCR PM β γ GTP GPCR Agonist Gα Basal resting state G-protein activation GDPGTP Pi RGS Gα Figure 1. Diagrammatic representation of the activation of trimeric G proteins upon agonist binding to Gprotein-coupled receptors. GDP: guanosine diphosphate; GTP: guanosine triphosphate; GPCR: G proteincoupled receptor; PM: plasma membrane; Pi: phosphate; RGS: regulator of G-protein signaling.
I. Introduction 18 Amyloid-beta protein (Aβ) has been shown to inhibit LTP, while enhancing LTD in rodents (Cheng et al 2009; Kim et al 2001; Li et al 2009; Shankar et al 2008). However, negative effects of Aβ on LTP seem to be highly concentration dependent, as low Aβ levels can actually facilitate the maintenance of LTP (Puzzo et al 2011; Puzzo et al 2008). Furthermore, LTP studies on transgenic mouse models for AD have unfortunately generated mixed and often contradictory results. Several groups have shown a decrease in LTP (Chong et al 2011; Gong et al 2004; Knobloch et al 2007; Saganich et al 2006; Sydow et al 2011; Trinchese et al 2004), while others have reported unaltered LTP (Chapman et al 1999; Fitzjohn et al 2010; Gureviciene et al 2004; Harris et al 2010; Marchetti & Marie 2011; Palop et al 2007). 5 Mechanism of memory enhancement Very little is known about the mechanism that underlies RGS14414 protein-mediated memory enhancement. Previously, an in vitro study has demonstrated the participation of RGS14414 protein in regulation of intracellular Ca2+ levels (Martin-Montanez et al 2010), a process considered essential for synaptic plasticity and memory formation (for review see (Baker et al 2013). With the use of two different cell lines of neuronal origin and two different Ca2+ measurement methods, we found that the expression of RGS14414 protein into these cell lines substantially reduced Ca2+ influx and that this reduction in Ca2+ was mediated through nifedipine-sensitive Cav1 channels. Though, it remains to be shown how preventing higher Ca2+ levels into cytoplasm by reducing Ca2+ influx through Cav1 channels can translate into memory enhancement. However, in contrast to RGS14414, an extraordinary progress has been made in the understanding of mechanisms that are engaged in memory processing (for review see (Lee & Silva 2009; Stern & Alberini 2013). Given the vast literature on pharmacological compounds or approaches that modulate memory, it is not feasible to cite every possible pathway. Instead we will focus on some that will become part of this thesis work. α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors. AMPA receptors are cation-permeable ionotropic glutamate receptors and they are expressed throughout the brain (Beneyto & Meador-Woodruff 2004). The four AMPA receptor subunits (GluA1-GluA4 or GluR1-GluR4) are highly homologous (Collingridge et al 2004) and are assembled as dimers-of-dimers to form heterotetrameric receptors (Hollmann & Heinemann 1994; Traynelis et al 2010). Homotetrameric receptors have also been reported (Lu et al 2009;
I. Introduction 19 Wenthold et al 1996). There are evidences for the involvement of AMPA receptor endocytosis in perirhinal-dependent object memory processing in rats (Griffiths et al 2008; Winters & Bussey 2005). In addition, blockade of AMPA receptors in perirhinal cortex impairs ORM in macaques (Malkova et al 2015). GluR2 is the most abundant subunit of AMPA receptors in adult brain and majority of GluR2-containing AMPA receptors are largely Ca2+-impermeable (Greger et al 2003). They also show a lower single channel conductance (Cull-Candy et al 2006; Traynelis et al 2010) along with a slightly increased decay time. In contrast, GluR2-lacking AMPA receptors are Ca2+-permeable, and they bear a higher single channel conductance (Swanson et al 1997) with faster rise and decay kinetics. GluR2 plays a critical role in synaptic plasticity and memory (Cazakoff & Howland 2011; Mead & Stephens 2003; Migues et al 2010). On the other hand, GluR4 subunit expression is distributed throughout the central nervous system, but is relatively high in the hippocampus, cerebral cortex and the granule cells of the cerebellum (Keinanen et al 1990). In hippocampus, high GluR4 expression is largely restricted to the first postnatal week, and the GluR4 subunit mediates the delivery of GluR2-containing AMPA receptors (Zhu et al 2000). GluR4 knockout mice showed improved spatial working memory and no alteration in the LTP suggesting the involvement of GluR4 in cognitive function (Sagata et al 2010). N-methyl-D-aspartate (NMDA) receptors. NMDA receptors are heteromers (Dingledine et al 1999) and they are composed of two essential NR1 subunits (Behe et al 1995) and two or three NR2 subunits (Laube et al 1998; Premkumar & Auerbach 1997). There are four NR2 subunits (A-D), but NR2A and NR2B subunits predominate in forebrain. There are evidences for the implication of NMDA in ORM in perirhinal cortex of macaques (Malkova et al 2015) and rats (Abe et al 2004; Winters & Bussey 2005). Metabotropic glutamate (mGlu) receptors. The mGlu receptor family consists of eight receptor subtypes (mGluR1-8) and they are divided into: group I, which is comprised of mGluR1 and mGluR5; group II, which is composed of mGluR2 and mGluR3; group III, which includes mGluR4, mGluR6, mGluR7, and mGluR8. These groups are formed based on sequence homology, pharmacological profile, and implication into signal transduction pathways (Conn & Pin 1997). Previous studies have shown the role of group I and group II mGlu receptors in acquisition of long-term ORM, but not in the consolidation or retrieval (Barker et al 2006).
I. Introduction 20 Muscarinic cholinergic (mACh) receptors. mACh receptors belong to seven transmembrane G protein-coupled receptors superfamily and they are comprised of five subtypes, M1-M5 (Bonner et al 1987). It has been shown that inhibition of mACh receptors by antagonists causes disruption in ORM (Abe et al 2004; Tinsley et al 2011; Warburton et al 2003). Further studies have demonstrated that this memory impairment is produced by antagonism of muscarinic M1 receptors (Tinsley et al 2011). Voltage-dependent calcium (VDC) channels. VDC channels are subdivided into various subfamilies: L-type VDC channels (Cav1 family); T-type VDC channels (Cav3 family); P/Q-type, R-type and N-type VDC channels (Cav2 family) (Catterall et al 2005). Ltype VDC channels are major sites for calcium ion entry into neurons (Berger & Bartsch 2014; Chittajallu et al 1998). The transient inactivation of L-type VDC channels impairs fear conditioning passive avoidance learning, spatial memory and ORM (Bauer et al 2002; Borroni et al 2000; Lashgari et al 2006; Seoane et al 2009; Winters et al 2007; Woodside et al 2004). Protein kinase Mζ (PKMζ). P KMζ is a PKC isoform that contains a ζ catalytic domain without the N-terminal regulatory domain, rendering it constitutively active (Sacktor 2011). It is expressed exclusively in the brain and is enriched in the hippocampus and neocortex (Hernandez et al 2003; Oster et al 2004). PKMζ plays a role in maintenance of hippocampus-dependent memory (Hardt et al 2010; Hernandez et al 2003; Serrano et al 2008). This protein kinase exerts its function by blocking a GluR2-dependent pathway for removal of AMPA receptors from postsynaptic site and thus, it promotes continual localization of GluR2 at the synapse (Migues et al 2010). In contrast to many short-acting molecules involved in memory formation, PKMζ is unique in that, its persistent activity is critical for storage of memory, long after its formation (Sacktor 2011; Shema et al 2011; Shema et al 2009). However, a recent study (Volk et al 2013) has refuted this model of memory formation and has demonstrated that PKM-ζ is not required for hippocampal synaptic plasticity, learning and memory. Ca2+/calmodulin-dependent protein kinase II (CaMKII). CaMKII is a multifunctional serine/threonine kinase with a broad range of substrates. In mammals, CaMKII is comprised of four isoforms: α, β, ϒ and δ (Lucchesi et al 2011). α and β isoforms are primarily localized in the brain, whereas ϒ and δ isoforms are ubiquitously expressed. CaMKIIα is highly expressed in forebrain where it constitutes a major post-synaptic density
I. Introduction 21 (PSD) protein (Cheng et al 2006). Little is known about the function of CaMKIIβ in brain and virtually nothing about ϒ and δ isoforms. CaMKII has been studied extensively in relation to memory formation. Its activity is increased during memory formation and blockade of CaMKII substantially impairs memory formation (Coultrap & Bayer 2012; Elgersma et al 2004; Irvine et al 2006; Lisman et al 2002; Lucchesi et al 2011; Tinsley et al 2009; Wayman et al 2008). Mitogen-activated protein kinase kinase (MAPKK) signaling. MAPKK, also known as MEK, is a kinase enzyme that phosphorylates mitogen activated protein kinases (MAPKs), such as extracellular signal-regulated kinase (ERK), p38 and JNK. These MAPKKs are part of three kinase signaling cascades where MAPK kinase kinase (MKKK) activates MAPK kinase (MKK) that in turn activates a MAPK. So far, seven MEK subtypes have been identified: MEK1 and MEK2 that are closely related and activate ERK1/2 participating in the Ras/Raf/MEK/ERK signal transduction cascade; MEK3 and MEK6 that are functionally similar and activate p38 MAP kinase; MEK4 and MEK7 that work synergistically and activate JNK protein kinases; and MEK5 which activates ERK5, also known as big MAP kinase 1 (BMK1). Upon activation, MAPKs can phosphorylate a variety of intracellular targets, including transcription factors, transcriptional adaptor proteins, membrane and cytoplasmic substrates, and other protein kinases (Akinleye et al 2013). Numerous studies have shown that activation of the MAPKKs is critical for memory formation. A number of studies using pharmacological inhibitors of MEK demonstrated that activation of ERK is necessary for consolidation of long-term memories, including ORM (Berman et al 2000; Davis & Laroche 2006; Hebert & Dash 2002; Kelly et al 2003; Leon et al 2010; Lu et al 2001; Schafe et al 2000; Shalin et al 2004), and furthermore, inhibition of upstream kinase, MEK, results in impaired memory (Davis & Laroche 2006). Poly ADP-ribosylation. Poly ADP-ribosylation is a post-translational modification of nuclear proteins, catalyzed by poly (ADP-ribose) polymerases (PARPs) (Ame et al 2004; Lautier et al 1993; Rouleau et al 2004; Schreiber et al 2006). In the nucleus, poly ADPribosylation catalyzed by PARP-1 participates in protein–protein and protein–DNA interactions, and it is implicated in chromatin remodeling, DNA transcription, and repair (Ju et al 2004; Rouleau et al 2004). PARP-1 also acts within ERK signaling cascade that mediates growth and differentiation (Cohen-Armon 2007; Cohen-Armon et al 2007). Previous results linked the activation of PARP-1 with long-term memory formation (Cohen-Armon et al 2004;
I. Introduction 22 Goldberg et al 2009) and memory consolidation (Fontan-Lozano et al 2010). Furthermore, a recent study showed that NGF promoted synaptic plasticity and long-term memory formation by activating PARP-1-mediated protein ribosylation and activation of PKA-CREB pathway (Wang et al 2012). Figure 4 summarizes the signaling transduction pathways underlying recognition memory. For more details, please follow poster from Tocris named Neurotransmitters of Synaptic Plasticity, Learning and Memory in the Perirhinal Cortex by Warburton & Bashir, 2011. Figure 4. Schematic representation of the cellular mechanisms of recognition memory. (from Tocris)
II. Objectives
II. Objectives 25 Previously, we have shown that RGS14414 protein is a potent memory enhancer and treatment with its gene into area V2 of visual cortex of rodent’s brain produced robust enhancement in object recognition memory, which is one of the most studied examples of episodic memory. Therefore, we have tested first whether object recognition memory loss observed in normal aging and Alzheimer´s disease can be recuperated by the same RGS14414 gene treatment. Further, we explored through various biological processes in brain to provide explanation of RGS14-mediated memory enhancement and recuperation of memory loss. Objective 1: Explore the effect of RGS14414 gene treatment in recovery of an episodic memory loss A number of psychiatric and neurological disorders are associated mainly with episodic memory impairments. Alzheimer’s disease and age-related cognitive decline are clear examples of it (see section I.4). Therefore, in this objective, using Alzheimer´s diseasemice and normal aged rats, two most studied rodent models that have consistently exhibited a loss in episodic memory, we have evaluated whether RGS14 gene treatment can serve as an effective therapy against memory loss or not. Objective 2: Identify pathways implicated in RGS14414-mediated memory enhancement A great deal of effort is made to understand underlying mechanism of RGS14414mediated memory enhancement seen in rats after a treatment. Here, we have performed pharmacological studies using antagonists or inhibitors to elucidate pathways that are implicated in memory enhancement. Objective 3: Determine relationship between memory enhancer effect of RGS14414 and AMPA receptors In objective 2, we identified the involvement of AMPA receptors in memory enhancement. Therefore, taking into consideration the involvement of AMPA receptors in object recognition memory processing (Griffiths et al 2008; Malkova et al 2015; Winters & Bussey 2005), we have evaluated the participation of these receptors in RGS14-mediated memory processing.
II. Objectives 26 Objective 4: Examine the effect of RGS14414 treatment on Hebbian synaptic plasticity in perirhinal cortex Given the vast literature describing synaptic plasticity as a potential substrate for recognition memory, we wanted to evaluate whether synaptic plasticity is implicated in RGSmediated memory enhancement. Therefore, we have performed electrophysiological studies in perirhinal cortex of brain slices of RGS-treated animals. Perirhinal cortex is a structure that is considered crucial for processing of object recognition memory. Objective 5: Analyze brain areas implicated in RGS14-mediated memory enhancement In this objective, we have looked into the relationship between area V2, perirhinal and frontal cortices, areas that are part of brain circuit associated with object recognition memory. First, we have evaluated the effect of RGS14 treatment on object recognition memory in these areas and then, determined whether a substantial damage through lesion to these areas can independently produce object recognition memory loss, conditions simulating to brain diseases and/or aging. Furthermore, we explored whether RGS14 treatment in one of the areas in these lesion-induced memory-deficient conditions was adequate to normalize memory loss similar to as rodent models in objective 1.
III. Materials and methods
III. Materials and methods 34 Table 3. Amplification cycles and temperatures. STEP TEMPERATURE TIME Initial denaturation 95 ºC 3 min 30 cycles Denaturation 95 ºC 1 min Annealing 57 ºC 1 min Extension 72 ºC 3 min Hold 4 ºC -- 1.2.1.1.4 Gel purification of PCR product The PCR product from above was purified by 1% agarose gel electrophoresis (appendix 1.a.2). Samples mixed with 30 % glycerol in proportion 4:1 were loaded on gel, and separated with Tris-Boric acid-EDTA (TBE) buffer (appendix 1.a.1) by applying 100 V power (Power-Pac 300, Bio-Rad). The DNA band was visualized under a long-wavelength UV light (Bio-Rad equipment Gel Doc 2000) and was excised using a sterile scalpel (figure 9) and transferred to a previously weighted 1.5 ml tube. The weight of the excised band was 350 mg. RGS DNA purification from excised gel was carried out following manufacture’s protocol of Wizard® SV Gel and PCR Clean-Up System kit (Promega, A9281) with some modifications (appendix 1.c.2). Recovered DNA solution (about 40 μl) with a final concentration of 55.63 ng/μl was stored at -20 ºC. 1 2 3 1636 bp 1018 bp Figure 9. Electrophoresis of RGS14 DNA with restriction sites for Xho I and EcoRI to purify. The gel on the right shows the band cut. (1) Molecular weight ladder, (2) RGS14414 cDNA with endonuclease target sequence resulting from PCR (1283 bp) and (3) RGS14414 cDNA used as PCR template (1245 bp).
III. Materials and methods 35 1.2.1.1.5 Restriction reaction Compatible cohesive ends between RGS14414 gene and pLVX-DsRed-Monomer-C1 were generated by XhoI and EcoRI endonuclease enzymes reaction as is shown in table 4. The reaction was carried out at 37 ºC in a thermostatic bath (SW22, Julabo) for 16 h in case of RGS14414 gene and 4 h in case of vector. The endonucleases were inactivated by heating at 65 ºC in a dry block thermostat (Bio TDB-100, Boeco) for 20 min. Table 4. Restriction reaction of RGS14414 and pLVX lentiviral vector. REAGENT VOLUME RGS14414 GENE (55.63 ng/µl) pLVX PLASMID (0.5 µg/µl) cDNA 18 µl (1 µg) 1 µl (0.5 µg) XhoI (20000 U/ml) 1.5 µl (30 U/µg DNA) 0.25 µl (10 U/µg DNA) EcoRI (20000 U/ml) 1.5 µl (30 U/µg DNA) 0.25 µl (10 U/µg DNA) NEBuffer 2.1(10X) (New England Biolabs, B7202S) 5 µl 2.5 µl Nuclease-Free Water (Gibco,10977) 24 µl 25 µl Total volume 50 µl 25 µl The DNAs resulting from restriction reactions were purified using agarose gel (figure 10) as explained in previous section (section III.1.2.1.1.4) and their concentrations were determined by absorbance at 260/280 nm. The final concentration was 6.06 ng/µl in both cases.
III. Materials and methods 36 4072 bp 12216 bp 1 3 4 1636 bp 1018 bp B. Vector pLVX. 1 2 1636 bp 1018 bp A. RGS14414 gene. Figure 10. Electrophoresis for gel purification of resulting product from restriction reactions. Electrophoresis of the RGS14 (A) and plasmid pLVX (B) cDNAs cut with XhoI and EcoRI. The gels on the right show the bands cut.(1) Molecular weight ladder, (2) RGS14414 cDNA (1283 bp) restriction reaction, (3) pLVX cDNA without endonuclease cutting and (4) pLVX vector resulting from restriction reaction. 1.2.1.1.6 Ligation reaction To insert gene into the vector, a ligation reaction using the T4 DNA ligase (Life Technologies, 15224) was performed as is detailed in table 5. All the reagents, excluding the T4 ligase enzyme, were mixed previously and incubated at 45 ºC in the dry block thermostat (Bio TDB-100, Boeco) for 5 min to prevent non-specific binding between cohesive ends.
III. Materials and methods 37 After addition of ligase enzyme, the reaction was performed at 24 ºC for 1 hour. At the end of reaction, ligase enzyme was inactivated by incubation at 70 ºC for 10 min. Table 5. Ligation reaction. REAGENT VOLUME 5X reaction buffer (Life technologies, 46300-18) 4 µl RGS14414 cDNA (6.06 ng/µl) 9.9 µl (60 ng) pLVX vector cDNA (6.06 ng/µl) 3.3 µl (20 ng) T4-Ligase (1 U/µl) (Life technologies, 15224) 1 µl Nuclease-Free Water 1.8 µl Total volume 20 µl 1.2.1.1.7 Transformation into E. coli With the goal to amplify, samples after ligation containing RGS14414 recombinant DNA were transformed into One Shot® Omni Max™ 2 T1® Chemically Competent E.coli (Life Technologies, C8540-03) by heat shock according to the manufacturer’s protocol (appendix 1.b.2). Finally, among the grown colonies, four (Col. 1-4) were selected for the test. 1.2.1.1.8 Extraction and purification of recombinant DNA To evaluate the correct insertion of the gene, each colony was inoculated in 2 ml of LB liquid medium with 100 µg/ml ampicillin (appendix 1.b.1) for 16 h at 37 ºC while shaking at 225 rpm in an orbital shaker incubator (Optic Ivymen System). An aliquot of each bacterial culture was spread on 90 mm diameter Petri plates of LB-agar with ampicillin (appendix 1.b.1). The plates were incubated for 24 h at 37 ºC and stored at 4 ºC as stock for future maxiprep preparations. 1.2.1.1.8.1 Miniprep The ampicillin resistant colonies were processed to extract and purify recombinant DNA by using StrataPrep plasmid miniprep kit (Agilent technologies, 400761), following manufacturer’s protocol with some modifications (appendix 1.c.3). To test gene insert size in all 4 colonies, restriction reactions with XhoI and EcoRI enzymes were performed in each
III. Materials and methods 38 eluted recombinant DNA (table 6). The restriction reactions took place for 16 h at 37 ºC. Then, 15 U of each enzyme was added and reincubated at 37 ºC for additional 2 h. Finally, the reaction was stopped by heating at 65 ºC for 20 min. Table 6. Restriction reaction with XhoI and EcoRI endonucleases of DNA from miniprep. REAGENT VOLUME (For each colony) Purified DNA (miniprep) 5 µl XhoI (20000 U/ml) 1.5 µl (30 U/µg DNA) EcoRI (20000 U/ml) 1.5 µl (30 U/µg DNA) NEBuffer 2.1(10X) (New England Biolabs, B7202S) 2 µl Nuclease-Free Water 10 µl Total volume 20 µl The restriction products were loaded in a 1% agarose gel to visualize the result similar to as described in previous section. As shown in figure 11, colonies 2 and 3 presented two main bands of 8.8 and 1.28 kb, which corresponds to the vector pLVX and the RGS14414 gene, respectively. These results indicate that at least, colonies 2 and 3 retain the characteristics of vector as well as of RGS gene insert. For our future experiments, colony 2 was selected to proceed with the maxiprep and obtain a bigger amount of RGS14414 recombinant DNA. * * 1 2 3 4 5 6 7 4072 bp 12216 bp 1636 bp 1018 bp Col. 1 Col. 2 Col. 3 Col. 4 Figure 11. XhoI and EcoRI restriction reaction of DNA resulting of miniprep to prove the presence of RGS14414 recombinant DNA. Restriction reaction of miniprep from colonies 1-4, demonstrated that only, colonies 2 and 3 had included RGS14414 recombinant. Thus, the restriction reaction generated two main bands of 8.8 and 1.28 Kb which corresponds to the vector pLVX and the RGS14414 gene respectively. Colonies 1 and 4 only had included the vector without the insert. Arrows indicate the vector pLVX and asterisks the RGS14414 gene. Numbers 1, 2 and 7 indicate the molecular weight ladder, RGS14414 as positive control and pLVX vector without endonuclease cutting respectively.
III. Materials and methods 39 1.2.1.1.8.2 Maxiprep Stored stock of bacteria of colony 2 was inoculated in 5 ml of LB liquid medium with 100 µg/ml ampicillin for 8 h at 37 ºC with shaking at 225 rpm and then, this culture was added into a flask containing 300 ml of LB medium with ampicillin and further incubated at 37 ºC, 225 rpm for 15 h. A stock of bacteria with RGS14414 recombinant DNA was prepared at this stage and stored at -80 ºC for long-term use. Maxiprep was done by using Wizard ® Plus Maxiprep DNA Purification System kit (Promega, A7270), following the manufacturer’s protocol (appendix 1.c.4). After maxiprep, resultant RGS14414 recombinant DNA concentration was 635 ng/μl. The DNA was aliquoted in 20 μl in DNase free tubes and stored at -80 ºC until their use. The integrity of RGS gene insert into vector was further examined by XhoI and EcoRI restriction reaction as described in table 7 and additionally by DNA sequencing at the Genomics Unit of the Scientific Park of Madrid. It was confirmed thus that the whole sequence was intact and showed no mutation. Table 7. Restriction reaction with XhoI and EcoRI endonucleases of DNA from maxiprep. REAGENT VOLUME Purified DNA (maxiprep) 0.8 µl (500 ng) XhoI (20000 U/ml) 0.75 µl (30 U/µg DNA) EcoRI (20000 U/ml) 0.75 µl (30 U/µg DNA) NEBuffer 2.1(10X) 2 µl Nuclease-Free Water 15.7 µl Total volume 20 µl The restriction reactions took place for 4 h at 37 ºC. Then, the reaction was stopped by heating at 65 ºC for 20 min. The restriction products were loaded in a 1 % agarose gel to visualize the result similar to as described in previous section (figure 12).
III. Materials and methods 40 * Col. 2 1 2 3 4 5 6 7 4072 bp 12216 bp 1636 bp 1018 bp 1.2.1.2 Lentivirus production and titration 1.2.1.2.1 Cell lines (i) The lentivirus stock was produced in the 293T cell line (Clontech, 632180), a subclone of the transformed human embryonic kidney cell line, HEK 293, with type-5 human adenovirus. These eukaryotic cells are highly transfectable and supports high levels of lentiviral protein expression (Pear et al 1993) and expresses the SV40 large T antigen under control of the constitutively active human citomegalovirus (CMV) promoter. Table 8 indicates the composition of complete growth medium of this cell line. Table 8. Complete growth medium for the 293T cell line. REAGENT VOLUME Base growth medium Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, 52100-021) 6.69 g Sodium bicarbonate (Sigma-Aldrich, S5761) 1.85 g Non-Essential Amino Acids100X (Gibco, 11140-050) 5 ml L-glutamine 200mM (Gibco, 25030-032) 5 ml Sodium pyruvate 100mM (Gibco,11360-070) 5 ml Milli-Q water 485 ml Total 500 ml 450 ml Fetal Bovine Serum (Tet System Approved) (Clontech, 631105) 50 ml Penicillin-streptomycin (Gibco, 15140-122) 5 ml *In appendix 2 are detailed the protocols of cells freezing and thaw, as well as the subculture procedure. These cells require a specific pretreatment of the culture surface (appendix 2.a). Figure 12. XhoI and EcoRI restriction reaction of DNA resulting of maxiprep from colony 2. It was confirmed that the colony 2 was correctly transformed with the RGS14414 recombinant DNA since it presents the vector pLVX band (8.8 Kb, indicated by an arrow) and the RGS14414 gene band (1.28 Kb, indicated by an asterisk). Numbers 1, 2 and 3 indicate the molecular weight ladder, RGS14414 as positive control and pLVX vector without endonuclease cutting respectively.
III. Materials and methods 41 (ii) The lentivirus titer was determined using HT1080 cells (ATCC, CCL-121), a cell line derived from fibrosarcoma human cell line. Table 9 indicates the composition of the complete culture medium of this cell line. Table 9. Complete growth medium for the HT1080 cell line. REAGENT VOLUME Base growth medium Minimum Essential Medium (MEM) (Gibco, 41500-018) 4.81 g Sodium bicarbonate 0.75 g Sodium pyruvate 100mM (Gibco,11360-070) 5 ml Milli-Q water 495 ml Total 500 ml 450 ml Fetal Bovine Serum (Gibco, 10500-064) 50 ml Penicillin-streptomycin 5 ml *In appendix 2 are detailed the protocols of cells freezing and thaw, as well as the subculture procedure. 1.2.1.2.2 Transfection, production and concentration of lentivirus 1.2.1.2.2.1 Transfection and production The lentivirus production started with the transfection of the 293T cells with the RGS14414 recombinant DNA by using Lenti-XTM Packaging System (Clontech, 631247) according to the manufacturer’s protocol (appendix 2.d). All steps were carried out according to Biosafety level 2 instructions (Chosewood et al 2009). This transfection took place at the seventh subculture of this cell line in 100 mm Petri plates (Corning, 734-1815). 4.5 x 106 cells per plate were seeded in six plates containing 10 ml of complete medium but without antibiotic. After 72 h, lentiviral supernatants were harvested and pooled in Ultra-Clear tubes (Beckman Coulter, 344058) for the next step of concentration. 1.2.1.2.2.2 Lentivirus concentration To concentrate, lentiviral solutions were ultracentrifuged (Ichim & Wells 2011; Reiser 2000) at 25.000 rpm, 4 ºC for 90 min using Beckman XL-90 ultracentrifuge and SW29 rotor. S upernatants were discarded and 150 μl of sterile saline serum was added to pellet and
III. Materials and methods 42 placed at 4 ºC for overnight to facilitate the resus pension of lentivirus. Aliquots of 3 μl were prepared and stored at -80 ºC. For the production of a vehicle-lentivirus stock, the same procedure described before (transfection, production and concentration) was followed using the empty vector in this case. 1.2.1.2.3 Lentivirus titration The lentivirus infection was done in HT1080 cells. After fourth subculture of HT1080 cells, 2 x 105 cells were seeded in 2 ml per well of a 6-well plate (Nunc, 140675) and were incubated in CO2 incubator for 24 h. For infection of HT1080 cells with concentrated lentivirus, 10x serial dilutions ranging from 10-3 to 10-7 were prepared in 1 ml and they were added in each well of 6-well plate together with one well as mock control where lentivirus was replaced by complete medium. Cells were incubated in CO2 incubator for 48 h. For the selection of transfected cells, culture medium from 6-well plate was removed and replaced by 2 ml of complete HT1080 growth medium with 1 μg/μl puromycin (Clontech, 631306). Since vector pLVX contains Puror gene, transfected cells expressing this gene are expected to show resistance against this drug. In continuation, cells were incubated in this drug for 10 days with change of culture medium every two days. Survived cell colonies were stained in crystal violet solution (appendix 2.e). The titer in terms of colony forming units (CFU) of lentivirus stock was estimated by calculating mean of the number of colonies generated by two least concentrated dilutions, multiplied by the dilution factor. As shown in figure 13, RGS14414-lentivirus titer was 1.75 x 107 CFU/ml and vehicle-lentivirus titer was 2.75 x 106 CFU/ml. Mock 10-3 10-4 10-5 10-6 10-7 B. Vehicle-LentivirusA. RGS14414-Lentivirus Mock 10-3 10-4 10-5 10-6 10-7 Figure 13. Titration of lentivirus stocks. (A) RGS14414-lentivirus. (B) Vehicle-lentivirus.
III. Materials and methods 43 1.2.2 Animal housing conditions and stereotaxic surgery 1.2.2.1 Housing conditions Animals were housed individually in eurostandard cage with free access to food and water. Animals were housed in a temperature-controlled (20 ± 2 ºC) room on a 12 h light/dark cycle. All experimental procedures in animals were carried out in accordance with European and Spanish regulations (2010/63/EU, and RD53/2013). Research study performed in this thesis was approved by Committee of Ethics on Animals Use of University of Malaga. 1.2.2.2 Stereotaxic surgery 1.2.2.2.1 Surgical procedure Before proceeding, animals were deeply anesthetized by administering intraperitoneally 75 mg/kg ketamine (Imalgene 1000; Merial Laboratorios) and 1 mg/kg (rats) or 0.5 mg/Kg (mice) of medetomidine (Domtor, Pfizer). During surgery, animal body temperature was maintained with an electric blanket. Animals head was placed on the stereotaxic apparatus (Stoelting). For the surgery of mice, an adaptor (Cunningham mouse, Harvard Apparatus) was coupled (Cetin et al 2006). The injection was carried out by a 30 G dental carpule (Heraeus Kulzer Iberia) connected to a 10 ml Hamilton syringe (MicroliterTM #701, Harvard Apparatus) through a plastic tube connector. Lentivirus was infused at the rate of 10 μl/h using an infusion pump (11 Plus, Harvard Apparatus) (figure 14). The carpule was maintained into the brain area for five more minutes once the lentivirus injection was finished to facilitate complete diffusion. Unilateral injections of 2 μl (rats) or 1 μl (mice) of RGSlentivirus or vehicle-lentivirus were delivered in the right hemisphere.
III. Materials and methods 50 Table 11. Antagonists and inhibitors used in the pharmacological studies. REFERENCE (Winters & Bussey 2005) (Winters & Bussey 2005) (Naie & ManahanVaughan 2005; Simonyi et al 2007) (Tinsley et al 2009) (Apergis-Schoute et al 2005) (Li et al 2011) (Fontan-Lozano et al 2010) ADMINISTRATED VOLUME 1 µl at a concentration of 1.76 µg/µl in 0.9 % physiological saline 2 µl at a concentration of 7 µg/µl in 0.9 % physiological saline 1 µl at a concentration of 2 µg/µl in 0.9 % physiological saline 2 µl at a concentration of 35 ng/µl in 2 % DMSO in 0.9% physiological saline 0.5 µl at a concentration of 2 µg/µl in 50 %.DMSO 2 µl at a concentration of 30 nmol/µl in PBS+0.1 M of acetic acid 1 µl in 100 % DMSO in physiological saline at a final concentration of 300 nM MOMENT OF ADMINISTRATION (with reference to the ORM-test) 15 min before exposure to objects 15 min before exposure to objects 20 min before exposure to objects 10 min before exposure to objects 30 min before exposure to objects 24 h before exposure to objects 5 min before exposure to objects MECHANISM OF ACTION Potent, competitive AMPA / kainate receptor antagonist. Also antagonist at NMDA receptor glycine site NMDA receptor antagonist Selective metabotropic glutamate 1a receptor (mGluR1a) antagonist Ca2+ / calmodulin - dependent protein kinase II (CaMKII) inhibitor Selective non-competitive inhibitor of MAP kinase kinase (MKK) Inhibitor of protein kinase Mζ (PKMζ) Poly[ADP]-ribose polymerase 1 (PARP-1) inhibitor (ribosylation inhibition) DRUG CNQX (Ascent, Asc-044) DL-AP5 (Ascent, Asc-271) LY367385 (Sigma-Aldrich, L4420) KN-62 (Ascent, Asc-271) U0126 (Ascent, Asc-241) ZIP (Tocris, 2549) TIQ-A (Sigma, T2825)
III. Materials and methods 51 2.2 Methods Note: The methodological procedure for this block concerning lentivirus production and ORM test is detailed in the sections III.1.2.1 and III.1.2.4 respectively. 2.2.1 Cannula implantation and lentivirus injection Before proceeding, rats were deeply anesthetized by administering intraperitoneally 75 mg/kg ketamine (Imalgene 1000; Merial Laboratorios) and 1 mg/kg medetomidine (Domtor, Pfizer) and fixed in a stereotaxic apparatus (Stoelting) (Cetin et al 2006). For these studies where the administration of different drugs is necessary, a guide cannula (Plastics one, C317G) was chronically implanted into area V2 of the right hemisphere (see coordinates in section III.1.2.2.2.2). This cannula was fixed to the rat skull with three screws (Plastics one, 0-80X1-8) and Resirapid acrylic cement (Garcia y Brückner). A dummy cannula (Plastics one, C317DC) was inserted to prevent clogging of the guide cannula. The next day of cannula implantation and after anesthetizing the rats once again, 2 µl of lentivirus (RGS14 or vehicle) were infused at the rate of 10 μ l/h using an injection cannula (Plastics one, C317I) which was inserted in the guide cannula (figure 19) and connected to a 10 ml Hamilton syringe (MicroliterTM #701, Harvard Apparatus) through a plastic tube connector and in turn to an infusion pump (11 Plus, Harvard Apparatus). Injection cannula Dummy cannula Guide cannula Area V2 Skull Screw Cement Figure 19. Schematic representation of the cannula system for unilateral microinjections into area V2. The guide cannula was inserted into the brain and fixed to the rat skull with acrylic cement and stainless steel screws. The dummy cannula and the injection cannula are also shown.
III. Materials and methods 52 21 days after the injection of lentivirus, the different drugs were administrated using the injection cannula. All studies were performed in awake and unstressed rats. Animals were housed in the same conditions as in the first block of experiments (section III.1.2.2) with the appropriate post-surgery recovery (section III.1.2.2.2.3). Behavioral studies were performed and analyzed as describe previously (section III.1.2.4), with the exception of the cannula insertion simulation based in the dummy cannula insertion and removal three o for times. 3 Third block of experiments: Determine relationship between memory enhancer effect of RGS14414 and AMPA receptors 3.1 Experimental design Taking into consideration the implication of AMPA receptors in episodic memory processing (Griffiths et al 2008; Malkova et al 2015; Winters & Bussey 2005) and the RGS14 effect on ORM enhancement (Lopez-Aranda et al 2009), here, we intend to investigate the possible relationship between AMPA receptors and RGS14-mediated memory enhancement. In this aim, we will perform gene as well as protein study of AMPA receptors as described in figure 20. Lentivirus production (RGS14-lentivirus and vehicle-lentivirus) Object exposure for 3 min as in ORM test Statistical analysis AMPA receptors mRNAquantification (qRT-PCR) Data collection (Quantityof AMPA receptors mRNA) RGS14-lentivirus or vehicle-lentivirus injection in area V2 (Stereotaxicsurgery) Area V2 dissection Data collection (Level of GluR2 expression) Area V2 dissection GluR2 protein quantification (Western blot) Figure 20. A scheme of experimental design.
III. Materials and methods 53 3.1.1 AMPA receptors mRNA quantification A set of 8 rats at age of 3-4 months were treated in area V2 with RGS14-lentivirus (RGS14 group) and another set of 8 rat of the same age with vehicle-lentivirus (vehicle group) (sections III.1.2.1 and III.1.2.2.2). After 21 days of the injection, area V2 was dissected out (section III.3.2.1) and tissues were processed for mRNA quantification by quantitative reverse transcription PCR (qRT-PCR) (section III.3.2.2). 3.1.2 GluR2 protein quantification 24 rats of 3-4 months of age were used in this study, where 12 rats were treated with vehicle-lentivirus (vehicle group) and other 12 rats with RGS14-lentivirus (RGS14 group) (sections III.1.2.1 and III.1.2.2.2). After 21 days of treatment, rats were exposed to two identical objects for 3 min and were sacrificed in groups of three animals at 20 min, 40 min, 60 min, and 24 h after the exposure (section III.1.2.4). After processing of brain samples, GluR2 protein quantification was carried out by Western blot (section III.3.2.3). 3.2 Methods Note: The methodological procedure for this block concerning lentivirus production and injection and ORM test is detailed in the sections III.1.2.1, III.1.2.2.2 and III.1.2.4. 3.2.1 Dissection of area V2 of visual cortex from rat brain Animals were anesthetized with an isoflurane/oxygen mixture and decapitated. After deep anesthesia, brains were dissected out and carefully area V2 of right hemisphere was extracted with a 4 mm punch (DH Material Médico, 94158BP-40F). 3.2.2 qRT-PCR Punches of area V2 were collected in 1.5 ml tubes containing RNAlater® RNA Stabilization Reagent (Quiagen, 1018087) and stored at 15-25 ºC up to 7 days and then 2-8 ºC up to 4 weeks, if necessary. 3.2.2.1 Extraction of total RNA Tissue RNA extraction was performed with RNeasy Tissue Mini kit (Quiagen, 74124) following manufacturer´s protocol (appendix 1.d). RNA purity and concentration were
III. Materials and methods 54 determined by measuring absorbance at 260 and 280 nm in Nanodrop1000, v3.7 (Thermo Scientific). The concentration of RNA was determined using the formula of one unit at A260 is equal to 40 μg/ml of total RNA. A260/A280 ratio of RNA samples was between 1.8 and 2, indicating a good purity grade of RNA. 3.2.2.2 Reverse transcription (RT) of total RNA For removal of genomic DNA (table 12), extracted RNA samples were incubated with rDNase I enzyme at 37 ºC for 30 min and the enzyme was inactivated by heating at 75 ºC for 10 min. RNA samples were stored at 4 ºC. Table 12. Reaction to remove the genomic DNA. REAGENT AMOUNT 10X DNase Buffer (Ambion, AM2235) 1.4 µl rDNase I (2 U/µl) (Ambion, AM2235) 0.2 U RNA SAMPLE 1 µg Nuclease-Free Water (Gibco, 10977) Up to 14 µl Total volume 14 µl The RT reaction was performed with the High Capacity RNA-to-cDNA kit (Applied Biosystems, 4387406) as shown in table 13. The reaction was performed at 37 ºC for 30 min and reverse transcriptase was inactivated by heating at 95 ºC for 5 min. The cDNAs were stored at -20 ºC. Table 13. Reverse transcription reaction. REAGENT AMAOUNT 2X RT Buffer Mix 16 µl 20X RT Enzyme Mix 1.6 µl RNA sample (resulting from genomic DNA digestion) 14 µl Nuclease-Free Water (Gibco, 10977) 0.4 µl Total volume 32 µl The cDNA concentration was estimated as in the previous section, using formula of one unit at A260 is equal to 33 μg/ml of ssDNA and A260/A280 ratio of DNA samples was between 1.8 and 2.
III. Materials and methods 55 3.2.2.3 Primers for qRT-PCR 3.2.2.3.1 Primers design Forward and reverse primers (table 14) were designed with the use of software Primer Express, v2.0 (Applied Biosystems). Specificity of primers was checked by the software Primer-Blast (NCBI) (Ye et al 2012) and finally a qRT-PCR simulation was done by the software Amplify 1.2 (University of Wisconsin). Table 14. qRT-PCR primer sequences. GEN REFERENCE (GenBank) PRIMER SEQUENCE*1 (5´3´) AMPLICON LENGTH (bp) Glutamate receptor, ionotropic, AMPA 1 (GluR1) NM_031608.1 Forward: ATGGCATCGGGTACCACTACA 100 Reverse: AGCTGGAAACCTGTCACATTGG Glutamate receptor, ionotropic, AMPA 2 (GluR2) NM_017261.2 Forward: TGGAGAGCTTGTCTACGGGAAA 100 Reverse: ACTCATGAAGGGCTTGGAGAAG Glutamate receptor, ionotropic, AMPA 3 (GluR3) NM_001112742.1 Forward: CTGAGAAGCCCTTCCATTTGAA 90 Reverse: AGAACTGGGAGCAGAAAGCATT Glutamate receptor, ionotropic, AMPA 4 (GluR4) BC093608.1 Forward: TCAAGGGCTGACTGGGAATG 90 Reverse: GGTCCTGTGCTTTTCAGTTCAAA Ribosomal protein L19 (Rpl19)*2 NM_031103.1 Forward: ATGCCAACTCTCGTCAACAG 102 Reverse: AGGTGTTCTTCCGGCATCG *1 Primers synthesized by Sigma-Aldrich. *2 Housekeeping gene 3.2.2.3.2 Determination of optimal concentration for qRT-PCR Three different concentrations of primers (0.45, 0.225 and 0.1125 µM) were tested in a qRT-PCR reaction (section III.3.2.2.5) where each primer concentration was used with 3 different amounts of cDNA (640, 320 or 160 ng) from vehicle group as template. Optimal primer concentration was selected for qRT-PCR experiments based on criteria detailed in
III. Materials and methods 56 appendix 1.d.2. We found that 0.45 µM primer concentration was optimum for all genes that were subject to study. 3.2.2.4 Creating standard curves PCR products of each gene (where optimal primer concentration was used) were purified by using MiniElute PCR purification kit (Quiagen, 28004) (appendix 1.c.1) and their concentrations were determined by the Nanodrop1000, v3.7 spectrophotometer (Thermo Scientific). To generate standard curves, five serial dilutions of the purified PCR product of each gene ranging 10-4 to 10-9 were processed for qRT-PCR where the logarithm of DNA concentration in femtograms was represented on X axis and corresponding Ct value on Y axis. The Ct values of the 10 fold dilution which were not 3.3 cycles apart were discarded. A good linear relationship between Ct and the logarithm of DNA concentration was considered when correlation coefficient (R2) reached over 0.98. Amplification efficiency (E) is calculated from the slope of the standard curve using the following formula: E = 10-1/slope In figure 21 are represented the standard curves of GluR1, GluR2, GluR3 and GluR4 genes and the housekeeping gene Rpl19.
III. Materials and methods 57 y = -3.4935x + 22.709 R² = 0.99 0 5 10 15 20 25 -1 1 3 5 Ct Log (cDNAquantity) (fg) Rpl19 (housekeeping gen) E=1.93 y = -3.3916x + 23.868 R² = 0.9998 0 5 10 15 20 25 -1 1 3 5 Ct Log (cDNA quantity) (fg) GluR2 E=1.97 y = -3.4002x + 23.724 R² = 0.9998 0 5 10 15 20 25 -1 1 3 5 Ct Log (cDNAquantity) (fg) GluR1 E=1.97 y = -3.4413x + 23.833 R² = 0.9999 0 5 10 15 20 25 -1 1 3 5 Ct Log (cDNAquantity) (fg) GluR3 E=1.95 y = -2.9385x + 21.697 R² = 0.9969 0 5 10 15 20 25 -1 1 3 5 Ct Log (cDNAquantity) (fg) GluR4 E=2.1 Figure 21. Standard curves of GluR1, GluR2, GluR3, GluR4 and Rpl19 genes. A correlation between logarithm of DNA concentration (fg) and corresponding Ct value of the 10 fold dilution of the cDNA is shown here. E: Amplification efficiency, R2: correlation coefficient.
III. Materials and methods 58 3.2.2.5 qRT-PCR reaction After primer optimization and standard curve analysis, we set out to perform qRTPCR for the evaluation of differential gene expression between the brain tissues obtained from control and RGS14-treated rats. The qRT-PCR reactions were performed in 7500 RealTime PCR Systems thermocycler (Applied Biosystems), using the Power SYBR® Green PCR Master Mix kit (Applied Biosystems, 4367659) as it is detailed in table 15. Table 15. qRT-PCR reaction using Power SYBR® Green PCR Master Mix kit. REAGENT VOLUME FINAL CONCENTRATION Power SYBR® Green PCR Master Mix (2X) 12 µl 1X Reverse Primer 8 µl 0.45 µM (each one) Forward Primer cDNA sample 4 µl 640 ng Total 24 µl Triplicates were run for each cDNA sample in a MicroAmp®Optical 96-Well Reaction Plate with Barcode (Applied Biosystems, 4306737). In addition to housekeeping gene, negative control without cDNA was run at the same time. Once all reactive were added, plates were sealed with qPCR Adhesive Clear Seals (4titude, 4ti-0560) and centrifuged at 1000 rpm for 1 min at 4 ºC in the Centrifuge 5810R (Eppendorf) using the A-4-62 rotor, before placing it on the qRT-PCR thermocycler. The quantitative amplification conditions as well as a standard melt curve protocol are shown in table 16. Table 16. qRT-PCR amplification cycles and temperatures. STEP TEMPERATURE TIME Polymerase activation 95 ºC 10 min 40 cycles Denaturation 95 ºC 15 s Annealing and extension 60 ºC 1 min Melt curve 95 ºC 15 s 60 ºC 1 min 95 ºC 30 s 60 ºC 15 s Hold 4 ºC --
III. Materials and methods 59 3.2.2.6 Data collection To determinate the RNA (cDNA) quantity of samples, obtained Ct for each gene were interpolated in the corresponding standard curves. cDNA values corresponding to genes (GluR1, GluR2, GluR3 and GluR4) of RGS14 group or vehicle group were normalized with housekeeping Rpl19 (Qgene/ QRpl19) and percentages of change between vehicle and RGS14 groups were calculated as following: Qgene nor RGS14 –Qgene nor Vehicle ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________ x 100 Qgene nor Vehicle 3.2.2.7 Statistical analysis The Qgene nor were presented as the mean ± SEM and significant difference between RGS and vehicle were tested by paired t-test (SigmaStat 3.5 software, Jandel Scientific), accepting a confidence interval of 95 % (p ≤ 0.05). 3.2.3 Western Blot 3.2.3.1 Brain homogenization and protein estimation Brain punches of injection area V2 were frozen immediately in dry ice and stored at - 80 ºC. Brain tissues were thawed, weighted and homogenized in 2 ml of 0.01 M Tris-HCl buffer pH 7.4 (appendix 5.a.1) which included 1 % (v/v) protease inhibitor cocktail (SigmaAldrich, P8340) and 1 % (v/v) phosphatase inhibitor cocktail (Sigma-Aldrich, P0044), using tissue homogenizing system (Glas-Col). Protein concentration of homogenized samples was determined by Lowry method (Lowry et al 1951) (appendix 5.b). 50 μl aliquots were then lyophilized in SPD1010 SpeedVac System (Thermo Savant) for 45 min without heating and stored at -80 ºC until used. 3.2.3.2 Denaturing polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblot Loading buffer (1X) (Laemmli 1970) (appendix 5.a.3) was added to lyophilized sample. The samples were heated at 95 ºC for 10 min twice in a thermostatic block heater TDB-100 (Boeco) to denature and dissolve the proteins. 2.5 μg and 5 μg of samples were run
III. Materials and methods 66 reference (grounding) electrode consisting of a partially chlorided silver wire was in contact with the recording chamber through a pellet (Model E206, 641310, Harvard apparatus) and connected to the headstage. (iv) Stimulation protocols A single pulse was delivered alternately to each stimulating electrode at 0.033 Hz (that is, a pulse each 30 s to each pathway; hence the tissue was alternately stimulated every 15 s). fEPSPs were reduced to 50 %-60 % of maximum amplitude to achieve a baseline of synaptic transmission before induction of synaptic plasticity. After a baseline of at least 30 min three stimulation protocols were carried out: a) Induction of long-term potentiation (LTP) of synaptic transmission through two different protocols of high frequency stimulation (HFS): HFS-100 Hz: 4 trains of stimuli, each of 100 Hz lasting 1 s, every 30 s (Massey et al 2004; Ziakopoulos et al 1999). HFS-20 Hz: 1 train of stimuli of 20 Hz lasting 1 s. b) Induction of muscarinic cholinergic receptor-dependent long-term depression (LTD) of synaptic transmission by bath application of a non-selective cholinergic agonist; carbachol (CCh) (Abcam, ab141354) for 10 min at two different concentrations: 50 µM or 20 µM (Massey et al 2001). c) Induction of depotentiation (reversal of LTP) of synaptic transmission through a low frequency stimulation (LFS) protocol (900 stimuli at 1 Hz lasting for 15 min) applied 20 min after LTP induction (Massey et al 2004; Ziakopoulos et al 1999). fEPSP peak amplitudes were measured during the 60 min period, posterior to the induction of synaptic plasticity in each case (after the 2 min HFS induction, the 15 min LFS induction or the 10 min after CCh bath-application). The pathway in which plasticity was induced was randomly allocated; on some occasions, it was the entorhinal and others, the temporal input. LTP, LTD and depotentiation were input specific with no plasticity observed in the nonconditioned pathway (data not shown) as has previously been described (Cho et al 2000b; Massey et al 2004; Warburton et al 2003; Ziakopoulos et al 1999).
III. Materials and methods 67 4.2.1.3 Data collection Field responses were monitored through an AxoPatch 200B amplifier (Axon instrument), and amplified 500-fold using a low-pass cut-off frequency of 5 kHz. Signals were digitalized using an analogue-digital converter with a sampling rate of 10 kHz. The data acquisition software Win LTP allowed on-line measurement of peak amplitudes. 4.2.1.4 Statistical analysis Experiments were analyzed off-line using the analysis software WinLTP 1.01 Reanalysis (Anderson & Collingridge 2007; Anderson et al 2012). Peak amplitude values were measured and expressed relative to the normalized pre-conditioning baseline (30 min) in each experiment. Data pooled across slices were expressed as means ± SEM and the significance of plasticity changes were established using the appropriate test: (i) An unpaired Student’s t-test to compare the RGS14 group versus the control group (normalized data). (ii) Paired Student’s t-test to compare the base line versus LTP or LTD (raw data) in each group (RGS14 or control). (iii) A one-way ANOVA with repeated measures followed by Bonferroni´s post hoc test to compare the baseline versus LTP versus depotentiation in each experiment. These statistical analyses were run in the software SigmaStat 3.5 (Jandel Scientific) to detect significant differences accepting a 5 % error probability (p ≤ 0.05). 5 Fifth block of experiments: Analyze brain areas implicated in RGS14mediated memory enhancement 5.1 Experimental design The aim of this section was to study the enhancer effect of RGS14 in different brain areas that are part of circuit involved in ORM processing that include area V2, perirhinal cortex and frontal cortex (see section I.2.1.1). Furthermore, to study the possible dependence
III. Materials and methods 68 of each area in memory processing, the immunotoxin Ox7-SAP was used to lesion a brain area or more than one brain area. The experimental design for this block is described briefly in figure 26. Lentivirus production (RGS14-lentivirus and vehicle-lentivirus) Study of RGS-mediated boost in ORM after treatment in perirhinal and frontal cortices and area V2 (ORM test) Statistical analysis RGS14-lentivirus or vehiclelentivirus injection in perirhinal cortex, frontal cortex or area V2 (Stereotaxic surgery) Data collection (DI) Study of independence of each area in ORM processing (Ox7-SAP administration) ORM test Visualization of the neuronal damage (cresyl violet staining) Figure 26. A scheme of experimental design. 5.1.1 RGS14-mediated enhancement in ORM after treatment in either areas V2, perirhinal cortex or frontal cortex Three groups of rats of 3-4 months of age were used in this study: (i) Area V2 group: 12 RGS14414-lentivirus treated and 12 vehicle-lentivirus treated rats were included in this group. However, injection was done in area V2 of visual cortex using atlas coordinates, AP: -4.3, ML: ± 2.1, DV: -1.9. (ii) Perirhinal cortex group: 8 RGS14414-lentivirus treated and 12 vehiclelentivirus treated rats were included here. In this group, injection was done in perirhinal cortex using atlas coordinates, AP: - 4.52, ML: ± 6.7, DV: - 4.75.
III. Materials and methods 69 (iii) Frontal cortex group: 8 RGS14414-lentivirus treated and 11 vehicle-lentivirus treated rats were included in this study. Here, the injection was done in frontal cortex using atlas coordinates, AP: + 4.7, ML: ± 2.2, DV: -1. All groups were subjected to ORM test for monitoring their ORM statuses after a delay of 24 h (section III.1.2.4). 5.1.2 Study of dependence of brain areas implicated in RGS14-mediated ORM processing After treatment of rats with RGS14414 gene in either area V2, perirhinal cortex or frontal cortex, a selective elimination of neurons in areas under study was carried out by the administration of Ox7-SAP (Advanced Targeting Systems, IT-02) at a concentration of 0.9 μg/μl in both hemispheres (Krum et al 1997; Nolan & Freeman 2005; Traissard et al 2007). A description on treatment and number of animals used in each condition is described in table 17, table 18, and table 19. Table 17. Ox7-SAP administration after RGS14 treatment in area V2. Vehicle group RGS14 group Treatment Without toxin n = 12 n = 8 With Ox7 in V2 --- n = 8 With Ox7 in Fr n = 7 n = 10 With Ox7 in PRh n = 7 n = 10 With Ox7 in PRh and Fr n = 7 n = 8 *In this group, 44 rats were treated with RGS14-lentivirus and 33 rats were treated with vehicle– lentivirus with or without Ox7-SAP. Table 18. Ox7-SAP administration after RGS14 treatment in perirhinal cortex. Vehicle group RGS14 group Treatment Without toxin n = 11 n = 7 With Ox7 in PRh --- n = 10 With Ox7 in Fr n = 7 n = 10 With Ox7 in V2 n = 7 n = 9 With Ox7 in Fr and V2 n = 7 n = 10 *In this group, 46 rats were treated with RGS14-lentivirus and 32 rats were treated with vehicle– lentivirus with or without Ox7-SAP.
III. Materials and methods 70 Table 19. Ox7-SAP administration after RGS14 treatment in frontal cortex. Vehicle group RGS14 group Treatment Without toxin n = 10 n = 9 With Ox7 in Fr --- n = 10 With Ox7 in PRh n = 7 n = 8 With Ox7 in V2 n = 7 n = 8 With Ox7 in PRh and V2 n = 7 n = 8 *In this group, 43 rats were treated with RGS14-lentivirus and 31 rats were treated with vehicle– lentivirus with or without Ox7-SAP. All animals were subjected to ORM test for monitoring their ORM statuses (section III.1.2.4) after a delay of 24 h. Once the behavioral studies terminated, neuronal damage produced by Ox7-SAP administration was confirmed by staining with Cresyl violet (section III.5.2.1). 5.2 Methods Note: The methodological procedure for this block concerning lentivirus production and injection and ORM test is detailed in the sections III.1.2.1, III.1.2.2.2 and III.1.2.4. 5.2.1 Cresyl violet staining Previous to the staining (appendix 4 (c, d and e)), sections were mounted on gelatincoated slides (appendix 4.b) and dried overnight at 37 ºC for their complete adhesion. Dried sections were hydrated through PBS 0.1M (30 min) and distilled water (30 min). Afterwards, staining was performed with 1 % Cresyl violet solution (Sigma-Aldrich; C5042) for 15 min. After removal of excess stain with distilled water for 2 min, sections were dehydrated following this order: 70 % ethanol for 10 s and then 90 % ethanol with 10 % glacial acetic acid for 1 min. Then, the sections were submerged in ethanol absolute for 4 min and xylene for 10 min. Finally the sections were mounted with DPX mounting medium (Merck, 1.00579). Sections were analyzed under the DM IRE2 microscope of Leica.
IV. Results
IV. Results 73 1 Recovery of ORM loss by RGS14414 gene treatment in area V2 Memory enhancer effect of RGS14414 (Lopez-Aranda et al 2009) was tested in two different ORM-deficient rodent models: normal aging rats and transgenic mice of Alzheimer´s disease. 1.1 Study in aging Discrimination index (DI) values representing capacity for holding information of an object in memory (see in section III.1.2.4.3 for details) of different experimental groups (control without injection, control vehicle-treated and RGS14 gene-treated groups) are shown in figure 27. We observed that 3 months old control rats without treatment were able to retain the information of an object after a delay of 45 min (0.719 ± 0.017), but not after 24 h (0.50 ± 0.054) (one-way ANOVA with Tukey´s post hoc test, p = 0.002). However, when these rats reached to 18 months of age, a drastic drop in ORM was observed and this fall in memory of 45 min was to a level where they were unable to remember the same information (0.507 ± 0.034, 45 min at 18 months versus 0.719 ± 0.017, 45 min at 3 months; one-way ANOVA with Tukey´s post hoc test, p < 0.001). After treating these memory-deficient 18 months old rats with RGS14414 gene in area V2 (RGS14 group), a full recovery in ORM loss was observed (0.75 ± 0.022, RGS14 group 45 min at 20 months versus 0.507 ± 0.034, control group without injection 45 min at 18 months; unpaired Student’s t-test, p < 0.001). In addition to ORM recovery of 45 min delay, a boost in memory capacity of these RGS-animals was observed. Untreated control animals are incapable of remembering an object information after 60 min of delay (Lopez-Aranda et al 2009) and 24 h delay (0.50 ± 0.054, 24 h at 3 months); however, RGS14414-treated animals could keep the same information in brain even after a delay of 24 h (0.727 ± 0.024, RGS14 group at 20 months versus 0.507 ± 0.054, control group without injection at 3 months of age, unpaired Student’s t-test, p = 0.003). This effect of RGS14414 treatment on recuperation of memory loss as well as on boost in memory persisted until 24 months of age (0.721 ± 0.038), an age until animals were able to perform on ORM test. However, in contrast to RGS14414 gene treatment, vehicle treatment (control vehicle group) did not produce any effect on memory (0.49 ± 0.035, 45 min delay; 0.501 ± 0.028, 24 h delay at 20 months; 0.496 ± 0.041, 24 h delay at 24 months).
IV. Results 74 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 Discrimination index Age in months Control without injection Vehicle RGS14 RGS14 or Vehicle * * Delay24 h 3 (n=12) 18 (n=16) 20 (n=7-9) 24 (n=5-6) Delay 45 min 3 (n=12) Delay 45 min Delay 24 h 20 (n=7-9) Delay 45 min Figure 27. Recovery of an episodic memory loss in aging rats after RGS14414 gene treatment in area V2. When normal rats of 3 months of age were exposed to an object for 3 min, they could retain the object information in memory for 45 min and were unable to do so after a delay of 24 h. However, this normal memory of 45 min in rats of 18 months of age was completely lost. A localized RGS14414 gene treatment in area V2 of these memory-deficient 18 months old rats led to a full recovery of ORM loss (delay 45 min, 20 months). In addition, this treatment produced an enhancement in this memory which was detectable even after a delay of 24 h (delay 24 h, 20 months) and this effect persisted until 24 months of age (delay 24 h). Number of rats (n) is indicated beneath bars. shows significant intra-group differences and shows significant intergroup differences (p ≤ 0.0 5). 1.2 Study in Alzheimer´s disease The level of performance of 2 months old AD-mice (AD group) and control wild type mice (WT group) on ORM task were very similar and both groups of animals showed normal ORM status (0.754 ± 0.025, AD group and 0.768 ± 0.039 WT group) (figure 28). However, in contrary to WT group, AD-mice showed a significant ORM deficit at the age of 4 months (0.795 ± 0.030, WT group versus 0.560 ± 0.021, AD group; unpaired Student’s ttest, p < 0.001). A treatment of these memory-deficient mice with RGS14414 gene in area V2 (AD+RGS14 group) led to full recuperation of ORM loss (0.773 ± 0.026, AD+RGS14 group versus 0.543 ± 0.041, AD group, 7 months; one-way ANOVA followed by a Tukey´s post hoc test, p < 0.001). This effect of RGS14 treatment persisted in these mice even until 10 *
IV. Results 75 months of age (0.698 ± 0.037, AD+RGS14 group versus 0.523 ± 0.067 AD group, 10 months; one-way ANOVA followed by a Tukey´s post hoc test, p = 0.0048). These AD+RGS14 group mice showed normal ORM similar to WT group (0.773 ± 0.026, AD+RGS14 group versus 0.726 ± 0.047, WT group at 7 months and 0.793 ± 0.033, at 10 months). However, vehicle treatment (AD+vehicle group) showed no effect on memory (0.542 ± 0.026, 7 months and 0.534 ± 0.045, 10 months) and their ORM levels were similar to AD group (0.543 ± 0.041, 7 months and 0.523 ± 0.067, 10 months). 0,0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 Discrimination index Agein months Wild-type control AD AD + Vehicle AD + RGS14 RGS14 or Vehicle 2 (n=8-12) 4 (n=10-16) 7 (n=8-15) 10 (n=8-13) Figure 28. Recovery of ORM loss in AD-mice by RGS14414 gene treatment in area V2 of visual cortex. ADmice of 2 months of age, similar to wild-type, showed normal ORM, however, a substantial ORM loss was observed at 4 months of age. A localized RGS14414 gene treatment in area V2 of 4 months old AD-mice led to a full recovery in ORM loss and this recovered memory was maintained even at 10 months of age (7 and 10 months). Number of rats (n) is indicated beneath bars. shows significant intergroup differences (p ≤ 0.05). AD: Alzheimer Disease. 2 Mechanism of memory enhancer activity of RGS14414 Different drugs (antagonists and inhibitors) were employed (table 11, section III.2.1) with the goal to identify possible pathways implicated in RGS14414-mediated ORM enhancement. These drugs were administered to RGS14-treated rats during performance on ORM task and their ORM levels were monitored.
IV. Results 82 Results of in vitro extracellular field recordings show a similar level of induction of LTP after application of 100 Hz HFS in RGS14-treated group (paired Student´s t-test, p = 0.003) as non-treated control group (paired Student´s t-test, p < 0.001) (figure 33.A). However, when HFS was applied at 20 Hz, no LTP induction in RGS14 group of animals was observed (paired Student´s t-test, p = 0.764), but it could successfully be induced in control group of animals (paired Student´s t-test, p = 0.024) (figure 33.B). 2.3.2.2 Effect of RGS14 on LTD induced by stimulation of muscarinic cholinergic system Normalized fEPSP amplitude values (section III.4.2.1.3) that were obtained after induction of muscarinic cholinergic receptor-dependent LTD in perirhinal cortex, are represented as mean ± SEM in figure 34. These inductions were carried out by 10 min bath application of two concentrations of carbachol, an agonist of muscarinic cholinergic system: (i) 50 µM (figure 34.A), and (ii) 20 µM (figure 34.B). Data obtained from in vitro extracellular field potential recordings (figure 34) show an induction of LTD upon application of 50 µM of carbachol in both RGS14-treated group (paired Student´s t-test, p = 0.004) and non-treated control group (paired Student´s t-test, p < 0.001), and this induction in LTD was very similar in both group of animals. However, in contrast, application of a lower concentration, 20 µM, of carbachol produced no LTD in RGS14 group of animals (paired Student´s t-test, p = 0.056), but successfully induced LTD in control group of animals (paired Student´s t-test, p = 0.006).
IV. Results 83 0 0,2 0,4 0,6 0,8 1 1,2 010 20 30 40 50 60 70 80 90 100 Normalized fEPSP amplitude Time (min) RGS14 (n=5) Control (n=5) -0,8 -0,4 0 -0,8 -0,4 0 -0,8 -0,4 0 -0,8 -0,4 0 -0,8 -0,4 0 -0,8 -0,4 0 30ms 0, 5mV Cch20 µM 2 1 1 2 1&2 30ms 0, 5mV 0 0,2 0,4 0,6 0,8 1 1,2 010 20 30 40 50 60 70 80 90 100 Normalized fEPSP amplitude Time (min) RGS14 (n=3) Control (n=3) Cch 50 µM 2 1 1 2 1&2 A B Figure 34. Alteration in LTD induced by carbachol at 20 µM but not at 50 µM in perirhinal cortex of RGS-treated rats. (A) In vitro extracellular field recordings show that bath application of carbachol (CCh) at 50 µM concentration for 10 min (black thick bar) produced a strong depression followed by LTD in RGS14 group (n = 3, p = 0.004) which was similar to control group (n = 3, p < 0.01). (B) However, when used at 20 µM concentration for 10 min (black thick bar) a failure in the maintenance of LTD was observed in RGS14 group (n = 5, p = 0.056). Traces above the graphs of A and B are representative fEPSP responses taken from appropriate time points as indicated in 1 and 2. Each trace is the average of four sweeps and stimulus artifacts have been removed for the presentation. Values of normalized fEPSP amplitudes are represented as mean ± SEM. Number (n) represents number of animals used.
IV. Results 84 2.3.2.3 Effect of RGS14 on depotentiation produced by low frequency stimulation (LFS) Results of in vitro extracellular field recordings that were obtained after induction of a depotentiation by application of LFS consisting of 900 stimuli at 1 Hz during 15 min in perirhinal cortex are represented in figure 35. 20 min prior to application of LFS for the development of depotentiation, brain slices with perirhinal cortex were subjected to a protocol of 100 Hz HFS to induce LTP. A one-way ANOVA with repeated measures followed by a Bonferroni´s post hoc test by comparing the base line versus LTP or depotentiation in each group, shows as expected, an induction of LTP in both RGS14-treated and control groups (p < 0.001). However, application of 1 Hz stimulation in same brain slices led to generation of depotentiation in control group (p = 0.002) and no in RGS-treated group (p = 0.565). A significant difference in depotentiation was observed between RGS and control groups (unpaired Student´s t-test, p = 0.034). 0,2 0,4 0,6 0,8 1 1,2 1,4 1,6 1,8 010 20 30 40 50 60 70 80 90 100 110 120 130 140 Normalized fEPSP amplitude Time (min) RGS14 (n=8) Control (n=9) 1 2 3 1,2 &3 3 1 2 HFS (100Hz) LFS (1Hz) 30ms 0, 4mV -0,35 0,05 -0,35 0,05 -0,35 0,05 -0,35 0,05 -0,35 0,05 -0,35 0,05 -0,35 0,05 -0,35 0,05 Figure 35. Lack of depotentiation in perirhinal cortex of RGS14-treated rats. In vitro extracellular field recordings show that after induction of LTP (4 train of 1 s stimulation at 100 Hz, indicated by arrow), depotentiation was induced by the application of 1 Hz stimulation for 15 min (black thick bar). There was a lack in depotentiation of RGS-treated rats (n = 8, p = 0.565). Traces above the graph are representative fEPSP responses taken from appropriate time points as indicated in 1, 2 and 3. Each trace is the average of four sweeps and stimulus artifacts have been removed for the presentation. Values of normalized fEPSP amplitudes are represented as mean ± SEM. Number (n) represents number of animals used.
IV. Results 85 A B -30 -20 -10 0 10 20 30 40 LTP LTP LTD LTD % Change from baseline Control RGS14 * * * *** (HFS-100 Hz) (HFS-20 Hz) (CCh-50 µM) (CCh-20µM) -30 -20 -10 0 10 20 30 40 Depotenciación % Change from LTP Control RGS14 * Depotentiation (LFS-1 Hz) 2.3.2.4 Summary of RGS14 effect on Hebbian plasticity in perirhinal cortex Figure 36 shows a summary of synaptic plasticity (LTP, muscarinic cholinergic receptor-dependent LTD and depotentiation) in perirhinal cortex in RGS14 and control groups. The percentages of change of normalized fEPSP amplitude (A fEPSPnor) of the RGS14 or control groups from baseline (figure 36.A) or from LTP in the case of depotentiation induction (figure 36.B) are calculated using equation as described in following: Figure 36. Summary of Hebbian plasticity in RGS-treated rats. (A) There was no difference in plasticity between RGS14 and control groups when applying higher level of stimulus (HFS at 100 Hz and carbachol application at 50 µM). However, when lower level of stimulus (HFS at 20 Hz and carbachol application at 20 µM) was applied, both forms (LTP and CCh-LTD) of plasticity were successfully induced in control group but failed to induce in RGS14 group. (B) Application of LFS at 1 Hz for 15 min in LTP induced brain sections led to a lack of depotentiation in RGS14 group. shows significant differences from baseline or LTP and shows significant intergroup differences (p ≤ 0.05). *
IV. Results 86 AfEPSPnor(controlor RGS14)(LTP,LTD,Dep.)–AfEPSPnor(controlor RGS14)(baselineor LTP) ________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________-________________ x100 AfEPSPnor(controlorRGS14)(baselineor LTP) As demonstrated in figure 36.A, application of higher level of stimulus (HFS at 100 Hz and bath application of carbachol at 50 μM) led to an induction of LTP and CCh-LTD in RGS14 group (LTP, 26.271 ± 4.925 % and LTD, -19.022 ± 5.276 %) and in control group (LTP, 29.780 ± 1.451 % and LTD, -23.545 ± 2.242 %), while application of lower level of stimulus (HFS at 20 Hz and bath application of carbachol at 20 μM) produced neither LTP nor CChLTD in the RGS14 group (LTP, -0.697 ± 2.008 % and LTD, -7.012 ± 2.785 %), but in control group application of lower level of stimulus generated both LTP and CCh-LTD (LTP, 8.906 ± 3,027 % and LTD, -16.221 ± 2.92 %). In addition, as shown in figure 36.B, the application of LFS at 1 Hz during 15 min in LTP induced brain sections showed a lack of depotentiation in RGS14 group of animals (-2.868 ± 4.298 %) and in contrary, control group (-15.769 ± 3.570) showed a successful depotentiation. 3 Independent brain areas implicated in ORM processing In addition to area V2 and perirhinal cortex, frontal cortex is an area also known to be crucial in ORM processing (Banks et al 2012; Swick & Knight 1999; Warburton & Brown 2010). Therefore, we examined the role of these 3 areas and their dependence in enhanced ORM processing in RGS14414 gene-treated rats. 3.1 RGS14 enhancer effect on ORM in area V2, perirhinal and frontal cortices As it is shown in figure 37, RGS14414 gene treatment in area V2 and perirhinal and frontal cortices, unlike their corresponding control vehicle, led to an enhancement in ORM. Results show that RGS-animals, which were treated in three brain areas, were able to retain information of an object in memory after a delay of 24 h. An unpaired Student´s t-test between RGS14 group and control vehicle group showed significant difference in area V2 (0.696 ± 0.020, RGS14 group versus 0.515 ± 0.025, control vehicle group; p < 0.001); in perirhinal cortex (0.763 ± 0.012, RGS14 group versus 0.531 ± 0.018, control vehicle group; p < 0.001); and in frontal cortex (0.745 ± 0.048, RGS14 group versus 0.454 ± 0.043, control vehicle group; p < 0.001). These observations further confirm memory enhancer effect of RGS14.
IV. Results 87 A B 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 V2 (n=8-12) PRh (n=8-11) Fr (n=9-10) Discriminationindex Area Vehicle RGS14 V2 Fr PRh V2 Fr PRh V2 Fr PRh Perirhinalcortex Secundaryvisual cortexRhinalsulcus Frontal cortexInjectionsite Ventral Caudal Rostral Dorsal Figure 37. RGS14414 gene treatment in area V2, perirhinal and frontal cortices produces an ORM enhancement. (A) A schematic lateral view of the rat brain showing injection sites: perirhinal cortex (PRh), frontal cortex (Fr) and area V2 (V2). (B) RGS14414 gene treatment in either area V2, PRh or Fr, produced a robust increase in ORM. This memory enhancement was similar to reported previously in area V2. Injections shown in each drawing on top of graph B, indicate RGS treatment site and corresponding results are shown just beneath in bars. Number of rats (n) is indicated beneath bars. shows significant intergroup differences (p ≤ 0.05).
IV. Results 88 Figure 38. Selective lesions in area V2, frontal and perirhinal cortex by Ox7-SAP. A. Cresyl violet-stained sections showing the lesions (indicated by asterisks) produced by immunotoxin Ox7-SAP injection in area V2 (V2, sagittal section), frontal (Fr, sagittal section) and perirhinal (PRh, coronal section) cortices. Bars represent 1000 µm. B. Schematic representation of sagittal (top) and coronal (bottom) serial sections indicating the area of lesion in brown. The lesion is indicated only in the right hemisphere for clarity. 3.2 Independent brain domains in ORM-processing After determination of the implication of area V2 and perirhinal and frontal cortices in ORM, we considered to test the degree of independence of these areas in RGS-mediated memory processing. Here, we have used Ox7-SAP, an immunotoxin that selectively eliminates neurons, as a tool for the generation of lesion in brain (figure 38). 3.2.1 Independence of Area V2 in ORM The results of performance on ORM test of rats who have received RGS14414 treatment in area V2 and were lesioned by Ox7-SAP either in frontal cortex, perirhinal cortex or frontal + perirhinal cortices, are shown in figure 39. The memory enhancer effect of
IV. Results 89 RGS14414 in area V2 was first confirmed (RGS14 group 0.696 ± 0.020 versus control vehicle group 0.510 ± 0.024; unpaired Student´s t-test, p < 0.001). This RGS14-mediated effect on ORM was completely abolished after a selective lesion of area V2, area of RGS14414 injection, by Ox7-SAP administration (0.517 ± 0.026, p < 0.001). However, lesions in frontal cortex (0.702 ± 0.026), perirhinal cortex (0.668 ± 0.033) or even frontal + perirhinal cortices (0.715 ± 0.016) did not produce any effect on memory enhancer effect of RGS14 (p ≤ 0.05). 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 Discrimination index Vehicle in V2 RGS14 in V2 V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh * Figure 39. RGS14414 gene-mediated ORM enhancement in area V2 is independent of perirhinal and frontal cortices. A selective elimination of area V2 neurons by Ox7 treatment completely abolished the ORM enhancement seen after RGS-mediated activation of same area neurons (Bars in “Without Ox7” versus “Ox7 in V2”). This memory enhancement emergence after RGS treatment in area V2 was not affected at all when Ox7 was applied either in frontal (Fr) and perirhinal (PRh) cortices or in both areas together. Injections shown in drawings on top of graph indicate RGS treatment sites and crosses indicate Ox7 treatment sites in each case. Their corresponding results are shown just beneath of them. Number of rats (n) is indicated beneath bars. nnnshows significant intra-group differences and shows significant intergroup differences (p ≤ 0.05). *
IV. Results 90 3.2.2 Independence of perirhinal cortex in ORM Similar to area V2, after confirmation of the enhancer effect of RGS14 in rats treated with RGS14414 gene in perirhinal cortex (RGS14 group 0.760 ± 0.011 versus control vehicle group 0.531 ± 0.018; unpaired Student´s t-test, p < 0.001), a lesion in the same area by Ox7SAP administration, led to complete abolition of enhanced ORM (0.480 ± 0.025, p < 0.001) (figure 40). However, lesions in area V2 (0.728 ± 0.051), frontal cortex (0.682 ± 0.045) or area V2 + frontal cortex (0.708 ± 0.028) did not cause any effect on RGS-mediated ORM enhancement (p ≤ 0.05). 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 Discrimination index Vehicle in PRh RGS14 in PRh * V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh Figure 40. RGS14414 gene treatment–mediated ORM enhancement in perirhinal cortex is independent of are V2 and frontal cortex. Similar to area V2, Ox7 treatment completely abolished the ORM enhancement mediated by RGS14414 gene treatment in perirhinal cortex. However, Ox7 treatment showed no effect on ORM enhancement when administrated in either frontal (Fr) cortex or area V2 (V2) or in both areas together. Injections shown in drawings on top of graph indicate RGS treatment sites and crosses indicate Ox7 treatment sites in each case. Their corresponding results are shown just beneath of them. Number (n) of rats is indicated beneath bars. shows significant intra-group differences and shows significant intergroup differences (p ≤ 0.05). *
IV. Results 91 3.2.3 Independence of frontal cortex in ORM Once memory enhancer effect of RGS14 gene treatment in frontal cortex was confirmed (RGS14 group 0.745 ± 0.048 versus control vehicle group 0.450 ± 0.040; p < 0.001), neurons of frontal cortex implicated in ORM enhancement were eliminated by Ox7SAP administration. This lesion in frontal cortex completely abolished the RGS14-mediated memory enhancer effect (0.479 ± 0.022, p < 0.001) (figure 41). However, lesions in perirhinal cortex (0.693 ± 0.020), area V2 (0.710 ± 0.038) or perirhinal cortex + area V2 (0.731 ± 0.061), did not generate any effect on memory enhancer effect of RGS14 (p ≤ 0.05). 0 0,1 0,2 0,3 0,4 0,5 0,6 0,7 0,8 0,9 Discrimination index Vehicle in Fr RGS14 in Fr * V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh V2 Fr PRh Figure 41. RGS14414 gene treatment–mediated ORM enhancement in frontal cortex is independent of area V2 and perirhinal cortices. ORM enhancement associated to RGS14414 gene treatment in frontal cortex was abolished by Ox7 administration in the same area, however, Ox7 administration in perirhinal (PRh) cortex and area V2 (V2) individually or together in both areas produces no effect on ORM enhancement. Injections shown in drawings on top of graph indicate RGS treatment sites and crosses indicate Ox7 treatment sites in each case. Their corresponding results are shown just beneath of them. Number of rats (n) is indicated beneath bars. nnshows significant intra-group differences and shows significant intergroup differences (p ≤ 0.05). *
V. Discussion 98 3 RGS14 does not facilitate the Hebbian synaptic plasticity Knowing the fact that RGS14 gene treatment upregulates GluR2 and the role of GluR2 in regulation of synaptic plasticity (Asrar & Jia 2013; Huganir & Nicoll 2013; Isaac et al 2007), we next planted to explore how high level of this protein in RGS-animals will effect on the different forms of synaptic plasticity, such as LTP, LTD and depotentiation. However, in literature, electrophysiological studies of synaptic plasticity that have a well-defined relation to ORM, are primarily done in perirhinal cortex and none in area V2. Therefore, we went on to test the memory enhancer effect of RGS14414 gene treatment in perirhinal cortex, with the idea to validate this area for electrophysiological studies. The memory enhancer effect of RGS14 in this brain area was similar to as previously observed in area V2. We found no difference in both areas. This result was no surprise because considering that perirhinal cortex is one of the principal brain areas that participate in neuronal circuit responsible for ORM (Brown & Aggleton 2001; Kim et al 2014; Lech & Suchan 2013; Martin et al 2013; Ranganath & Ritchey 2012; Warburton & Brown 2010; Watson & Lee 2013), and cellular mediation of RGS14 effect should not discriminate between area V2 and perirhinal cortex neurons. A study of in vitro extracellular field recordings in perirhinal cortex of brain slices obtained from RGS-treated rats showed no effect on both LTP and LTD when high level of stimulation was applied (100 Hz for LTP and 50 µM carbachol for LTD). However, low level of stimulation (20 Hz for LTP and 20 µM carbachol for LTD) reduced their maintenance for long-term. In addition, RGS14 treatment blocked the induction of depotentiation generated by low frequency stimulation of 1 Hz, and once stopped the application of this stimulation, it went back to same LTP level as was prior to depotentiation. These results support the notion that RGS 14 treatment does not favor Hebbian synaptic plasticity, not even in the presence of higher concentration of GluR2 protein. Despite the fact that underlying mechanism of this lack in plasticity is yet to be elucidated, we hypothesize that a decrease in the calcium influx through RGS-mediated blockage of L-type calcium channel could trigger impairments seen in Hebbian plasticity. Because RGS14414 reduces intracellular Ca2+ levels by blocking L-type calcium channels (Martin-Montanez et al 2010) and intracellular Ca2+ levels are welldocumented for their direct implication in different forms of Hebbian plasticity (Baker et al 2013). Interestingly, in addition to the fact that the administration of L-type calcium channel antagonists has been demonstrated to improve spatial memory in rodents (Levy et al 1991;
V. Discussion 99 Quartermain et al 2001), several studies have reported a link between calcium channel antagonists and rescue of memory loss. Nimodipine, an L-type calcium channel blocker, prevents age-associated memory deficits in aged rodents (Batuecas et al 1998; Hopp et al 2014; Ingram et al 1994; Moyer et al 1992; Thompson et al 1990) as well as memory loss deficits caused by alcohol or morphine withdrawal in rodents (Brooks et al 2008; Brooks et al 2002; Vaseghi et al 2014; Vaseghi et al 2012). Furthermore, epidemiological evidence shows that L-type calcium channel antagonism is associated with reduced prevalence of Alzheimer’s disease (AD) (Anekonda & Quinn 2011; Lopez-Arrieta & Birks 2002) and AD patients given the L-type calcium channel antagonist nimodipine showed improvements over placebotreated patients on several cognitive measures (Tollefson 1990). It should be pointed that a lack in Hebbian plasticity in RGS-animals does not mean that there should not be enhancement in ORM in these animals. Instead, there is ample evidence in literature showing memory enhancement independent to Hebbian plasticity. It is becoming increasingly evident that memory is also reliant on non-Hebbian forms of plasticity, such as intrinsic plasticity and synaptic scaling (Baker-Andresen et al 2013; Nelson & Turrigiano 2008). For instance, RGS14-mediated memory enhancement could be explained by a facilitation of synaptic scaling, the best understood form of homeostatic plasticity at central excitatory synapses (Davis 2006; Turrigiano 2008; Turrigiano & Nelson 2004), that has now been shown in a variety of central neurons both in vitro and in vivo, including neocortical and hippocampal pyramidal neurons and spinal neurons (Chandler & Grossberg 2012; Desai et al 2002; Goel & Lee 2007; Kim & Tsien 2008; Knogler et al 2010; O'Brien et al 1998; Stellwagen & Malenka 2006; Turrigiano et al 1998). Though, we have no data showing the involvement of non-Hebbian plasticity or intracellular Ca2+ levels, this laboratory continues to explore this route for possible explanation of ORM enhancement in RGS-treated rats. 4 Independent brain areas can promote RGS-mediated recovery of ORM loss The most surprising part of our results showing the recovery of ORM loss in rodent models was how activation of area V2, a brain area never been demonstrated to be involved in memory dysfunction, is able to correct memory deficit that might have been originated by two distinct mechanisms in both models. It is thought that ORM in brain is processed through specialized neuronal circuit, which is formed by the participation of multiple brain areas.
V. Discussion 100 Within this neuronal circuit, the role of perirhinal cortex (Brown & Aggleton 2001; Kim et al 2014; Lech & Suchan 2013; Martin et al 2013; Ranganath & Ritchey 2012; Warburton & Brown 2010; Watson & Lee 2013) and frontal cortex (Banks et al 2012; Swick & Knight 1999; Warburton & Brown 2010) in object recognition have been well studied. And now, our laboratory has discovered that area V2 (Lopez-Aranda et al 2006) play an important role in ORM processing. Therefore, we thought that if activation of area V2 by RGS treatment can recuperate ORM loss, same treatment either in frontal cortex or in perirhinal cortex should produce same effect on memory. To simulate ORM deficit seen in many brain diseases and aging conditions, we performed lesion either in area V2, frontal cortex or perirhinal cortex. Lesions in any one of the three areas produced substantial damage and significant loss in ORM. Further, a treatment with RGS14414 in one of the non-lesion areas of these three brain areas restored the memory to normal level. The activity associated with recuperation in memory loss by RGS14 treatment was to an extent that it was ample even when two of the three brain areas were damaged by lesion. Our results of full recuperation of memory loss in rats with lesion suggest that area V2, frontal and perirhinal cortices are independently adequate for treatment of memory loss in spite of where the primary cause is localized in whole brain. Considering that lesion produced here was with the use of Ox7-SAP, which selectively eliminates neurons and does not affect other structures and cell types, including passing by fibers, the information could still pass through the damaged brain areas. In light of this observation, our results indicate that RGS-mediated neuronal activation contributes to stabilization and subsequently normalization in dysfunctional ORM circuit that runs through various brain areas. 5 Mechanism of RGS-mediated memory enhancement and recovery of ORM loss Mechanism that drives a recuperation of ORM loss in both rodent models and in rats with lesion seems to be associated with the activation of GluR2 activity. A down-regulation in GluR2 levels has been reported in normal aging (Liu et al 2008; Yu et al 2011) and in Alzheimer´s disease (Resende et al 2007). This decrease in GluR2 subunit of glutamate AMPA receptors was thought to be responsible for significant rise in cytosolic Ca2+ concentration, which as a consequence led to dendritic dystrophy and impairment in synaptic function (Hof et al 2002; Resende et al 2007). Normalization in GluR2 levels after treatment
V. Discussion 101 with RGS14414 might cause a decrease in cytosolic Ca2+ concentration as seen previously (Martin-Montanez et al 2010). Apart from work of current thesis, this laboratory has discovered that RGS14 gene treatment produces a robust neuronal arborization (NavarroLobato 2015). Therefore, it is argued that an increase in neuronal connections might not only promote restructuration of the circuit responsible for RGS-mediated ORM enhancement, but could also facilitate the flow of information during ORM processing. Loss of AMPA receptors from the postsynaptic neurons resulted in reduced dendritic branch stability (Haas et al 2006), whereas overexpression of AMPA receptor subunits led to increased numbers of branch segments (Chen et al 2009; Prithviraj et al 2008). Moreover, GluR2 overexpression increased spine density in hippocampus (Passafaro et al 2003) and dendritic length in developing cortical neurons in rat embryos (Chen et al 2009), whereas GluR2 downregulation caused a loss of dendritic branch segments in the hippocampus (Passafaro et al 2003) and reduced the dendritic arborization of developing spinal motoneurons in chicken embryos (Yoon et al 2012). Though the complete mechanistic map of RGS14-mediated memory enhancement and recuperation of memory loss has long way to go, results from current work suggest that GluR2 overexpression could be the trigger for an increased dendritic arborization promoting the appearance of new synapses and therefore, causing a restructuration of the circuit responsible for RGS14-mediated ORM enhancement. And most importantly, we have demonstrated that an episodic memory (ORM) loss can be recovered by RGS14414 gene treatment either in area V2, frontal cortex or perirhinal cortex, and this recuperation is independent to where origination of memory loss is localized in brain. Thus, a treatment is feasible without knowing the area or areas of brain implicated in memory loss. Current work provides a strategic platform for treatment of memory loss observed in many neurological and neurodegenerative diseases and in normal aging.
VI. Conclusions
VI. Conclusions 105 1. RGS14414 gene treatment not only led to full recovery of an episodic memory loss in rodent models of normal aging and Alzheimer´s disease, but also aided in maintenance of the elevated ORM levels for long time. 2. GluR2, an AMPA receptor subunit, is a key in RGS14-mediated ORM enhancement. In addition to upregulated level, GluR2 subunit showed a dynamic participation in conversion of short-term ORM into long-term memory. 3. RGS14414 gene treatment did not favor Hebbian synaptic plasticity, which included LTP, muscarinic receptor-dependent LTD, and depotentiation. Though underlying cause of this lack in plasticity is yet to be elucidated, we believe that a decrease in calcium influx through RGS14-mediated blockage of L-type calcium channel could trigger the impairments seen in Hebbian plasticity, and that RGS14-mediated ORM enhancement could be reliant on nonHebbian forms of plasticity. 4. Area V2, frontal cortex and perirhinal cortex, areas that participate in brain circuit responsible for ORM processing, are not dependent on each other in RGS14-mediated memory enhancement. This independency of these brain areas in memory enhancement suggests that they are individually adequate for treatment of memory loss, in spite of where the primary cause is localized in brain. 5. The results of memory loss recovery in rodent models and of memory enhancement in lesioned rats demonstrate that RGS14414 gene therapy might be a viable strategy for the treatment of memory loss in patients.
VII. References
VII. References 114 Hollinger S, Taylor JB, Goldman EH, Hepler JR. 2001. RGS14 is a bifunctional regulator of Galphai/o activity that exists in multiple populations in brain. J Neurochem 79:941-9 Hollmann M, Heinemann S. 1994. Cloned glutamate receptors. Annu Rev Neurosci 17:31-108 Hopp SC, D'Angelo HM, Royer SE, Kaercher RM, Adzovic L, Wenk GL. 2014. Differential rescue of spatial memory deficits in aged rats by L-type voltage-dependent calcium channel and ryanodine receptor antagonism. Neuroscience 280:10-8 Huganir RL, Nicoll RA. 2013. AMPARs and synaptic plasticity: the last 25 years. Neuron 80:704-17 Ichim CV, Wells RA. 2011. Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation. J Transl Med 9:137 Ingram DK, Joseph JA, Spangler EL, Roberts D, Hengemihle J, Fanelli RJ. 1994. Chronic nimodipine treatment in aged rats: analysis of motor and cognitive effects and muscarinic-induced striatal dopamine release. Neurobiol Aging 15:55-61 Insausti R, Herrero MT, Witter MP. 1997. Entorhinal cortex of the rat: cytoarchitectonic subdivisions and the origin and distribution of cortical efferents. Hippocampus 7:146-83 Irvine EE, von Hertzen LS, Plattner F, Giese KP. 2006. alphaCaMKII autophosphorylation: a fast track to memory. Trends Neurosci 29:459-65 Isaac JT, Ashby MC, McBain CJ. 2007. The role of the GluR2 subunit in AMPA receptor function and synaptic plasticity. Neuron 54:859-71 Ju BG, Solum D, Song EJ, Lee KJ, Rose DW, et al. 2004. Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell 119:815-29 Kajiwara R, Takashima I, Mimura Y, Witter MP, Iijima T. 2003. Amygdala input promotes spread of excitatory neural activity from perirhinal cortex to the entorhinal-hippocampal circuit. J Neurophysiol 89:2176-84 Kealy J, Commins S. 2011. The rat perirhinal cortex: A review of anatomy, physiology, plasticity, and function. Prog Neurobiol 93:522-48 Keinanen K, Wisden W, Sommer B, Werner P, Herb A, et al. 1990. A family of AMPA-selective glutamate receptors. Science 249:556-60 Kelly A, Laroche S, Davis S. 2003. Activation of mitogen-activated protein kinase/extracellular signal-regulated kinase in hippocampal circuitry is required for consolidation and reconsolidation of recognition memory. J Neurosci 23:5354-60 Kemp N, Bashir ZI. 2001. Long-term depression: a cascade of induction and expression mechanisms. Prog Neurobiol 65:339-65 Killiany RJ, Hyman BT, Gomez-Isla T, Moss MB, Kikinis R, et al. 2002. MRI measures of entorhinal cortex vs hippocampus in preclinical AD. Neurology 58:1188-96 Kim J, Tsien RW. 2008. Synapse-specific adaptations to inactivity in hippocampal circuits achieve homeostatic gain control while dampening network reverberation. Neuron 58:925-37 Kim JH, Anwyl R, Suh YH, Djamgoz MB, Rowan MJ. 2001. Use-dependent effects of amyloidogenic fragments of (beta)-amyloid precursor protein on synaptic plasticity in rat hippocampus in vivo. J Neurosci 21:1327-33 Kim JM, Kim DH, Lee Y, Park SJ, Ryu JH. 2014. Distinct roles of the hippocampus and perirhinal cortex in GABAA receptor blockade-induced enhancement of object recognition memory. Brain Res 1552:17-25 Kimple RJ, De Vries L, Tronchere H, Behe CI, Morris RA, et al. 2001. RGS12 and RGS14 GoLoco motifs are G alpha(i) interaction sites with guanine nucleotide dissociation inhibitor Activity. J Biol Chem 276:29275-81 Kitazawa M, Medeiros R, Laferla FM. 2012. Transgenic mouse models of Alzheimer disease: developing a better model as a tool for therapeutic interventions. Curr Pharm Des 18:1131-47 Knobloch M, Farinelli M, Konietzko U, Nitsch RM, Mansuy IM. 2007. Abeta oligomer-mediated long-term potentiation impairment involves protein phosphatase 1-dependent mechanisms. J Neurosci 27:7648-53 Knogler LD, Liao M, Drapeau P. 2010. Synaptic scaling and the development of a motor network. J Neurosci 30:8871-81
VII. References 115 Krum JM, Kenyon KL, Rosenstein JM. 1997. Expression of blood-brain barrier characteristics following neuronal loss and astroglial damage after administration of anti-Thy-1 immunotoxin. Exp Neurol 146:33-45 Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-5 Larminie C, Murdock P, Walhin JP, Duckworth M, Blumer KJ, et al. 2004. Selective expression of regulators of G-protein signaling (RGS) in the human central nervous system. Brain Res Mol Brain Res 122:24-34 Lashgari R, Motamedi F, Zahedi Asl S, Shahidi S, Komaki A. 2006. Behavioral and electrophysiological studies of chronic oral administration of L-type calcium channel blocker verapamil on learning and memory in rats. Behav Brain Res 171:324-8 Laube B, Kuhse J, Betz H. 1998. Evidence for a tetrameric structure of recombinant NMDA receptors. J Neurosci 18:2954-61 Lautier D, Lagueux J, Thibodeau J, Menard L, Poirier GG. 1993. Molecular and biochemical features of poly (ADP-ribose) metabolism. Mol Cell Biochem 122:171-93 Lech RK, Suchan B. 2013. The medial temporal lobe: memory and beyond. Behav Brain Res 254:45-9 Lee SE, Simons SB, Heldt SA, Zhao M, Schroeder JP, et al. 2010. RGS14 is a natural suppressor of both synaptic plasticity in CA2 neurons and hippocampal-based learning and memory. Proc Natl Acad Sci U S A 107:16994-8 Lee YS, Silva AJ. 2009. The molecular and cellular biology of enhanced cognition. Nat Rev Neurosci 10:126-40 Leon WC, Bruno MA, Allard S, Nader K, Cuello AC. 2010. Engagement of the PFC in consolidation and recall of recent spatial memory. Learn Mem 17:297-305 Levy A, Kong RM, Stillman MJ, Shukitt-Hale B, Kadar T, et al. 1991. Nimodipine improves spatial working memory and elevates hippocampal acetylcholine in young rats. Pharmacol Biochem Behav 39:781-6 Li S, Hong S, Shepardson NE, Walsh DM, Shankar GM, Selkoe D. 2009. Soluble oligomers of amyloid Beta protein facilitate hippocampal long-term depression by disrupting neuronal glutamate uptake. Neuron 62:788-801 Li YQ, Xue YX, He YY, Li FQ, Xue LF, et al. 2011. Inhibition of PKMzeta in nucleus accumbens core abolishes long-term drug reward memory. J Neurosci 31:5436-46 Lisman J, Schulman H, Cline H. 2002. The molecular basis of CaMKII function in synaptic and behavioural memory. Nat Rev Neurosci 3:175-90 Liu P, Smith PF, Darlington CL. 2008. Glutamate receptor subunits expression in memory-associated brain structures: regional variations and effects of aging. Synapse 62:834-41 Lopez-Aranda MF, Acevedo MJ, Carballo FJ, Gutierrez A, Khan ZU. 2006. Localization of the GoLoco motif carrier regulator of G-protein signalling 12 and 14 proteins in monkey and rat brain. Eur J Neurosci 23:2971-82 Lopez-Aranda MF, Lopez-Tellez JF, Navarro-Lobato I, Masmudi-Martin M, Gutierrez A, Khan ZU. 2009. Role of layer 6 of V2 visual cortex in object-recognition memory. Science 325:87-9 Lopez-Arrieta JM, Birks J. 2002. Nimodipine for primary degenerative, mixed and vascular dementia. Cochrane Database Syst Rev:CD000147 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-75 Lu KT, Walker DL, Davis M. 2001. Mitogen-activated protein kinase cascade in the basolateral nucleus of amygdala is involved in extinction of fear-potentiated startle. J Neurosci 21:RC162 Lu W, Khatri L, Ziff EB. 2014. Trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA) receptor subunit GluA2 from the endoplasmic reticulum is stimulated by a complex containing Ca2+/calmodulin-activated kinase II (CaMKII) and PICK1 protein and by release of Ca2+ from internal stores. J Biol Chem 289:19218-30 Lu W, Shi Y, Jackson AC, Bjorgan K, During MJ, et al. 2009. Subunit composition of synaptic AMPA receptors revealed by a single-cell genetic approach. Neuron 62:254-68 Lucchesi W, Mizuno K, Giese KP. 2011. Novel insights into CaMKII function and regulation during memory formation. Brain Res Bull 85:2-8 Malenka RC, Bear MF. 2004. LTP and LTD: an embarrassment of riches. Neuron 44:5-21
VII. References 116 Malkova L, Forcelli PA, Wellman LL, Dybdal D, Dubach MF, Gale K. 2015. Blockade of glutamatergic transmission in perirhinal cortex impairs object recognition memory in macaques. J Neurosci 35:5043-50 Marchetti C, Marie H. 2011. Hippocampal synaptic plasticity in Alzheimer's disease: what have we learned so far from transgenic models? Rev Neurosci 22:373-402 Martin-Montanez E, Acevedo MJ, Lopez-Tellez JF, Duncan RS, Mateos AG, et al. 2010. Regulator of G-protein signaling 14 protein modulates Ca(2)+ influx through Cav1 channels. Neuroreport 21:1034-9 Martin CB, McLean DA, O'Neil EB, Kohler S. 2013. Distinct familiarity-based response patterns for faces and buildings in perirhinal and parahippocampal cortex. J Neurosci 33:10915-23 Martin SJ, Morris RG. 2002. New life in an old idea: the synaptic plasticity and memory hypothesis revisited. Hippocampus 12:609-36 Massey PV, Bhabra G, Cho K, Brown MW, Bashir ZI. 2001. Activation of muscarinic receptors induces protein synthesis-dependent long-lasting depression in the perirhinal cortex. Eur J Neurosci 14:145-52 Massey PV, Johnson BE, Moult PR, Auberson YP, Brown MW, et al. 2004. Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and longterm depression. J Neurosci 24:7821-8 McCaffery B, Cho K, Bortolotto ZA, Aggleton JP, Brown MW, et al. 1999. Synaptic depression induced by pharmacological activation of metabotropic glutamate receptors in the perirhinal cortex in vitro. Neuroscience 93:977-84 Mead AN, Stephens DN. 2003. Involvement of AMPA receptor GluR2 subunits in stimulus-reward learning: evidence from glutamate receptor gria2 knock-out mice. J Neurosci 23:9500-7 Migues PV, Hardt O, Wu DC, Gamache K, Sacktor TC, et al. 2010. PKMzeta maintains memories by regulating GluR2-dependent AMPA receptor trafficking. Nat Neurosci 13:630-4 Mittal V, Linder ME. 2004. The RGS14 GoLoco domain discriminates among Galphai isoforms. J Biol Chem 279:46772-8 Mittal V, Linder ME. 2006. Biochemical characterization of RGS14: RGS14 activity towards Gprotein alpha subunits is independent of its binding to Rap2A. Biochem J 394:309-15 Moore CI, Browning MD, Rose GM. 1993. Hippocampal plasticity induced by primed burst, but not long-term potentiation, stimulation is impaired in area CA1 of aged Fischer 344 rats. Hippocampus 3:57-66 Morris RG, Anderson E, Lynch GS, Baudry M. 1986. Selective impairment of learning and blockade of long-term potentiation by an N-methyl-D-aspartate receptor antagonist, AP5. Nature 319:774-6 Moyer JR, Jr., Thompson LT, Black JP, Disterhoft JF. 1992. Nimodipine increases excitability of rabbit CA1 pyramidal neurons in an ageand concentration-dependent manner. J Neurophysiol 68:2100-9 Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, et al. 2000. High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J Neurosci 20:4050-8 Murray EA, Bussey TJ, Saksida LM. 2007. Visual perception and memory: a new view of medial temporal lobe function in primates and rodents. Annu Rev Neurosci 30:99-122 Naie K, Manahan-Vaughan D. 2005. Pharmacological antagonism of metabotropic glutamate receptor 1 regulates long-term potentiation and spatial reference memory in the dentate gyrus of freely moving rats via N-methyl-D-aspartate and metabotropic glutamate receptor-dependent mechanisms. Eur J Neurosci 21:411-21 Navarro-Lobato I. 2015. RGS14414-mediated prevention of an episodic memory loss: a study of molecular mechanism. Ph.D. thesis. Universidad de Málaga, Málaga Nelson SB, Turrigiano GG. 2008. Strength through diversity. Neuron 60:477-82 Neves SR, Ram PT, Iyengar R. 2002. G protein pathways. Science 296:1636-9 Nolan BC, Freeman JH, Jr. 2005. Purkinje cell loss by OX7-saporin impairs excitatory and inhibitory eyeblink conditioning. Behav Neurosci 119:190-201 Norris CM, Korol DL, Foster TC. 1996. Increased susceptibility to induction of long-term depression and long-term potentiation reversal during aging. J Neurosci 16:5382-92
VII. References 117 Nyberg L, Lovden M, Riklund K, Lindenberger U, Backman L. 2012. Memory aging and brain maintenance. Trends Cogn Sci 16:292-305 O'Brien RJ, Kamboj S, Ehlers MD, Rosen KR, Fischbach GD, Huganir RL. 1998. Activity-dependent modulation of synaptic AMPA receptor accumulation. Neuron 21:1067-78 Oster H, Eichele G, Leitges M. 2004. Differential expression of atypical PKCs in the adult mouse brain. Brain Res Mol Brain Res 127:79-88 Palop JJ, Chin J, Roberson ED, Wang J, Thwin MT, et al. 2007. Aberrant excitatory neuronal activity and compensatory remodeling of inhibitory hippocampal circuits in mouse models of Alzheimer's disease. Neuron 55:697-711 Passafaro M, Nakagawa T, Sala C, Sheng M. 2003. Induction of dendritic spines by an extracellular domain of AMPA receptor subunit GluR2. Nature 424:677-81 Paxinos G, Franklin KBJ. 2001. The mouse brain in stereotaxic coordinates. San Diego: Academic Press Paxinos G, Watson C. 1998. The rat brain in stereotaxic coordinates. San Diego: Academic Press Pear WS, Nolan GP, Scott ML, Baltimore D. 1993. Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90:8392-6 Persson J, Pudas S, Lind J, Kauppi K, Nilsson LG, Nyberg L. 2012. Longitudinal structure-function correlates in elderly reveal MTL dysfunction with cognitive decline. Cereb Cortex 22:2297304 Petersen RC. 2000. Aging, mild cognitive impairment, and Alzheimer's disease. Neurol Clin 18:789806 Premkumar LS, Auerbach A. 1997. Stoichiometry of recombinant N-methyl-D-aspartate receptor channels inferred from single-channel current patterns. J Gen Physiol 110:485-502 Prithviraj R, Kelly KM, Espinoza-Lewis R, Hexom T, Clark AB, Inglis FM. 2008. Differential regulation of dendrite complexity by AMPA receptor subunits GluR1 and GluR2 in motor neurons. Dev Neurobiol 68:247-64 Puzzo D, Privitera L, Fa M, Staniszewski A, Hashimoto G, et al. 2011. Endogenous amyloid-beta is necessary for hippocampal synaptic plasticity and memory. Ann Neurol 69:819-30 Puzzo D, Privitera L, Leznik E, Fa M, Staniszewski A, et al. 2008. Picomolar amyloid-beta positively modulates synaptic plasticity and memory in hippocampus. J Neurosci 28:14537-45 Quartermain D, deSoria VG, Kwan A. 2001. Calcium channel antagonists enhance retention of passive avoidance and maze learning in mice. Neurobiol Learn Mem 75:77-90 Ranganath C, Ritchey M. 2012. Two cortical systems for memory-guided behaviour. Nat Rev Neurosci 13:713-26 Raz N, Lindenberger U, Rodrigue KM, Kennedy KM, Head D, et al. 2005. Regional brain changes in aging healthy adults: general trends, individual differences and modifiers. Cereb Cortex 15:1676-89 Reiser J. 2000. Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene Ther 7:910-3 Resende R, Pereira C, Agostinho P, Vieira AP, Malva JO, Oliveira CR. 2007. Susceptibility of hippocampal neurons to Abeta peptide toxicity is associated with perturbation of Ca2+ homeostasis. Brain Res 1143:11-21 Rodrigue KM, Raz N. 2004. Shrinkage of the entorhinal cortex over five years predicts memory performance in healthy adults. J Neurosci 24:956-63 Rosenzweig ES, Rao G, McNaughton BL, Barnes CA. 1997. Role of temporal summation in agerelated long-term potentiation-induction deficits. Hippocampus 7:549-58 Ross EM, Wilkie TM. 2000. GTPase-activating proteins for heterotrimeric G proteins: regulators of G protein signaling (RGS) and RGS-like proteins. Annu Rev Biochem 69:795-827 Rouleau M, Aubin RA, Poirier GG. 2004. Poly(ADP-ribosyl)ated chromatin domains: access granted. J Cell Sci 117:815-25 Sacktor TC. 2011. How does PKMzeta maintain long-term memory? Nat Rev Neurosci 12:9-15 Saganich MJ, Schroeder BE, Galvan V, Bredesen DE, Koo EH, Heinemann SF. 2006. Deficits in synaptic transmission and learning in amyloid precursor protein (APP) transgenic mice require C-terminal cleavage of APP. J Neurosci 26:13428-36
VII. References 118 Sagata N, Iwaki A, Aramaki T, Takao K, Kura S, et al. 2010. Comprehensive behavioural study of GluR4 knockout mice: implication in cognitive function. Genes Brain Behav 9:899-909 Salmon DP. 2012. Neuropsychological features of mild cognitive impairment and preclinical Alzheimer's disease. Curr Top Behav Neurosci 10:187-212 Schafe GE, Atkins CM, Swank MW, Bauer EP, Sweatt JD, LeDoux JE. 2000. Activation of ERK/MAP kinase in the amygdala is required for memory consolidation of pavlovian fear conditioning. J Neurosci 20:8177-87 Schiapparelli L, Simon AM, Del Rio J, Frechilla D. 2006. Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus. Neuropharmacology 50:897-907 Schreiber V, Dantzer F, Ame JC, de Murcia G. 2006. Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol 7:517-28 Seoane A, Massey PV, Keen H, Bashir ZI, Brown MW. 2009. L-type voltage-dependent calcium channel antagonists impair perirhinal long-term recognition memory and plasticity processes. J Neurosci 29:9534-44 Serrano P, Friedman EL, Kenney J, Taubenfeld SM, Zimmerman JM, et al. 2008. PKMzeta maintains spatial, instrumental, and classically conditioned long-term memories. PLoS Biol 6:2698-706 Shalin SC, Zirrgiebel U, Honsa KJ, Julien JP, Miller FD, et al. 2004. Neuronal MEK is important for normal fear conditioning in mice. J Neurosci Res 75:760-70 Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, et al. 2008. Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 14:837-42 Shema R, Haramati S, Ron S, Hazvi S, Chen A, et al. 2011. Enhancement of consolidated long-term memory by overexpression of protein kinase Mzeta in the neocortex. Science 331:1207-10 Shema R, Hazvi S, Sacktor TC, Dudai Y. 2009. Boundary conditions for the maintenance of memory by PKMzeta in neocortex. Learn Mem 16:122-8 Shing YL, Werkle-Bergner M, Brehmer Y, Muller V, Li SC, Lindenberger U. 2010. Episodic memory across the lifespan: the contributions of associative and strategic components. Neurosci Biobehav Rev 34:1080-91 Shu FJ, Ramineni S, Amyot W, Hepler JR. 2007. Selective interactions between Gi alpha1 and Gi alpha3 and the GoLoco/GPR domain of RGS14 influence its dynamic subcellular localization. Cell Signal 19:163-76 Shu FJ, Ramineni S, Hepler JR. 2010. RGS14 is a multifunctional scaffold that integrates G protein and Ras/Raf MAPkinase signalling pathways. Cell Signal 22:366-76 Simonyi A, Serfozo P, Shelat PB, Dopheide MM, Coulibaly AP, Schachtman TR. 2007. Differential roles of hippocampal metabotropic glutamate receptors 1 and 5 in inhibitory avoidance learning. Neurobiol Learn Mem 88:305-11 Snow BE, Antonio L, Suggs S, Gutstein HB, Siderovski DP. 1997. Molecular cloning and expression analysis of rat Rgs12 and Rgs14. Biochem Biophys Res Commun 233:770-7 Squire LR, Stark CE, Clark RE. 2004. The medial temporal lobe. Annu Rev Neurosci 27:279-306 Squire LR, Wixted JT, Clark RE. 2007. Recognition memory and the medial temporal lobe: a new perspective. Nat Rev Neurosci 8:872-83 Stellwagen D, Malenka RC. 2006. Synaptic scaling mediated by glial TNF-alpha. Nature 440:1054-9 Stern SA, Alberini CM. 2013. Mechanisms of memory enhancement. Wiley Interdiscip Rev Syst Biol Med 5:37-53 Swanson GT, Kamboj SK, Cull-Candy SG. 1997. Single-channel properties of recombinant AMPA receptors depend on RNA editing, splice variation, and subunit composition. J Neurosci 17:58-69 Swick D, Knight RT. 1999. Contributions of prefrontal cortex to recognition memory: electrophysiological and behavioral evidence. Neuropsychology 13:155-70 Sydow A, Van der Jeugd A, Zheng F, Ahmed T, Balschun D, et al. 2011. Tau-induced defects in synaptic plasticity, learning, and memory are reversible in transgenic mice after switching off the toxic Tau mutant. J Neurosci 31:2511-25 Taylor KI, Probst A. 2008. Anatomic localization of the transentorhinal region of the perirhinal cortex. Neurobiol Aging 29:1591-6
VII. References 119 Thompson LT, Deyo RA, Disterhoft JF. 1990. Nimodipine enhances spontaneous activity of hippocampal pyramidal neurons in aging rabbits at a dose that facilitates associative learning. Brain Res 535:119-30 Tinsley CJ, Fontaine-Palmer NS, Vincent M, Endean EP, Aggleton JP, et al. 2011. Differing time dependencies of object recognition memory impairments produced by nicotinic and muscarinic cholinergic antagonism in perirhinal cortex. Learn Mem 18:484-92 Tinsley CJ, Narduzzo KE, Ho JW, Barker GR, Brown MW, Warburton EC. 2009. A role for calciumcalmodulin-dependent protein kinase II in the consolidation of visual object recognition memory. Eur J Neurosci 30:1128-39 Tollefson GD. 1990. Short-term effects of the calcium channel blocker nimodipine (Bay-e-9736) in the management of primary degenerative dementia. Biol Psychiatry 27:1133-42 Tombaugh GC, Rowe WB, Chow AR, Michael TH, Rose GM. 2002. Theta-frequency synaptic potentiation in CA1 in vitro distinguishes cognitively impaired from unimpaired aged Fischer 344 rats. J Neurosci 22:9932-40 Traissard N, Herbeaux K, Cosquer B, Jeltsch H, Ferry B, et al. 2007. Combined damage to entorhinal cortex and cholinergic basal forebrain neurons, two early neurodegenerative features accompanying Alzheimer's disease: effects on locomotor activity and memory functions in rats. Neuropsychopharmacology 32:851-71 Traver S, Bidot C, Spassky N, Baltauss T, De Tand MF, et al. 2000. RGS14 is a novel Rap effector that preferentially regulates the GTPase activity of galphao. Biochem J 350 Pt 1:19-29 Traver S, Splingard A, Gaudriault G, De Gunzburg J. 2004. The RGS (regulator of G-protein signalling) and GoLoco domains of RGS14 co-operate to regulate Gi-mediated signalling. Biochem J 379:627-32 Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, et al. 2010. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev 62:405-96 Trinchese F, Liu S, Battaglia F, Walter S, Mathews PM, Arancio O. 2004. Progressive age-related development of Alzheimer-like pathology in APP/PS1 mice. Ann Neurol 55:801-14 Turrigiano GG. 2008. The self-tuning neuron: synaptic scaling of excitatory synapses. Cell 135:42235 Turrigiano GG, Leslie KR, Desai NS, Rutherford LC, Nelson SB. 1998. Activity-dependent scaling of quantal amplitude in neocortical neurons. Nature 391:892-6 Turrigiano GG, Nelson SB. 2004. Homeostatic plasticity in the developing nervous system. Nat Rev Neurosci 5:97-107 van Strien NM, Cappaert NL, Witter MP. 2009. The anatomy of memory: an interactive overview of the parahippocampal-hippocampal network. Nat Rev Neurosci 10:272-82 Vaseghi G, Hajhashemi V, Rabbani M. 2014. The effect of nimodipine on memory loss following naloxone-induced morphine withdrawal in object recognition. Res Pharm Sci 9:445-51 Vaseghi G, Rabbani M, Hajhashemi V. 2012. The effect of nimodipine on memory impairment during spontaneous morphine withdrawal in mice: Corticosterone interaction. Eur J Pharmacol 695:83-7 Volk LJ, Bachman JL, Johnson R, Yu Y, Huganir RL. 2013. PKM-zeta is not required for hippocampal synaptic plasticity, learning and memory. Nature 493:420-3 Wang SH, Liao XM, Liu D, Hu J, Yin YY, et al. 2012. NGF promotes long-term memory formation by activating poly(ADP-ribose)polymerase-1. Neuropharmacology 63:1085-92 Warburton EC, Brown MW. 2010. Findings from animals concerning when interactions between perirhinal cortex, hippocampus and medial prefrontal cortex are necessary for recognition memory. Neuropsychologia 48:2262-72 Warburton EC, Koder T, Cho K, Massey PV, Duguid G, et al. 2003. Cholinergic neurotransmission is essential for perirhinal cortical plasticity and recognition memory. Neuron 38:987-96 Watson HC, Lee AC. 2013. The perirhinal cortex and recognition memory interference. J Neurosci 33:4192-200 Wayman GA, Lee YS, Tokumitsu H, Silva AJ, Soderling TR. 2008. Calmodulin-kinases: modulators of neuronal development and plasticity. Neuron 59:914-31 Wenthold RJ, Petralia RS, Blahos J, II, Niedzielski AS. 1996. Evidence for multiple AMPA receptor complexes in hippocampal CA1/CA2 neurons. J Neurosci 16:1982-9
VII. References 120 Whitlock JR, Heynen AJ, Shuler MG, Bear MF. 2006. Learning induces long-term potentiation in the hippocampus. Science 313:1093-7 Willard FS, Willard MD, Kimple AJ, Soundararajan M, Oestreich EA, et al. 2009. Regulator of Gprotein signaling 14 (RGS14) is a selective H-Ras effector. PLoS One 4:e4884 Williams-Gray CH, Foltynie T, Lewis SJ, Barker RA. 2006. Cognitive deficits and psychosis in Parkinson's disease: a review of pathophysiology and therapeutic options. CNS Drugs 20:477505 Winters BD, Bartko SJ, Saksida LM, Bussey TJ. 2007. Scopolamine infused into perirhinal cortex improves object recognition memory by blocking the acquisition of interfering object information. Learn Mem 14:590-6 Winters BD, Bussey TJ. 2005. Glutamate receptors in perirhinal cortex mediate encoding, retrieval, and consolidation of object recognition memory. J Neurosci 25:4243-51 Woodard GE, Jardin I, Berna-Erro A, Salido GM, Rosado JA. 2015. Regulators of g-protein-signaling proteins: negative modulators of g-protein-coupled receptor signaling. Int Rev Cell Mol Biol 317:97-183 Woodside BL, Borroni AM, Hammonds MD, Teyler TJ. 2004. NMDA receptors and voltagedependent calcium channels mediate different aspects of acquisition and retention of a spatial memory task. Neurobiol Learn Mem 81:105-14 Wu X, Wakefield JK, Liu H, Xiao H, Kralovics R, et al. 2000. Development of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2:47-55 Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134 Yonelinas AP. 2001. Components of episodic memory: the contribution of recollection and familiarity. Philos Trans R Soc Lond B Biol Sci 356:1363-74 Yonelinas AP, Aly M, Wang WC, Koen JD. 2010. Recollection and familiarity: examining controversial assumptions and new directions. Hippocampus 20:1178-94 Yoon YJ, White SL, Ni X, Gokin AP, Martin-Caraballo M. 2012. Downregulation of GluA2 AMPA receptor subunits reduces the dendritic arborization of developing spinal motoneurons. PLoS One 7:e49879 Yu DF, Wu PF, Fu H, Cheng J, Yang YJ, et al. 2011. Aging-related alterations in the expression and distribution of GluR2 and PICK1 in the rat hippocampus. Neurosci Lett 497:42-5 Zhu JJ, Esteban JA, Hayashi Y, Malinow R. 2000. Postnatal synaptic potentiation: delivery of GluR4containing AMPA receptors by spontaneous activity. Nat Neurosci 3:1098-106 Ziakopoulos Z, Tillett CW, Brown MW, Bashir ZI. 1999. Input-and layer-dependent synaptic plasticity in the rat perirhinal cortex in vitro. Neuroscience 92:459-72 .
VIII. Appendices
VIII. Appendices 123 1 Appendix 1. MOLECULAR BIOLOGY 1.a) Electrophoresis in agarose gel 1.a.1) Tris-Boric acid-EDTA buffer (TBE) 5X, 1 L 1.a.2) 1 % Agarose gel REAGENT AMOUNT Small gel (8 wells) Big gel (10 wells) Agarose (E0301, EuRx) 0.4 g 1 g TBE 1X buffer *1 40 ml 100 ml Ethidium Bromide (0,1 mg/ml) *2 68 µl 170 µl *1 Prepared mixing 200 ml of TBE 5X (appendix 1.a.1). *2 Prepared using 10 mg/m Ethidium Bromide stock solution (Invitrogen, 15585-011). 1.b) Gene amplification in bacteria 1.b.1) Bacterial growth media: 100 µg/ml ampicillin LB and LB-Agar After dissolving LB and NaCl 1 L in Milli-Q water, the resulting volume was distributed into two 1 L glass bottles (500 ml each one). 7.5 g of LB-Agar (Invitrogen, 22700-025) were added to one of the bottles and LB-Agar medium was made. The medium without LB-Agar was called LB liquid medium. Both media were sterilized by moist heat at 121 ºC / 15 min in an autoclave (sterilclav-75, Raypa) and were chilled to 50 ºC to avoid solidifying. Then, at the laminar flow cabinet, 500 μl of 100 mg/ml ampicillin solution (Sig ma-Aldrich, A9393) were added to each bottle of medium (ampicillin final concentration: 100 µg/ml). The 100 µg/ml REAGENT AMOUNT Tris (Sigma-Aldrich,T1503) 54 g Boric acid (Sigma-Aldrich,b6768) 27.5 g Ethylenediaminetetraacetic acid, EDTA (Sigma-Aldrich,E5134) 3.72 g Milli-Q water Up to 1 L REAGENT AMOUNT LB Broth Base (Invitrogen, 12780-052) 20 g Sodium chloride (NaCl) (Sigma-Aldrich, S3014) 5 g Milli-Q water Up to 1 L
VIII. Appendices 130 4.a.2) 0.1 M Phosphate buffered Saline (PBS) pH 7.4 (1 L) The pH was adjusted up to 7.4 and the buffer was stored at room temperature. 4.a.3) PLP fixative solution (4 % paraformaldehyde, 75 mM L-lysine and 10 mM (meta) periodate) in 0.1 M PB, pH 7.4 (1 L) Paraformaldehyde was dissolved in 500 ml of Milli-Q water at 60 ºC adding some drops of 8 N NaOH solution to facilitate paraformaldehyde dissolution. The solution was filtered using filter paper, and Milli-Q water was added up to 750 ml. In addition, the lysine and the sodium (meta) periodate were dissolved in 200 ml of 0.4 M PB buffer pH 7.4, and then PB was added up to 250 ml. Finally, both solutions were mixed. 4.a.4) 30 % (w/v) sucrose, 0.02 % (w/v) sodium azide in 0.1 M PBS buffer (100 ml) To prepare this solution, 30 g of sucrose (Panreac, 131621) was dissolved in 0.1 M PBS buffer, pH 7.4 (Appendix 4.a.2) up to 100 ml. 200 µl of this solution was removed and 200 µl of 10 % sodium azide solution (Sigma-Aldrich, S2002) were added and the resulting solution was stored at 4 ºC. 4.a.5) Mounting medium for Fluorescent immunohistochemistry (DABCO medium) To prepare this mounting medium, a PBS-glycerol mix was prepared previously with glycerol (141339, Panreac) and 0.1 M PBS buffer pH 7.4 (appendix 4.a.2) at a proportion of 1:1. Then, DABCO (Sigma-Aldrich, D-2522) was added to 3 % (w/v) and the resulting solution was stored at 4 ºC in darkness. REAGENT AMOUNT Milli-Q water Up to 1 L Sodium chloride NaCl (Panreac, 131659) 9 g PB 0.4 M buffer, pH 7.4 (appendix 4.a.1) 250 ml REAGENT AMOUNT Milli-Q water 750 ml Paraformaldehyde (CH2O)n (Merck, 1.04005) 40 g L-Lysine monohydrochloride C6H14N2O2HCl (Sigma-Aldrich, 62929) 13.7 g Sodium (meta)periodate INaO4 (Sigma, 30323) 2.14 g PB 0.4 M, pH 7.4 (appendix 4.a.1) 250 ml
VIII. Appendices 131 4.b) Gelatin-coated slides -Preparation of the gelatin solution To prepare this solution, the gelatin was dissolved in 60 ºC pre-warmed Milli-Q water and then the chromium (III) potassium sulfate was added. - Preparation of gelatin-coated slides Before the treatment with gelatin, the slides were degreased in a mixture of absolute ethanol: ether (1:1) for at least 24 h. The degreasing solution was removed and the slides were dried for 2 min at room temperature. The slides were immersed then in the gelatin solution for 1 min and this step was repeated five times for a few seconds. Finally the slices were dried for 48 h at 37 ºC (they can be used up to two month after treatment). 4.c) Fixation by transcardial perfusion and brain extraction Anesthesia and surgery: Animals were deeply anesthetized by an intraperitoneal injection of 120 mg/Kg of sodium pentobarbital (Eutanax 200 mg/ml, Fatro) before proceeding with the transcardial perfusion. In order to access the heart, a 5-6 cm lateral incision through the integument and abdominal wall just beneath the rib cage was made. Then the diaphragm was carefully incised along the entire length of the rib cage to expose the pleural cavity. Cutting through the lateral part of the rib cage on both sides, heart was exposed. Washing: A 21 gauge perfusion needle connected to a peristaltic pump (Cole parmer) was introduced into left ventricle, a nd then a n incision was made to the animal’s right atriu m. Thus, whole blood was removed by injecting 120 ml of 0.1 M PBS buffer (appendix 4.a.2) at a steady flow rate of 8 ml/min. Fixation: Once blood vessels were washed, 350 ml of PLP fixative solution (appendix 4.a.3) were passed through the circulatory system in order to obtain the best possible preservation of the brain. Brain dissection: Head was guillotined and brain was carefully extracted cutting the integument, the skull and muscles. Post-fixation: The brain was kept in the fixative solution for 24 h at 4 ºC. 4.d) Cryoprotection and freezing Post-fixed brains were washed with 0.1 M PBS buffer for 10 min by exchanging the media 3 times and swirling each time to remove any residual PLP. They were immersed in 30 % (w/v) sucrose, 0.02 % (w/v) sodium azide in 0.1 M PBS buffer (appendix 4.a.4) for 7 days at 4 ºC. Finally brains were frozen using dry ice and stored at -80 ºC. REAGENT AMOUNT Milli-Q water 600 ml Gelatin (Panreac, 142060) 3 g Chromium(III) potassium sulfate (Panreac, 131284) 0.3 g
VIII. Appendices 132 4.e) Brain sectioning 30 µm-thick brain tissue sections obtained from the areas of interest (area V2, perirhinal or frontal cortices) were cut using a cryostat (Leica CM-1325) and immersed in 0.02 % (w/v) sodium azide in 0.1 M PBS buffer. These sections were stored at 4 ºC during several months, renewing the buffer regularly. 4.f) Fluorescent immunohistochemistry (IHC) for RGS14 protein Before proceeding with the IHC, selected sections were washed 3 times for 10 min at room temperature in 0.1 M PBS buffer (appendix 4.a.2) with gentle agitation at room temperature. The avidin/biotin blocking kit (Vector Laboratories, SP-2001) was then used incubating the sections in each solution for 30 min at room temperature with gentle agitation. Sections were then washed 3 times with PBS as seen before and incubated overnight at 4 ºC with gentle agitation in the primary RGS14-polyclonal antibody (Novus biological, NBP1-31174; dilution 1:500) produced in rabbit and diluted in 0.3 % (v/v) triton X-100 (Sigma-Aldrich, 900293-1), 0.1 % (w/v) sodium azide in PBS buffer. After removing the excess of primary antibody with PBS, sections were incubated for 2.5 h at room temperature in darkness in the Alexa fluor® 488-conjugated secondary antibody goat anti-rabbit IgG (Life technologies, A11008; dilution 1:1000) diluted in 0.3 % (v/v) triton X-100, 0.1 % (w/v) sodium azide, 0.1 M PBS buffer. The excess of the secondary antibody was removed with PBS (3 washes). Mounting brain sections: Finally, slices were mounted on gelatin-coated slides (appendix 4.b) and kept overnight at room temperature to dry. Then, 1-2 drops of DABCO (appendix 4.a.5) were applied on sections and covered with the coverslip. Samples were observed under a Leica confocal microscope (Leica DM IRE2). 5 Appendix 5. PROTEOMICS 5.a) Buffers and solutions 5.a.1) 0.01 M Tris-HCl buffer, pH 7.4 (50 ml) This buffer was prepared by dissolving 0.06 g of Tris (Sigma-Aldrich, T1503) in Milli-Q water up to 50 ml. To adjust the pH at 7.4, some drops of HCl solution (T-Bakes, 6081) were added. 5.a.2) 0.5 M Tris-HCl buffer, pH 6.8 (50 ml) This buffer was prepared by dissolving 3.02 g of Tris (Sigma-Aldrich, T1503) in Milli-Q water up to 50 ml and the pH was adjusted at 6.8. 5.a.3) Loading buffer 1X (8 ml) Tris-HCl 60 mM pH 6.8, 2 % SDS, 10 % glicerol, 5 % 2β-mercaptoetanol and 0.002 % blue bromophenol:
VIII. Appendices 133 5.a.4) Tris-Glycine-SDS (TGS) buffer 5X (1 L) 12.5 mM Tris, 96 mM glycine, 0.5 % SDS 5.a.5) Phosphate Buffered Saline (PBS buffer) 10X (1 L) 5.a.6) 0.1 % Tween PBS buffer 1X (TPBS) (1 L) REAGENT AMOUNT Milli-Q water 3.88 ml 2β mercaptoethanol (Sigma-Aldrich, M7154) 0.4 ml Glycerol, 99 % (Sigma-Aldrich,G6279) 0.8 ml Sodium dodecyl sulfate (SDS), 10 % (Sigma-Aldrich, L3771) 1.6 ml Tris-HCL 0.5 M, pH 6.8 (appendix 5.a.2) 1 ml REAGENT AMOUNT Milli-Q water Up to 1 L Glycine (Sigma-Aldrich, G7126) 72 g Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, L3771) 5 g Tris (Sigma-Aldrich,T1503) 15 g REAGENT AMOUNT Milli-Q water Up to 1 L Sodium chloride (NaCl) (Sigma-Aldrich, S3014) 72.2 g Potassium dihydrogen phosphate (KH2PO4) (Merck-Millipore, 104873) 4.3 g Sodium phosphate dibasic dihydrate (Na2HP04 2H2O) (Fluka, 71645) 19 g REAGENT AMOUNT Milli-Q water 900 ml PBS buffer (10X) (appendix 5.a.5) 100 ml Tween (Sigma-Aldrich, 9005-64) 1 ml
VIII. Appendices 134 5.b) Lowry Method for protein determination The protein concentration of samples were estimated by the colorimetric Lowry method (Lowry et al 1951) according to the protocol detailed below: Reagents and solutions 500 µg/ml Bovine serum albumin stock solution, (10 ml): The 500 µg/ml BSA stock solution was prepared by dissolving 5 mg of BSA (Sigma-Aldrich, A3059) in 10 ml of Milli-Q water. The solution was aliquoted in small volume of 500 µl and stored at -80 ºC. 2 % Sodium carbonate solution, (50 ml): 1 g of sodium carbonate anhydrous (Na2CO3, Panreac, 131648.1210) was dissolved in 50 ml of Milli-Q water and solution was stored at 4 ºC. 1 % (w/v) copper sulfate solution (50 ml): 0.5 g of Cooper (II) sulfate anhydrous (Panreac, 122726.1209) were dissolved in 50 ml of Milli-Q and the solution was stored at 4 ºC. 2 % (v/v) Na2 tartrate solution (50 ml): 1 g of sodium tartrate anhydrous (Na2C4H4O6, Panreac, 121720.1210) was dissolved in 50 ml of Milli-Q water and the solution was stored at 4 ºC 1.2 N Sodium hydroxide solution (50 ml): 2.4 g of NaOH (Panreac, 1316877787.1211) were dissolved in 50 ml of Milli-Q water and the solution was stored at 4 ºC. Alkaline copper reagent (ACR): ACR was prepared by mixing in a proportion of 100:1:1 the 2 % (w/v) Na2CO3, 2 % (w/v) Na2C4H4O6 and 1 % (w/v) CuSO4 respectively. 2 N Folin-Ciocolteus´s phenol reagent (Sigma-Aldrich, F9252) Procedure A BSA standard curve (from 0 to 267 µg/ml) was prepared using a 500 µg/ml BSA stock solution. Three replicates were used for each concentration. Tube Volume of 500 µg/ml BSA (µl) Volume of Milli-Q water (µl) [BSA] (µg/ml) T1 0 75 0 T2 5 75 33 T3 10 65 67 T4 20 55 133 T5 30 45 200 T6 40 35 267 Two replicates of 1/5 and 1/10 dilutions of each sample were prepared, and 75 μl of them were p laced in a 1.5 ml tube. In addition, 1/5 and 1/10 dilutions of Tris-HCl 0.01 M pH 7.4 (Appendix 5.a.1) in Milli-Q water were prepared as blanks. 75 µl of NaOH 1.2 N were added to each tube and mixed by vortex. According to the number of tubes, the adequate volume of ACR was prepared at the moment of use, 750 µl of ACR were added to each tube and mixed by vortex. Then the mixture was incubated for 15 min. 75 µl of FolinCiocolteus´s phenol 2 N reagent:Milli-Q water in a proportion 1:1 were added to each sample and mixed by vortex. Finally, the mixture was incubated for 45 min at room temperature and the absorbance was read spectrophotometrically (S30, Boeco) at 750 nm.
VIII. Appendices 135 6 Appendix 6. ELECTROPHYSIOLOGY a) Modified Artificial Cerebrospinal Fluid (mACSF) , for 1 L REAGENT CONCENTRATION (mM) AMOUNT (g) Sucrose (Sigma-Aldrich, S0389) 189 64.69 Glucose (Fluka, G0350500) 10 1.80 Sodium hydrogen carbonate (NaHCO3) (Sigma-Aldrich, S5761 ) 26 2.18 Potassium chloride (KCl) (Sigma-Aldrich, P9541) 3 0.22 Magnesium sulfate (MgSO4) (Sigma-Aldrich, M2643) 5 0.60 Calcium chloride (CaCl2) (Sigma-Aldrich, C5670) 0.1 0.011 Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, S3139) 1.25 0.15 b) Artificial Cerebrospinal Fluid (ACSF) , for 1 L REAGENT CONCENTRATION (mM) AMOUNT (g) Sodium chloride (NaCl) (Sigma-Aldrich, S3014) 124 7.25 Potassium chloride (KCl) (Sigma-Aldrich, P9541) 3 0.22 Sodium hydrogen carbonate (NaHCO3) (Sigma-Aldrich, S5761 ) 26 2.18 Sodium phosphate monobasic (NaH2PO4) (Sigma-Aldrich, S3139) 1.4 0.17 Magnesium sulfate (MgSO4) (Sigma-Aldrich, M2643) 1 0.12 Glucose (Fluka, G0350500) 10 1.8 Calcium chloride (CaCl2) (Sigma-Aldrich, C5670) 2 0.22
Versión en español
Abreviaturas ACSF: líquido cefalorraquídeo artificial. AD: enfermedad de Alzheimer. AMPAR: receptor ácido alfa-amino-3hidroxi-5-metil-4-isoxazol-propiónico. ANOVA: análisis de la varianza. AP: anteroposterior. BSA: albúmina de suero bovino. CamKII: proteína quinasa II dependiente de Ca2+ / calmodulina. CCh: carbacol. cDNA: DNA complementario. CFU: unidades formadoras de colonias. CNQX: 6-ciano-7-nitroquinoxalina-2,3diona. CREB: proteína de unión al elemento de respuesta de cAMP. Ct: ciclo umbral. DABCO: 1,4-diaza-biciclo[2,2,2] octano. DI: índice de discriminación. DL-AP5: ácido DL-2-amino-5-fosfopentanoico. DNA: ácido desoxirribonucleico. DV: dorsoventral. ERK: quinasa regulada por señales extracelulares. fEPSP: potencial post-sináptico de excitación de campo. Fr: corteza frontal. GAP: proteínas activadoras de GTPasas. GDP: guanosín difosfato. GluR1-4: receptores inotrópicos de glutamato (AMPA). GPCR: receptor acoplado a proteínas G. GPR (dominio): dominio regulador de las proteínas G. GTP: guanosín trifosfato. HFS: estimulación de alta frecuencia. JNK: quinasa c-Jun N-terminal. KN62: ester del ácido 4-[(2S)-2-[(5isoquinolinilsulfonil)metilamino]-3oxo - 3-(4-fenil-1-piperazinil) propil] fenil isoquinolinsulfonico. LFS: estimulación de baja frecuencia. LTD: depresión a largo plazo. LTP: potenciación a largo plazo. LY367385: ácido (S)-(+)-α-amino-4carboxi-2-metilbencenoacetico. mAChR: receptor colinérgico muscarínico. mACSF: líquido cefalorraquídeo artificial modificado. MAPKK (MKK): proteína quinasa de quinasa activada por mitógeno. mGluR: receptor metabotrópico de glutamato. mRNA: RNA mensajero. MTL: lóbulo temporal medial.
V. Discusión 242 El tratamiento con el gen RGS14 causó un incremento progresivo de la expresión de la proteína GluR2, alcanzando los niveles más altos tras 60 min desde la exposición, periodo de tiempo requerido para la conversión de una ORM a corto plazo en una memoria a largo plazo según el procedimiento puesto a punto y llevado a cabo en nuestro laboratorio (Lopez-Aranda et al 2009). Hemos observado que cuando se expusieron ratas normales a un objeto durante 3 min, éstas eran capaces de retener la información en el cerebro durante 45 min (corto plazo) pero no 60 min. Sin embargo, las ratas tratadas con RGS14 eran capaces de retener la misma información durante 24 h e incluso periodos más largos (largo plazo). Por tanto, los altos niveles de la subunidad GluR2 obtenidos a los 60 min concuerdan con la idea de que esta proteína podría ser clave en el aumento de ORM y la conversión a memoria a largo plazo en los animales RGS14. A diferencia del grupo-RGS, los animales tratados con vehículo mostraban altos niveles de expresión de GluR2 a los 20 min y no a los 60 min, e incluso se produjo un descenso progresivo a partir de los 20 min. Estas observaciones, están en concordancia con nuestro argumento de que la sobreexpresión de GluR2 así como su mantenimiento producido por el tratamiento con el gen RGS14 podrían desencadenar el aumento de la ORM y por tanto, podría considerarse una diana importante a tener en cuenta para futuras estrategias de aumento de potenciación de memoria. 3 RGS14 no facilita la plasticidad sináptica hebiana Teniendo en conocimiento que el tratamiento con el gen RGS14 regula a la alta la proteína GluR2 y el papel de ésta última en la regulación de la plasticidad sináptica (Asrar & Jia 2013; Huganir & Nicoll 2013; Isaac et al 2007), decidimos explorar como altos niveles de esta proteína en los animales RGS14 podían influir en distintas formas de plasticidad sináptica incluyendo LTP, LTD y despotenciación. Sin embargo, puesto que los estudios en electrofisiología sobre la plasticidad sináptica en relación a la ORM, tal y como se refleja en la literatura, se realizan principalmente en la corteza perirrinal y no en el área V2, se testó el efecto potenciador del tratamiento con el gen RGS14414 sobre la memoria en la corteza perirrinal, con la idea de validar esta área para los posteriores estudios electrofisiológicos. El efecto potenciador de RGS14 sobre la memoria en esta área cerebral fue similar al observado previamente en el área V2, no encontrando diferencias entre las dos áreas. Estos resultados eran de esperar ya que la corteza perirrinal es una de las áreas cerebrales principales que participan en el circuito neuronal responsable de la ORM (Brown & Aggleton 2001; Kim et al
V. Discusión 243 2014; Lech & Suchan 2013; Martin et al 2013; Ranganath & Ritchey 2012; Warburton & Brown 2010; Watson & Lee 2013), y que la mediación celular del efecto de RGS14 no debería discriminar entre las neuronas del área V2 y las de la corteza perirrinal. El estudio in vitro de los registros de los potenciales de campo extracelulares en la corteza perirrinal de cortes de cerebro de ratas tratadas con RGS14 mostró que no se producía ningún efecto sobre la LTP y LTD al aplicar altos niveles de estimulación (100 Hz para LTP y 50 µM de carbachol para LTD), mientras que bajos niveles de estimulación (20 Hz para LTP y 20 µM de carbachol para LTD) reducían el mantenimiento de estas formas de plasticidad sináptica. Además, el tratamiento con RGS14 bloqueó la inducción de la despotenciación generada por una estimulación de baja frecuencia de 1 Hz volviendo a los niveles previos de LTP una vez terminada la aplicación de esta estimulación. Estos resultados ponían de manifiesto que el tratamiento con el gen RGS14 no favorecía la plasticidad sináptica hebiana, incluso en presencia de altos niveles de concentración de la proteína RGS14. A pesar de que los mecanismos implicados en la alteración de la plasticidad sináptica han de ser todavía determinados, proponemos la hipótesis de que la reducción en la entrada de calcio debido al bloqueo de los canales de calcio tipo L mediado por RGS14 podría ser la causante de las alteraciones observadas en la plasticidad sináptica hebiana. Esta hipótesis se basa en que RGS14414 reduce los niveles de calcio intracelular mediante el bloqueo de los canales de calcio tipo L (Martin-Montanez et al 2010) y en que los niveles intracelulares de calcio están directamente implicados en las diferentes formas de plasticidad sináptica hebiana (Baker et al 2013). Cabe destacar, que además de la mejora sobre la memoria espacial demostrada en roedores tras la administración de antagonistas de canales de calcio tipo L (Levy et al 1991; Quartermain et al 2001), varios estudios reflejan la existencia de una conexión entre los antagonistas de canales de calcio y la recuperación de la pérdida de memoria. La nimodipina, un bloqueador de los canales de calcio tipo L, previene tanto la aparición de las alteraciones de la memoria asociadas a la edad en roedores envejecidos (Batuecas et al 1998; Hopp et al 2014; Ingram et al 1994; Moyer et al 1992; Thompson et al 1990) como la pérdida de memoria causada por la abstinencia al alcohol o morfina en roedores (Brooks et al 2008; Brooks et al 2002; Vaseghi et al 2014; Vaseghi et al 2012). Asimismo, la evidencia epidemiológica muestra que el antagonismo de los receptores de calcio tipo L está asociado con una menor prevalencia de la enfermedad de Alzheimer (AD) (Anekonda & Quinn 2011; Lopez-Arrieta & Birks 2002). En este sentido, los pacientes con AD a los cuales se les
V. Discusión 244 suministró el antagonista de canales de calcio tipo L, nimodipina mostraron una mejora en comparación con los pacientes tratados con placebo en varias medidas cognitivas (Tollefson 1990). Por otro lado, cabe señalar también que una alteración en la plasticidad sináptica hebiana en los animales RGS14 no implica que no pueda haber un aumento de la ORM en estos animales. De hecho, existen cada vez más evidencias en la literatura que muestran un aumento de memoria independiente de esta forma de plasticidad, y que relacionan la memoria con las formas no hebianas de plasticidad sináptica como pueden ser la plasticidad intrínseca y el synaptic scaling (Baker-Andresen et al 2013; Nelson & Turrigiano 2008). Por tanto, el aumento de memoria mediado por RGS14 podría explicarse con una facilitación del synaptic scaling, la forma más estudiada de la plasticidad homeostática en las sinapsis exitatorias centrales (Davis 2006; Turrigiano 2008; Turrigiano & Nelson 2004), la cual se ha visto en una variedad de neuronas centrales tanto in vitro como in vivo, incluyendo las neuronas neocorticales, las piramidales hipocampales y las espinales (Chandler & Grossberg 2012; Desai et al 2002; Goel & Lee 2007; Kim & Tsien 2008; Knogler et al 2010; O'Brien et al 1998; Stellwagen & Malenka 2006; Turrigiano et al 1998). Por tanto, aunque no disponemos de datos que confirmen la implicación de la plasticidad sináptica no hebiana o de los niveles de calcio intracelular en este proceso, este laboratorio continúa explorando esta ruta para dar una posible explicación al aumento de la ORM en ratas RGS14. 4 Áreas independientes del cerebro pueden promover la recuperación de la ORM mediada por RGS14 La parte más sorprendente de nuestros resultados que muestran la recuperación de la pérdida de ORM en modelos de roedores era demostrar cómo la activación del área V2, un área cerebral que nunca se ha relacionado con la disfunción de la memoria, es capaz de corregir el déficit de memoria, que podría haberse originado mediante dos mecanismos diferentes. Se piensa que el procesamiento de la ORM en el cerebro esta mediado por un circuito neuronal especializado, el cual se forma mediante la participación de varias áreas cerebrales. En este circuito neuronal, el papel en el reconocimiento de objetos tanto de la corteza perirrinal (Brown & Aggleton 2001; Kim et al 2014; Lech & Suchan 2013; Martin et al 2013; Ranganath & Ritchey 2012; Warburton & Brown 2010; Watson & Lee 2013) como el de la corteza frontal (Banks et al 2012; Swick & Knight 1999; Warburton & Brown 2010)
V. Discusión 245 han sido ampliamente estudiados y ahora nuestro laboratorio ha descubierto que el área V2 (Lopez-Aranda et al 2006) juega un papel importante en el procesamiento de la ORM. Por ello, propusimos que si la activación del área V2 mediante el tratamiento con RGS14 podía recuperar la pérdida de memoria, el mismo tratamiento tanto en la corteza frontal como en la corteza perirrinal debería producir el mismo efecto sobre la memoria. Para simular el déficit de ORM manifestado en muchas condiciones de enfermedades cerebrales y del envejecimiento, originamos lesiones en el área V2, la corteza frontal y la corteza perirrinal. Se vio como las lesiones en cualquiera de estas tres áreas producía un daño considerable y una pérdida significativa de la ORM. Además, el tratamiento con RGS14 en una de las áreas no lesionadas de entre estas 3 áreas cerebrales promovía la recuperación de la memoria hasta un nivel normal. La actividad asociada con la recuperación de la pérdida de la memoria mediante el tratamiento con RGS14 era de tal magnitud que se producía incluso cuando dos de las tres áreas se lesionaban. Nuestros resultados sobre la recuperación de la pérdida de la memoria en ratas mediante la producción de lesión sugieren que el área V2, la corteza frontal y la corteza perirrinal son zonas adecuadas para llevar a cabo un tratamiento con RGS sobre una de estas áreas de forma independiente a pesar de desconocer la localización en el cerebro de la causa principal de la pérdida de memoria. Teniendo en cuenta que la lesión producida, empleando Ox7-SAP como herramienta, elimina selectivamente las neuronas sin afectar a otras estructuras como pueden ser las fibras de paso, la información aún podría pasar a través de las áreas cerebrales dañadas. A la luz de estas observaciones, nuestros resultados indican que la activación neuronal mediada por RGS14 contribuye a la estabilización y por tanto a la normalización de la disfunción del circuito de la ORM que atraviesa varias áreas cerebrales. 5 Mecanismo de la potenciación de la memoria mediada por RGS14 y la recuperación de la pérdida de ORM Los mecanismos conducentes a la recuperación de la pérdida de ORM tanto en los dos modelos de roedores como en las ratas con lesiones selectivas parecen estar asociados a la estimulación de la actividad de GluR2. Se ha demostrado una regulación a la baja de los niveles de GluR2 en el envejecimiento normal (Liu et al 2008; Yu et al 2011) y en la enfermedad de Alzheimer (Resende et al 2007). Se piensa que esta disminución en los niveles de la subunidad GluR2 de los receptores AMPA es la responsable del aumento significativo
V. Discusión 246 en la concentración del calcio citosólico, el cual como consecuencia conduce a una distrofia dendrítica y a una alteración de la función sináptica (Hof et al 2002; Resende et al 2007). La normalización de los niveles de GluR2 tras el tratamiento con RGS14414 podía dar lugar a una disminución de las concentraciones de calcio citosólicas como se vio previamente (Martin-Montanez et al 2010). Además del trabajo de esta tesis, nuestro laboratorio ha descubierto que el tratamiento con el gen RGS14 produce una fuerte arborización neuronal (Navarro-Lobato 2015). Por tanto, se plantea que el incremento en las conexiones neuronales no sólo promueve la restructuración del circuito responsable del aumento de la ORM mediado por RGS14 sino que también facilita el flujo de la información durante el procesamiento de ORM. Se ha demostrado que la perdida de los receptores AMPA en las células postsinápticas conlleva a un deterioro de la estabilidad de la ramificación dendrítica (Haas et al 2006), sin embargo, la sobreexpresión de las subunidades de los receptores AMPA se ha asociado con un incremento del número de segmentos de las ramificaciones (Chen et al 2009; Prithviraj et al 2008). También se ha demostrado que la sobreexpresión de GluR2 conlleva a un aumento de la densidad de las espinas en el hipocampo (Passafaro et al 2003) y de la longitud dendrítica de la neuronas corticales en desarrollo en embriones de ratas (Chen et al 2009), mientras que una regulación a la baja de GluR2 produce una pérdida de los segmentos de la ramificación dendrítica en el hipocampo (Passafaro et al 2003) y una reducción en la arborización dendrítica de las motoneuronas espinales en desarrollo en embriones de pollo (Yoon et al 2012). A pesar de que queda un largo camino por recorrer para conocer con exactitud el completo mecanismo implicado en el aumento de la memoria mediado por RGS14 y la recuperación de la pérdida de memoria, los resultados del presente trabajo sugieren que la sobreexpresión de GluR2 podría ser el desencadenante del aumento de la arborización dendrítica promoviendo la aparición de nuevas sinapsis y causando así una reestructuración del circuito responsable del aumento de la ORM mediado por RGS14. Y lo que es más importante, hemos demostrado que la pérdida de una memoria episódica (ORM) puede ser recuperada mediante un tratamiento con el gen RGS14414 en el área V2, la corteza frontal o la corteza perirrinal siendo esta recuperación independiente de dónde se localice el origen de la pérdida de memoria en el cerebro. Por tanto, un tratamiento es posible, sin necesidad de conocer el área o las áreas del cerebro implicadas en la pérdida de memoria. El presente trabajo proporciona una plataforma
V. Discusión 247 estratégica para el tratamiento de la pérdida de memoria observada en muchas enfermedades neurodegenerativas y en el envejecimiento normal.
VI. Conclusiones
VI. Conclusiones 251 1. El tratamiento con el gen RGS14 no solo dio lugar a una total recuperación de la pérdida de una memoria episódica en modelos de roedores con envejecimiento normal y enfermedad de Alzheimer, sino que también ayudó al mantenimiento de niveles elevados de ORM por largo tiempo. 2. GluR2, subunidad del receptor AMPA, es un componente clave en la potenciación de la ORM mediada por RGS14. Además de mostrarse una regulación a la alta de los niveles de esta proteína, se observó su participación dinámica en la conversión de memoria a corto plazo a memoria a largo plazo. 3. El tratamiento con el gen RGS14414 no favoreció la plasticidad sináptica hebiana, la cual incluía LTP, LTD dependiente de receptores muscarínicos y despotenciación. Pese a que la causa de este déficit en la plasticidad ha de ser encontrada, creemos que la disminución en el flujo de calcio a través del bloqueo de los receptores de calcio tipo L por parte de RGS14 podría desencadenar las alteraciones vistas en este tipo de plasticidad sináptica. Por otra parte, sugerimos que la potenciación de la memoria mediada por RGS14 podría deberse a formas no hebianas de plasticidad. 4. El área V2, la corteza frontal y la corteza perirrinal son áreas implicadas en el circuito responsable del procesamiento de la ORM y participan de forma independiente en la potenciación de la memoria mediada por RGS14. La independencia que caracteriza a cada área en la potenciación de la memoria sugiere la idoneidad de cada una de ellas de forma separada como tratamiento de la pérdida de la memoria, aún desconociendo la localización de la causa primaria en el cerebro. 5. Los resultados correspondientes a la recuperación de la pérdida de la memoria en modelos de roedores y de la potenciación de la memoria en ratas lesionadas sugieren que una terapia con el gen RGS14414 podría ser empleada como una estrategia viable para el tratamiento de la pérdida de memoria en pacientes.
VII. Bibliografía 258 Deupree DL, Turner DA, Watters CL. 1991. Spatial performance correlates with in vitro potentiation in young and aged Fischer 344 rats. Brain Res 554:1-9 Diana G, Domenici MR, Loizzo A, Scotti de Carolis A, Sagratella S. 1994a. Age and strain differences in rat place learning and hippocampal dentate gyrus frequency-potentiation. Neurosci Lett 171:113-6 Diana G, Scotti de Carolis A, Frank C, Domenici MR, Sagratella S. 1994b. Selective reduction of hippocampal dentate frequency potentiation in aged rats with impaired place learning. Brain Res Bull 35:107-11 Diana RA, Yonelinas AP, Ranganath C. 2007. Imaging recollection and familiarity in the medial temporal lobe: a three-component model. Trends Cogn Sci 11:379-86 Didic M, Barbeau EJ, Felician O, Tramoni E, Guedj E, et al. 2011. Which memory system is impaired first in Alzheimer's disease? J Alzheimers Dis 27:11-22 Dieguez D, Jr., Barea-Rodriguez EJ. 2004. Aging impairs the late phase of long-term potentiation at the medial perforant path-CA3 synapse in awake rats. Synapse 52:53-61 Dingledine R, Borges K, Bowie D, Traynelis SF. 1999. The glutamate receptor ion channels. Pharmacol Rev 51:7-61 Donaldson W. 1996. The role of decision processes in remembering and knowing. Mem Cognit 24:523-33 Drag LL, Bieliauskas LA. 2010. Contemporary review 2009: cognitive aging. J Geriatr Psychiatry Neurol 23:75-93 Dubois B, Feldman HH, Jacova C, Dekosky ST, Barberger-Gateau P, et al. 2007. Research criteria for the diagnosis of Alzheimer's disease: revising the NINCDS-ADRDA criteria. Lancet Neurol 6:734-46 Eichenbaum H, Yonelinas AP, Ranganath C. 2007. The medial temporal lobe and recognition memory. Annu Rev Neurosci 30:123-52 Elgersma Y, Sweatt JD, Giese KP. 2004. Mouse genetic approaches to investigating calcium/calmodulin-dependent protein kinase II function in plasticity and cognition. J Neurosci 24:8410-5 Ennaceur A, Delacour J. 1988. A new one-trial test for neurobiological studies of memory in rats. 1: Behavioral data. Behav Brain Res 31:47-59 Escribano L, Simon AM, Perez-Mediavilla A, Salazar-Colocho P, Del Rio J, Frechilla D. 2009. Rosiglitazone reverses memory decline and hippocampal glucocorticoid receptor downregulation in an Alzheimer's disease mouse model. Biochem Biophys Res Commun 379:406-10 Evans PR, Lee SE, Smith Y, Hepler JR. 2014. Postnatal developmental expression of regulator of G protein signaling 14 (RGS14) in the mouse brain. J Comp Neurol 522:186-203 Feldman DE. 2009. Synaptic mechanisms for plasticity in neocortex. Annu Rev Neurosci 32:33-55 Fitzjohn SM, Kuenzi F, Morton RA, Rosahl TW, Lewis H, et al. 2010. A study of long-term potentiation in transgenic mice over-expressing mutant forms of both amyloid precursor protein and presenilin-1. Mol Brain 3:21 Fjell AM, Walhovd KB, Fennema-Notestine C, McEvoy LK, Hagler DJ, et al. 2009. One-year brain atrophy evident in healthy aging. J Neurosci 29:15223-31 Fjell AM, Westlye LT, Grydeland H, Amlien I, Espeseth T, et al. 2014. Accelerating cortical thinning: unique to dementia or universal in aging? Cereb Cortex 24:919-34 Fleming JJ, England PM. 2010. AMPA receptors and synaptic plasticity: a chemist's perspective. Nat Chem Biol 6:89-97 Fontan-Lozano A, Suarez-Pereira I, Horrillo A, del-Pozo-Martin Y, Hmadcha A, Carrion AM. 2010. Histone H1 poly[ADP]-ribosylation regulates the chromatin alterations required for learning consolidation. J Neurosci 30:13305-13 Foster TC. 2007. Calcium homeostasis and modulation of synaptic plasticity in the aged brain. Aging Cell 6:319-25 Foster TC, Norris CM. 1997. Age-associated changes in Ca(2+)-dependent processes: relation to hippocampal synaptic plasticity. Hippocampus 7:602-12 Furtak SC, Wei SM, Agster KL, Burwell RD. 2007. Functional neuroanatomy of the parahippocampal region in the rat: the perirhinal and postrhinal cortices. Hippocampus 17:709-22 Gaffan D. 2002. Against memory systems. Philos Trans R Soc Lond B Biol Sci 357:1111-21
VII. Bibliografía 259 Gallagher M, Koh MT. 2011. Episodic memory on the path to Alzheimer's disease. Curr Opin Neurobiol 21:929-34 Gerace E, Masi A, Resta F, Felici R, Landucci E, et al. 2014. PARP-1 activation causes neuronal death in the hippocampal CA1 region by increasing the expression of Ca(2+)-permeable AMPA receptors. Neurobiol Dis 70:43-52 Gerace E, Pellegrini-Giampietro DE, Moroni F, Mannaioni G. 2015. Poly(ADP-Ribose)Polymerase 1 (PARP-1) Activation and Ca(2+) Permeable alpha-Amino-3-Hydroxy-5-Methyl-4Isoxazolepropionic Acid (AMPA) Channels in Post-Ischemic Brain Damage: New Therapeutic Opportunities? CNS Neurol Disord Drug Targets 14:636-46 Gertz HJ, Xuereb J, Huppert F, Brayne C, McGee MA, et al. 1998. Examination of the validity of the hierarchical model of neuropathological staging in normal aging and Alzheimer's disease. Acta Neuropathol 95:154-8 Gilman AG. 1987. G proteins: transducers of receptor-generated signals. Annu Rev Biochem 56:61549 Goel A, Lee HK. 2007. Persistence of experience-induced homeostatic synaptic plasticity through adulthood in superficial layers of mouse visual cortex. J Neurosci 27:6692-700 Goldberg S, Visochek L, Giladi E, Gozes I, Cohen-Armon M. 2009. PolyADP-ribosylation is required for long-term memory formation in mammals. J Neurochem 111:72-9 Gong B, Vitolo OV, Trinchese F, Liu S, Shelanski M, Arancio O. 2004. Persistent improvement in synaptic and cognitive functions in an Alzheimer mouse model after rolipram treatment. J Clin Invest 114:1624-34 Grafstein-Dunn E, Young KH, Cockett MI, Khawaja XZ. 2001. Regional distribution of regulators of G-protein signaling (RGS) 1, 2, 13, 14, 16, and GAIP messenger ribonucleic acids by in situ hybridization in rat brain. Brain Res Mol Brain Res 88:113-23 Greger IH, Khatri L, Kong X, Ziff EB. 2003. AMPA receptor tetramerization is mediated by Q/R editing. Neuron 40:763-74 Griffiths S, Scott H, Glover C, Bienemann A, Ghorbel MT, et al. 2008. Expression of long-term depression underlies visual recognition memory. Neuron 58:186-94 Gureviciene I, Ikonen S, Gurevicius K, Sarkaki A, van Groen T, et al. 2004. Normal induction but accelerated decay of LTP in APP + PS1 transgenic mice. Neurobiol Dis 15:188-95 Haas K, Li J, Cline HT. 2006. AMPA receptors regulate experience-dependent dendritic arbor growth in vivo. Proc Natl Acad Sci U S A 103:12127-31 Haist F, Shimamura AP, Squire LR. 1992. On the relationship between recall and recognition memory. J Exp Psychol Learn Mem Cogn 18:691-702 Hamm HE. 1998. The many faces of G protein signaling. J Biol Chem 273:669-72 Hardt O, Migues PV, Hastings M, Wong J, Nader K. 2010. PKMzeta maintains 1-dayand 6-day-old long-term object location but not object identity memory in dorsal hippocampus. Hippocampus 20:691-5 Harris JA, Devidze N, Halabisky B, Lo I, Thwin MT, et al. 2010. Many neuronal and behavioral impairments in transgenic mouse models of Alzheimer's disease are independent of caspase cleavage of the amyloid precursor protein. J Neurosci 30:372-81 Head D, Snyder AZ, Girton LE, Morris JC, Buckner RL. 2005. Frontal-hippocampal double dissociation between normal aging and Alzheimer's disease. Cereb Cortex 15:732-9 Hebert AE, Dash PK. 2002. Extracellular signal-regulated kinase activity in the entorhinal cortex is necessary for long-term spatial memory. Learn Mem 9:156-66 Hepler JR, Gilman AG. 1992. G proteins. Trends Biochem Sci 17:383-7 Hernandez AI, Blace N, Crary JF, Serrano PA, Leitges M, et al. 2003. Protein kinase M zeta synthesis from a brain mRNA encoding an independent protein kinase C zeta catalytic domain. Implications for the molecular mechanism of memory. J Biol Chem 278:40305-16 Hof PR, Duan H, Page TL, Einstein M, Wicinski B, et al. 2002. Age-related changes in GluR2 and NMDAR1 glutamate receptor subunit protein immunoreactivity in corticocortically projecting neurons in macaque and patas monkeys. Brain Res 928:175-86 Hollinger S, Hepler JR. 2002. Cellular regulation of RGS proteins: modulators and integrators of G protein signaling. Pharmacol Rev 54:527-59
VII. Bibliografía 260 Hollinger S, Taylor JB, Goldman EH, Hepler JR. 2001. RGS14 is a bifunctional regulator of Galphai/o activity that exists in multiple populations in brain. J Neurochem 79:941-9 Hollmann M, Heinemann S. 1994. Cloned glutamate receptors. Annu Rev Neurosci 17:31-108 Hopp SC, D'Angelo HM, Royer SE, Kaercher RM, Adzovic L, Wenk GL. 2014. Differential rescue of spatial memory deficits in aged rats by L-type voltage-dependent calcium channel and ryanodine receptor antagonism. Neuroscience 280:10-8 Huganir RL, Nicoll RA. 2013. AMPARs and synaptic plasticity: the last 25 years. Neuron 80:704-17 Ichim CV, Wells RA. 2011. Generation of high-titer viral preparations by concentration using successive rounds of ultracentrifugation. J Transl Med 9:137 Ingram DK, Joseph JA, Spangler EL, Roberts D, Hengemihle J, Fanelli RJ. 1994. Chronic nimodipine treatment in aged rats: analysis of motor and cognitive effects and muscarinic-induced striatal dopamine release. Neurobiol Aging 15:55-61 Insausti R, Herrero MT, Witter MP. 1997. Entorhinal cortex of the rat: cytoarchitectonic subdivisions and the origin and distribution of cortical efferents. Hippocampus 7:146-83 Irvine EE, von Hertzen LS, Plattner F, Giese KP. 2006. alphaCaMKII autophosphorylation: a fast track to memory. Trends Neurosci 29:459-65 Isaac JT, Ashby MC, McBain CJ. 2007. The role of the GluR2 subunit in AMPA receptor function and synaptic plasticity. Neuron 54:859-71 Ju BG, Solum D, Song EJ, Lee KJ, Rose DW, et al. 2004. Activating the PARP-1 sensor component of the groucho/ TLE1 corepressor complex mediates a CaMKinase IIdelta-dependent neurogenic gene activation pathway. Cell 119:815-29 Kajiwara R, Takashima I, Mimura Y, Witter MP, Iijima T. 2003. Amygdala input promotes spread of excitatory neural activity from perirhinal cortex to the entorhinal-hippocampal circuit. J Neurophysiol 89:2176-84 Kealy J, Commins S. 2011. The rat perirhinal cortex: A review of anatomy, physiology, plasticity, and function. Prog Neurobiol 93:522-48 Keinanen K, Wisden W, Sommer B, Werner P, Herb A, et al. 1990. A family of AMPA-selective glutamate receptors. Science 249:556-60 Kelly A, Laroche S, Davis S. 2003. Activation of mitogen-activated protein kinase/extracellular signal-regulated kinase in hippocampal circuitry is required for consolidation and reconsolidation of recognition memory. J Neurosci 23:5354-60 Killiany RJ, Hyman BT, Gomez-Isla T, Moss MB, Kikinis R, et al. 2002. MRI measures of entorhinal cortex vs hippocampus in preclinical AD. Neurology 58:1188-96 Kim J, Tsien RW. 2008. Synapse-specific adaptations to inactivity in hippocampal circuits achieve homeostatic gain control while dampening network reverberation. Neuron 58:925-37 Kim JH, Anwyl R, Suh YH, Djamgoz MB, Rowan MJ. 2001. Use-dependent effects of amyloidogenic fragments of (beta)-amyloid precursor protein on synaptic plasticity in rat hippocampus in vivo. J Neurosci 21:1327-33 Kim JM, Kim DH, Lee Y, Park SJ, Ryu JH. 2014. Distinct roles of the hippocampus and perirhinal cortex in GABAA receptor blockade-induced enhancement of object recognition memory. Brain Res 1552:17-25 Kimple RJ, De Vries L, Tronchere H, Behe CI, Morris RA, et al. 2001. RGS12 and RGS14 GoLoco motifs are G alpha(i) interaction sites with guanine nucleotide dissociation inhibitor Activity. J Biol Chem 276:29275-81 Kitazawa M, Medeiros R, Laferla FM. 2012. Transgenic mouse models of Alzheimer disease: developing a better model as a tool for therapeutic interventions. Curr Pharm Des 18:1131-47 Knobloch M, Farinelli M, Konietzko U, Nitsch RM, Mansuy IM. 2007. Abeta oligomer-mediated long-term potentiation impairment involves protein phosphatase 1-dependent mechanisms. J Neurosci 27:7648-53 Knogler LD, Liao M, Drapeau P. 2010. Synaptic scaling and the development of a motor network. J Neurosci 30:8871-81 Krum JM, Kenyon KL, Rosenstein JM. 1997. Expression of blood-brain barrier characteristics following neuronal loss and astroglial damage after administration of anti-Thy-1 immunotoxin. Exp Neurol 146:33-45
VII. Bibliografía 261 Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-5 Larminie C, Murdock P, Walhin JP, Duckworth M, Blumer KJ, et al. 2004. Selective expression of regulators of G-protein signaling (RGS) in the human central nervous system. Brain Res Mol Brain Res 122:24-34 Lashgari R, Motamedi F, Zahedi Asl S, Shahidi S, Komaki A. 2006. Behavioral and electrophysiological studies of chronic oral administration of L-type calcium channel blocker verapamil on learning and memory in rats. Behav Brain Res 171:324-8 Laube B, Kuhse J, Betz H. 1998. Evidence for a tetrameric structure of recombinant NMDA receptors. J Neurosci 18:2954-61 Lautier D, Lagueux J, Thibodeau J, Menard L, Poirier GG. 1993. Molecular and biochemical features of poly (ADP-ribose) metabolism. Mol Cell Biochem 122:171-93 Lech RK, Suchan B. 2013. The medial temporal lobe: memory and beyond. Behav Brain Res 254:45-9 Lee SE, Simons SB, Heldt SA, Zhao M, Schroeder JP, et al. 2010. RGS14 is a natural suppressor of both synaptic plasticity in CA2 neurons and hippocampal-based learning and memory. Proc Natl Acad Sci U S A 107:16994-8 Lee YS, Silva AJ. 2009. The molecular and cellular biology of enhanced cognition. Nat Rev Neurosci 10:126-40 Leon WC, Bruno MA, Allard S, Nader K, Cuello AC. 2010. Engagement of the PFC in consolidation and recall of recent spatial memory. Learn Mem 17:297-305 Levy A, Kong RM, Stillman MJ, Shukitt-Hale B, Kadar T, et al. 1991. Nimodipine improves spatial working memory and elevates hippocampal acetylcholine in young rats. Pharmacol Biochem Behav 39:781-6 Li S, Hong S, Shepardson NE, Walsh DM, Shankar GM, Selkoe D. 2009. Soluble oligomers of amyloid Beta protein facilitate hippocampal long-term depression by disrupting neuronal glutamate uptake. Neuron 62:788-801 Li YQ, Xue YX, He YY, Li FQ, Xue LF, et al. 2011. Inhibition of PKMzeta in nucleus accumbens core abolishes long-term drug reward memory. J Neurosci 31:5436-46 Lisman J, Schulman H, Cline H. 2002. The molecular basis of CaMKII function in synaptic and behavioural memory. Nat Rev Neurosci 3:175-90 Liu P, Smith PF, Darlington CL. 2008. Glutamate receptor subunits expression in memory-associated brain structures: regional variations and effects of aging. Synapse 62:834-41 Lopez-Aranda MF, Acevedo MJ, Carballo FJ, Gutierrez A, Khan ZU. 2006. Localization of the GoLoco motif carrier regulator of G-protein signalling 12 and 14 proteins in monkey and rat brain. Eur J Neurosci 23:2971-82 Lopez-Aranda MF, Lopez-Tellez JF, Navarro-Lobato I, Masmudi-Martin M, Gutierrez A, Khan ZU. 2009. Role of layer 6 of V2 visual cortex in object-recognition memory. Science 325:87-9 Lopez-Arrieta JM, Birks J. 2002. Nimodipine for primary degenerative, mixed and vascular dementia. Cochrane Database Syst Rev:CD000147 Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-75 Lu KT, Walker DL, Davis M. 2001. Mitogen-activated protein kinase cascade in the basolateral nucleus of amygdala is involved in extinction of fear-potentiated startle. J Neurosci 21:RC162 Lu W, Khatri L, Ziff EB. 2014. Trafficking of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor (AMPA) receptor subunit GluA2 from the endoplasmic reticulum is stimulated by a complex containing Ca2+/calmodulin-activated kinase II (CaMKII) and PICK1 protein and by release of Ca2+ from internal stores. J Biol Chem 289:19218-30 Lu W, Shi Y, Jackson AC, Bjorgan K, During MJ, et al. 2009. Subunit composition of synaptic AMPA receptors revealed by a single-cell genetic approach. Neuron 62:254-68 Lucchesi W, Mizuno K, Giese KP. 2011. Novel insights into CaMKII function and regulation during memory formation. Brain Res Bull 85:2-8 Malkova L, Forcelli PA, Wellman LL, Dybdal D, Dubach MF, Gale K. 2015. Blockade of glutamatergic transmission in perirhinal cortex impairs object recognition memory in macaques. J Neurosci 35:5043-50
VII. Bibliografía 262 Marchetti C, Marie H. 2011. Hippocampal synaptic plasticity in Alzheimer's disease: what have we learned so far from transgenic models? Rev Neurosci 22:373-402 Martin-Montanez E, Acevedo MJ, Lopez-Tellez JF, Duncan RS, Mateos AG, et al. 2010. Regulator of G-protein signaling 14 protein modulates Ca(2)+ influx through Cav1 channels. Neuroreport 21:1034-9 Martin CB, McLean DA, O'Neil EB, Kohler S. 2013. Distinct familiarity-based response patterns for faces and buildings in perirhinal and parahippocampal cortex. J Neurosci 33:10915-23 Martin SJ, Morris RG. 2002. New life in an old idea: the synaptic plasticity and memory hypothesis revisited. Hippocampus 12:609-36 Massey PV, Bhabra G, Cho K, Brown MW, Bashir ZI. 2001. Activation of muscarinic receptors induces protein synthesis-dependent long-lasting depression in the perirhinal cortex. Eur J Neurosci 14:145-52 Massey PV, Johnson BE, Moult PR, Auberson YP, Brown MW, et al. 2004. Differential roles of NR2A and NR2B-containing NMDA receptors in cortical long-term potentiation and longterm depression. J Neurosci 24:7821-8 McCaffery B, Cho K, Bortolotto ZA, Aggleton JP, Brown MW, et al. 1999. Synaptic depression induced by pharmacological activation of metabotropic glutamate receptors in the perirhinal cortex in vitro. Neuroscience 93:977-84 Mead AN, Stephens DN. 2003. Involvement of AMPA receptor GluR2 subunits in stimulus-reward learning: evidence from glutamate receptor gria2 knock-out mice. J Neurosci 23:9500-7 Migues PV, Hardt O, Wu DC, Gamache K, Sacktor TC, et al. 2010. PKMzeta maintains memories by regulating GluR2-dependent AMPA receptor trafficking. Nat Neurosci 13:630-4 Mittal V, Linder ME. 2004. The RGS14 GoLoco domain discriminates among Galphai isoforms. J Biol Chem 279:46772-8 Mittal V, Linder ME. 2006. Biochemical characterization of RGS14: RGS14 activity towards Gprotein alpha subunits is independent of its binding to Rap2A. Biochem J 394:309-15 Moore CI, Browning MD, Rose GM. 1993. Hippocampal plasticity induced by primed burst, but not long-term potentiation, stimulation is impaired in area CA1 of aged Fischer 344 rats. Hippocampus 3:57-66 Morris RG, Anderson E, Lynch GS, Baudry M. 1986. Selective impairment of learning and blockade of long-term potentiation by an N-methyl-D-aspartate receptor antagonist, AP5. Nature 319:774-6 Moyer JR, Jr., Thompson LT, Black JP, Disterhoft JF. 1992. Nimodipine increases excitability of rabbit CA1 pyramidal neurons in an ageand concentration-dependent manner. J Neurophysiol 68:2100-9 Mucke L, Masliah E, Yu GQ, Mallory M, Rockenstein EM, et al. 2000. High-level neuronal expression of abeta 1-42 in wild-type human amyloid protein precursor transgenic mice: synaptotoxicity without plaque formation. J Neurosci 20:4050-8 Murray EA, Bussey TJ, Saksida LM. 2007. Visual perception and memory: a new view of medial temporal lobe function in primates and rodents. Annu Rev Neurosci 30:99-122 Naie K, Manahan-Vaughan D. 2005. Pharmacological antagonism of metabotropic glutamate receptor 1 regulates long-term potentiation and spatial reference memory in the dentate gyrus of freely moving rats via N-methyl-D-aspartate and metabotropic glutamate receptor-dependent mechanisms. Eur J Neurosci 21:411-21 Navarro-Lobato I. 2015. RGS14414-mediated prevention of an episodic memory loss: a study of molecular mechanism. Ph.D. thesis. Universidad de Málaga, Málaga Nelson SB, Turrigiano GG. 2008. Strength through diversity. Neuron 60:477-82 Neves SR, Ram PT, Iyengar R. 2002. G protein pathways. Science 296:1636-9 Nolan BC, Freeman JH, Jr. 2005. Purkinje cell loss by OX7-saporin impairs excitatory and inhibitory eyeblink conditioning. Behav Neurosci 119:190-201 Norris CM, Korol DL, Foster TC. 1996. Increased susceptibility to induction of long-term depression and long-term potentiation reversal during aging. J Neurosci 16:5382-92 Nyberg L, Lovden M, Riklund K, Lindenberger U, Backman L. 2012. Memory aging and brain maintenance. Trends Cogn Sci 16:292-305
VII. Bibliografía 263 O'Brien RJ, Kamboj S, Ehlers MD, Rosen KR, Fischbach GD, Huganir RL. 1998. Activity-dependent modulation of synaptic AMPA receptor accumulation. Neuron 21:1067-78 Oster H, Eichele G, Leitges M. 2004. Differential expression of atypical PKCs in the adult mouse brain. Brain Res Mol Brain Res 127:79-88 Palop JJ, Chin J, Roberson ED, Wang J, Thwin MT, et al. 2007. Aberrant excitatory neuronal activity and compensatory remodeling of inhibitory hippocampal circuits in mouse models of Alzheimer's disease. Neuron 55:697-711 Passafaro M, Nakagawa T, Sala C, Sheng M. 2003. Induction of dendritic spines by an extracellular domain of AMPA receptor subunit GluR2. Nature 424:677-81 Paxinos G, Franklin KBJ. 2001. The mouse brain in stereotaxic coordinates. San Diego: Academic Press Paxinos G, Watson C. 1998. The rat brain in stereotaxic coordinates. San Diego: Academic Press Pear WS, Nolan GP, Scott ML, Baltimore D. 1993. Production of high-titer helper-free retroviruses by transient transfection. Proc Natl Acad Sci U S A 90:8392-6 Persson J, Pudas S, Lind J, Kauppi K, Nilsson LG, Nyberg L. 2012. Longitudinal structure-function correlates in elderly reveal MTL dysfunction with cognitive decline. Cereb Cortex 22:2297304 Petersen RC. 2000. Aging, mild cognitive impairment, and Alzheimer's disease. Neurol Clin 18:789806 Premkumar LS, Auerbach A. 1997. Stoichiometry of recombinant N-methyl-D-aspartate receptor channels inferred from single-channel current patterns. J Gen Physiol 110:485-502 Prithviraj R, Kelly KM, Espinoza-Lewis R, Hexom T, Clark AB, Inglis FM. 2008. Differential regulation of dendrite complexity by AMPA receptor subunits GluR1 and GluR2 in motor neurons. Dev Neurobiol 68:247-64 Puzzo D, Privitera L, Fa M, Staniszewski A, Hashimoto G, et al. 2011. Endogenous amyloid-beta is necessary for hippocampal synaptic plasticity and memory. Ann Neurol 69:819-30 Puzzo D, Privitera L, Leznik E, Fa M, Staniszewski A, et al. 2008. Picomolar amyloid-beta positively modulates synaptic plasticity and memory in hippocampus. J Neurosci 28:14537-45 Quartermain D, deSoria VG, Kwan A. 2001. Calcium channel antagonists enhance retention of passive avoidance and maze learning in mice. Neurobiol Learn Mem 75:77-90 Ranganath C, Ritchey M. 2012. Two cortical systems for memory-guided behaviour. Nat Rev Neurosci 13:713-26 Raz N, Lindenberger U, Rodrigue KM, Kennedy KM, Head D, et al. 2005. Regional brain changes in aging healthy adults: general trends, individual differences and modifiers. Cereb Cortex 15:1676-89 Reiser J. 2000. Production and concentration of pseudotyped HIV-1-based gene transfer vectors. Gene Ther 7:910-3 Resende R, Pereira C, Agostinho P, Vieira AP, Malva JO, Oliveira CR. 2007. Susceptibility of hippocampal neurons to Abeta peptide toxicity is associated with perturbation of Ca2+ homeostasis. Brain Res 1143:11-21 Rodrigue KM, Raz N. 2004. Shrinkage of the entorhinal cortex over five years predicts memory performance in healthy adults. J Neurosci 24:956-63 Rosenzweig ES, Rao G, McNaughton BL, Barnes CA. 1997. Role of temporal summation in agerelated long-term potentiation-induction deficits. Hippocampus 7:549-58 Ross EM, Wilkie TM. 2000. GTPase-activating proteins for heterotrimeric G proteins: regulators of G protein signaling (RGS) and RGS-like proteins. Annu Rev Biochem 69:795-827 Rouleau M, Aubin RA, Poirier GG. 2004. Poly(ADP-ribosyl)ated chromatin domains: access granted. J Cell Sci 117:815-25 Sacktor TC. 2011. How does PKMzeta maintain long-term memory? Nat Rev Neurosci 12:9-15 Saganich MJ, Schroeder BE, Galvan V, Bredesen DE, Koo EH, Heinemann SF. 2006. Deficits in synaptic transmission and learning in amyloid precursor protein (APP) transgenic mice require C-terminal cleavage of APP. J Neurosci 26:13428-36 Sagata N, Iwaki A, Aramaki T, Takao K, Kura S, et al. 2010. Comprehensive behavioural study of GluR4 knockout mice: implication in cognitive function. Genes Brain Behav 9:899-909
VII. Bibliografía 264 Salmon DP. 2012. Neuropsychological features of mild cognitive impairment and preclinical Alzheimer's disease. Curr Top Behav Neurosci 10:187-212 Schafe GE, Atkins CM, Swank MW, Bauer EP, Sweatt JD, LeDoux JE. 2000. Activation of ERK/MAP kinase in the amygdala is required for memory consolidation of pavlovian fear conditioning. J Neurosci 20:8177-87 Schiapparelli L, Simon AM, Del Rio J, Frechilla D. 2006. Opposing effects of AMPA and 5-HT1A receptor blockade on passive avoidance and object recognition performance: correlation with AMPA receptor subunit expression in rat hippocampus. Neuropharmacology 50:897-907 Schreiber V, Dantzer F, Ame JC, de Murcia G. 2006. Poly(ADP-ribose): novel functions for an old molecule. Nat Rev Mol Cell Biol 7:517-28 Seoane A, Massey PV, Keen H, Bashir ZI, Brown MW. 2009. L-type voltage-dependent calcium channel antagonists impair perirhinal long-term recognition memory and plasticity processes. J Neurosci 29:9534-44 Serrano P, Friedman EL, Kenney J, Taubenfeld SM, Zimmerman JM, et al. 2008. PKMzeta maintains spatial, instrumental, and classically conditioned long-term memories. PLoS Biol 6:2698-706 Shalin SC, Zirrgiebel U, Honsa KJ, Julien JP, Miller FD, et al. 2004. Neuronal MEK is important for normal fear conditioning in mice. J Neurosci Res 75:760-70 Shankar GM, Li S, Mehta TH, Garcia-Munoz A, Shepardson NE, et al. 2008. Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med 14:837-42 Shema R, Haramati S, Ron S, Hazvi S, Chen A, et al. 2011. Enhancement of consolidated long-term memory by overexpression of protein kinase Mzeta in the neocortex. Science 331:1207-10 Shema R, Hazvi S, Sacktor TC, Dudai Y. 2009. Boundary conditions for the maintenance of memory by PKMzeta in neocortex. Learn Mem 16:122-8 Shing YL, Werkle-Bergner M, Brehmer Y, Muller V, Li SC, Lindenberger U. 2010. Episodic memory across the lifespan: the contributions of associative and strategic components. Neurosci Biobehav Rev 34:1080-91 Shu FJ, Ramineni S, Amyot W, Hepler JR. 2007. Selective interactions between Gi alpha1 and Gi alpha3 and the GoLoco/GPR domain of RGS14 influence its dynamic subcellular localization. Cell Signal 19:163-76 Shu FJ, Ramineni S, Hepler JR. 2010. RGS14 is a multifunctional scaffold that integrates G protein and Ras/Raf MAPkinase signalling pathways. Cell Signal 22:366-76 Simonyi A, Serfozo P, Shelat PB, Dopheide MM, Coulibaly AP, Schachtman TR. 2007. Differential roles of hippocampal metabotropic glutamate receptors 1 and 5 in inhibitory avoidance learning. Neurobiol Learn Mem 88:305-11 Snow BE, Antonio L, Suggs S, Gutstein HB, Siderovski DP. 1997. Molecular cloning and expression analysis of rat Rgs12 and Rgs14. Biochem Biophys Res Commun 233:770-7 Squire LR, Stark CE, Clark RE. 2004. The medial temporal lobe. Annu Rev Neurosci 27:279-306 Squire LR, Wixted JT, Clark RE. 2007. Recognition memory and the medial temporal lobe: a new perspective. Nat Rev Neurosci 8:872-83 Stellwagen D, Malenka RC. 2006. Synaptic scaling mediated by glial TNF-alpha. Nature 440:1054-9 Stern SA, Alberini CM. 2013. Mechanisms of memory enhancement. Wiley Interdiscip Rev Syst Biol Med 5:37-53 Swanson GT, Kamboj SK, Cull-Candy SG. 1997. Single-channel properties of recombinant AMPA receptors depend on RNA editing, splice variation, and subunit composition. J Neurosci 17:58-69 Swick D, Knight RT. 1999. Contributions of prefrontal cortex to recognition memory: electrophysiological and behavioral evidence. Neuropsychology 13:155-70 Sydow A, Van der Jeugd A, Zheng F, Ahmed T, Balschun D, et al. 2011. Tau-induced defects in synaptic plasticity, learning, and memory are reversible in transgenic mice after switching off the toxic Tau mutant. J Neurosci 31:2511-25 Taylor KI, Probst A. 2008. Anatomic localization of the transentorhinal region of the perirhinal cortex. Neurobiol Aging 29:1591-6
VII. Bibliografía 265 Thompson LT, Deyo RA, Disterhoft JF. 1990. Nimodipine enhances spontaneous activity of hippocampal pyramidal neurons in aging rabbits at a dose that facilitates associative learning. Brain Res 535:119-30 Tinsley CJ, Fontaine-Palmer NS, Vincent M, Endean EP, Aggleton JP, et al. 2011. Differing time dependencies of object recognition memory impairments produced by nicotinic and muscarinic cholinergic antagonism in perirhinal cortex. Learn Mem 18:484-92 Tinsley CJ, Narduzzo KE, Ho JW, Barker GR, Brown MW, Warburton EC. 2009. A role for calciumcalmodulin-dependent protein kinase II in the consolidation of visual object recognition memory. Eur J Neurosci 30:1128-39 Tollefson GD. 1990. Short-term effects of the calcium channel blocker nimodipine (Bay-e-9736) in the management of primary degenerative dementia. Biol Psychiatry 27:1133-42 Tombaugh GC, Rowe WB, Chow AR, Michael TH, Rose GM. 2002. Theta-frequency synaptic potentiation in CA1 in vitro distinguishes cognitively impaired from unimpaired aged Fischer 344 rats. J Neurosci 22:9932-40 Traissard N, Herbeaux K, Cosquer B, Jeltsch H, Ferry B, et al. 2007. Combined damage to entorhinal cortex and cholinergic basal forebrain neurons, two early neurodegenerative features accompanying Alzheimer's disease: effects on locomotor activity and memory functions in rats. Neuropsychopharmacology 32:851-71 Traver S, Bidot C, Spassky N, Baltauss T, De Tand MF, et al. 2000. RGS14 is a novel Rap effector that preferentially regulates the GTPase activity of galphao. Biochem J 350 Pt 1:19-29 Traver S, Splingard A, Gaudriault G, De Gunzburg J. 2004. The RGS (regulator of G-protein signalling) and GoLoco domains of RGS14 co-operate to regulate Gi-mediated signalling. Biochem J 379:627-32 Traynelis SF, Wollmuth LP, McBain CJ, Menniti FS, Vance KM, et al. 2010. Glutamate receptor ion channels: structure, regulation, and function. Pharmacol Rev 62:405-96 Trinchese F, Liu S, Battaglia F, Walter S, Mathews PM, Arancio O. 2004. Progressive age-related development of Alzheimer-like pathology in APP/PS1 mice. Ann Neurol 55:801-14 Turrigiano GG. 2008. The self-tuning neuron: synaptic scaling of excitatory synapses. Cell 135:42235 Turrigiano GG, Leslie KR, Desai NS, Rutherford LC, Nelson SB. 1998. Activity-dependent scaling of quantal amplitude in neocortical neurons. Nature 391:892-6 Turrigiano GG, Nelson SB. 2004. Homeostatic plasticity in the developing nervous system. Nat Rev Neurosci 5:97-107 van Strien NM, Cappaert NL, Witter MP. 2009. The anatomy of memory: an interactive overview of the parahippocampal-hippocampal network. Nat Rev Neurosci 10:272-82 Vaseghi G, Hajhashemi V, Rabbani M. 2014. The effect of nimodipine on memory loss following naloxone-induced morphine withdrawal in object recognition. Res Pharm Sci 9:445-51 Vaseghi G, Rabbani M, Hajhashemi V. 2012. The effect of nimodipine on memory impairment during spontaneous morphine withdrawal in mice: Corticosterone interaction. Eur J Pharmacol 695:83-7 Volk LJ, Bachman JL, Johnson R, Yu Y, Huganir RL. 2013. PKM-zeta is not required for hippocampal synaptic plasticity, learning and memory. Nature 493:420-3 Wang SH, Liao XM, Liu D, Hu J, Yin YY, et al. 2012. NGF promotes long-term memory formation by activating poly(ADP-ribose)polymerase-1. Neuropharmacology 63:1085-92 Warburton EC, Brown MW. 2010. Findings from animals concerning when interactions between perirhinal cortex, hippocampus and medial prefrontal cortex are necessary for recognition memory. Neuropsychologia 48:2262-72 Warburton EC, Koder T, Cho K, Massey PV, Duguid G, et al. 2003. Cholinergic neurotransmission is essential for perirhinal cortical plasticity and recognition memory. Neuron 38:987-96 Watson HC, Lee AC. 2013. The perirhinal cortex and recognition memory interference. J Neurosci 33:4192-200 Wayman GA, Lee YS, Tokumitsu H, Silva AJ, Soderling TR. 2008. Calmodulin-kinases: modulators of neuronal development and plasticity. Neuron 59:914-31 Wenthold RJ, Petralia RS, Blahos J, II, Niedzielski AS. 1996. Evidence for multiple AMPA receptor complexes in hippocampal CA1/CA2 neurons. J Neurosci 16:1982-9
VII. Bibliografía 266 Whitlock JR, Heynen AJ, Shuler MG, Bear MF. 2006. Learning induces long-term potentiation in the hippocampus. Science 313:1093-7 Willard FS, Willard MD, Kimple AJ, Soundararajan M, Oestreich EA, et al. 2009. Regulator of Gprotein signaling 14 (RGS14) is a selective H-Ras effector. PLoS One 4:e4884 Williams-Gray CH, Foltynie T, Lewis SJ, Barker RA. 2006. Cognitive deficits and psychosis in Parkinson's disease: a review of pathophysiology and therapeutic options. CNS Drugs 20:477505 Winters BD, Bartko SJ, Saksida LM, Bussey TJ. 2007. Scopolamine infused into perirhinal cortex improves object recognition memory by blocking the acquisition of interfering object information. Learn Mem 14:590-6 Winters BD, Bussey TJ. 2005. Glutamate receptors in perirhinal cortex mediate encoding, retrieval, and consolidation of object recognition memory. J Neurosci 25:4243-51 Woodard GE, Jardin I, Berna-Erro A, Salido GM, Rosado JA. 2015. Regulators of g-protein-signaling proteins: negative modulators of g-protein-coupled receptor signaling. Int Rev Cell Mol Biol 317:97-183 Woodside BL, Borroni AM, Hammonds MD, Teyler TJ. 2004. NMDA receptors and voltagedependent calcium channels mediate different aspects of acquisition and retention of a spatial memory task. Neurobiol Learn Mem 81:105-14 Wu X, Wakefield JK, Liu H, Xiao H, Kralovics R, et al. 2000. Development of a novel trans-lentiviral vector that affords predictable safety. Mol Ther 2:47-55 Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134 Yonelinas AP. 2001. Components of episodic memory: the contribution of recollection and familiarity. Philos Trans R Soc Lond B Biol Sci 356:1363-74 Yonelinas AP, Aly M, Wang WC, Koen JD. 2010. Recollection and familiarity: examining controversial assumptions and new directions. Hippocampus 20:1178-94 Yoon YJ, White SL, Ni X, Gokin AP, Martin-Caraballo M. 2012. Downregulation of GluA2 AMPA receptor subunits reduces the dendritic arborization of developing spinal motoneurons. PLoS One 7:e49879 Yu DF, Wu PF, Fu H, Cheng J, Yang YJ, et al. 2011. Aging-related alterations in the expression and distribution of GluR2 and PICK1 in the rat hippocampus. Neurosci Lett 497:42-5 Zhu JJ, Esteban JA, Hayashi Y, Malinow R. 2000. Postnatal synaptic potentiation: delivery of GluR4containing AMPA receptors by spontaneous activity. Nat Neurosci 3:1098-106 Ziakopoulos Z, Tillett CW, Brown MW, Bashir ZI. 1999. Input-and layer-dependent synaptic plasticity in the rat perirhinal cortex in vitro. Neuroscience 92:459-72
VIII. Apéndices
VIII. Apéndices 274 Tripsinización: una vez retirado el medio de cultivo y con el fin de lavarlo se añadió PBS pH7,4 (Gibco, 10010) moviendo suavemente el frasco durante aproximadamente 1 min. Tras retirar el PBS se añadió la solución tripsina-EDTA (Gibco, 25200-072), 2 ml para frascos de 75 cm2 (Nunc, 156499) y 5 ml en frascos de 175 cm2 (Nunc, 159910). Se incubó la placa a 37 ºC durante 5 min y se inactivó la tripsina al añadir 3 o 5 ml (dependiendo del frasco) de medio completo (con suero). Una vez neutralizada la enzima, se recuperó el medio en un tubo de 15 ml mediante una pipeta serológica y se centrifugó a 1500 rpm durante 5 min en la centrífuga Labofuge 400 (Heaeus, rotor 8179) para finalmente descartar el sobrenadante y resuspender el sedimento celular en 10 ml de medio completo mediante pipeteo. Contaje celular: se determinó la densidad y viabilidad celular mediante el método de tinción con azul trípano 0,4 % (Sigma-Aldrich, T8154) en una cámara de Neubauer (Bright-line). Siembra: se sembró el volumen de resuspensión celular necesario para obtener el volumen final deseado en un frasco de 75 cm2 con 10 ml de medio completo, o en un frasco de 175 cm2 con 15 ml de medio completo. El volumen a sembrar dependió de la línea celular utilizada (descrito en el manual de la línea celular). 2.d) Transfección Tras 24 h desde la siembra de 4.5 x 106 células 293T por placa (células al 80 % de confluencia) se llevó a cabo la transfección de estas células utilizando el kit Lenti-XTM Packaging System (Clontech, 631247) siguiendo el protocolo proporcionado por el fabricante. Para ello, por cada muestra de transfección (placa), se añadieron los reactivos indicados en la siguiente tabla para dos tubos diferentes (los componentes de cada tubo se mezclaron pipeteando con suavidad arriba y abajo): A continuación se añadió el contenido del tubo 2 al tubo 1 mezclando bien por pipeteo y se incubó la mezcla durante 10 min a temperatura ambiente para permitir la formación de nanopartículas. Pasados los 10 min de incubación, se añadieron 1200 µl de la mezcla a cada placa de cultivo, gota a gota por toda la superficie de forma homogénea, y se incubó a 37 ºC durante 24 h. Tras la incubación, se reemplazó el medio de transfección de las placas por medio completo sin antibiótico para las células 293T y se volvió a incubar a 37 ºC durante 48 h para la producción de lentivirus. Transcurrido el tiempo, se recogieron los sobrenadantes de las placas que contenían los lentivirus en 2 tubos de 50 ml (30 ml en cada uno), manteniendo los sobrenadantes en hielo y se centrifugaron a 500 x g a 4 ºC 15 min en la centrífuga Beckman CS-15R (Rotor S4180). A continuación, se aspiró el sobrenadante con una jeringa de 10 ml (BD DiscarditTM, 309110) y una aguja de punta roma de 18 G (BD, 305180) y se procedió a su filtración con la ayuda de un filtro de 0,45 µm (Sarstedt, 831826) manteniendo en todo momento el sobrenadante que contenía los lentivirus a 4 ºC. Tubo 1 Tubo 2 557 µl Xfect Reaction Buffer (Clontech, 631317) 592,5 µl Xfect Reaction Buffer (Clontech, 631317) 36 µl Lenti-X HTX Packaging Mix (Clontech, 631260) 7,5 µl Xfect Polymer (Clontech, 631317) 7 µl Lenti-X Vector DNA (1 µg/µl) 600 µl volumen total 600 µl volumen total
VIII. Apéndices 275 2.e) Tinción de las colonias celulares con cristal violeta Para llevar a cabo esta tinción, se retiró el medio de los pocillos de la placa sembrada con las células HT1080 infectadas con el stock de lentivirus y se realizaron dos lavados con PBS pH7,4 (Gibco, 10010) añadiendo 1 ml por pocillo en cada lavado. Tras retirar el PBS, se añadió en cada pocillo 1 ml de cristal violeta (Sigma, C3886) al 1 % en 10 % de etanol (JT Baker, 8025) incubándose 10 min a temperatura ambiente. A continuación, se retiró el colorante de los pocillos y se lavaron con 1 ml de PBS 3 veces. Tras retirar el PBS se contaron las colonias. 3 Apéndice 3. TEST DE ORM 3.a) Objetos para el test de ORM de rata 3.b) Objetos para el test de ORM de ratón 1 2 3 1 2 3
VIII. Apéndices 276 4 Apéndice 4. HISTOLOGÍA 4.a) Tampones y soluciones 4.a.1) Tampón fosfato (PB) 0,4 M pH 7.4 (para 1L) Ajustar el pH a 7,4 y conservar a temperatura ambiente. 4.a.2) Tampón fosfato salino (PBS) 0,1 M pH 7,4 (para 1L) Ajustar el pH a 7,4 y conservar a temperatura ambiente. 4.a.3) Solución fijadora PLP (paraformaldehído 4%, L-lisina 75 mM y Meta-periodato 10 mM) en PB 0,1 M, pH 7,4 (para 1L) REACTIVO CANTIDAD Agua Milli-Q hasta 1 L Hidrógenofosfato disódico HNa2O4P 2H2O (Fluka, 71645) 53,4 g Dihidrógenofosfato sódico NaH2PO4.H2O (Panreac, 131965) 13,8 g REACTIVO CANTIDAD Agua Milli-Q Hasta 1 L Cloruro sódico NaCl (Panreac, 131659) 9 g PB 0,4 M a pH 7,4 (apéndice 4.a.1) 250 ml REACTIVO CANTIDAD Agua Milli-Q 750 ml Paraformaldehído (CH2O)n (Merck, 1.04005) 40 g L-Lisina monoclorhidrato C6H14N2O2HCl (Sigma-Aldrich, 62929) 13,7 g Metaperiodato sódico INaO4 (Sigma, 30323) 2,14 g PB 0,4 M, pH 7,4 (apéndice 4.a.1) 250 ml
VIII. Apéndices 277 Para la preparación de esta solución, se diluyó el paraformaldehído en 500 ml de agua Milli-Q previamente calentada a 60 ºC (añadiéndose unas gotas de NaOH para su completa disolución). Se filtró la solución resultante con papel de filtro y se enrasó hasta 750 ml con agua Milli-Q. Por otro lado, se diluyeron la lisina y el meta-periodato en 200 ml de PB 0,4 M pH 7,4 y se filtró la solución resultante con papel de filtro enrasando hasta 250 ml con PB 0,4 M pH 7,4. Por último, se añadieron los 250 ml de la solución de lisina y meta-periodato a los 750 ml de solución de paraformaldehído en agitación. 4.a.4) Solución de sacarosa al 30 % y azida al 0,02 % en PBS 0,1 M (para 100 ml) Para la preparación de esta solución, se disolvieron 30 g de sacarosa (Panreac, 131621) en PBS 0,1 M a pH 7,4 (apéndice 4.a.2) y se enrasó hasta un volumen final de 100 ml. Se retiraron 200 µl de la solución para añadir 200 µl de una solución de azida sódica al 10 % (Sigma-Aldrich, S2002) conservándose la solución resultante a 4 ºC. 4.a.5) Medio de montaje para inmunohistoquímica fluorescente (Medio DABCO) Para preparar este medio de montaje, se diluyó el DABCO (1,4-diazabiciclo [2.2.2.]-octano) (SigmaAldrich, D-2522) al 3 % en una mezcla PBS 0,1 M pH 7,4 (apéndice 4.a.2) y glicerol (141339, Panreac) previamente preparada en una proporción 1:1 manteniendo la solución resultante a 4 ºC y en oscuridad. 4.b) Portaobjetos gelatinizados -Preparación de la solución de Gelatina Para preparar la solución de gelatina, se disolvió esta última en agua Milli-Q previamente calentada a 60 ºC y se añadió el sulfato de cromo (III) y potasio hasta su completa disolución. -Gelatinizado de los portaobjetos Previo al gelatinizado, se desengrasaron con una mezcla de alcohol absoluto:éter (1:1) al menos un día, dejándose secar 2 min a temperatura ambiente tras el tratamiento. A continuación se sumergieron en la solución de gelatina previamente preparada durante 1 min y se repitió esta operación 5 veces más durante unos segundos. Finalmente se dejaron secar en la estufa a 37 ºC 48 h. Estos portaobjetos son viables al menos dos meses desde su preparación. REACTIVO CANTIDAD Agua Milli-Q 600 ml Gelatina (Panreac, 142060) 3 g Sulfato de cromo (III) y potasio (Panreac, 131284) 0,3 g
VIII. Apéndices 278 4.c) Fijación por perfusión cardíaca y extracción del cerebro fijado Una vez anestesiado el animal (rata) con la administración intraperitoneal de pentobarbital sódico (Eutanax 200 mg/ml, Fatro) a una dosis de 120 mg/Kg, los animales se perfundieron transcardialmente. Para acceder al corazón, se practicó una incisión en el abdomen y se abrió la cavidad torácica exponiendo el órgano. Se introdujo una aguja en el ventrículo izquierdo y se abrió la aurícula derecha formando así un circuito abierto. Utilizando una bomba de perfusión (Cole parmer) se inyectó lentamente PBS 0,1 M, pH 7,4 (apéndice 4.a.2) durante 15 min a un flujo de 10 ml/min hasta lavar completamente el sistema circulatorio de sangre. A continuación, se inyectaron 350 ml de una solución fijadora de PLP en PBS 0,1 M, pH 7,4 (apéndice 4.a.3). Finalmente, se extrajo cuidadosamente el cerebro y se post-fijó por inmersión en PLP durante una noche a 4 ºC. 4.d) Crioprotección y congelación Una vez post-fijados, los encéfalos se lavaron con PBS (10 min, 3 veces) para eliminar los restos de PLP y se crioprotegieron mediante inmersión en una solución de sacarosa al 30 % y azida sódica al 0,02 % en PBS (apéndice 4.a.4) a 4 ºC para evitar daños en la estructura del tejido durante el proceso de congelación. A continuación, los cerebros se congelaron utilizando nieve carbónica y se almacenaron a -80 ºC hasta su uso. 4.e) Obtención de las secciones Los cerebros congelados se cortaron en secciones coronales de 30 µm de grosor en un microtomo de congelación (Leica CM-1325), almacenándose de forma seriada según la técnica de free-floating en pocillos que contenían una solución de PBS 0,1 M y 0,02 % de azida sódica. Se seleccionaron los cortes pertenecientes a las zonas de interés (área V2, corteza perirrinal o corteza frontal) y se distribuyeron en 6 series (una serie en cada pocillo) de tal for ma que dentro de una serie, los cortes consecutivos distaban entre sí 180 μm. Las placas que contenían las secciones seriadas se almacenaron a 4 ºC durante varios meses, renovando regularmente el tampón PBS con azida sódica. 4.f) Marcaje inmunofluorescente simple para microscopía convencional de fluorescencia para RGS14 Previo a la incubación con avidina y biotina, se realizaron 3 lavados de 10 min cada uno en PBS 0,1 M (apéndice 4.a.2), en agitación y a temperatura ambiente. Se empleó el kit de bloqueo de avidina-biotina (Vector Laboratories, SP-2001) incubándose los cortes durante 30 min en cada solución, (con un paso intermedio de un lavado de 10 min en PBS) en agitación y a temperatura ambiente. Tras estas incubaciones se realizaron 3 lavados con PBS siguiendo el procedimiento anterior y se incubaron los cortes con el anticuerpo primario policlonal de conejo frente a la proteína RGS14 (Novus biological, NBP1-31174) a una dilución 1:500 (diluido en PBS, con 0,3 % tritón X-100 (Sigma-Aldrich, 9002-93-1) y 0,1 % azida sódica) durante toda la noche a 4 ºC y en agitación. Tras eliminar el exceso de anticuerpo primario lavando con PBS, los cortes se incubaron en oscuridad, a temperatura ambiente y en agitación 2 h 30 min con el anticuerpo secundario Alexa fluor 488, IgG anti-IgG de conejo desarrollado en cabra (Life technologies, A11008) a una dilución 1:1000 (diluido en PBS 0,1 M con 0,3 % tritón X-100 y 0,1 % azida sódica). El exceso de anticuerpo secundario se eliminó con PBS (3 lavados). -Montaje: Por último, las secciones se montaron en portaobjetos gelatinizados (apéndice 4.b) y se dejaron secar durante toda la noche. Al día siguiente, se cubrieron usando como medio de montaje PBS-glicerina (1:1) y 3 % de 1,4-diazabiciclo [2.2.2.]-octano (DABCO) (apéndice 4.a.5). Las secciones se analizaron en el microscopio CTR Mic DM IRE2 (Leica).
VIII. Apéndices 279 5 Apéndice 5. PROTEÓMICA 5.a)Tampones y soluciones 5.a.1) Tampón Tris-HCl 0,01 M, pH 7,4 , para 50 ml En 50 ml de Agua Milli-Q se añadieron 0,06 g de Tris (Sigma-Aldrich, T1503) y se ajustó el pH a 7,4 con HCl (T-Bakes, 6081). 5.a.2) Tampón Tris-HCl 0,5 M, pH 6,8, para 50 ml En 50 ml de Agua Milli-Q se añadieron 3,02 g de Tris (Sigma-Aldrich, T1503) y se ajustó el pH a 6,8 con HCl (T-Bakes, 6081). 5.a.3) Tampón de carga (1X) , para 8 ml Tris-HCl 60 mM pH 6.8, SDS al 2 %, glicerol al 10 %, 2β-mercaptoetanol al 5 % y azul de bromofenol al 0,002 %: 5.a.4) Tampón Tris-Glicina-SDS (TGS) (5X), para 1 L 12,5 mM Tris, 96 mM glicina, 0,5 % SDS REACTIVO CANTIDAD Agua Milli-Q 3,88 ml 2-β mercaptoetanol (Sigma-Aldrich, M7154) 0,4 ml Glicerol al 99% (Sigma-Aldrich,G6279) 0,8 ml Dodecilsulfato sódico (SDS) al 10% (Sigma-Aldrich, L3771) 1,6 ml Tris-HCL 0,5M, pH 6,8 (apéndice 5.a.2) 1 ml REACTIVO CANTIDAD Agua Milli-Q hasta 1 L Glicina (Sigma-Aldrich, G7126) 72 g Dodecilsulfato sódico (SDS) (Sigma-Aldrich, L3771) 5 g Tris (Sigma-Aldrich,T1503) 15 g
VIII. Apéndices 280 5.a.5) Tampón PBS (10X), para 1 L 5.a.6) Tampón PBS-Tween 0,1% (TPBS), para 1 L 5.b) Determinación de la concentración de proteínas mediante el método de Lowry La concentración de proteínas de las muestras se estimó mediante el método colorimétrico de Lowry (Lowry et al 1951) siguiendo el protocolo descrito a continuación: Reactivos y soluciones Solución stock de albúmina de suero bovina a 500 µg/ml, para 10 ml: se disolvieron 5 mg de BSA (Sigma-Aldrich, A3059) en 10 ml de agua Milli-Q y se prepararon alícuotas de 500 µl que se conservaron a -80 ºC. Solución de carbonato sódico al 2 %, para 50 ml: se disolvió 1 g de carbonato sódico anhidro (Na2CO3, Panreac, 131648.1210) en 50 ml de agua Milli-Q y se conservó la solución a 4 ºC. Solución de sulfato de cobre al 1 %, para 50 ml: se disolvieron 0,5 g de cobre (II) sulfato anhidro (CuSO4, Panreac, 122726.1209) en 50 ml de agua Milli-Q conservándose la solución a 4 ºC. Solución de tartrato sódico al 2 %, para 50 ml: se disolvió 1g de tartrato sódico anhidro (Na2C4H4O6, Panreac, 121720.1210) en 50 ml de agua Milli-Q y se conservó la solución a 4 ºC. Solución de hidróxido sódico 1,2 N, para 50 ml: se disolvieron 2,4 g de hidróxido sódico (Panreac, 1316877787.1211) en 50 ml de Agua Milli-Q conservándose la solución a 4 ºC. Reactivo alcalino de cobre (ACR): se mezclaron en una proporción 100:1:1 las soluciones Na2CO3 al 2 %:Na2C4H4O6 al 2 %:CuSO4 al 1 %. Reactivo fenol de Folin-Ciocolteus, 2 N (Sigma-Aldrich, F9252) REACTIVO CANTIDAD Agua Milli-Q hasta 1 L Cloruro de sodio (NaCl) (Sigma-Aldrich, S3014) 72,2 g Fosfato de potasio monobásico (KH2PO4) (Merck-Millipore, 104873) 4,3 g Fosfato de sodio dibásico (Na2HP04 2H2O) (Fluka, 71645) 19 g REACTIVO CANTIDAD Agua Milli-Q 900 ml Tampón PBS (10X) (apéndice 5.a.5) 100 ml Tween (Sigma-Aldrich, 9005-64) 1 ml
VIII. Apéndices 281 Procedimiento A partir de una solución stock de BSA a 500 µg/ml, se preparó la curva patrón (n = 3 para cada concentración) tal y como se muestra en la tabla: Tubo Volumen de BSA 500 µg/ml (µl) Volumen de agua Milli-Q (µl) [BSA] (µg/ml) T1 0 75 0 T2 5 75 33 T3 10 65 67 T4 20 55 133 T5 30 45 200 T6 40 35 267 Una vez preparadas las muestras de la curva patrón, se prepararon 2 diluciones (1/5 y 1/10) por cada tratamiento a estudio (n = 2). Como blanco, se utilizaron las diluciones 1/5 y 1/10 del tampón de homogenizado Tris-HCl 0,01 M pH 7,4 (apéndice 5.a.1) en agua Milli-Q. A cada muestra se le añadieron 75 µl de NaOH 1,2 N mezclándose mediante una ligera agitación en vortex. Tras preparar el volumen necesario de ACR, se adicionaron 750 µl de esta solución a cada tubo, se mezcló mediante una ligera agitación en vortex y se incubó 15 min a temperatura ambiente. Seguidamente, se añadieron 75 µl de reactivo fenol de Folin-Ciocolteus 2 N:agua Milli-Q en una proporción 1:1 mezclándose vigorosamente con vortex y se incubó 45 min a temperatura ambiente. Finalmente, se midió la absorbancia a 750 nm en el espectrofotómetro (S30, Boeco). 6 Apéndice 6. ELECTROFISIOLOGÍA 6.a) Líquido cefalorraquídeo artificial modificado (mACSF), para 1 L COMPUESTO CONCENTRACIÓN (mM) CANTIDAD (g) Sacarosa (Sigma-Aldrich, S0389) 189 64,69 Glucosa (Fluka, G0350500) 10 1,80 Bicarbonato de sodio (NaHCO3) (Sigma-Aldrich, S5761 ) 26 2,18 Cloruro de potasio (KCl) (Sigma-Aldrich, P9541) 3 0,22 Sulfatato de Magnesio (MgSO4) (Sigma-Aldrich, M2643) 5 0,60 Cloruro de calcio (CaCl2) (Sigma-Aldrich, C5670) 0,1 0,011 Fosfato de sodio monobásico (NaH2PO4) (Sigma-Aldrich, S3139) 1,25 0,15
VIII. Apéndices 282 6.b) Líquido cefalorraquídeo artificial (ACSF) , para 1 L COMPUESTO CONCENTRACIÓN (mM) CANTIDAD (g) Cloruro de sodio (NaCl) (Sigma-Aldrich, S3014) 124 7,25 Cloruro de potasio (KCl) (Sigma-Aldrich, P9541) 3 0,22 Bicarbonato de sodio (NaHCO3) (Sigma-Aldrich, S5761 ) 26 2,18 Fosfato de sodio monobásico (NaH2PO4) (Sigma-Aldrich, S3139) 1,4 0,17 Sulfato de magnesio (MgSO4) (Sigma-Aldrich, M2643) 1 0,12 Glucosa (Fluka, G0350500) 10 1,8 Cloruro de calcio (CaCl2) (Sigma-Aldrich, C5670) 2 0,22